© 1999 American Heart Association, Inc.
Cellular Biology |
Adenosine Receptor Activation Induces Vascular Endothelial Growth Factor in Human Retinal Endothelial Cells
From the Departments of Medicine (M.B.G., R.W.T., S.C., M.I.D., P.E.S., J.C.S., L.B.), Ophthalmology (M.B.G.), and Pharmacology and Therapeutics (M.J.O., J.C.S., L.B.), University of Florida, Gainesville, Fla, and Department of Medicine and Pharmacology (I.F., I.B.), Vanderbilt University, Nashville, Tenn. L.B.'s current address is Pharmacological Sciences, CV Therapeutics, Palo Alto, Calif.
Correspondence to M.B. Grant, MD, Associate Professor of Medicine, Department of Medicine, Division of Endocrinology and Metabolism, University of Florida, P.O. Box 100226, Gainesville, FL 32610-0226. E-mail grantma{at}medicine.ufl.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Adenosine, released in increased amounts by hypoxic tissues, is thought to be an angiogenic factor that links altered cellular metabolism caused by oxygen deprivation to compensatory angiogenesis. Adenosine interacts with 4 subtypes of G protein–coupled receptors, termed A1, A2A, A2B, and A3. We investigated whether adenosine causes proliferation of human retinal endothelial cells (HRECs) and synthesis of vascular endothelial growth factor (VEGF) and, if so, which adenosine receptor subtype mediates these effects. The nonselective adenosine receptor agonist 5'-N-ethylcarboxamidoadenosine (NECA), in a concentration-dependent manner, increased both VEGF mRNA and protein expression by HRECs, as well as proliferation. This proliferative effect of NECA was inhibited by the addition of anti-human VEGF antibody. NECA also increased insulin-like growth factor-I and basic fibroblast growth factor mRNA expression in a time-dependent manner and cAMP accumulation in these cells. In contrast, neither the A1 agonist N6-cyclopentyladenosine nor the A2A agonist 2-p-(2-carboxyethyl) phenethylamino-NECA caused any of the above effects of NECA. The effects of NECA were not significantly attenuated by either the A2A antagonist SCH58261 or the A1 antagonist 8-cyclopentyl-1,3-dipropylxanthine. However, the nonselective adenosine receptor antagonist xanthine amine congener completely inhibited the effects of NECA. Addition of antisense oligonucleotide complementary to A2B adenosine receptor mRNA inhibited VEGF protein production by HRECs after NECA stimulation. Thus, the A2B adenosine receptor subtype appears to mediate the actions of adenosine to increase growth factor production, cAMP content, and cell proliferation of HRECs. Adenosine activates the A2B adenosine receptor in HRECs, which may lead to neovascularization by a mechanism involving increased angiogenic growth factor expression.
Key Words: adenosine receptor • angiogenesis • ischemia • hypoxia • diabetes
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Tissue hypoxia and ischemia are known to initiate a series of events that lead to the development of collateral blood vessels1 in a process referred to as compensatory angiogenesis.2 However, the cellular and molecular mechanisms underlying compensatory angiogenesis have been only partially elucidated.2 Potential mediators of compensatory angiogenesis include vascular endothelial growth factor (VEGF),3 basic fibroblast growth factor (bFGF),4 insulin-like growth factor-I (IGF-I),5 and nucleosides such as adenosine.6
Adenosine, the subject of the present study, has been proposed to be a factor that links altered cellular metabolism caused by oxygen deprivation to the formation of new capillaries.7 8 9 This proposed role of adenosine is based on the observation that this nucleoside is released in increased amounts by hypoxic and/or ischemic cells and promotes proliferation of endothelial cells.9 10 11 Consistent with this hypothesis, adenosine and adenosine analogs have been reported to affect a number of steps involved in angiogenesis, including endothelial cell proliferation,8 12 13 14 migration,12 15 16 and blood vessel formation in various vascular beds.15 17 Adenosine can interact with at least 4 subtypes of G protein–coupled receptors, designated A1, A2A, A2B, and A3.18 These receptor subtypes are encoded by distinct genes and can, for the most part, be differentiated on the basis of their affinities for selected agonists and antagonists.19 20 A1 and A3 adenosine receptors are coupled to pertussis toxin–sensitive inhibitory G proteins that inhibit adenylyl cyclase activity, whereas A2A (high-affinity) and A2B (low-affinity) adenosine receptors are coupled to cholera toxin–sensitive G proteins that stimulate adenylyl cyclase activity.21 In most cell types and organ systems, activation of A1 adenosine receptors results in decreased work, and therefore, reduced O2 consumption. Activation of A2A adenosine receptors, on the other hand, increases O2 supply by causing vasodilation.22 Thus, adenosine is an ideal metabolite to respond to imbalances between O2 supply and demand. In the retina, hypoxia is followed by compensatory angiogenesis, which is detrimental and results in aberrant blood vessels that are friable and prone to bleeding.23
VEGF is a potent endothelial mitogen, induced by hypoxia and hyperglycemia, and has been shown to be an important factor in ischemic ocular neovascularization.24 25 26 VEGF causes hyperpermeability of blood vessels, which is observed in both nonproliferative and proliferative diabetic retinopathy. VEGF acts through 2 receptors, VEGFR-1 (Flt-1) and VEGFR-2 (Flk-1/KDR), both of which are tyrosine kinases. VEGF signaling occurs through tyrosine phosphorylation of phospholipase C (PLC) and phosphatidylinositol 3'-kinase.27 28 The effects of VEGF are also mediated by activation of protein kinase C (PKC) to induce membrane translocation of PKC isoforms, especially the ß-isoform of the enzyme.25 VEGFR-1 mediates the permeability effects associated with VEGF, whereas VEGFR-2 mediates the proliferative effects of VEGF. Elevated levels of VEGF have been detected in vitreous humor of diabetic patients with proliferative retinopathy.25 More importantly, in animal models of retinal neovascularization, inhibition of VEGF blocks neovascularization.29 Other growth factors have been implicated in ocular angiogenesis, including bFGF30 and IGF-I.31
The experiments described were performed test the hypothesis that adenosine regulates expression of the angiogenic growth factor VEGF and to determine the adenosine receptor subtype that mediates the effect of the nucleoside in retinal endothelial cells of human origin.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5'-N-ethylcarboxamidoadenosine (NECA), 2-p-(2-carboxyethyl) phenethylamino-NECA (CGS21680), N6-cyclopentyladenosine (CPA), xanthine amine congener (XAC), and 8-cyclopentyl-1,3-dipropylxanthine (CPX) were from Research Biochemicals, Inc. 5-Amino-7-(2-phenylethyl)-2-(2-furyl)-pyrazolo(4,3-E)-1,2,4-trizolo(1,5-c) pyrimidine (SCH58261) was a gift from Schering-Plough Research Institute. Rabbit anti-human VEGF was from Peprotech. Antibodies and conjugates for immunofluorescence were as follows. Chicken anti-human A2B adenosine receptor,32 FITC-conjugated rabbit anti-chicken IgG, and nonimmune sera were from Sigma-Aldrich. Sense and antisense oligonucleotides corresponding to either VEGF or A2B adenosine receptor sequences were synthesized by Life Technologies. The sequences were chosen from the region proximal to and including the start codon using published sequence information for these genes. The antisense sequences are as follows: VEGF, AGACAGCAGAAAGTTCATGG, and A2B adenosine receptor, CAGCGCGTCCTGTGTCTCCAGCAGCATGG. Sense sequences are the complement of the antisense sequences shown.
