Cellular Biology |
From the Department of Pharmacology (H.O., Y.I., R.I.), Graduate School of Medical Sciences, Kyushu University, and Special Patient Oral Care Unit (H.M.), Kyushu University Dental Hospital, Fukuoka, Japan, and Prince of Wales Medical Research Institute (H.C.), New South Wales, Australia.
Correspondence to Ryuji Inoue, Department of Pharmacology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582, Japan. E-mail inouery{at}pharmaco.med.kyushu-u.ac.jp
| Abstract |
|---|
|
|
|---|
2-fold more permeable than Ca2+, and Cd2+
is a better blocker than Ni2+ (IC50, 6 and
68 µmol/L, respectively). Relatively specific blockers for N-
and P/Q-type Ca2+ channels such as
-conotoxins GVIA and
MVIIC (each 1 µmol/L) and
-agatoxin IVA (1
µmol/L) were ineffective at inhibiting
NI-ICa, whereas nimodipine partially
(10 µmol/L;
40%) and amiloride potently (
75% with 1
mmol/L; IC50; 107 µmol/L) blocked the current.
Although these properties are reminiscent of R-type Ca2+
channels, expression of the
1E mRNA was not detected
using reverse transcriptasepolymerase chain reaction. These results
strongly suggest the predominant presence of NI, high
voltageactivated Ca2+ channels with novel
properties, which may be abundantly expressed in peripheral
small arterioles and contribute to their tone regulation.
Key Words: voltage-dependent Ca2+ channel dihydropyridine insensitivity arteriole tone regulation
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
5 cm long from the ileocecal valve) and attached mesenterium was
carefully excised and pinned stretched on the rubber bottom of a
dissecting dish filled with low Ca2+ (
0.5
mmol/L)containing physiological salt solution
(PSS). The terminal branches of mesenteric artery (40 to 100 µm
in diameter) were cleaned of fats and connective tissues using a fine
scissors and forceps, and from their distal halves short cylindrical
pieces were made. These pieces were then transferred consecutively into
nominally Ca2+-free PSS with and without 2 mg/mL
collagenase (type I; Sigma) and incubated at 35°C for 30
and 45 to 70 minutes, respectively. Single cells were dissociated by
triturating these digested pieces with a large-bore Pasteur pipette in
Ca2+-free PSS and stored at 4°C to 10°C until
use. In the case of a submucosal arteriole, a short segment of
arteriole was carefully excised from the mucosa, and its surface was
cleaned mechanically. This segment was then incubated in
Ca2+-free PSS containing 0.5 mg/mL
collagenase for 10 to 20 minutes at 35°C and triturated
in collagenase-free, Ca2+-free PSS to
thoroughly remove connective tissues and ileal smooth muscle cells
remaining on its surface, using a large-bore Pasteur pipette
(
0.5 mm in orifice diameter). The following cell-dispersion
procedures used were the same as for the terminal mesenteric artery.
Experiments were carried out within 6 hours from the time of cell
isolation. All procedures described above were performed according to
the Guidelines of Local Animal Ethics of Kyushu University.
Electrophysiology
The details of electrophysiological
recordings in this study are very similar to those described
previously.18 Briefly, a low-noise,
high-performance patch clamp amplifier (Axopatch 1D, Axon
Instruments) driven by an IBM-compatible computer (Aptiva) in
conjunction with an A/D, D/A board (TL-1, Axon Instruments) was used to
generate and apply voltage pulses to clamped cells and to record
the corresponding membrane currents. Current signals were low-pass
filtered at 1 kHz and digitized at 2 kHz before being stored on a
computer hard disk. Linear leak subtraction was made using the
hyperpolarizing P/4 or P/2 routine. Under the present experimental
conditions, the series resistance of cells stayed almost constant
throughout the experiment (11±0.4 M
; n=245); 50% to 70% of this
resistance was compensated. All data were analyzed
offline and illustrations made using pClamp version 6.03 (Axon
Instruments) and KaleidaGraph version 3.04 (Hulinks), respectively. All
experiments were performed at room temperature (20°C to
25°C).
Reverse TranscriptasePolymerase Chain Reaction (RT-PCR)
Analysis
Total RNA was isolated from cerebellum or terminal branches of
mesenteric arteries of the guinea pig (either sex, 200 to 250 g),
using the total RNA extraction kit (RNeasy Mini-Kit, Qiagen),
according to the manufacturer's suggestions.
Oligonucleotide primers specific for the
1C and
1E subunits of
VDCCs were designed according to the published calcium channel sequence
or previously reported primer sequence19 20 (see below).
