Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Circulation Research. 1999;85:699-706

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Methods
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grant, M. B.
Right arrow Articles by Belardinelli, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grant, M. B.
Right arrow Articles by Belardinelli, L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Angiogenesis
Right arrow Mechanism of atherosclerosis/growth factors
(Circulation Research. 1999;85:699-706.)
© 1999 American Heart Association, Inc.

Cellular Biology

Adenosine Receptor Activation Induces Vascular Endothelial Growth Factor in Human Retinal Endothelial Cells

Maria B. Grant, Roy W. Tarnuzzer, Sergio Caballero, Mark J. Ozeck, Margaret I. Davis, Polyxenie E. Spoerri, Igor Feoktistov, Italo Biaggioni, John C. Shryock, Luiz Belardinelli

From the Departments of Medicine (M.B.G., R.W.T., S.C., M.I.D., P.E.S., J.C.S., L.B.), Ophthalmology (M.B.G.), and Pharmacology and Therapeutics (M.J.O., J.C.S., L.B.), University of Florida, Gainesville, Fla, and Department of Medicine and Pharmacology (I.F., I.B.), Vanderbilt University, Nashville, Tenn. L.B.'s current address is Pharmacological Sciences, CV Therapeutics, Palo Alto, Calif.

Correspondence to M.B. Grant, MD, Associate Professor of Medicine, Department of Medicine, Division of Endocrinology and Metabolism, University of Florida, P.O. Box 100226, Gainesville, FL 32610-0226. E-mail grantma{at}medicine.ufl.edu


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract—Adenosine, released in increased amounts by hypoxic tissues, is thought to be an angiogenic factor that links altered cellular metabolism caused by oxygen deprivation to compensatory angiogenesis. Adenosine interacts with 4 subtypes of G protein–coupled receptors, termed A1, A2A, A2B, and A3. We investigated whether adenosine causes proliferation of human retinal endothelial cells (HRECs) and synthesis of vascular endothelial growth factor (VEGF) and, if so, which adenosine receptor subtype mediates these effects. The nonselective adenosine receptor agonist 5'-N-ethylcarboxamidoadenosine (NECA), in a concentration-dependent manner, increased both VEGF mRNA and protein expression by HRECs, as well as proliferation. This proliferative effect of NECA was inhibited by the addition of anti-human VEGF antibody. NECA also increased insulin-like growth factor-I and basic fibroblast growth factor mRNA expression in a time-dependent manner and cAMP accumulation in these cells. In contrast, neither the A1 agonist N6-cyclopentyladenosine nor the A2A agonist 2-p-(2-carboxyethyl) phenethylamino-NECA caused any of the above effects of NECA. The effects of NECA were not significantly attenuated by either the A2A antagonist SCH58261 or the A1 antagonist 8-cyclopentyl-1,3-dipropylxanthine. However, the nonselective adenosine receptor antagonist xanthine amine congener completely inhibited the effects of NECA. Addition of antisense oligonucleotide complementary to A2B adenosine receptor mRNA inhibited VEGF protein production by HRECs after NECA stimulation. Thus, the A2B adenosine receptor subtype appears to mediate the actions of adenosine to increase growth factor production, cAMP content, and cell proliferation of HRECs. Adenosine activates the A2B adenosine receptor in HRECs, which may lead to neovascularization by a mechanism involving increased angiogenic growth factor expression.


Key Words: adenosine receptor • angiogenesis • ischemia • hypoxia • diabetes


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Tissue hypoxia and ischemia are known to initiate a series of events that lead to the development of collateral blood vessels1 in a process referred to as compensatory angiogenesis.2 However, the cellular and molecular mechanisms underlying compensatory angiogenesis have been only partially elucidated.2 Potential mediators of compensatory angiogenesis include vascular endothelial growth factor (VEGF),3 basic fibroblast growth factor (bFGF),4 insulin-like growth factor-I (IGF-I),5 and nucleosides such as adenosine.6

Adenosine, the subject of the present study, has been proposed to be a factor that links altered cellular metabolism caused by oxygen deprivation to the formation of new capillaries.7 8 9 This proposed role of adenosine is based on the observation that this nucleoside is released in increased amounts by hypoxic and/or ischemic cells and promotes proliferation of endothelial cells.9 10 11 Consistent with this hypothesis, adenosine and adenosine analogs have been reported to affect a number of steps involved in angiogenesis, including endothelial cell proliferation,8 12 13 14 migration,12 15 16 and blood vessel formation in various vascular beds.15 17 Adenosine can interact with at least 4 subtypes of G protein–coupled receptors, designated A1, A2A, A2B, and A3.18 These receptor subtypes are encoded by distinct genes and can, for the most part, be differentiated on the basis of their affinities for selected agonists and antagonists.19 20 A1 and A3 adenosine receptors are coupled to pertussis toxin–sensitive inhibitory G proteins that inhibit adenylyl cyclase activity, whereas A2A (high-affinity) and A2B (low-affinity) adenosine receptors are coupled to cholera toxin–sensitive G proteins that stimulate adenylyl cyclase activity.21 In most cell types and organ systems, activation of A1 adenosine receptors results in decreased work, and therefore, reduced O2 consumption. Activation of A2A adenosine receptors, on the other hand, increases O2 supply by causing vasodilation.22 Thus, adenosine is an ideal metabolite to respond to imbalances between O2 supply and demand. In the retina, hypoxia is followed by compensatory angiogenesis, which is detrimental and results in aberrant blood vessels that are friable and prone to bleeding.23