Human retinal endothelial cells (HRECs) were prepared and maintained as previously described.33 Cells in passages 3 to 6 were used for the studies. The identity of HRECs was validated by demonstrating endothelial cell incorporation of fluorescently labeled acetylated LDL and by fluorescence-activated cell sorting analysis as previously described.33 For all experiments, cells were starved of serum overnight and then incubated with adenosine deaminase type III (2 U/mL, Sigma-Aldrich) for 20 minutes before test agents were added. Adenosine receptor agonists and antagonists were added at concentrations ranging from 5 nmol/L up to 100 µmol/L in serum-free medium containing adenosine deaminase type III and then incubated for additional times as indicated in specific results.
cAMP was measured in response to adenosine receptor agonists and/or antagonists as described.34 Conditioned medium was used to measure changes in VEGF protein in response to adenosine receptor agonists and/or antagonists using an ELISA kit (R&D Systems, Inc). HREC proliferation was determined by measuring DNA synthesis via colorimetric detection of bromodeoxyuridine (BrdU) incorporation using a kit (Roche Molecular Biochemicals), and also by changes in cell number. BrdU incorporation was also used to measure the effect of anti-VEGF antibody on adenosine receptor agonist–induced HREC proliferation. The potential reduction of VEGF synthesis induced by adenosine receptor agonist was tested by ELISA after inclusion of antisense oligonucleotides directed against mRNA for either A2B adenosine receptor or VEGF. Quantitative reverse transcriptase–polymerase chain reaction (RT-PCR), using a competitive synthetic multiplex template as described previously,35 was performed to measure changes in mRNA after treatment with adenosine receptor agonists and/or antagonists. Immunofluorescent confocal microscopy was used as described36 to demonstrate both the presence of A2B adenosine receptors and uptake of fluorescence-labeled acetylated LDL in HRECs grown on multichamber glass slides (Nalge Nunc International).
Statistical Analysis
Comparisons between treatment groups (as described in the figure
legends) were analyzed by 1-way ANOVA followed by the
Bonferroni t test. Data are expressed as mean±SEM. Values
of P<0.05 were considered statistically significant.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The nonselective adenosine receptor agonist NECA, after 48 hours of exposure, induced a concentration-dependent increase in DNA synthesis by HRECs, as indicated by BrdU incorporation (Figure 1A
). In contrast, neither the
A2A adenosine receptor agonist CGS21680
(10 nmol/L to 10 µmol/L) nor the A1
adenosine receptor agonist CPA (10 nmol/L to 10 µmol/L)
increased BrdU incorporation by HRECs (Figure 1A). The addition
of the adenosine receptor antagonist XAC completely
prevented NECA-stimulated BrdU incorporation (Figure 1B). In
contrast, neither the selective A1
adenosine receptor antagonist CPX (20 nmol/L) nor
the selective A2A adenosine receptor
antagonist SCH58261 (60 nmol/L) attenuated the stimulatory
effect of NECA on BrdU incorporation by HRECs (Figure 1B).
|
), ie, nutrient medium without supplements; growth medium
(
); or basal medium supplemented with increasing
concentrations of the selective A2A adenosine
receptor agonist CGS21680 (
), the selective
A1 adenosine receptor agonist CPA (
), or the
nonselective adenosine receptor agonist NECA
(
) for 48 hours. DNA synthesis was quantified by
measuring BrdU incorporation as described in Materials and Methods.
Increase in BrdU incorporation caused by NECA was significantly
different (P<0.05) from both CGS21680 and CPA at
concentrations ranging from 100 nmol/L to 10 µmol/L.
*Significantly different from basal medium, by ANOVA
(P<0.05). B, BrdU incorporation in HRECs exposed
simultaneously to the nonspecific adenosine
receptor agonist NECA and the selective A1 receptor
antagonist CPX, the selective A2A receptor
antagonist SCH58261 (SCH), or the nonselective receptor
antagonist XAC for 48 hours. Untreated cells were
maintained in basal nutrient medium. *Significantly different from
10 µmol/L NECA, by ANOVA (P<0.05). A and B, Data
are mean±SEM of 4 independent experiments.