Total RNA (1 µg) was reverse transcribed into cDNA using random
primer (hexamer) and RT (Superscript II, Gibco-BRL) with a reaction
volume of 20 µL. The PCR protocol used was as follows: denaturing at
95°C for 30 seconds, annealing at 50°C
(
1C) or 54°C (
1E)
for 30 seconds, and extension at 72°C for 1 minute, with 20 cycles
for first PCR and 30 cycles for nested PCR. PCR products were
electrophoresed on a 2% agarose gel, stained by ethidium bromide, and
photographed. The sequences of primers were as follows: for
1C, forward, GGAGTTGGACAAGGCTATGAAGGA (first
PCR) and CACCGTCCCATGAGAAGCT (nested PCR), and reverse,
GACCTAGAGAGGCAGAGCGAAGGA (first and nested PCRs); for
1E, forward, CTTCCTGAGGATGACAAGACC (first PCR)
and GAAGTCCATCATGAAGGCCA (nested PCR), and reverse, TCAATGGAAGGCATGTTGG
(first PCR) and AGCAAGCATGACTTCCTCTG (nested PCR).
Solutions
We used a modified Krebs solution containing (in mmol/L)
Na+ 140, K+ 6,
Mg2+ 1.2, Ca2+ 2,
Cl- 151.4, glucose 10, and HEPES 10 (adjusted to
pH 7.4 with Tris base). To obtain elevated Ba2+-
or Ca2+-containing solutions,
Na+ was replaced isosmotically by
Ba2+ or Ca2+. Low
Ca2+containing and
Ca2+-free solutions were made by reducing the
concentration of Ca2+. The
Cs+ internal solution contained (in mmol/L)
Cs+ 140, Mg2+ 2.0,
Cl- 144, phosphocreatine 5,
Na2ATP 1, EGTA 10, and HEPES 10 (adjusted to pH
7.2 with Tris base).
Chemicals
ATP, GTP, HEPES, and EGTA were purchased from Dojin;
nifedipine, nimodipine, diltiazem, verapamil,
amiloride, CdCl2, NiCl2 and
N-methyl-D-glucamine from
Sigma; and
-conotoxin GVIA,
-conotoxin MVIIC, and
-agatoxin
IVA from Calbiochem.
Statistics
All data are expressed as mean±SEM, and 2-tailed paired or
unpaired t tests and the Tukey multiple comparison test were
used where appropriate for statistical evaluation.
| Results |
|---|
|
|
|---|
Figure 1
compares
Ca2+ currents (ICa)
evoked by a depolarizing pulse to 0 mV in the absence and presence of
10 µmol/L nifedipine, between myocytes dissociated
from the proximal, terminal, and submucosal branches of guinea pig
mesenteric artery. Nifedipine differentially affected
ICa. In proximal branches, the majority of
ICa was abolished, whereas in the terminal
and submucosal branches only a minor part was inhibited, leaving a
transient, fast-inactivating component. The magnitude of this NI
component was unaffected by pretreatment with 10 µmol/L
tetrodotoxin or 100 µmol/L DIDS or by substituting external
Na+ and Cl with
N-methyl-D-glucamine and
benzensulfonate, respectively (data not shown), suggesting that the
current is not carried by Na+ and
Cl and is likely to be carried by
Ca2+. As summarized in Figure 1B
, the
fraction of NI-ICa to the global
ICa was significantly larger in submucosal
and terminal than in more proximal branches (98±1%, 87±3%, and
30±3%, respectively). These results strongly suggest that the
NI-ICa may be more abundantly expressed in
the periphery of the mesenteric vasculature.
|
The amplitude of NI-ICa recorded with
the physiological concentration of
Ca2+ (1 to 2 mmol/L) was so small (5 to 20
pA) that its quantitative evaluation was often unreliable because of
poor signal-to-noise ratio. To circumvent this problem, as well as to
avoid secondary complications caused by
Ca2+-induced currents and progressive cell
contracture caused by repeated large amounts of
Ca2+ entry relative to a small cell volume,
external Ca2+ (2 mmol/L) was replaced by a
slightly elevated concentration of Ba2+ (5
mmol/L), a procedure that was reported to enhance the amplitude of
L-type Ca2+ current with little change in its
voltage dependence.21 Indeed, under these ionic
conditions, the amplitude of NI-ICa was
nearly doubled (Figure 2A
a), whereas its
waveform remained almost unchanged (Figure 2A
b), and
corresponding I-V relationships were almost superimposable
when normalized to their peaks (data not shown). In addition, the decay
of NI-ICa did not appreciably change by
replacing Ca2+ with Ba2+
(Figure 2A
b), indicating the absence of
Ca2+-dependent inactivation in this current
component.
|
Concentration dependence of ICa inhibition
by nifedipine was tested with 5 mmol/L
Ba2+ in the bath. As summarized in Figure 2B
, this relationship was well described by a Hill-type equation
with an IC50 of 34 nmol/L. At concentrations
higher than 1 µmol/L or so, no further inhibition was observed.