VEGF is a potent endothelial mitogen, induced by hypoxia and hyperglycemia, and has been shown to be an important factor in ischemic ocular neovascularization.24 25 26 VEGF causes hyperpermeability of blood vessels, which is observed in both nonproliferative and proliferative diabetic retinopathy. VEGF acts through 2 receptors, VEGFR-1 (Flt-1) and VEGFR-2 (Flk-1/KDR), both of which are tyrosine kinases. VEGF signaling occurs through tyrosine phosphorylation of phospholipase C (PLC) and phosphatidylinositol 3'-kinase.27 28 The effects of VEGF are also mediated by activation of protein kinase C (PKC) to induce membrane translocation of PKC isoforms, especially the ß-isoform of the enzyme.25 VEGFR-1 mediates the permeability effects associated with VEGF, whereas VEGFR-2 mediates the proliferative effects of VEGF. Elevated levels of VEGF have been detected in vitreous humor of diabetic patients with proliferative retinopathy.25 More importantly, in animal models of retinal neovascularization, inhibition of VEGF blocks neovascularization.29 Other growth factors have been implicated in ocular angiogenesis, including bFGF30 and IGF-I.31

The experiments described were performed test the hypothesis that adenosine regulates expression of the angiogenic growth factor VEGF and to determine the adenosine receptor subtype that mediates the effect of the nucleoside in retinal endothelial cells of human origin.


*    Materials and Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Materials and Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
5'-N-ethylcarboxamidoadenosine (NECA), 2-p-(2-carboxyethyl) phenethylamino-NECA (CGS21680), N6-cyclopentyladenosine (CPA), xanthine amine congener (XAC), and 8-cyclopentyl-1,3-dipropylxanthine (CPX) were from Research Biochemicals, Inc. 5-Amino-7-(2-phenylethyl)-2-(2-furyl)-pyrazolo(4,3-E)-1,2,4-trizolo(1,5-c) pyrimidine (SCH58261) was a gift from Schering-Plough Research Institute. Rabbit anti-human VEGF was from Peprotech. Antibodies and conjugates for immunofluorescence were as follows. Chicken anti-human A2B adenosine receptor,32 FITC-conjugated rabbit anti-chicken IgG, and nonimmune sera were from Sigma-Aldrich. Sense and antisense oligonucleotides corresponding to either VEGF or A2B adenosine receptor sequences were synthesized by Life Technologies. The sequences were chosen from the region proximal to and including the start codon using published sequence information for these genes. The antisense sequences are as follows: VEGF, AGACAGCAGAAAGTTCATGG, and A2B adenosine receptor, CAGCGCGTCCTGTGTCTCCAGCAGCATGG. Sense sequences are the complement of the antisense sequences shown.

Human retinal endothelial cells (HRECs) were prepared and maintained as previously described.33 Cells in passages 3 to 6 were used for the studies. The identity of HRECs was validated by demonstrating endothelial cell incorporation of fluorescently labeled acetylated LDL and by fluorescence-activated cell sorting analysis as previously described.33 For all experiments, cells were starved of serum overnight and then incubated with adenosine deaminase type III (2 U/mL, Sigma-Aldrich) for 20 minutes before test agents were added. Adenosine receptor agonists and antagonists were added at concentrations ranging from 5 nmol/L up to 100 µmol/L in serum-free medium containing adenosine deaminase type III and then incubated for additional times as indicated in specific results.

cAMP was measured in response to adenosine receptor agonists and/or antagonists as described.34 Conditioned medium was used to measure changes in VEGF protein in response to adenosine receptor agonists and/or antagonists using an ELISA kit (R&D Systems, Inc). HREC proliferation was determined by measuring DNA synthesis via colorimetric detection of bromodeoxyuridine (BrdU) incorporation using a kit (Roche Molecular Biochemicals), and also by changes in cell number. BrdU incorporation was also used to measure the effect of anti-VEGF antibody on adenosine receptor agonist–induced HREC proliferation. The potential reduction of VEGF synthesis induced by adenosine receptor agonist was tested by ELISA after inclusion of antisense oligonucleotides directed against mRNA for either A2B adenosine receptor or VEGF. Quantitative reverse transcriptase–polymerase chain reaction (RT-PCR), using a competitive synthetic multiplex template as described previously,35 was performed to measure changes in mRNA after treatment with adenosine receptor agonists and/or antagonists. Immunofluorescent confocal microscopy was used as described36 to demonstrate both the presence of A2B adenosine receptors and uptake of fluorescence-labeled acetylated LDL in HRECs grown on multichamber glass slides (Nalge Nunc International).

Statistical Analysis
Comparisons between treatment groups (as described in the figure legends) were analyzed by 1-way ANOVA followed by the Bonferroni t test. Data are expressed as mean±SEM. Values of P<0.05 were considered statistically significant.

An expanded Materials and Methods section is available online at http://www.circresaha.org.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 *Results
down arrowDiscussion
 down arrowReferences
 
The nonselective adenosine receptor agonist NECA, after 48 hours of exposure, induced a concentration-dependent increase in DNA synthesis by HRECs, as indicated by BrdU incorporation (Figure 1ADown). In contrast, neither the A2A adenosine receptor agonist CGS21680 (10 nmol/L to 10 µmol/L) nor the A1 adenosine receptor agonist CPA (10 nmol/L to 10 µmol/L) increased BrdU incorporation by HRECs (Figure 1ADown). The addition of the adenosine receptor antagonist XAC completely prevented NECA-stimulated BrdU incorporation (Figure 1BDown). In contrast, neither the selective A1 adenosine receptor antagonist CPX (20 nmol/L) nor the selective A2A adenosine receptor antagonist SCH58261 (60 nmol/L) attenuated the stimulatory effect of NECA on BrdU incorporation by HRECs (Figure 1BDown).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 1. A, DNA synthesis in HRECs exposed to basal medium ({circ}), ie, nutrient medium without supplements; growth medium ({square}); or basal medium supplemented with increasing concentrations of the selective A2A adenosine receptor agonist CGS21680 ({blacksquare}), the selective A1 adenosine receptor agonist CPA ({blacktriangleup}), or the nonselective adenosine receptor agonist NECA ({diamondsuit}) for 48 hours. DNA synthesis was quantified by measuring BrdU incorporation as described in Materials and Methods. Increase in BrdU incorporation caused by NECA was significantly different (P<0.05) from both CGS21680 and CPA at concentrations ranging from 100 nmol/L to 10 µmol/L. *Significantly different from basal medium, by ANOVA (P<0.05). B, BrdU incorporation in HRECs exposed simultaneously to the nonspecific adenosine receptor agonist NECA and the selective A1 receptor antagonist CPX, the selective A2A receptor antagonist SCH58261 (SCH), or the nonselective receptor antagonist XAC for 48 hours. Untreated cells were maintained in basal nutrient medium. *Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05). A and B, Data are mean±SEM of 4 independent experiments.