The data for cell counts were consistent with those for BrdU
incorporation. Treatment with NECA for 48 hours resulted in a
concentration-dependent increase in HREC number, whereas neither
CGS21680 nor CPA caused an increase in cell number (Figure 2A). Of the 3 adenosine receptor
antagonists tested, only XAC (10 µmol/L)
significantly inhibited the increase in cell number induced by 10
µmol/L NECA (Figure 2B).
|
cAMP Accumulation
To obtain evidence for the presence of the
A2B adenosine receptors in HRECs, we
performed assays for cAMP content in intact HRECs after treatment of
cells with adenosine receptor agonists and
antagonists. The nonselective adenosine receptor
agonist NECA increased the cAMP content of HRECs in a
concentration-dependent manner (Figure 3A), with an EC50
value of 24 µmol/L. In contrast, the selective high-affinity
A2A adenosine receptor agonist CGS21680
(at concentrations up to 100 µmol/L) had no significant effect
on cAMP content of HRECs (Figure 3A). The effect of selective
A1 and A2A
adenosine receptor antagonists on NECA-induced
accumulation of cAMP was also examined. NECA (10
µmol/L)-induced increase in cAMP content in HRECs was not
significantly inhibited either by the selective
A2A adenosine receptor
antagonist SCH58261 (60 nmol/L) or by the selective
A1 adenosine receptor
antagonist CPX (20 nmol/L) (Figure 3B). On the other
hand, the nonselective adenosine receptor
antagonist XAC (10 µmol/L) completely blocked the
effect of NECA on cAMP accumulation.
|
Quantification of VEGF, IGF-I, and bFGF mRNA in HRECs
To determine whether NECA stimulates angiogenic growth factor mRNA
expression in HRECs, total mRNA from HRECs exposed to NECA was
subjected to quantitative RT-PCR. Treatment of HRECs with NECA (10
nmol/L to 10 µmol/L) for 2 hours induced a
concentration-dependent increase in expression of mRNA for VEGF by up
to 4.6-fold (from 0.4x106 to
1.85x106 copies/µg RNA), compared with
untreated control cells. After 8 hours of exposure to NECA, cell mRNA
levels for VEGF in cells treated with NECA had returned to baseline.
HRECs were also treated with the A2A
adenosine receptor agonist, CGS21680 (10 nmol/L to 10
µmol/L), and the A1 adenosine receptor
agonist, CPA (10 nmol/L to 10 µmol/L). In contrast to NECA,
neither CGS21680 nor CPA caused a significant change in VEGF mRNA
expression (data not shown).
The increase in mRNA for VEGF caused by 10 µmol/L NECA was not
attenuated significantly either by the selective
A2A adenosine receptor
antagonist SCH58261 (60 nmol/L) or by the selective
A1 adenosine receptor
antagonist CPX (20 nmol/L) (Figure 4). The nonselective
antagonist XAC (10 µmol/L) completely attenuated
NECA-induced increases in mRNA for VEGF (Figure 4). NECA
(10 µmol/L) also induced a time-dependent increase in mRNA for
both IGF-I and bFGF. IGF-I mRNA levels increased by 2.2-fold after 2
hours of exposure (from 30x103 copies/µg RNA
to 65x103 copies/µg RNA) and 11.7-fold
(350x103 copies/µg RNA) after 8 hours of
exposure to NECA. Similarly, bFGF mRNA increased 3.7-fold after 2 hours
of exposure (from 2x103 copies/µg RNA to
7.4x103 copies/µg RNA) and 11.4-fold
(22.8x103 copies/µg RNA) after 8 hours of
exposure to NECA.
|
Quantification of VEGF Protein in Conditioned Medium
To determine whether the increase in VEGF mRNA expression resulted
in increased protein levels, VEGF was measured in conditioned medium
after 8 hours of exposure to NECA, in the presence or absence of
adenosine receptor antagonists (Figure 5). NECA increased VEGF protein, but
neither the A1 adenosine receptor agonist
CPA (not shown) nor the A2A adenosine
receptor agonist CGS21680 caused an increase in VEGF protein (Figure 5). The increase in VEGF protein caused by NECA was not
attenuated by either the selective A2A
adenosine receptor antagonist SCH58261 (60 nmol/L)
or by the selective A1 adenosine receptor
antagonist CPX (20 nmol/L). Only the nonselective
adenosine receptor antagonist XAC (10
µmol/L) completely inhibited the action of NECA to increase VEGF
protein expression (Figure 5).
|
Effect of Anti-VEGF Antibody on NECA-Induced HREC
Proliferation
Incubation with 10 ng/mL VEGF resulted in BrdU incorporation to a
level approximating that induced by normal growth medium. The anti-VEGF
antibody at 100 ng/mL significantly reduced DNA synthesis induced by
VEGF (Figure 6). Incubation with NECA
(10 µmol/L) increased DNA synthesis to levels comparable with
that induced by normal growth medium. The addition of anti-VEGF
antibody resulted in a decrease in NECA-induced BrdU incorporation,
which was statistically significant at the highest concentration of
antibody used (Figure 6). Similar results were observed at
either 24 or 48 hours of exposure to the test agents.
|
Significantly different from 10 ng/mL VEGF alone for the respective
exposure time, by ANOVA (P<0.05).
Effect of Antisense Oligonucleotides on VEGF
Induction by NECA
Both A2B adenosine receptor
and VEGF antisense oligonucleotides caused a
significant decrease of VEGF in the conditioned medium after NECA
exposure (Figure 7). This effect was most
pronounced for the receptor antisense oligonucleotide
with 10 nmol/L NECA, but it was evident for all concentrations of NECA
tested. The VEGF antisense oligonucleotide also caused
a decrease in secreted VEGF in response to NECA, although not to the
same magnitude as that observed with the A2B
adenosine receptor antisense.
|
Immunofluorescence
Analysis of acetylated LDL uptake indicates
that the cells are indeed of endothelial origin (Figure 8A). These results were confirmed
by immunofluorescent labeling with antibody to coagulation
factor VIII (data not shown). Labeling with A2B
adenosine receptor antibody clearly demonstrated that the
tested cells express the A2B receptor subtype
(Figure 8B and 8C).
|
50% confluence reacted with FITC-conjugated rabbit
anti-chicken Ab showing nonspecific binding of this antibody.