The IC50 value of 34 nmol/L is comparable with
those reported for L-type Ca2+ channels in other
tissues, suggesting that the nifedipine-sensitive (NS)
component in this preparation reflects a typical L-type
Ca2+ current. In fact, other properties of this
NS component coincided very well with those of L-type
Ca2+ channels (see below), including its rapid
rundown on elimination of nucleotide phosphates from, or
with inclusion of, 5 mmol/L F in the patch
pipette (Figure 2C
).11 In contrast, the NI
component stayed relatively resistant to these procedures
(Figure 2C
, ). Thus, progressive convergence of NI and
rundown-resistant components of global
ICa was observed, both of which eventually
became indistinguishable (Figure 2C
); the maximally effective
concentrations of nifedipine (1 or 10 µmol/L) did
not exert any effects on remaining ICa
(101±1% of control; n=5). These results strongly indicate that the
component of global ICa insensitive to
nifedipine does not represent a residual L-type
Ca2+ current that was impartially blocked by this
compound, thus validating the specificity of nifedipine as
a tool to separate putative NI-Ca2+ channels from
L-type Ca2+ channels in the present
preparation.
NI-ICa Is an HVA Ca2+
Channel
Figure 3
shows typical
I-V relationships of IBa in the
absence and presence of 10 µmol/L nifedipine
(holding potential, -100 mV; Figure 3A
), together with that of
the latter (NI-IBa) averaged from 5 to 8
different cells (Figure 3B
; holding potential, -60 or -100
mV). Regardless of holding potential, activation of
NI-IBa was detectable at a potential above
-50 mV and its peak found around -10 mV. On the other hand, the
I-V relationship for NS-IBa
showed a slightly more positive activation threshold and peak, but
these differed by no more than 10 mV, compared with
NI-IBa (dotted curve in Figure 3A
).
Accordingly, the relationships between the degree of activation and the
membrane potential of NS-IBa (Figure 4A
,
) and
NI-IBa (Figure 4A
, ) exhibited a
similar sigmoidal pattern; Boltzmann fitting of these relationships
gave similar values for the 50% activation potential and slope factor
(-15.5 and -8.4 mV for NS-IBa,
respectively [dotted curve in Figure 4A
]; -11.0 and -11.3 mV
for NI-IBa, respectively [solid curve in
Figure 4A
]). These results strongly indicate that the channels
underlying NI-IBa would pertain to a class
of HVA-VDCCs.
|
|
Voltage Dependence of Activation and Deactivation Kinetics
Activation of NI-IBa was rapid (of the
order of milliseconds) and accelerated by stronger depolarizations (for
actual traces see Figures 2A
, 3B
, and 5A
). As
summarized in Figure 4B
(solid curve), the time required for
10% to 90% activation was markedly dependent on the membrane
potential (13±2 ms at -30 mV versus 4±1 ms at 20 mV), decreasing
e-fold by 48.2 mV. Similarly, the deactivating time course of
NI-IBa evaluated by single exponential
fitting of tail currents showed a clear dependence on the membrane
potential (Figure 5A
). By reducing the
degree of hyperpolarization from a preceding short
depolarization to 20 mV, the time constant of deactivation was
increased e-fold by 22.9 mV (Figure 5B
).
|
Fast and Slow Inactivation Kinetics of
NI-IBa
When the pulse duration was set longer than
20 ms, the
NI-IBa exhibited a fast, monophasic
inactivation (for actual traces, see, eg, Figure 3B
). As has
already been described above, this time course was not appreciably
affected by replacing Ba2+ with
Ca2+ (Figure 2A
b), excluding the
involvement of the Ca2+-dependent mechanism. This
inactivation was complete at potentials more positive than -10 mV
during the first 100-ms depolarization (Figure 6A
), and its time constant
(evaluated by single exponential fitting) was
30 ms at 20 mV and was
relatively unchanged over a wide range of membrane potentials (e-fold
change per 102.1 mV; Figure 6B
). This sharply contrasts with a
marked voltage dependence of activation and deactivation time constants
(Figures 4B
and 5B
). Figure 6A
shows the
inactivation curves of NI-IBa obtained with
3 conditioning pulses of different lengths (100 ms, 1 second, and 10
seconds), in which prolonged pulse duration shifted the curve toward
more negative potentials. The 50% inactivation potentials evaluated by
Boltzmann fitting were -30.9, -38.5, and -52.3 mV, respectively,
suggesting the existence of another much longer inactivation state, of
the order of seconds. Fast and complete inhibition of
NI-IBa is entirely different from those of
NS-IBa, which inactivates
incompletely and more slowly in a similar range of membrane
potentials.
|
Superimposing the activation and steady-state inactivation curves
reveals the existence of a potential range at which
NI-IBa would constantly flow (ie, window
current). This range is apparent between approximately -60 and -30
mV, being almost overlapping that of the
physiological membrane potential (solid and dotted
curves in Figure 6A
; see Discussion).