The data for cell counts were consistent with those for BrdU incorporation. Treatment with NECA for 48 hours resulted in a concentration-dependent increase in HREC number, whereas neither CGS21680 nor CPA caused an increase in cell number (Figure 2ADown). Of the 3 adenosine receptor antagonists tested, only XAC (10 µmol/L) significantly inhibited the increase in cell number induced by 10 µmol/L NECA (Figure 2BDown).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 2. Changes in cell number caused by 48-hour exposure to adenosine receptor agonists and antagonists. A, Effects of NECA ({diamondsuit}), CGS21680 ({blacksquare}), and CPA ({blacktriangleup}) on cell number. *Significantly different from basal medium, by ANOVA (P<0.05). B, Effects of XAC, CPX, and SCH58261 (SCH) on mean cell number in the presence of 10 µmol/L NECA. *Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05). A and B, Data are mean±SEM of 3 different experiments.

cAMP Accumulation
To obtain evidence for the presence of the A2B adenosine receptors in HRECs, we performed assays for cAMP content in intact HRECs after treatment of cells with adenosine receptor agonists and antagonists. The nonselective adenosine receptor agonist NECA increased the cAMP content of HRECs in a concentration-dependent manner (Figure 3ADown), with an EC50 value of 24 µmol/L. In contrast, the selective high-affinity A2A adenosine receptor agonist CGS21680 (at concentrations up to 100 µmol/L) had no significant effect on cAMP content of HRECs (Figure 3ADown). The effect of selective A1 and A2A adenosine receptor antagonists on NECA-induced accumulation of cAMP was also examined. NECA (10 µmol/L)-induced increase in cAMP content in HRECs was not significantly inhibited either by the selective A2A adenosine receptor antagonist SCH58261 (60 nmol/L) or by the selective A1 adenosine receptor antagonist CPX (20 nmol/L) (Figure 3BDown). On the other hand, the nonselective adenosine receptor antagonist XAC (10 µmol/L) completely blocked the effect of NECA on cAMP accumulation.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 3. A, cAMP content of HRECs exposed to increasing doses of either the selective A2A adenosine receptor agonist CGS21680 or the nonselective adenosine receptor agonist NECA. Data are mean±SEM of 4 independent experiments. B, cAMP content of HRECs exposed to NECA alone or in combination with either the selective A1 adenosine receptor antagonist CPX, the selective A2A adenosine receptor antagonist SCH58261 (SCH), or the nonselective adenosine receptor antagonist XAC at the concentrations indicated. Data are mean±SEM of 3 independent experiments. *Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05).

Quantification of VEGF, IGF-I, and bFGF mRNA in HRECs
To determine whether NECA stimulates angiogenic growth factor mRNA expression in HRECs, total mRNA from HRECs exposed to NECA was subjected to quantitative RT-PCR. Treatment of HRECs with NECA (10 nmol/L to 10 µmol/L) for 2 hours induced a concentration-dependent increase in expression of mRNA for VEGF by up to 4.6-fold (from 0.4x106 to 1.85x106 copies/µg RNA), compared with untreated control cells. After 8 hours of exposure to NECA, cell mRNA levels for VEGF in cells treated with NECA had returned to baseline. HRECs were also treated with the A2A adenosine receptor agonist, CGS21680 (10 nmol/L to 10 µmol/L), and the A1 adenosine receptor agonist, CPA (10 nmol/L to 10 µmol/L). In contrast to NECA, neither CGS21680 nor CPA caused a significant change in VEGF mRNA expression (data not shown).

The increase in mRNA for VEGF caused by 10 µmol/L NECA was not attenuated significantly either by the selective A2A adenosine receptor antagonist SCH58261 (60 nmol/L) or by the selective A1 adenosine receptor antagonist CPX (20 nmol/L) (Figure 4Down). The nonselective antagonist XAC (10 µmol/L) completely attenuated NECA-induced increases in mRNA for VEGF (Figure 4Down). NECA (10 µmol/L) also induced a time-dependent increase in mRNA for both IGF-I and bFGF. IGF-I mRNA levels increased by 2.2-fold after 2 hours of exposure (from 30x103 copies/µg RNA to 65x103 copies/µg RNA) and 11.7-fold (350x103 copies/µg RNA) after 8 hours of exposure to NECA. Similarly, bFGF mRNA increased 3.7-fold after 2 hours of exposure (from 2x103 copies/µg RNA to 7.4x103 copies/µg RNA) and 11.4-fold (22.8x103 copies/µg RNA) after 8 hours of exposure to NECA.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 4. Changes in VEGF mRNA expression in HRECs exposed for 2 hours to the nonselective adenosine receptor agonist NECA alone or in combination with either the selective A1 adenosine receptor antagonist CPX, the selective A2A adenosine receptor antagonist SCH58261 (SCH), or the nonselective adenosine receptor antagonist XAC at the concentrations indicated. A, Representative photograph of ethidium bromide–stained agarose gel showing the 2 amplification products from the competitive RT-PCR reaction (described in Materials and Methods). The PCR products for the target VEGF and template sequences were 326 and 235 bp, respectively. B, Plot of band intensities of target-to-template ratio vs template copy number. Note the left shift of the line for XAC, indicating a decrease in target mRNA expression to a level similar to that of untreated cells. C, Graphical representation of the data plotted in B. Data are mean±SEM of 2 independent experiments. *Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05).