Magnification, x60. C, Confocal image of HRECs at |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this report, we demonstrate that the nonselective adenosine receptor agonist NECA, but neither the A2A adenosine receptor agonist CGS21680 nor the A1 adenosine receptor agonist CPA, stimulates HREC DNA synthesis, proliferation, and cAMP accumulation. Furthermore, neither the selective A2A adenosine receptor antagonist SCH58261 nor the A1 adenosine receptor selective antagonist CPX attenuated significantly the effects of NECA. Only the nonselective adenosine receptor antagonist XAC reduced significantly the NECA-mediated increase of DNA synthesis, cell proliferation, cAMP content, and VEGF synthesis. The A2B adenosine receptor, which we localized in HRECs using a specific antibody, is the predominant adenosine receptor subtype responsible for mediating the actions of NECA. Equally or more importantly, the addition of VEGF antibody decreased significantly NECA-induced BrdU incorporation. This finding provides strong evidence that VEGF plays a major role in mediating the mitogenic effect of NECA and, presumably, the natural ligand adenosine. We also demonstrated a significant increase in expression of mRNA for both IGF-I and bFGF after 8 hours of exposure to NECA. Thus, our data also raise the possibility that, in addition to VEGF, IGF-I and bFGF may contribute in part to the proliferative effect of NECA.
In HRECs, NECA caused a concentration-dependent increase in VEGF mRNA as well as an increase in secreted VEGF protein that was blocked by an antisense oligonucleotide complementary to A2B adenosine receptor mRNA. In contrast, neither the A2A agonist CGS21680 nor the A1 agonist CPA affected the expression either of VEGF mRNA or protein, ruling out a role for either A2A or A1 adenosine receptors in mediating increased VEGF expression, increased BrdU incorporation, and cell proliferation. NECA-induced increases in expression of both VEGF mRNA and protein by HRECs were blocked by the nonselective adenosine receptor antagonist XAC, whereas the A1- and A2A-selective adenosine receptor antagonists CPX (20 nmol/L) and SCH58261 (60 nmol/L), respectively, did not attenuate these increases. The antagonists CPX and SCH58261 were used at concentrations at which their selectivity for A1 and A2A receptors has been demonstrated in cardiovascular preparations.18 37 38 On the other hand, XAC was used at a concentration (10 µmol/L) that should be sufficient to antagonize effectively A1, A2A, A2B, and possibly the A3 receptor-mediated responses.
Hence, the evidence supporting the role of A2B adenosine receptors as the adenosine receptor subtype that mediates the effects of NECA reported here can be summarized as follows: (1) A2B receptors were localized in HRECs using immunofluorescence microscopy with the A2B antibody; (2) antisense oligonucleotides homologous to the A2B receptor blocked NECA-stimulated VEGF production; (3) neither the A1 nor the A2A receptor agonists had any effect on BrdU incorporation, cell proliferation, or cAMP production; (4) neither the A1 nor the A2A antagonists, used at the concentration at which they are selective for their receptor subtype, antagonized the effects of NECA; and (5) the nonselective but potent A2B antagonist XAC used at high concentrations significantly attenuated the effects of NECA.
Taken together, the data support the hypothesis that the A2B adenosine receptor, but neither the A1 nor the A2A receptor, is responsible for mediating the actions of NECA on cAMP accumulation and VEGF synthesis in cultured HRECs. The results of our studies do not rule out a possible role of A3 receptor in mediating the effects of NECA. However, this is unlikely, because the affinity (Ki) of XAC for the A3 adenosine receptor is 29 µmol/L, which is higher than the concentration (10 µmol/L) used in our studies.37 39 Our conclusion that the A2B receptor is the most likely adenosine receptor subtype that mediates the effects of NECA—and presumably adenosine—on HRECs differs from that reported by Takagi et al.40 41 These investigators, using retinal endothelial cells of bovine origin, concluded that the proliferative action of adenosine is mediated by A2A receptor. Takagi et al40 also reported that acute hypoxia causes a decline in KDR/Flk mRNA levels as well as VEGF binding sites on the cell surface. On the other hand, chronic hypoxia was associated with increased KDR/Flk message levels.40 More importantly, Takagi et al41 also reported that the endogenous adenosine released by hypoxic bovine retinal endothelial cells was sufficient to stimulate VEGF message expression. Species differences and passage number may account for differences in the observed adenosine receptor subtype in retinal endothelial cells. Furthermore, distinct adenosine receptor subtypes may mediate the proliferative effects of adenosine in endothelial cells from different vascular beds, even within the same species.
Protein kinase A and members of the mitogen-activated protein kinase, family such as extracellular signal–regulated kinases 1 and 2 (ERK1/ERK2) are potential mediators of adenosine–mediated cell proliferation.42 43 44 Activation of the A2B adenosine receptor results in cAMP generation via Gs. A2 receptor activation and stimulation of adenylyl cyclase/protein kinase A pathways can either activate11 or inhibit45 46 47 growth factor–stimulated ERK activity.
A2B adenosine receptor signaling through Gq/11 also results in increased levels of ERK.42 Therefore, A2B receptor stimulation of Gq/11, PLC, and PKC may synergize with or potentiate the effects of traditional tyrosine kinase–coupled growth factors,48 49 either through c-src–dependent activation of ERK or through PKC-dependent, src-independent, pathways. Because forskolin-mediated adenylyl cyclase activity does not activate VEGF expression in endothelial cells,50 Gq/11- and PKC-mediated activation of ERK may contribute to activation of transcription factors and lead to the induction of message for VEGF.51 Thus, A2B receptor activation can mediate proliferation by inducing growth factor synthesis and through stimulation of Gq/11, PLC, and PKC pathways.
Angiogenesis is a compensatory mechanism in response to insufficient tissue oxygenation.2 In the retina of diabetic individuals, homeostatic abnormalities lead to retinal nonperfusion and subsequent ischemia.52 Ischemia leads to new vessel formation and disruption of the normal retinal vasculature, the hallmarks of proliferative diabetic retinopathy.23 Our findings raise the possibility that selective A2B adenosine receptor antagonists could be used as a novel therapeutic approach to block the inciting events leading to aberrant angiogenesis in proliferative diabetic retinopathy. Pharmacological modulation of the neovascular response in a nondestructive manner should have significant advantages over current therapeutic approaches.
By blocking the A2B adenosine receptor, the action of adenosine to induce the growth factor cascade may be inhibited, and blocking the A2B adenosine receptor may attenuate aberrant cellular proliferation. In summary, our results provide strong evidence that the proliferative effect of adenosine on HRECs is caused by increased expression of VEGF and probably other growth factors, and this effect is mediated by the A2B adenosine receptor.
|
Acknowledgments |
|---|
We thank Dr Donald Szarowski (Wadsworth Center, 3-D Light Microscopy Facility, Albany, NY) for assistance with confocal imaging.
Received December 22, 1998; accepted August 11, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Folkman J, Shing Y. Angiogenesis. J Biol Chem. 1992;267:10931–10934.
2. Dor Y, Eli K. Ischemia-driven angiogenesis. Trends Cardiovasc Med. 1997;7:289–294.
3.
Ferrara N, Davis Smith T. The biology of
vascular endothelial growth factor. Endocr
Rev. 1997;18:4–25.
4. Gospodarowicz D, Bialecki H, Thakral TK. The angiogenic activity of the fibroblast and epidermal growth factor. Exp Eye Res. 1979;28:501–514.[Medline] [Order article via Infotrieve]
5. Grant MB. Insulinlike growth factor-I in diabetic vascular complications. Curr Opin Endocr Diabetes. 1996;3:335–345.
6. Dusseau J, Hutchins P. Hypoxia-induced angiogenesis in chick chorioallantoic membranes: a role for adenosine. Respir Physiol. 1988;17:33–44.
7.
Roth T, Podesta F, Stepp MA, Boeri D, Lorenzi M.
Integrin overexpression induced by high glucose and by human diabetes:
potential pathway to cell dysfunction in diabetic microangiopathy.
Proc Natl Acad Sci U S A. 1993;90:9640–9644.
8.
Dusseau J, Hutchins P, Malbasa D. Stimulation of
angiogenesis by adenosine on the chick chorioallantoic
membrane. Circ Res. 1986;59:163–170.
9.
Meininger CJ, Granger HJ. Mechanisms leading to
adenosine-stimulated proliferation of microvascular
endothelial cells. Am J Physiol. 1990;258:H198–H206.
10. Nees S, Herzog V, Becker BF, Bock M, Des Rosiers CH, Gerlach E. The coronary endothelium: a highly active metabolic barrier for adenosine. Basic Res Cardiol. 1985;80:515–529.[Medline] [Order article via Infotrieve]
11.
Sexl V, Mancusi G, Holler C, Gloria Maercker E,
Schutz W, Freissmuth M. Stimulation of the
mitogen-activated protein kinase via the A2A-adenosine
receptor in primary human endothelial cells.
J Biol Chem. 1997;272:5792–5799.
12.
Meininger CJ, Schelling ME, Granger HJ.
Adenosine and hypoxia stimulate proliferation and
migration of endothelial cells. Am J
Physiol. 1988;255:H554–H562.
13. Sexl V, Mancusi G, Baumgartner Parzer S, Schutz W, Freissmuth M. Stimulation of human umbilical vein endothelial cell proliferation by A2-adenosine and beta 2-adrenoceptors. Br J Pharmacol. 1995;114:1577–1586.[Medline] [Order article via Infotrieve]
14.
Ethier MF, Chander V, Dobson JG Jr.
Adenosine stimulates proliferation of human
endothelial cells in culture. Am J
Physiol. 1993;265:H131–H138.
15. Hudlicka O, Wright A, Ziada A. Angiogenesis in the heart and skeletal muscle. Can J Cardiol. 1986;2:120–123.[Medline] [Order article via Infotrieve]
16.
Van Daele P, Van Coevorden A, Roger PP, Boeynaems
JM. Effects of adenine nucleotides on the proliferation of
aortic endothelial cells. Circ Res. 1992;70:82–90.
17.
Adair T, Montani J, Strick D, Guyton A. Vascular
development in chick embryos: a possible role for adenosine.
Am J Physiol. 1989;256:H240–H246.
18. Shryock J, Belardinelli L. Adenosine and adenosine receptors in the cardiovascular system: biochemistry, physiology, and pharmacology. Am J Cardiol. 1997;79:2–10.
19. Fredholm BB, Abbracchio MP, Burnstock G, Daly JW, Harden TK, Jacobson KA, Leff P, Williams M. Nomenclature and classification of purinoceptors. Pharmacol Rev. 1994;46:143–156.[Medline] [Order article via Infotrieve]
20. Collis M, Hourani S. Adenosine receptor subtypes. Trends Pharmacol Sci. 1993;14:360–366.[Medline] [Order article via Infotrieve]
21.
Stiles G. Adenosine receptors.
J Biol Chem. 1992;267:6451.
22.
Belardinelli L, Shryock J. Does adenosine
function as a retaliatory metabolite in the heart? News Physiol
Sci. 1992;7:52–56.
23. Frank RN. On the pathogenesis of diabetic retinopathy: a 1990 update. Ophthalmology. 1991;98:586–593.[Medline] [Order article via Infotrieve]
24. Miller JW, Adamis AP, Shima DT, D'Amore PA, Moulton RS, O'Reilly MS, Folkman J, Dvorak HF, Brown LF, Berse B. Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model. Am J Pathol. 1994;145:574–584.[Abstract]
25.
Aiello L. Vascular endothelial
growth factor: 20th-century mechanisms, 21st-century therapies.
Invest Ophthalmol Vis Sci. 1997;38:1647–1652.
26. Kirkpatrick CJ, Wagner M, Hermanns I, Klein CL, Kohler H, Otto M, van Kooten TG, Bittinger F. Physiology and cell biology of the endothelium: a dynamic interface for cell communication. Int J Microcirc Clin Exp. 1997;17:231–240.[Medline] [Order article via Infotrieve]
27.
Mukhopadhyay D, Nagy J, Manseau E, Dvorak H.
Vascular permeability factor/vascular endothelial
growth factor-mediated signaling in mouse mesentery vascular
endothelium. Cancer Res. 1998;58:1278–1284.
28.
Gerber H, McMurtrey A, Kowalski J, Yan M, Keyt B,
Dixit V, Ferrara N. Vascular endothelial growth factor
regulates endothelial cell survival through the
phosphatidylinositol 3'-kinase/Akt signal transduction pathway:
requirement for flk-1/kdr activation. J Biol Chem. 1998;273:30336–30343.
29. Miller J, Adamis A, Aiello L. Vascular endothelial growth factor in ocular neovascularization and proliferative diabetic retinopathy. Diabetes Metab Rev. 1997;13:37–50.[Medline] [Order article via Infotrieve]
30. Hanneken A, Lutty GA, McLeod DS, Robey F, Harvey AK, Hjelmeland LM. Localization of basic fibroblast growth factor to the developing capillaries of the bovine retina. J Cell Physiol. 1989;138:115–120.[Medline] [Order article via Infotrieve]
31. Grant MB, King GL. IGF-1 and blood vessels. Diabetes Rev. 1995;3:113–128.
32. Feoktistov I, Sheller J, Vallejo V, Biaggioni I. Immunological identification of adenosine A2B receptors in human lung mast cells. Drug Dev Res. 1996;37:146–150.
33.
Grant MG, Guay C. Plasminogen
activator production by human retinal
endothelial cells of nondiabetic and diabetic origin.
Invest Ophthalmol Vis Sci. 1991;32:53–64.
34.
Shryock JC, Ozeck MJ, Belardinelli L. Inverse
agonists and neutral antagonists of recombinant human A1
adenosine receptors stably expressed in Chinese hamster ovary
cells. Mol Pharmacol. 1998;53:886–893.
35. Tarnuzzer RW, Macauley SP, Farmerie WG, Caballero S, Ghassemifar MR, Anderson JT, Robinson CP, Grant MB, Humphreys-Beher MG, Franzen L, Peck AB, Schultz GS. Competitive RNA templates for detection and quantitation of growth factors, cytokines, extracellular matrix components and matrix metalloproteinases by RT-PCR. Biotechniques. 1996;20:670–674.[Medline] [Order article via Infotrieve]
36. Davis-Cox MI, Turner JN, Szarowski D, Shain W. Phorbol ester-stimulated stellation in primary cultures of astrocytes from different brain regions. Microsc Res Tech. 1994;29:319–327.[Medline] [Order article via Infotrieve]
37.
Shryock J, Snowdy S, Baraldi P, Cacciari B,
Spalluto G, Monopoli A, Ongini E, Baker S, Belardinelli L. A2A
adenosine receptor reserve for coronary vasodilation.
Circulation. 1998;98:711–718.
38.
Belardinelli L, Shryock J, Snowdy S, Zhang Y,
Monopoli A, Lozza G, Ongini E, Olsson R, Dennis D. The A2A
adenosine receptor mediates coronary vasodilation.
J Pharmacol Exp Ther. 1998;284:1066–1073.
39. Daly J, Jacobson K. Adenosine receptors: selective agonists and antagonists. In: Belardinelli L, Pelleg A, eds. Adenosine and Adenine Nucleotides: From Molecular Biology to Integrative Physiology. Boston, Mass: Kluwer Academic Publishers; 1995:157–166.
40.
Takagi H, King G, Ferrara N, Aiello L.
Hypoxia regulates vascular endothelial growth
factor receptor KDR/Flk gene expression through adenosine A2
receptors in retinal capillary endothelial cells.
Invest Ophthalmol Vis Sci. 1996;37:1311–1321.
41.
Takagi H, King GL, Robinson GS, Ferrara N, Aiello
LP. Adenosine mediates hypoxic induction of vascular
endothelial growth factor in retinal pericytes and
endothelial cells. Invest Ophthalmol Vis
Sci. 1996;37:2165–2176.
42.
Feoktistov I, Goldstein AE, Biaggioni I. Role of
p38 mitogen-activated protein kinase and extracellular
signal-regulated protein kinase kinase in adenosine A2B
receptor-mediated interleukin-8 production in human mast cells.
Mol Pharmacol. 1999;55:726–734.
43. Grant MB, Tarnuzzer RW, Davis MI, Caballero S, Spoerri PE, Ozeck MJ, Shryock JC, Belardinelli L. Adenosine activates mitogen activated protein kinase (MAPK) and angiogenic growth factor production in human retinal endothelial cells (HRECs). In: The Endocrine Society 8th Annual Meeting, June 27, 1998; New Orleans, La. Bethesda, Md: The Endocrine Society; 1998. Abstract.
44. Grant MB, Davis MI, Tarnuzzer RW, Caballero S, Belardinelli L. Adenosine mediates human retinal endothelial cell (HREC) chemotaxis, capillary tube formation and stimulatory signaling cascades. Invest Ophthalmol Vis Sci. 1999;40:S616.
45. D'Angelo G, Lee H, Weiner RI. cAMP-dependent protein kinase inhibits the mitogenic action of vascular endothelial growth factor and fibroblast growth factor in capillary endothelial cells by blocking Raf activation. J Cell Biochem. 1997;67:353–366.[Medline] [Order article via Infotrieve]
46.
Wu J, Dent P, Jelinek T, Wolfman A, Weber MJ,
Sturgill TW. Inhibition of the EGF-activated MAP kinase
signaling pathway by adenosine 3',5'-monophosphate.
Science. 1993;262:1065–1069.
47.
Cook SJ, McCormick F. Inhibition by cAMP of
Ras-dependent activation of Raf. Science. 1993;262:1069–1072.
48.
Ray LB, Sturgill TW. Insulin-stimulated
microtubule-associated protein kinase is phosphorylated
on tyrosine and threonine in vivo. Proc Natl Acad Sci
U S A. 1988;85:3753–3757.
49.
Schonwasser DC, Marais RM, Marshall CJ, Parker
PJ. Activation of the mitogen-activated protein
kinase/extracellular signal-regulated kinase pathway by conventional,
novel, and atypical protein kinase C isotypes. Mol Cell
Biol. 1998;18:790–798.
50. Pueyo ME, Chen Y, D'Angelo G, Michael JB. Regulation of vascular endothelial growth factor expression by cAMP in rat aortic smooth muscle cells. Exp Cell Res. 1998;238:354–358.[Medline] [Order article via Infotrieve]
51.
Milanini J, Vinals F, Pouyssegur J, Pages G.
p42/p44 MAP kinase module plays a key role in the transcriptional
regulation of the vascular endothelial growth factor
gene in fibroblasts. J Biol Chem. 1998;273:18165–18172.
52. Alexander SP, Cooper J, Shine J, Hill SJ. Characterization of the human brain putative A2B adenosine receptor expressed in Chinese hamster ovary (CHO.A2B4) cells. Br J Pharmacol. 1996;119:1286–1290.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  M. Mandapathil, M. J. Szczepanski, M. Szajnik, J. Ren, D. E. Lenzner, E. K. Jackson, E. Gorelik, S. Lang, J. T. Johnson, and T. L. Whiteside Increased Ectonucleotidase Expression and Activity in Regulatory T Cells of Patients with Head and Neck Cancer Clin. Cancer Res., October 15, 2009; 15(20): 6348 - 6357. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hellsten, N. Rufener, J. J. Nielsen, B. Hoier, P. Krustrup, and J. Bangsbo Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R975 - R982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Yang, M. Koupenova, D. J. McCrann, K. J. Kopeikina, H. M. Kagan, B. M. Schreiber, and K. Ravid The A2b adenosine receptor protects against vascular injury PNAS, January 15, 2008; 105(2): 792 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Clark, R. Youkey, X. Liu, L. Jia, R. Blatt, Y.-J. Day, G. W. Sullivan, J. Linden, and A. L. Tucker A1 Adenosine Receptor Activation Promotes Angiogenesis and Release of VEGF From Monocytes Circ. Res., November 26, 2007; 101(11): 1130 - 1138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-J. You, C.-H. Yang, J.-S. Huang, M.-S. Chen, and C.-M. Yang Fractalkine, a CX3C Chemokine, as a Mediator of Ocular Angiogenesis Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5290 - 5298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Fang and M. E. Olah Cyclic AMP-Dependent, Protein Kinase A-Independent Activation of Extracellular Signal-Regulated Kinase 1/2 Following Adenosine Receptor Stimulation in Human Umbilical Vein Endothelial Cells: Role of Exchange Protein Activated by cAMP 1 (Epac1) J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1189 - 1200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ryzhov, J. L. McCaleb, A. E. Goldstein, I. Biaggioni, and I. Feoktistov Role of Adenosine Receptors in the Regulation of Angiogenic Factors and Neovascularization in Hypoxia J. Pharmacol. Exp. Ther., February 1, 2007; 320(2): 565 - 572. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Allen-Gipson, J. Wong, J. R. Spurzem, J. H. Sisson, and T. A. Wyatt Adenosine A2A receptors promote adenosine-stimulated wound healing in bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L849 - L855. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Segal, R. Shah, A. Afzal, C. M. Perrault, K. Chang, A. Schuler, E. Beem, L. C. Shaw, S. Li Calzi, J. K. Harrison, et al. Nitric Oxide Cytoskeletal-Induced Alterations Reverse the Endothelial Progenitor Cell Migratory Defect Associated With Diabetes Diabetes, January 1, 2006; 55(1): 102 - 109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. H. Adair Growth regulation of the vascular system: an emerging role for adenosine Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R283 - R296. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Adair An Emerging Role for Adenosine in Angiogenesis Hypertension, November 1, 2004; 44(5): 618 - 620. [Full Text] [PDF]
|
|
|
|
|
|
I. Feoktistov, S. Ryzhov, H. Zhong, A. E. Goldstein, A. Matafonov, D. Zeng, and I. Biaggioni Hypoxia Modulates Adenosine Receptors in Human Endothelial and Smooth Muscle Cells Toward an A2B Angiogenic Phenotype Hypertension, November 1, 2004; 44(5): 649 - 654. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Pan, N.-Q.-N. Nguyen, H. Yoshida, F. Bentzien, L. C. Shaw, F. Rentier-Delrue, J. A. Martial, R. Weiner, I. Struman, and M. B. Grant Molecular Targeting of Antiangiogenic Factor 16K hPRL Inhibits Oxygen-Induced Retinopathy in Mice Invest. Ophthalmol. Vis. Sci., July 1, 2004; 45(7): 2413 - 2419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Spychala, E. Lazarowski, A. Ostapkowicz, L. H. Ayscue, A. Jin, and B. S. Mitchell Role of Estrogen Receptor in the Regulation of Ecto-5'-Nucleotidase and Adenosine in Breast Cancer Clin. Cancer Res., January 15, 2004; 10(2): 708 - 717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Chen, D. B. Jump, M. B. Grant, W. J. Esselman, and J. V. Busik Dyslipidemia, but Not Hyperglycemia, Induces Inflammatory Adhesion Molecules in Human Retinal Vascular Endothelial Cells Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 5016 - 5022. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. D. Khoa, M. C. Montesinos, A. J. Williams, M. Kelly, and B. N. Cronstein Th1 Cytokines Regulate Adenosine Receptors and Their Downstream Signaling Elements in Human Microvascular Endothelial Cells J. Immunol., October 15, 2003; 171(8): 3991 - 3998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Olah and C. C. Caldwell Adenosine Receptors and Mammalian Toll-Like Receptors: Synergism in Macrophages Mol. Interv., October 1, 2003; 3(7): 370 - 374. [Abstract] [Full Text]
|
|
|
|
|
|
A. Afzal, L.C. Shaw, S. Caballero, P.E. Spoerri, A.S. Lewin, D. Zeng, L. Belardinelli, and M.B. Grant Reduction in Preretinal Neovascularization by Ribozymes That Cleave the A2B Adenosine Receptor mRNA Circ. Res., September 19, 2003; 93(6): 500 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Chhokar and A. L. Tucker Angiogenesis: Basic Mechanisms and Clinical Applications Seminars in Cardiothoracic and Vascular Anesthesia, September 1, 2003; 7(3): 253 - 280. [Abstract] [PDF]
|
|
|
|
|
|
M. Fan, W. Qin, and S. J. Mustafa Characterization of adenosine receptor(s) involved in adenosine-induced bronchoconstriction in an allergic mouse model Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1012 - L1019. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Gardner and M. E. Olah Distinct Protein Kinase C Isoforms Mediate Regulation of Vascular Endothelial Growth Factor Expression by A2A Adenosine Receptor Activation and Phorbol Esters in Pheochromocytoma PC12 Cells J. Biol. Chem., April 18, 2003; 278(17): 15421 - 15428. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Feoktistov, S. Ryzhov, A. E. Goldstein, and I. Biaggioni Mast Cell-Mediated Stimulation of Angiogenesis: Cooperative Interaction Between A2B and A3 Adenosine Receptors Circ. Res., March 21, 2003; 92(5): 485 - 492. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Busik, L. K. Olson, M. B. Grant, and D. N. Henry Glucose-Induced Activation of Glucose Uptake in Cells from the Inner and Outer Blood-Retinal Barrier Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2356 - 2363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Montesinos, A. Desai, J.-F. Chen, H. Yee, M. A. Schwarzschild, J. S. Fink, and B. N. Cronstein Adenosine Promotes Wound Healing and Mediates Angiogenesis in Response to Tissue Injury Via Occupancy of A2A Receptors Am. J. Pathol., June 1, 2002; 160(6): 2009 - 2018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Feoktistov, A. E. Goldstein, S. Ryzhov, D. Zeng, L. Belardinelli, T. Voyno-Yasenetskaya, and I. Biaggioni Differential Expression of Adenosine Receptors in Human Endothelial Cells: Role of A2B Receptors in Angiogenic Factor Regulation Circ. Res., March 22, 2002; 90(5): 531 - 538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Burnstock Purinergic Signaling and Vascular Cell Proliferation and Death Arterioscler Thromb Vasc Biol, March 1, 2002; 22(3): 364 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Dubey, D. G. Gillespie, and E. K. Jackson A2B Adenosine Receptors Stimulate Growth of Porcine and Rat Arterial Endothelial Cells Hypertension, February 1, 2002; 39(2): 530 - 535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wothe, A. Hohimer, M. Morton, K. Thornburg, G. Giraud, and L. Davis Increased coronary blood flow signals growth of coronary resistance vessels in near-term ovine fetuses Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R295 - R302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Mino, P. E. Spoerri, S. Caballero, D. Player, L. Belardinelli, I. Biaggioni, and M. B. Grant Adenosine Receptor Antagonists and Retinal Neovascularization in Vivo Invest. Ophthalmol. Vis. Sci., December 1, 2001; 42(13): 3320 - 3324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Joussen, S. Huang, V. Poulaki, K. Camphausen, W.-D. Beecken, B. Kirchhof, and A. P. Adamis In Vivo Retinal Gene Expression in Early Diabetes Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 3047 - 3057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Picano and on behalf of the PISA study group Dipyridamole in chronic stable angina pectoris. A randomized, double blind, placebo-controlled, parallel group study Eur. Heart J., October 1, 2001; 22(19): 1785 - 1793. [Abstract] [PDF]
|
|
|
|
|
|
M. B. Grant, M. I. Davis, S. Caballero, I. Feoktistov, I. Biaggioni, and L. Belardinelli Proliferation, Migration, and ERK Activation in Human Retinal Endothelial Cells through A2B Adenosine Receptor Stimulation Invest. Ophthalmol. Vis. Sci., August 1, 2001; 42(9): 2068 - 2073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Feoktistov, A. E. Goldstein, and I. Biaggioni Cyclic AMP and Protein Kinase A Stimulate Cdc42: Role of A2 Adenosine Receptors in Human Mast Cells Mol. Pharmacol., November 1, 2000; 58(5): 903 - 910. [Abstract] [Full Text]
|
|
|
|
|
|
M. E. Olah and F. L. Roudabush Down-Regulation of Vascular Endothelial Growth Factor Expression after A2A Adenosine Receptor Activation in PC12 Pheochromocytoma Cells J. Pharmacol. Exp. Ther., June 1, 2000; 293(3): 779 - 787. [Abstract] [Full Text]
|
|
|
|
|
|
R. K. Dubey, D. G. Gillespie, H. Shue, and E. K. Jackson A2B Receptors Mediate Antimitogenesis in Vascular Smooth Muscle Cells Hypertension, January 1, 2000; 35(1): 267 - 272. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Feoktistov, A. E. Goldstein, S. Ryzhov, D. Zeng, L. Belardinelli, T. Voyno-Yasenetskaya, and I. Biaggioni Differential Expression of Adenosine Receptors in Human Endothelial Cells: Role of A2B Receptors in Angiogenic Factor Regulation Circ. Res., March 22, 2002; 90(5): 531 - 538. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||