Recovery of a major part of NI-IBa
(
90%) from inactivation was completed within several hundreds of
milliseconds, the time course of which could be described by a single
exponential with a time constant of
100 ms at -80 mV (Figure 6C
). In addition, there appeared to be another slow recovery
phase explaining the remaining
10% of recovery that proceeded with
a time constant of the order of seconds. The time constant of initial
fast recovery was considerably shorter than that typical for
NS-Ca2+ currents (data not shown).
Effects of Increased Divalent Cation Concentration and Anomalous
Mole-Fraction Dependence
Raising the concentration of Ba2+ or
Ca2+ in the bath increased the amplitude of NI
current with a positive shift in activation threshold and a peak of its
I-V relationship (Figure 7A
).
For Ba2+, the degree of shift was
20 mV with a
concentration change from 2 to 30 mmol/L. A similar degree of the
shift of I-V relationship was also observed for
Ca2+, although the peak of its I-V
relationship was smaller than that of Ba2+ (not
shown). At a concentration of 30 mmol/L, the magnitude of
NI-ICa was about twice smaller than that of
NI-IBa (0.56±0.11; n=5).
|
The NI current showed a complex dependence on the concentration of
Ba2+ and Ca2+ when both
cations were mixed (Figure 7B
). By changing the molar ratio of
Ba2+ to Ca2+ while keeping
the sum of their concentrations at 10 mmol/L, the amplitude of the
mixed current became minimal with the ratio of 8:2, even though
Ba2+ can carry a larger current than
Ca2+ when each cation is present alone
(leftmost versus rightmost circles in Figure 7B
). This
phenomenon, called anomalous mole-fraction dependence,22
together with the results described in the preceding paragraph,
indicates some interaction of permeating ions
(Ba2+ and Ca2+) at multiple
binding sites in the channel pore that has commonly been observed for
other types of HVA Ca2+.23 24
Inorganic and Organic Blockers
To further clarify similarities and differences between the
NI-Ca2+ channels in our preparation and other
types of VDCCs, the effects of known VDCC blockers were tested. Figure 8A
shows the concentration-inhibition
curve of NI-IBa for
Cd2+ and Ni2+, with 5
mmol/L Ba2+ as the charge carrier. The
IC50 values evaluated by Hill analysis
were 5.8 and 68 µmol/L with a similar cooperativity factor of
approximately unity for Cd2+ and
Ni2+, respectively, suggesting a
10-fold
greater efficacy of Cd2+.
|
In the next series of experiments, the inhibitory effects
of several widely used L-type Ca2+ channel
blockers other than nifedipine on
NI-IBa were investigated. Two structurally
unrelated L-channel blockers to DHP, verapamil and
diltiazem, suppressed IBa dose dependently,
but no more than nifedipine, at a concentration as high as
100 µmol/L (P>0.05 with the Tukey test; Figure 8B
). In contrast, another potent DHP compound, nimodipine
(10 µmol/L), which has been reported to suppress T-type
Ca2+ channels as well,25
further decreased the amplitude of the NI part of
IBa by
40% (P<0.01 with
unpaired t test; Figure 8B
). A similar extent of
inhibition by 10 µmol/L nimodipine was also observed when
IBa was recorded with 5 mmol/L
internal solution containing F (data not
shown). In addition, amiloride, a well-known potent blocker of T-type
Ca2+ currents, dose-dependently inhibited the
NI-IBa (Figure 8A
;
IC50, 107 µmol/L), but in this case,
complete inhibition was not observed up to a
concentration of 2 mmol/L.
In a final series of experiments, several peptide toxins known to block
various types of HVA Ca2+ currents
(
-conotoxins GVIA and MVIIC and
-agatoxin IVA) were tested.
However, none of these were found to affect the
NI-IBa recorded with 5 mmol/L
Ba2+ (Figure 8B
).
RT-PCR
The above results strongly suggest that the
Ca2+ channels underlying
NI-IBa may be homologous to "R-type"
channels (for details, see Discussion). Thus, we explored possible
expression of its molecular counterpart
1E
subunit in comparison with that of the
1C
subunit, which is likely to be expressed as the NS component, but to a
lesser extent, in the present preparation (see Figure 1
).