Quantification of VEGF Protein in Conditioned Medium
To determine whether the increase in VEGF mRNA expression resulted in increased protein levels, VEGF was measured in conditioned medium after 8 hours of exposure to NECA, in the presence or absence of adenosine receptor antagonists (Figure 5Down). NECA increased VEGF protein, but neither the A1 adenosine receptor agonist CPA (not shown) nor the A2A adenosine receptor agonist CGS21680 caused an increase in VEGF protein (Figure 5Down). The increase in VEGF protein caused by NECA was not attenuated by either the selective A2A adenosine receptor antagonist SCH58261 (60 nmol/L) or by the selective A1 adenosine receptor antagonist CPX (20 nmol/L). Only the nonselective adenosine receptor antagonist XAC (10 µmol/L) completely inhibited the action of NECA to increase VEGF protein expression (Figure 5Down).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 5. VEGF content in conditioned medium from HRECs exposed for 8 hours to NECA alone or in combination with the selective A1 adenosine receptor antagonist CPX, the selective A2A adenosine receptor antagonist SCH58261 (SCH), or the nonselective adenosine receptor antagonist XAC at the concentrations indicated. Untreated cells (negative control) and cells exposed to the selective A2A adenosine receptor agonist CGS (agonist control) are shown for comparison. Data are mean±SEM of 4 independent experiments. *Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05).

Effect of Anti-VEGF Antibody on NECA-Induced HREC Proliferation
Incubation with 10 ng/mL VEGF resulted in BrdU incorporation to a level approximating that induced by normal growth medium. The anti-VEGF antibody at 100 ng/mL significantly reduced DNA synthesis induced by VEGF (Figure 6Down). Incubation with NECA (10 µmol/L) increased DNA synthesis to levels comparable with that induced by normal growth medium. The addition of anti-VEGF antibody resulted in a decrease in NECA-induced BrdU incorporation, which was statistically significant at the highest concentration of antibody used (Figure 6Down). Similar results were observed at either 24 or 48 hours of exposure to the test agents.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 6. BrdU incorporation as a measure of DNA synthesis in HRECs after stimulation with NECA alone or in combination with a blocking antibody to VEGF. Data are mean±SEM of 3 independent experiments. Open bars are results after 24 hours of exposure; filled bars are results after 48 hours. Serum-free medium (SFM) and normal growth medium (GM) were used as negative and positive controls, respectively. *Significantly different from 10 µmol/L NECA alone for the respective exposure time, by ANOVA (P<0.05). {ddagger}Significantly different from 10 ng/mL VEGF alone for the respective exposure time, by ANOVA (P<0.05).

Effect of Antisense Oligonucleotides on VEGF Induction by NECA
Both A2B adenosine receptor and VEGF antisense oligonucleotides caused a significant decrease of VEGF in the conditioned medium after NECA exposure (Figure 7Down). This effect was most pronounced for the receptor antisense oligonucleotide with 10 nmol/L NECA, but it was evident for all concentrations of NECA tested. The VEGF antisense oligonucleotide also caused a decrease in secreted VEGF in response to NECA, although not to the same magnitude as that observed with the A2B adenosine receptor antisense.



View larger version (49K):
[in this window]
[in a new window]
  		Figure 7. VEGF content in conditioned medium from HRECs after stimulation with NECA in the presence or absence of sense or antisense oligonucleotides homologous to the human A2B adenosine receptor or to human VEGF. Assay duration was 48 hours. The presence of sense oligonucleotide serves to control for nonspecific oligonucleotide effects. Data are mean±SEM of 3 determinations. *Significantly different from the respective condition (GM or increasing concentrations of NECA) receiving no oligonucleotide, by ANOVA (P<0.01). {ddagger}Significantly different from 10 µmol/L NECA, by ANOVA (P<0.05).

Immunofluorescence
Analysis of acetylated LDL uptake indicates that the cells are indeed of endothelial origin (Figure 8ADown). These results were confirmed by immunofluorescent labeling with antibody to coagulation factor VIII (data not shown). Labeling with A2B adenosine receptor antibody clearly demonstrated that the tested cells express the A2B receptor subtype (Figure 8BDown and 8CDown).



View larger version (47K):
[in this window]
[in a new window]
  		Figure 8. A, Fluoromicrograph of subconfluent HRECs that were incubated for 6 hours with 5 µg/mL fluorescence-labeled acetylated LDL. Magnification, x120. Cells were visualized using a standard FITC long-pass excitation:emission filter set. Note the abundance of punctate perinuclear fluorescence in the HRECs. Cultured human coronary artery smooth muscle cells were used as a negative control and showed no evidence of acetylated LDL uptake (data not shown). B, Confocal image of HRECs at {approx}50% confluence reacted with FITC-conjugated rabbit anti-chicken Ab showing nonspecific binding of this antibody. Magnification, x60. C, Confocal image of HRECs at {approx}50% confluence reacted first with AF5 chicken anti-A2B adenosine receptor Ab, followed by FITC-conjugated rabbit anti-chicken Ab, demonstrating specific reactivity of the cells to the anti-A2B receptor antibody. Magnification, x60.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 *Discussion
down arrowReferences
 