Figure 9
shows an ethidium bromide
staining of RT-PCR products obtained from the total RNA of guinea
pig cerebellum or terminal branches of mesenteric arteries. The
products of both Ca2+ channel
1C and
1E subunits
could be detected in the cerebellum (C lanes in Figure 9
),
whereas only the
1C was positive in the
terminal branches of mesenteric artery, using the same primers (MA lane
in left panel of Figure 9
).
|
| Discussion |
|---|
|
|
|---|
-conotoxins
GVIA and MVIIC and
-agatoxin IVA) is obviously incompatible with the
involvement of L-, N- or P/Q-type Ca2+ channels,
and the relatively high sensitivities of
NI-IBa to nimodipine and amiloride does not
fit with "typical" R-type Ca2+ channels.
|
|
Recent cloning and expression studies have disclosed that the major
properties of VDCCs such as divalent cation permeation/block and
pharmacological sensitivities to drugs such as the DHPs (but see
Reference 3737 ) and peptide toxins would be conferred exclusively by the
structural differences in the
1 subunit that
not only forms the ion conductive pore but also contains the binding
sites for various blockers and agonists. In contrast, the current
amplitude (thus, the number of channels inserted in the cell membrane)
and the gating properties (ie, activation and inactivation kinetics) of
VDCCs could strongly be modified by other auxiliary subunits, ß and
2-
subunits.36 38 For example,
it has been reported that coexpression of distinct ß subunits with
the
1A,
1B, or
1E subunit results in a markedly enhanced
current amplitude and a variable extent of hyperpolarizing shifts
in activation and steady-state inactivation curves with significantly
altered kinetics.30 32 38 39 40 In light of these molecular
data, the apparently confounding properties of
NI-Ca2+ channels described above could be
explained by the following interpretation. The putative
1 subunit responsible for the
NI-Ca2+ channels would be homologous to those
constituting HVA-VDCCs (ie,
1C,
1D,
1S,
1B,
1A, or
1E) and devoid of the sequence essential for
binding to DHP and toxins, because the observed properties
representing the pore structure and blocker sensitivities
are clearly of HVA type (see above) (Table![]()
). On the other hand,
an apparent resemblance of NI-Ca2+ channels to
T-type Ca2+ channels in gating kinetics and
pharmacology such as relatively slow rates of activation and
deactivation (millisecond order), the presence of fast and slow phases
of inactivation,11 and partial sensitivities to nimodipine
and amiloride would not necessarily reflect their essential
similarities in the primary structure of the
1
subunit but could to some extent be accounted for by complex
interactions between the
1 and auxiliary
subunits. It may thus be reasonable to speculate that the most closely
related member of VDCCs to the NI-Ca2+ channels
in the present study is the R-type Ca2+
channel (or its most likely molecular counterpart, the
1E subunit), and some differences found
between them such as differential deactivation rates (millisecond
versus submillisecond) and sensitivities to nimodipine or amiloride
(intermediate versus null or low) may be attributable to a rather broad
diversity of R-type Ca2+ channels or
1E subunits (Table![]()
). However, the
results of RT-PCR do not simply support this possibility. Using the
specific primers discriminating the
1C and
1E subunits in cerebellum, only the
1C subunit, which seems functionally less
abundantly expressed (Figure 1
), was detected in the terminal
branches of mesenteric artery (Figure 9
). Although inadequacy of
the primers used for detecting the
1E mRNA in
the present preparation remains to be excluded, the most
intriguing possibility is that an entirely new
1 subunit encoded by a yet-to-be-identified
gene(s) or a novel isoform of the
1 subunit
produced by alternative RNA splicing from known NI-HVA
1-encoding genes (eg,
1B,
1A, or
1E) might be abundantly expressed in the
periphery of mesenteric circulation. Moreover, if alternative splicing
could alter the properties of VDCC
1 subunit
such as DHP sensitivity37 and voltage dependence more
dramatically than currently envisaged, the involvement of
1C,
1G, or
1H could not be completely excluded either. A
more extensive database on single-channel recording and
molecular technologies will be necessary to distinguish between these
possibilities.
Possible Physiological Implications
Despite its rapidly inactivating nature, a significant overlap of
activation and steady-state inactivation curves of
NI-IBa strongly suggest that there is a
range of membrane potentials in which a small but significant magnitude
of Ca2+ current would continuously flow (Figure 6A
). This noninactivating current, the
so-called "window current," would not be an "artifact" because
of the use of 5 mmol/L Ba2+ as a charge
carrier, given that substitution of Ca2+ with
Ba2+ did not significantly affect the
inactivation time course (Figure 2A
b) and the observed
I-V relationship with 5 mmol/L
Ba2+ was comparable to that with the
physiological concentration of
Ca2+ (2 mmol/L) (see Results; see
also Reference 2121 ). The predicted range of window current (Figure 6A
) would overlap the physiological range of
membrane potential of VSMCs (-75 to 50 mV),1 and its
magnitude would change severalfold by small changes in this potential
range. For example, a
5-fold increase (from 0.1 to 0.5 pA) is
expected with a potential change from -80 to -50 mV, taking the mean
current density of 1.6 pA/pF at -10 mV (Figure 3B
), capacitance
of 13.6 pF, and the parameters for activation and
inactivation. This means that small depolarizations or
hyperpolarizations caused by neurotransmitters and
other vasoactive substances, such as noradrenaline,
calcitonin generelated peptide, vasoactive intestinal peptide,
and endothelin,1 2 9 could significantly alter the rate of
Ca2+ influx through NI-Ca2+
channels, thereby profoundly affecting the
[Ca2+]i of arteriolar
smooth muscle cells, which have an extremely small cell volume (of the
order of subpicoliters). This is strikingly similar to the postulated
role of L-type Ca2+ channels in tone regulation
of more proximal and larger-sized arteries.4 In addition,
our preliminary data have suggested that NI-Ca2+
currents showing almost identical properties to the
NI-Ca2+ current in the present study may also
exist in the rabbit and rat terminal mesenteric arteries (H. Morita et
al, unpublished data, 1999). This fact, combined with our
observation that the fraction of NI-Ca2+ channels
appears to approach 100% in the more peripheral branches
of mesenteric artery, may further imply an intriguing role of these
channels, together with L-type Ca2+
channels,41 for regulating the small arteriolar
circulation.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received March 22, 1999; accepted July 13, 1999.