In this report, we demonstrate that the nonselective adenosine receptor agonist NECA, but neither the A2A adenosine receptor agonist CGS21680 nor the A1 adenosine receptor agonist CPA, stimulates HREC DNA synthesis, proliferation, and cAMP accumulation. Furthermore, neither the selective A2A adenosine receptor antagonist SCH58261 nor the A1 adenosine receptor selective antagonist CPX attenuated significantly the effects of NECA. Only the nonselective adenosine receptor antagonist XAC reduced significantly the NECA-mediated increase of DNA synthesis, cell proliferation, cAMP content, and VEGF synthesis. The A2B adenosine receptor, which we localized in HRECs using a specific antibody, is the predominant adenosine receptor subtype responsible for mediating the actions of NECA. Equally or more importantly, the addition of VEGF antibody decreased significantly NECA-induced BrdU incorporation. This finding provides strong evidence that VEGF plays a major role in mediating the mitogenic effect of NECA and, presumably, the natural ligand adenosine. We also demonstrated a significant increase in expression of mRNA for both IGF-I and bFGF after 8 hours of exposure to NECA. Thus, our data also raise the possibility that, in addition to VEGF, IGF-I and bFGF may contribute in part to the proliferative effect of NECA.

In HRECs, NECA caused a concentration-dependent increase in VEGF mRNA as well as an increase in secreted VEGF protein that was blocked by an antisense oligonucleotide complementary to A2B adenosine receptor mRNA. In contrast, neither the A2A agonist CGS21680 nor the A1 agonist CPA affected the expression either of VEGF mRNA or protein, ruling out a role for either A2A or A1 adenosine receptors in mediating increased VEGF expression, increased BrdU incorporation, and cell proliferation. NECA-induced increases in expression of both VEGF mRNA and protein by HRECs were blocked by the nonselective adenosine receptor antagonist XAC, whereas the A1- and A2A-selective adenosine receptor antagonists CPX (20 nmol/L) and SCH58261 (60 nmol/L), respectively, did not attenuate these increases. The antagonists CPX and SCH58261 were used at concentrations at which their selectivity for A1 and A2A receptors has been demonstrated in cardiovascular preparations.18 37 38 On the other hand, XAC was used at a concentration (10 µmol/L) that should be sufficient to antagonize effectively A1, A2A, A2B, and possibly the A3 receptor-mediated responses.

Hence, the evidence supporting the role of A2B adenosine receptors as the adenosine receptor subtype that mediates the effects of NECA reported here can be summarized as follows: (1) A2B receptors were localized in HRECs using immunofluorescence microscopy with the A2B antibody; (2) antisense oligonucleotides homologous to the A2B receptor blocked NECA-stimulated VEGF production; (3) neither the A1 nor the A2A receptor agonists had any effect on BrdU incorporation, cell proliferation, or cAMP production; (4) neither the A1 nor the A2A antagonists, used at the concentration at which they are selective for their receptor subtype, antagonized the effects of NECA; and (5) the nonselective but potent A2B antagonist XAC used at high concentrations significantly attenuated the effects of NECA.

Taken together, the data support the hypothesis that the A2B adenosine receptor, but neither the A1 nor the A2A receptor, is responsible for mediating the actions of NECA on cAMP accumulation and VEGF synthesis in cultured HRECs. The results of our studies do not rule out a possible role of A3 receptor in mediating the effects of NECA. However, this is unlikely, because the affinity (Ki) of XAC for the A3 adenosine receptor is 29 µmol/L, which is higher than the concentration (10 µmol/L) used in our studies.37 39 Our conclusion that the A2B receptor is the most likely adenosine receptor subtype that mediates the effects of NECA—and presumably adenosine—on HRECs differs from that reported by Takagi et al.40 41 These investigators, using retinal endothelial cells of bovine origin, concluded that the proliferative action of adenosine is mediated by A2A receptor. Takagi et al40 also reported that acute hypoxia causes a decline in KDR/Flk mRNA levels as well as VEGF binding sites on the cell surface. On the other hand, chronic hypoxia was associated with increased KDR/Flk message levels.40 More importantly, Takagi et al41 also reported that the endogenous adenosine released by hypoxic bovine retinal endothelial cells was sufficient to stimulate VEGF message expression. Species differences and passage number may account for differences in the observed adenosine receptor subtype in retinal endothelial cells. Furthermore, distinct adenosine receptor subtypes may mediate the proliferative effects of adenosine in endothelial cells from different vascular beds, even within the same species.

Protein kinase A and members of the mitogen-activated protein kinase, family such as extracellular signal–regulated kinases 1 and 2 (ERK1/ERK2) are potential mediators of adenosine–mediated cell proliferation.42 43 44 Activation of the A2B adenosine receptor results in cAMP generation via Gs. A2 receptor activation and stimulation of adenylyl cyclase/protein kinase A pathways can either activate11 or inhibit45 46 47 growth factor–stimulated ERK activity.

A2B adenosine receptor signaling through Gq/11 also results in increased levels of ERK.42 Therefore, A2B receptor stimulation of Gq/11, PLC, and PKC may synergize with or potentiate the effects of traditional tyrosine kinase–coupled growth factors,48 49 either through c-src–dependent activation of ERK or through PKC-dependent, src-independent, pathways. Because forskolin-mediated adenylyl cyclase activity does not activate VEGF expression in endothelial cells,50 Gq/11- and PKC-mediated activation of ERK may contribute to activation of transcription factors and lead to the induction of message for VEGF.51 Thus, A2B receptor activation can mediate proliferation by inducing growth factor synthesis and through stimulation of Gq/11, PLC, and PKC pathways.

Angiogenesis is a compensatory mechanism in response to insufficient tissue oxygenation.2 In the retina of diabetic individuals, homeostatic abnormalities lead to retinal nonperfusion and subsequent ischemia.52 Ischemia leads to new vessel formation and disruption of the normal retinal vasculature, the hallmarks of proliferative diabetic retinopathy.23 Our findings raise the possibility that selective A2B adenosine receptor antagonists could be used as a novel therapeutic approach to block the inciting events leading to aberrant angiogenesis in proliferative diabetic retinopathy. Pharmacological modulation of the neovascular response in a nondestructive manner should have significant advantages over current therapeutic approaches.

By blocking the A2B adenosine receptor, the action of adenosine to induce the growth factor cascade may be inhibited, and blocking the A2B adenosine receptor may attenuate aberrant cellular proliferation. In summary, our results provide strong evidence that the proliferative effect of adenosine on HRECs is caused by increased expression of VEGF and probably other growth factors, and this effect is mediated by the A2B adenosine receptor.


*    Acknowledgments
 
We thank Dr Donald Szarowski (Wadsworth Center, 3-D Light Microscopy Facility, Albany, NY) for assistance with confocal imaging.

Received December 22, 1998; accepted August 11, 1999.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Folkman J, Shing Y. Angiogenesis. J Biol Chem. 1992;267:10931–10934.[Free Full Text]
  2. Dor Y, Eli K. Ischemia-driven angiogenesis. Trends Cardiovasc Med. 1997;7:289–294.
  3. Ferrara N, Davis Smith T. The biology of vascular endothelial growth factor. Endocr Rev. 1997;18:4–25.[Abstract/Free Full Text]
  4. Gospodarowicz D, Bialecki H, Thakral TK. The angiogenic activity of the fibroblast and epidermal growth factor. Exp Eye Res. 1979;28:501–514.[Medline] [Order article via Infotrieve]
  5. Grant MB. Insulinlike growth factor-I in diabetic vascular complications. Curr Opin Endocr Diabetes. 1996;3:335–345.
  6. Dusseau J, Hutchins P. Hypoxia-induced angiogenesis in chick chorioallantoic membranes: a role for adenosine. Respir Physiol. 1988;17:33–44.
  7. Roth T, Podesta F, Stepp MA, Boeri D, Lorenzi M. Integrin overexpression induced by high glucose and by human diabetes: potential pathway to cell dysfunction in diabetic microangiopathy. Proc Natl Acad Sci U S A. 1993;90:9640–9644.[Abstract/Free Full Text]
  8. Dusseau J, Hutchins P, Malbasa D. Stimulation of angiogenesis by adenosine on the chick chorioallantoic membrane. Circ Res. 1986;59:163–170.[Abstract/Free Full Text]
  9. Meininger CJ, Granger HJ. Mechanisms leading to adenosine-stimulated proliferation of microvascular endothelial cells. Am J Physiol. 1990;258:H198–H206.[Abstract/Free Full Text]
  10. Nees S, Herzog V, Becker BF, Bock M, Des Rosiers CH, Gerlach E. The coronary endothelium: a highly active metabolic barrier for adenosine. Basic Res Cardiol. 1985;80:515–529.[Medline] [Order article via Infotrieve]
  11. Sexl V, Mancusi G, Holler C, Gloria Maercker E, Schutz W, Freissmuth M. Stimulation of the mitogen-activated protein kinase via the A2A-adenosine receptor in primary human endothelial cells. J Biol Chem. 1997;272:5792–5799.[Abstract/Free Full Text]
  12. Meininger CJ, Schelling ME, Granger HJ. Adenosine and hypoxia stimulate proliferation and migration of endothelial cells. Am J Physiol. 1988;255:H554–H562.[Abstract/Free Full Text]
  13. Sexl V, Mancusi G, Baumgartner Parzer S, Schutz W, Freissmuth M. Stimulation of human umbilical vein endothelial cell proliferation by A2-adenosine and beta 2-adrenoceptors. Br J Pharmacol. 1995;114:1577–1586.[Medline] [Order article via Infotrieve]
  14. Ethier MF, Chander V, Dobson JG Jr. Adenosine stimulates proliferation of human endothelial cells in culture. Am J Physiol. 1993;265:H131–H138.[Abstract/Free Full Text]
  15. Hudlicka O, Wright A, Ziada A. Angiogenesis in the heart and skeletal muscle. Can J Cardiol. 1986;2:120–123.[Medline] [Order article via Infotrieve]
  16. Van Daele P, Van Coevorden A, Roger PP, Boeynaems JM. Effects of adenine nucleotides on the proliferation of aortic endothelial cells. Circ Res. 1992;70:82–90.[Abstract/Free Full Text]
  17. Adair T, Montani J, Strick D, Guyton A. Vascular development in chick embryos: a possible role for adenosine. Am J Physiol. 1989;256:H240–H246.[Abstract/Free Full Text]
  18. Shryock J, Belardinelli L. Adenosine and adenosine receptors in the cardiovascular system: biochemistry, physiology, and pharmacology. Am J Cardiol. 1997;79:2–10.
  19. Fredholm BB, Abbracchio MP, Burnstock G, Daly JW, Harden TK, Jacobson KA, Leff P, Williams M. Nomenclature and classification of purinoceptors. Pharmacol Rev. 1994;46:143–156.[Medline] [Order article via Infotrieve]
  20. Collis M, Hourani S. Adenosine receptor subtypes. Trends Pharmacol Sci. 1993;14:360–366.[Medline] [Order article via Infotrieve]
  21. Stiles G. Adenosine receptors. J Biol Chem. 1992;267:6451.[Abstract/Free Full Text]
  22. Belardinelli L, Shryock J. Does adenosine function as a retaliatory metabolite in the heart? News Physiol Sci. 1992;7:52–56.[Abstract/Free Full Text]