| References |
|---|
|
|
|---|
2. Lundberg JM. Pharmacology of cotransmission in the autonomic nervous system: integrative aspects on amines, neuropeptides, adenosine trisphosphate, amino acids and nitric oxide. Pharmacol Rev. 1996;48:113178.[Medline] [Order article via Infotrieve]
3.
Meininger GA, Davis MJ. Cellular mechanisms
involved in the vascular myogenic response. Am J
Physiol. 1992;263:H647H659.
4.
Nelson MT, Patlak JB, Worley JF, Standen NB. Calcium
channels, potassium channels, and voltage dependence of
arterial smooth muscle tone. Am J Physiol. 1990;259:C3C18.
5. Knot HJ, Nelson MT. Regulation of arterial diameter and wall [Ca2+]i in cerebral arteries of rat by membrane potential and intravascular pressure. J Physiol (Lond). 1998;598:199209.
6.
McCarron JG, Crichton CA, Langton PD, Mackenzie A,
Smith GL. Myogenic contraction by modulation of voltage-dependent
calcium currents in isolated rat cerebral arteries. J
Physiol (Lond). 1997;498:371379.
7.
Nelson MT, Worley JF.
Dihydropyridine inhibition of single calcium
channels and contraction in rabbit mesenteric artery depends on
voltage. J Physiol (Lond). 1989;412:6591.
8. Guyton AC, Hall JE. Overview of the circulation: medical physics of pressure, flow, and resistance. Chapter 14. In: Guyton AC, Hall JE, eds. Textbook of Medical Physiology. Philadelphia, Pa: WB Saunders Co Inc; 1996:161169.
9.
Hirst GDS, Edwards FR. Sympathetic neuroeffector
transmission in arteries and arterioles. Physiol Rev. 1989;69:546604.
10. Morita H, Inoue R, Cousins H, Ito Y. Dihydropyridine (DHP)-insensitive high-voltage activated (HVA) Ca2+ currents in the guinea-pig mesenteric arteriole. Jpn J Pharmacol. 1999;79(suppl I):40P.
11.
Akaike N, Kanaide H, Kuga T, Nakamura M, Sadoshima J,
Tomoike H. Low-voltage-activated calcium current in rat aorta
smooth muscle cells in primary culture. J Physiol
(Lond). 1989;416:141160.
12. Benham CD, Hess P, Tsien RW. Two types of calcium channels in single smooth muscle cells from rabbit ear artery studied with whole-cell and single-channel recordings. Circ Res. 1987;61(suppl I):I-10I-16.
13. Friedman ME, Suarez-Kurtz G, Kaczorowski J, Katz GM, Reuben JP. Two calcium currents in a smooth muscle cell line. Am J Physiol. 1986;250:H699H703.
14.
Ganitkevich VYA, Isenberg G.
Contribution of two types of calcium channels to membrane conductance
of single myocytes from guinea-pig coronary artery.
J Physiol (Lond). 1990;426:1942.
15.
Loirand G, Mironneau C, Mironneau J, Pacaud P. Two
types of calcium currents in single smooth muscle cells from rat portal
vein. J Physiol (Lond). 1989;412:333349.
16.
Smirnov SV, Aaronson PI. Ca2+
currents in single myocytes from human mesenteric arteries: evidence
for a physiological role of L-type channels.
J Physiol (Lond). 1992;457:455475.
17.
Yatani A, Seidel CL, Allen J, Brown AM. Whole-cell and
single-channel calcium currents of isolated smooth muscle cells from
saphenous vein. Circ Res. 1987;60:523533.
18.