  23. Frank RN. On the pathogenesis of diabetic retinopathy: a 1990 update. Ophthalmology. 1991;98:586–593.[Medline] [Order article via Infotrieve]
  24. Miller JW, Adamis AP, Shima DT, D'Amore PA, Moulton RS, O'Reilly MS, Folkman J, Dvorak HF, Brown LF, Berse B. Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model. Am J Pathol. 1994;145:574–584.[Abstract]
  25. Aiello L. Vascular endothelial growth factor: 20th-century mechanisms, 21st-century therapies. Invest Ophthalmol Vis Sci. 1997;38:1647–1652.[Free Full Text]
  26. Kirkpatrick CJ, Wagner M, Hermanns I, Klein CL, Kohler H, Otto M, van Kooten TG, Bittinger F. Physiology and cell biology of the endothelium: a dynamic interface for cell communication. Int J Microcirc Clin Exp. 1997;17:231–240.[Medline] [Order article via Infotrieve]
  27. Mukhopadhyay D, Nagy J, Manseau E, Dvorak H. Vascular permeability factor/vascular endothelial growth factor-mediated signaling in mouse mesentery vascular endothelium. Cancer Res. 1998;58:1278–1284.[Abstract/Free Full Text]
  28. Gerber H, McMurtrey A, Kowalski J, Yan M, Keyt B, Dixit V, Ferrara N. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway: requirement for flk-1/kdr activation. J Biol Chem. 1998;273:30336–30343.[Abstract/Free Full Text]
  29. Miller J, Adamis A, Aiello L. Vascular endothelial growth factor in ocular neovascularization and proliferative diabetic retinopathy. Diabetes Metab Rev. 1997;13:37–50.[Medline] [Order article via Infotrieve]
  30. Hanneken A, Lutty GA, McLeod DS, Robey F, Harvey AK, Hjelmeland LM. Localization of basic fibroblast growth factor to the developing capillaries of the bovine retina. J Cell Physiol. 1989;138:115–120.[Medline] [Order article via Infotrieve]
  31. Grant MB, King GL. IGF-1 and blood vessels. Diabetes Rev. 1995;3:113–128.
  32. Feoktistov I, Sheller J, Vallejo V, Biaggioni I. Immunological identification of adenosine A2B receptors in human lung mast cells. Drug Dev Res. 1996;37:146–150.
  33. Grant MG, Guay C. Plasminogen activator production by human retinal endothelial cells of nondiabetic and diabetic origin. Invest Ophthalmol Vis Sci. 1991;32:53–64.[Abstract/Free Full Text]
  34. Shryock JC, Ozeck MJ, Belardinelli L. Inverse agonists and neutral antagonists of recombinant human A1 adenosine receptors stably expressed in Chinese hamster ovary cells. Mol Pharmacol. 1998;53:886–893.[Abstract/Free Full Text]
  35. Tarnuzzer RW, Macauley SP, Farmerie WG, Caballero S, Ghassemifar MR, Anderson JT, Robinson CP, Grant MB, Humphreys-Beher MG, Franzen L, Peck AB, Schultz GS. Competitive RNA templates for detection and quantitation of growth factors, cytokines, extracellular matrix components and matrix metalloproteinases by RT-PCR. Biotechniques. 1996;20:670–674.[Medline] [Order article via Infotrieve]
  36. Davis-Cox MI, Turner JN, Szarowski D, Shain W. Phorbol ester-stimulated stellation in primary cultures of astrocytes from different brain regions. Microsc Res Tech. 1994;29:319–327.[Medline] [Order article via Infotrieve]
  37. Shryock J, Snowdy S, Baraldi P, Cacciari B, Spalluto G, Monopoli A, Ongini E, Baker S, Belardinelli L. A2A adenosine receptor reserve for coronary vasodilation. Circulation. 1998;98:711–718.[Abstract/Free Full Text]
  38. Belardinelli L, Shryock J, Snowdy S, Zhang Y, Monopoli A, Lozza G, Ongini E, Olsson R, Dennis D. The A2A adenosine receptor mediates coronary vasodilation. J Pharmacol Exp Ther. 1998;284:1066–1073.[Abstract/Free Full Text]
  39. Daly J, Jacobson K. Adenosine receptors: selective agonists and antagonists. In: Belardinelli L, Pelleg A, eds. Adenosine and Adenine Nucleotides: From Molecular Biology to Integrative Physiology. Boston, Mass: Kluwer Academic Publishers; 1995:157–166.
  40. Takagi H, King G, Ferrara N, Aiello L. Hypoxia regulates vascular endothelial growth factor receptor KDR/Flk gene expression through adenosine A2 receptors in retinal capillary endothelial cells. Invest Ophthalmol Vis Sci. 1996;37:1311–1321.[Abstract/Free Full Text]
  41. Takagi H, King GL, Robinson GS, Ferrara N, Aiello LP. Adenosine mediates hypoxic induction of vascular endothelial growth factor in retinal pericytes and endothelial cells. Invest Ophthalmol Vis Sci. 1996;37:2165–2176.[Abstract/Free Full Text]
  42. Feoktistov I, Goldstein AE, Biaggioni I. Role of p38 mitogen-activated protein kinase and extracellular signal-regulated protein kinase kinase in adenosine A2B receptor-mediated interleukin-8 production in human mast cells. Mol Pharmacol. 1999;55:726–734.[Abstract/Free Full Text]
  43. Grant MB, Tarnuzzer RW, Davis MI, Caballero S, Spoerri PE, Ozeck MJ, Shryock JC, Belardinelli L. Adenosine activates mitogen activated protein kinase (MAPK) and angiogenic growth factor production in human retinal endothelial cells (HRECs). In: The Endocrine Society 8th Annual Meeting, June 27, 1998; New Orleans, La. Bethesda, Md: The Endocrine Society; 1998. Abstract.
  44. Grant MB, Davis MI, Tarnuzzer RW, Caballero S, Belardinelli L. Adenosine mediates human retinal endothelial cell (HREC) chemotaxis, capillary tube formation and stimulatory signaling cascades. Invest Ophthalmol Vis Sci. 1999;40:S616.
  45. D'Angelo G, Lee H, Weiner RI. cAMP-dependent protein kinase inhibits the mitogenic action of vascular endothelial growth factor and fibroblast growth factor in capillary endothelial cells by blocking Raf activation. J Cell Biochem. 1997;67:353–366.[Medline] [Order article via Infotrieve]
  46. Wu J, Dent P, Jelinek T, Wolfman A, Weber MJ, Sturgill TW. Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'-monophosphate. Science. 1993;262:1065–1069.[Abstract/Free Full Text]
  47. Cook SJ, McCormick F. Inhibition by cAMP of Ras-dependent activation of Raf. Science. 1993;262:1069–1072.[Abstract/Free Full Text]
  48. Ray LB, Sturgill TW. Insulin-stimulated microtubule-associated protein kinase is phosphorylated on tyrosine and threonine in vivo. Proc Natl Acad Sci U S A. 1988;85:3753–3757.[Abstract/Free Full Text]
  49. Schonwasser DC, Marais RM, Marshall CJ, Parker PJ. Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol Cell Biol. 1998;18:790–798.[Abstract/Free Full Text]
  50. Pueyo ME, Chen Y, D'Angelo G, Michael JB. Regulation of vascular endothelial growth factor expression by cAMP in rat aortic smooth muscle cells. Exp Cell Res. 1998;238:354–358.[Medline] [Order article via Infotrieve]
  51. Milanini J, Vinals F, Pouyssegur J, Pages G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J Biol Chem. 1998;273:18165–18172.[Abstract/Free Full Text]
  52. Alexander SP, Cooper J, Shine J, Hill SJ. Characterization of the human brain putative A2B adenosine receptor expressed in Chinese hamster ovary (CHO.A2B4) cells. Br J Pharmacol. 1996;119:1286–1290.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Hellsten, N. Rufener, J. J. Nielsen, B. Hoier, P. Krustrup, and J. Bangsbo
Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R975 - R982.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. Yang, M. Koupenova, D. J. McCrann, K. J. Kopeikina, H. M. Kagan, B. M. Schreiber, and K. Ravid
The A2b adenosine receptor protects against vascular injury
PNAS, January 15, 2008; 105(2): 792 - 796.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
A. N. Clark, R. Youkey, X. Liu, L. Jia, R. Blatt, Y.-J. Day, G. W. Sullivan, J. Linden, and A. L. Tucker
A1 Adenosine Receptor Activation Promotes Angiogenesis and Release of VEGF From Monocytes
Circ. Res., November 26, 2007; 101(11): 1130 - 1138.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J.-J. You, C.-H. Yang, J.-S. Huang, M.-S. Chen, and C.-M. Yang
Fractalkine, a CX3C Chemokine, as a Mediator of Ocular Angiogenesis
Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5290 - 5298.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
Y. Fang and M. E. Olah
Cyclic AMP-Dependent, Protein Kinase A-Independent Activation of Extracellular Signal-Regulated Kinase 1/2 Following Adenosine Receptor Stimulation in Human Umbilical Vein Endothelial Cells: Role of Exchange Protein Activated by cAMP 1 (Epac1)
J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1189 - 1200.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
S. Ryzhov, J. L. McCaleb, A. E. Goldstein, I. Biaggioni, and I. Feoktistov
Role of Adenosine Receptors in the Regulation of Angiogenic Factors and Neovascularization in Hypoxia
J. Pharmacol. Exp. Ther., February 1, 2007; 320(2): 565 - 572.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. S. Allen-Gipson, J. Wong, J. R. Spurzem, J. H. Sisson, and T. A. Wyatt
Adenosine A2A receptors promote adenosine-stimulated wound healing in bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L849 - L855.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
M. S. Segal, R. Shah, A. Afzal, C. M. Perrault, K. Chang, A. Schuler, E. Beem, L. C. Shaw, S. Li Calzi, J. K. Harrison, et al.
Nitric Oxide Cytoskeletal-Induced Alterations Reverse the Endothelial Progenitor Cell Migratory Defect Associated With Diabetes
Diabetes, January 1, 2006; 55(1): 102 - 109.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. H. Adair
Growth regulation of the vascular system: an emerging role for adenosine
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R283 - R296.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
T. H. Adair
An Emerging Role for Adenosine in Angiogenesis
Hypertension, November 1, 2004; 44(5): 618 - 620.
[Full Text] [PDF]

Home page
 HypertensionHome page
I. Feoktistov, S. Ryzhov, H. Zhong, A. E. Goldstein, A. Matafonov, D. Zeng, and I. Biaggioni
Hypoxia Modulates Adenosine Receptors in Human Endothelial and Smooth Muscle Cells Toward an A2B Angiogenic Phenotype
Hypertension, November 1, 2004; 44(5): 649 - 654.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
H. Pan, N.-Q.-N. Nguyen, H. Yoshida, F. Bentzien, L. C. Shaw, F. Rentier-Delrue, J. A. Martial, R. Weiner, I. Struman, and M. B. Grant
Molecular Targeting of Antiangiogenic Factor 16K hPRL Inhibits Oxygen-Induced Retinopathy in Mice
Invest. Ophthalmol. Vis. Sci., July 1, 2004; 45(7): 2413 - 2419.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. Spychala, E. Lazarowski, A. Ostapkowicz, L. H. Ayscue, A. Jin, and B. S. Mitchell
Role of Estrogen Receptor in the Regulation of Ecto-5'-Nucleotidase and Adenosine in Breast Cancer
Clin. Cancer Res., January 15, 2004; 10(2): 708 - 717.
[Abstract] [Full Text] [PDF]