Waniishi Y, Inoue R, Morita H, Teramoto N, Abe K, Ito
Y. Cyclic GMP-dependent but G-kinase-independent inhibition of
Ca2+-dependent Cl
currents by NO donors in cat tracheal smooth muscle. J
Physiol (Lond). 1998;511:719731.
19.
Borman B, Lakaye B, Minet A, Zorzi W, Vergnes M,
Marescaux C, Grisar T. Expression of mRNA encoding
1E and
1G
subunit in the brain of a rat model of absence epilepsy.
NeuroReport. 1999;10:569574.[Medline]
[Order article via Infotrieve]
20.
Wyatt CN, Page KM, Berrow NS, Brice NL, Dolphin AC. The
effect of overexpression of auxiliary Ca2+
channel subunits on native Ca2+ channel currents
in undifferentiated mammalian NG10815 cells. J Physiol
(Lond). 1998;510:347360.
21.
Ganitkevich VYA, Shuba MF, Smirnov SV. Saturation of
calcium channels in single isolated smooth muscle cells of guinea-pig
taenia caeci. J Physiol (Lond). 1988;399:419436.
22. Hille B. Selective permeability: saturation and binding. Chapter 14. In: Ion Channels of Excitable Membrane. 2nd ed. Sunderland, Mass: Sinauer Associates, Inc; 1992.
23. Hess P, Tsien RW. Mechanism of ion permeation through calcium channels. Nature. 1984;309:453456.[Medline] [Order article via Infotrieve]
24.
Wakamori M, Strobec M, Niidome T, Teramoto T, Imoto K,
Mori Y. Functional characterization of ion permeation pathway in the
N-type Ca2+ channel. J
Neurophysiol. 1998;79:622634.
25. Randall AD, Tsien RW. Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology.. 1997;36:879893.[Medline] [Order article via Infotrieve]
26.
Tohse N, Masuda H, Sperelakis N. Novel isoform of
Ca2+ channel in rat fetal
cardiomyocytes. J Physiol (Lond). 1992;451:295306.
27. Ellinor PT, Zhang JF, Randall AD, Zhou M, Scharz TL, Tsien RW, Horne WA. Functional expression of a rapidly inactivating neuronal calcium channel. Nature. 1993;363:455458.[Medline] [Order article via Infotrieve]
28. Zhang JF, Randall AD, Ellinor PT, Horne WA, Sather WA, Tanabe T, Scharz T, Tsien RW. Neuropharmacology. 1993;32:10751088.[Medline] [Order article via Infotrieve]
29.
Soong TW, Stea A, Hodson CD, Dubel SJ, Vincent SR,
Snutch TP. Structure and functional expression of a member of the low
voltage-activated calcium channel family. Science. 1993;260:11331136.
30.
Stephens GJ, Page KM, Burley JR, Berrow NS, Dolphin AC.
Functional expression of rat brain cloned
1E calcium channels
in COS-7 cells. Pflugers Arch. 1997;433:523532.[Medline]
[Order article via Infotrieve]
31. Wakamori M, Niidome T, Furutama D, Furuichi T, Mikoshiba K, Fujita Y, Tanaka I, Katayama K, Yatani A, Schartz A, Mori Y. Distinctive functional properties of the neuronal BII (Class E) calcium channel. Receptors and Channels. 1994;2:303314.[Medline] [Order article via Infotrieve]
32.
Williams ME, Marubio LM, Deal CR, Hans M, Brust PF,
Philipson LH, Miller RJ, Johnson EC, Harpold MM, Ellis SB. Structure
and functional characterization of neuronal
1E calcium channel subtypes. J Biol
Chem. 1994;269:2234722357.
33. Nooney JM, Lambert RC, Feltz A. Identifying neuronal non-L Ca2+ channels: more than stamp collecting? Trends Pharmacol Sci. 1997;18:363371.[Medline] [Order article via Infotrieve]
34. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, Lee JH. Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature. 1998;391:896900.[Medline] [Order article via Infotrieve]
35.
Cribbs LL, Lee JH, Yang J, Satin J, Zhang Y, Daud A,
Barclay J, Williamson MP, Fox M, Rees M, Perez-Reyes E. Cloning and
characterization of
1H from human heart,
a member of the T-type Ca2+ channel gene family.
Circ Res. 1998;83:103109.
36. Mori Y, Mikala G, Kobayashi T, Koch S, Wakamori M, Schwarz A. Molecular pharmacology of voltage-dependent calcium channels. Jpn J Pharmacol. 1996;72:83109.[Medline] [Order article via Infotrieve]
37.
Welling A, Kwan YW, Bosse E, Flockerzi V, Hofmann F,
Kass RS. Subunit-dependent modulation of recombinant L-type calcium
channels: molecular basis for dihydropyridine
tissue selectivity. Circ Res. 1993;73:974980.
38. Walker D, Waard MD. Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function. Trends Neurosci. 1998;21:148154.[Medline] [Order article via Infotrieve]
39.
Stephens GJ, Brice NL, Berrow NS, Dolphin AC.
Facilitation of rabbit
1B calcium
channels: involvement of endogenous Gß
subunits.
J Physiol (Lond). 1998;509:1527.
40.
Waard MD, Campbell KP. Subunit regulation of the
neuronal
1A Ca2+
channel expressed in Xenopus oocytes. J Physiol
(Lond). 1995;485:619634.
41.
Bowles DK, Hu Q, Laughlin MH, Sturek M. Exercise
training increases L-type calcium current density in coronary
smooth muscle. Am J Physiol. 1998;275:H2159H2169.
This article has been cited by other articles:
![]() |
E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald Voltage-dependent calcium channels of dog basilar artery J. Physiol., April 15, 2007; 580(2): 523 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Z. Xu, G. Boulay, R. Flemming, and D. J. Beech E3-targeted anti-TRPC5 antibody inhibits store-operated calcium entry in freshly isolated pial arterioles Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2653 - H2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Kovac, H. G. Preiksaitis, and S. M. Sims Functional and molecular analysis of L-type calcium channels in human esophagus and lower esophageal sphincter smooth muscle Am J Physiol Gastrointest Liver Physiol, December 1, 2005; 289(6): G998 - G1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishiguro, T. L. Wellman, A. Honda, S. R. Russell, B. I. Tranmer, and G. C. Wellman Emergence of a R-Type Ca2+ Channel (CaV 2.3) Contributes to Cerebral Artery Constriction After Subarachnoid Hemorrhage Circ. Res., March 4, 2005; 96(4): 419 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pucovsky, R. F Moss, and T. B Bolton Non-Contractile Cells with Thin Processes Resembling Interstitial Cells of Cajal Found in the Wall of Guinea-Pig Mesenteric Arteries J. Physiol., October 1, 2003; 552(1): 119 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Perez-Reyes Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels Physiol Rev, January 1, 2003; 83(1): 117 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Salomonsson, F. Gustafsson, D. Andreasen, B. L. Jensen, and N.-H. Holstein-Rathlou Local electric stimulation causes conducted calcium response in rat interlobular arteries Am J Physiol Renal Physiol, September 1, 2002; 283(3): F473 - F480. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chul Kim, S. Don Koh, and K. M Sanders Voltage-dependent inward currents of interstitial cells of Cajal from murine colon and small intestine J. Physiol., June 15, 2002; 541(3): 797 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
R E Haddock, G D S Hirst, and C E Hill Voltage independence of vasomotion in isolated irideal arterioles of the rat J. Physiol., April 1, 2002; 540(1): 219 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Morita, T. Sharada, T. Takewaki, Y. Ito, and R. Inoue Multiple regulation by external ATP of nifedipine-insensitive, high voltage-activated Ca2+ current in guinea-pig mesenteric terminal arteriole J. Physiol., March 15, 2002; 539(3): 805 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Eto, Y. Ohya, Y. Nakamura, I. Abe, and M. Iida Intracellular Angiotensin II Stimulates Voltage-Operated Ca2+ Channels in Arterial Myocytes Hypertension, February 1, 2002; 39(2): 474 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Sanders Signal Transduction in Smooth Muscle: Invited Review: Mechanisms of calcium handling in smooth muscles J Appl Physiol, September 1, 2001; 91(3): 1438 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Hill, H. Zou, S. J. Potocnik, G. A. Meininger, and M. J. Davis Signal Transduction in Smooth Muscle: Invited Review: Arteriolar smooth muscle mechanotransduction: Ca2+ signaling pathways underlying myogenic reactivity J Appl Physiol, August 1, 2001; 91(2): 973 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gustafsson, D. Andreasen, M. Salomonsson, B. L. Jensen, and N.-H. Holstein-Rathlou Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca2+ channels Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H582 - H590. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Hansen, B. L. Jensen, D. Andreasen, U. G. Friis, and O. Skott Vascular Smooth Muscle Cells Express the {alpha}1A Subunit of a P-/Q-Type Voltage-Dependent Ca2+Channel, and It Is Functionally Important in Renal Afferent Arterioles Circ. Res., November 10, 2000; 87(10): 896 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pignier and D. Potreau Characterization of nifedipine-resistant calcium current in neonatal rat ventricular cardiomyocytes Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2259 - H2268. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Evans and C. H. Gelband A Novel Ca2+ Channel in Vascular Smooth Muscle? Circ. Res., October 1, 1999; 85(7): 651 - 652. [Full Text] [PDF] |
||||
![]() |
R E Haddock, G D S Hirst, and C E Hill Voltage independence of vasomotion in isolated irideal arterioles of the rat J. Physiol., April 1, 2002; 540(1): 219 - 229. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |