This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Morita, H. Articles by Inoue, R. Search for Related Content PubMed PubMed Citation Articles by Morita, H. Articles by Inoue, R. Related Collections Animal models of human disease Ion channels/membrane transport Coronary circulation

(Circulation Research. 1999;85:596-605.)
© 1999 American Heart Association, Inc.

Cellular Biology

Predominant Distribution of Nifedipine-Insensitive, High Voltage–Activated Ca²⁺ Channels in the Terminal Mesenteric Artery of Guinea Pig

Hiromitsu Morita¹, Helen Cousins¹, Hitoshi Onoue, Yushi Ito, Ryuji Inoue

From the Department of Pharmacology (H.O., Y.I., R.I.), Graduate School of Medical Sciences, Kyushu University, and Special Patient Oral Care Unit (H.M.), Kyushu University Dental Hospital, Fukuoka, Japan, and Prince of Wales Medical Research Institute (H.C.), New South Wales, Australia.

Correspondence to Ryuji Inoue, Department of Pharmacology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582, Japan. E-mail inouery{at}pharmaco.med.kyushu-u.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—We have found nifedipine-insensitive (NI), rapidly inactivating, voltage-dependent Ca²⁺ channels (current, NI-I_Ca) with unique biophysical and pharmacological properties in the terminal branches of guinea pig mesenteric artery, by using a whole-cell mode of the patch-clamp technique. The fraction of NI-I_Ca appeared to increase dramatically along the lower branches of mesenteric artery, amounting to almost 100% of global I_Ca in its periphery. With 5 mmol/L Ba²⁺ as the charge carrier, NI-I_Ca was activated with a threshold of -50 mV, peaked at -10 mV, and was half-activated and inactivated at -11 and -52 mV, respectively, generating a potential range of constant activation near the resting membrane potential. The NI-I_Ca was rundown resistant, was not subject to Ca²⁺-dependent inactivation, and exhibited the pore properties typical for high voltage–activated Ca²⁺ channels; Ba²⁺ is 2-fold more permeable than Ca²⁺, and Cd²⁺ is a better blocker than Ni²⁺ (IC₅₀, 6 and 68 µmol/L, respectively). Relatively specific blockers for N- and P/Q-type Ca²⁺ channels such as -conotoxins GVIA and MVIIC (each 1 µmol/L) and -agatoxin IVA (1 µmol/L) were ineffective at inhibiting NI-I_Ca, whereas nimodipine partially (10 µmol/L; 40%) and amiloride potently (75% with 1 mmol/L; IC₅₀; 107 µmol/L) blocked the current. Although these properties are reminiscent of R-type Ca²⁺ channels, expression of the _1E mRNA was not detected using reverse transcriptase–polymerase chain reaction. These results strongly suggest the predominant presence of NI, high voltage–activated Ca²⁺ channels with novel properties, which may be abundantly expressed in peripheral small arterioles and contribute to their tone regulation.

Key Words: voltage-dependent Ca²⁺ channel • dihydropyridine insensitivity • arteriole • tone regulation

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The vascular tone or the resistance of the systemic circulation is dynamically controlled by changes in the intravascular pressure as well as by many vasoactive substances released from autonomic nerves, endocrine organs, and endothelial cells.^{1 2 3} The mechanism involved in this regulation seems to result, in part, from depolarization or hyperpolarization of the vascular smooth muscle (VSM) membrane, which in turn alters the rate of Ca²⁺ entry into, and the intracellular Ca²⁺ concentration ([Ca²⁺]_i) of, VSM cells (VSMCs).^{3 4} With respect to possible pathways for such Ca²⁺ entry, the importance of dihydropyridine (DHP)–sensitive, high voltage–activated (HVA) L-type Ca²⁺ channels has been emphasized, mainly on the basis of the ubiquity of these channels over the whole vascular tree and high susceptibility of vascular tone or diameter to L type–specific blockers, including DHPs.^{4 5 6 7} However, most of these studies were restricted (probably for technical reasons) to relatively proximal arteries having a diameter typically ranging between 100 and 1000 µm, with walls that contained more than a single layer of smooth muscle cells (eg, Reference 3³ ). On the other hand, it is well recognized that the systemic blood pressure falls most sharply in the region of smaller, higher-order resistant arterioles that undergo denser autonomic innervation such as from sympathetic nerves.^{8 9} These facts raise the possibility that Ca²⁺-permeable channels other than L-type Ca²⁺ channels might more importantly contribute to the tone regulation of smaller arterioles. Indeed, we have very recently found that in submucosal arterioles of the guinea pig ileum and in terminal branches of the mesenteric artery, the density of nifedipine-insensitive (NI), voltage-dependent Ca²⁺ currents (or channels; VDCCs) is unexpectedly large.¹⁰ Although DHP-insensitive, transient, or T-type VDCCs have already been identified in several distinct types of VSM,^{11 12 13 14 15 16 17} they appear to be expressed much less abundantly than L-type Ca²⁺ channels (but see Reference 11¹¹ , rat aortic cells in primary culture) and their precise physiological role remains elusive.⁴ The present study was therefore undertaken to characterize the putative NI-VDCCs in small branches of mesenteric circulation of the guinea pig, in terms of patch-clamp experiments. To this end, the terminal branch of mesenteric artery rather than submucosal arterioles was chosen to ease the difficulty of experiments as well as to avoid contamination from cells other than VSMCs. As a result of the study, we have found that a new subclass of VDCCs with unique properties may predominantly exist in this region.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell Dispersion
Guinea pigs of either sex (200 to 250 g) were stunned and killed by decapitation. A radial segment consisting of terminal ileum (5 cm long from the ileocecal valve) and attached mesenterium was carefully excised and pinned stretched on the rubber bottom of a dissecting dish filled with low Ca²⁺ (0.5 mmol/L)–containing physiological salt solution (PSS). The terminal branches of mesenteric artery (40 to 100 µm in diameter) were cleaned of fats and connective tissues using a fine scissors and forceps, and from their distal halves short cylindrical pieces were made. These pieces were then transferred consecutively into nominally Ca²⁺-free PSS with and without 2 mg/mL collagenase (type I; Sigma) and incubated at 35°C for 30 and 45 to 70 minutes, respectively. Single cells were dissociated by triturating these digested pieces with a large-bore Pasteur pipette in Ca²⁺-free PSS and stored at 4°C to 10°C until use. In the case of a submucosal arteriole, a short segment of arteriole was carefully excised from the mucosa, and its surface was cleaned mechanically. This segment was then incubated in Ca²⁺-free PSS containing 0.5 mg/mL collagenase for 10 to 20 minutes at 35°C and triturated in collagenase-free, Ca²⁺-free PSS to thoroughly remove connective tissues and ileal smooth muscle cells remaining on its surface, using a large-bore Pasteur pipette (0.5 mm in orifice diameter). The following cell-dispersion procedures used were the same as for the terminal mesenteric artery. Experiments were carried out within 6 hours from the time of cell isolation. All procedures described above were performed according to the Guidelines of Local Animal Ethics of Kyushu University.

Electrophysiology
The details of electrophysiological recordings in this study are very similar to those described previously.¹⁸ Briefly, a low-noise, high-performance patch clamp amplifier (Axopatch 1D, Axon Instruments) driven by an IBM-compatible computer (Aptiva) in conjunction with an A/D, D/A board (TL-1, Axon Instruments) was used to generate and apply voltage pulses to clamped cells and to record the corresponding membrane currents. Current signals were low-pass filtered at 1 kHz and digitized at 2 kHz before being stored on a computer hard disk. Linear leak subtraction was made using the hyperpolarizing P/4 or P/2 routine. Under the present experimental conditions, the series resistance of cells stayed almost constant throughout the experiment (11±0.4 M; n=245); 50% to 70% of this resistance was compensated. All data were analyzed offline and illustrations made using pClamp version 6.03 (Axon Instruments) and KaleidaGraph version 3.04 (Hulinks), respectively. All experiments were performed at room temperature (20°C to 25°C).

Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA was isolated from cerebellum or terminal branches of mesenteric arteries of the guinea pig (either sex, 200 to 250 g), using the total RNA extraction kit (RNeasy Mini-Kit, Qiagen), according to the manufacturer's suggestions. Oligonucleotide primers specific for the _1C and _1E subunits of VDCCs were designed according to the published calcium channel sequence or previously reported primer sequence^{19 20} (see below). Total RNA (1 µg) was reverse transcribed into cDNA using random primer (hexamer) and RT (Superscript II, Gibco-BRL) with a reaction volume of 20 µL. The PCR protocol used was as follows: denaturing at 95°C for 30 seconds, annealing at 50°C (_1C) or 54°C (_1E) for 30 seconds, and extension at 72°C for 1 minute, with 20 cycles for first PCR and 30 cycles for nested PCR. PCR products were electrophoresed on a 2% agarose gel, stained by ethidium bromide, and photographed. The sequences of primers were as follows: for _1C, forward, GGAGTTGGACAAGGCTATGAAGGA (first PCR) and CACCGTCCCATGAGAAGCT (nested PCR), and reverse, GACCTAGAGAGGCAGAGCGAAGGA (first and nested PCRs); for _1E, forward, CTTCCTGAGGATGACAAGACC (first PCR) and GAAGTCCATCATGAAGGCCA (nested PCR), and reverse, TCAATGGAAGGCATGTTGG (first PCR) and AGCAAGCATGACTTCCTCTG (nested PCR).

Solutions
We used a modified Krebs solution containing (in mmol/L) Na⁺ 140, K⁺ 6, Mg²⁺ 1.2, Ca²⁺ 2, Cl^- 151.4, glucose 10, and HEPES 10 (adjusted to pH 7.4 with Tris base). To obtain elevated Ba²⁺- or Ca²⁺-containing solutions, Na⁺ was replaced isosmotically by Ba²⁺ or Ca²⁺. Low Ca²⁺–containing and Ca²⁺-free solutions were made by reducing the concentration of Ca²⁺. The Cs⁺ internal solution contained (in mmol/L) Cs⁺ 140, Mg²⁺ 2.0, Cl^- 144, phosphocreatine 5, Na₂ATP 1, EGTA 10, and HEPES 10 (adjusted to pH 7.2 with Tris base).

Chemicals
ATP, GTP, HEPES, and EGTA were purchased from Dojin; nifedipine, nimodipine, diltiazem, verapamil, amiloride, CdCl₂, NiCl₂ and N-methyl-D-glucamine from Sigma; and -conotoxin GVIA, -conotoxin MVIIC, and -agatoxin IVA from Calbiochem.

Statistics
All data are expressed as mean±SEM, and 2-tailed paired or unpaired t tests and the Tukey multiple comparison test were used where appropriate for statistical evaluation.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Prominence of NI-Ca²⁺ Current in Mesenteric Arterioles
Single myocytes dissociated from the terminal branches of guinea pig mesenteric artery showed a rectangular or ellipsoidal appearance measuring 50 to 80 µm in length and 5 µm in width and had an input capacitance of 13.6±0.2 pF (n=205; range, 8 to 23 pF). These myocytes rapidly contracted to external ATP diffusing out of a patch pipette and thus were readily distinguishable from nonmuscular cells.

Figure 1 compares Ca²⁺ currents (I_Ca) evoked by a depolarizing pulse to 0 mV in the absence and presence of 10 µmol/L nifedipine, between myocytes dissociated from the proximal, terminal, and submucosal branches of guinea pig mesenteric artery. Nifedipine differentially affected I_Ca. In proximal branches, the majority of I_Ca was abolished, whereas in the terminal and submucosal branches only a minor part was inhibited, leaving a transient, fast-inactivating component. The magnitude of this NI component was unaffected by pretreatment with 10 µmol/L tetrodotoxin or 100 µmol/L DIDS or by substituting external Na⁺ and Cl^– with N-methyl-D-glucamine and benzensulfonate, respectively (data not shown), suggesting that the current is not carried by Na⁺ and Cl^– and is likely to be carried by Ca²⁺. As summarized in Figure 1B, the fraction of NI-I_Ca to the global I_Ca was significantly larger in submucosal and terminal than in more proximal branches (98±1%, 87±3%, and 30±3%, respectively). These results strongly suggest that the NI-I_Ca may be more abundantly expressed in the periphery of the mesenteric vasculature.

View larger version (23K): [in this window] [in a new window]   Figure 1. Differential distribution of NI-ICa. Bath and pipette contained PSS (2 mmol/L Ca2+) and Cs+ internal solution, respectively. Holding potential (VH), -60 mV. A, Inward currents evoked by 400-ms pulses to 0 mV, in the absence (thin curve) and presence (thick curve) of 10 µmol/L nifedipine, in proximal (a; 2nd, 3rd) and submucosal (b) branches. B, Percentage of NI-ICa to global ICa. The numbers of cells tested were 8, 7, and 3 for proximal, terminal, and submucosal branches, respectively. P values indicate the results of the Tukey multiple-comparison test.

The amplitude of NI-I_Ca recorded with the physiological concentration of Ca²⁺ (1 to 2 mmol/L) was so small (5 to 20 pA) that its quantitative evaluation was often unreliable because of poor signal-to-noise ratio. To circumvent this problem, as well as to avoid secondary complications caused by Ca²⁺-induced currents and progressive cell contracture caused by repeated large amounts of Ca²⁺ entry relative to a small cell volume, external Ca²⁺ (2 mmol/L) was replaced by a slightly elevated concentration of Ba²⁺ (5 mmol/L), a procedure that was reported to enhance the amplitude of L-type Ca²⁺ current with little change in its voltage dependence.²¹ Indeed, under these ionic conditions, the amplitude of NI-I_Ca was nearly doubled (Figure 2Aa), whereas its waveform remained almost unchanged (Figure 2Ab), and corresponding I-V relationships were almost superimposable when normalized to their peaks (data not shown). In addition, the decay of NI-I_Ca did not appreciably change by replacing Ca²⁺ with Ba²⁺ (Figure 2Ab), indicating the absence of Ca²⁺-dependent inactivation in this current component.

View larger version (23K): [in this window] [in a new window]   Figure 2. Absence of Ca2+-dependent inactivation, nifedipine insensitivity, and rundown-resistant properties of NI-ICa. A, NI-ICa recorded with 2 and 5 mmol/L Ca2+ or 5 mmol/L Ba2+ from the same cell (a). To compare the waveform, the currents are scaled to give the same peak amplitude (b). B, Concentration-inhibition curve for nifedipine fitted to an empirical Hill equation: (1-r)/{1+([drug]/Ki)n}+r, where [drug], Ki, n, and r denote the drug concentration, its IC50 value, cooperativity factor, and the fraction of unblocked current, respectively. Data were evaluated at 0 mV, with from 3 to 6 cells. VH=-80 mV. C, Rundown time course of global () and NI (10 µmol/L)–ICa (•) during internal dialysis of nucleotide-free Cs+ internal solution. Bottom axis denotes time elapsed after onset of whole-cell configuration.

Concentration dependence of I_Ca inhibition by nifedipine was tested with 5 mmol/L Ba²⁺ in the bath. As summarized in Figure 2B, this relationship was well described by a Hill-type equation with an IC₅₀ of 34 nmol/L. At concentrations higher than 1 µmol/L or so, no further inhibition was observed. The IC₅₀ value of 34 nmol/L is comparable with those reported for L-type Ca²⁺ channels in other tissues, suggesting that the nifedipine-sensitive (NS) component in this preparation reflects a typical L-type Ca²⁺ current. In fact, other properties of this NS component coincided very well with those of L-type Ca²⁺ channels (see below), including its rapid rundown on elimination of nucleotide phosphates from, or with inclusion of, 5 mmol/L F^– in the patch pipette (Figure 2C).¹¹ In contrast, the NI component stayed relatively resistant to these procedures (Figure 2C, •). Thus, progressive convergence of NI and rundown-resistant components of global I_Ca was observed, both of which eventually became indistinguishable (Figure 2C); the maximally effective concentrations of nifedipine (1 or 10 µmol/L) did not exert any effects on remaining I_Ca (101±1% of control; n=5). These results strongly indicate that the component of global I_Ca insensitive to nifedipine does not represent a residual L-type Ca²⁺ current that was impartially blocked by this compound, thus validating the specificity of nifedipine as a tool to separate putative NI-Ca²⁺ channels from L-type Ca²⁺ channels in the present preparation.

NI-I_Ca Is an HVA Ca²⁺ Channel
Figure 3 shows typical I-V relationships of I_Ba in the absence and presence of 10 µmol/L nifedipine (holding potential, -100 mV; Figure 3A), together with that of the latter (NI-I_Ba) averaged from 5 to 8 different cells (Figure 3B; holding potential, -60 or -100 mV). Regardless of holding potential, activation of NI-I_Ba was detectable at a potential above -50 mV and its peak found around -10 mV. On the other hand, the I-V relationship for NS-I_Ba showed a slightly more positive activation threshold and peak, but these differed by no more than 10 mV, compared with NI-I_Ba (dotted curve in Figure 3A). Accordingly, the relationships between the degree of activation and the membrane potential of NS-I_Ba (Figure 4A, ) and NI-I_Ba (Figure 4A, •) exhibited a similar sigmoidal pattern; Boltzmann fitting of these relationships gave similar values for the 50% activation potential and slope factor (-15.5 and -8.4 mV for NS-I_Ba, respectively [dotted curve in Figure 4A]; -11.0 and -11.3 mV for NI-I_Ba, respectively [solid curve in Figure 4A]). These results strongly indicate that the channels underlying NI-I_Ba would pertain to a class of HVA-VDCCs.

View larger version (27K): [in this window] [in a new window]   Figure 3. I-V relationships of NS-IBa and NI-IBa. Bath contained 5 mmol/L Ba2+ in this and the following figures, unless otherwise stated. A, I-V relationships of IBa obtained from the same cell, in the absence (•) and presence () of 10 µmol/L nifedipine, and their difference (dotted curve). Values are corrected for the leak using 300 µmol/L Cd2+. VH=-100 mV. B, Summary of I-V relationship of NI-IBa with VH of -100 mV (; n=5) and -60 mV (•; n=8). Data are mean±SEM. Illustrations on the right side indicate actual traces at -60, -40, -30, -10, and 0 mV.

View larger version (19K): [in this window] [in a new window]   Figure 4. Activation characteristics of NI-IBa. A, Activation curves evaluated by tail current analysis (inset). •, Solid curve, NI-IBa (n=7); , dotted curve, NS-IBa (ie, global minus NI-IBa; n=11). Curves are drawn according to the best nonlinear fit of data points with the Boltzmann equation, as follows: I=Imax/[1+exp(Vm-V0.5)/k], where I, Imax, Vm, V0.5, and k denote the tail current amplitude conditioned to Vm, its maximum, membrane potential, 50% activation potential, and slope factor, respectively. B, Relationship between the membrane potential and the time constant for 10% to 90% activation. Data are mean±SEM from 4 cells.

Voltage Dependence of Activation and Deactivation Kinetics
Activation of NI-I_Ba was rapid (of the order of milliseconds) and accelerated by stronger depolarizations (for actual traces see Figures 2A, 3B, and 5A). As summarized in Figure 4B (solid curve), the time required for 10% to 90% activation was markedly dependent on the membrane potential (13±2 ms at -30 mV versus 4±1 ms at 20 mV), decreasing e-fold by 48.2 mV. Similarly, the deactivating time course of NI-I_Ba evaluated by single exponential fitting of tail currents showed a clear dependence on the membrane potential (Figure 5A). By reducing the degree of hyperpolarization from a preceding short depolarization to 20 mV, the time constant of deactivation was increased e-fold by 22.9 mV (Figure 5B).

View larger version (16K): [in this window] [in a new window]   Figure 5. Deactivation of NI-IBa. A, Deactivation time course on repolarization to various voltage levels (-110 to 50 mV, 20-mV increments) after full activation at 20 mV. Smooth solid curves are the results of single exponential fits. B, Relationship of deactivation time constant vs membrane potential, evaluated from 5 cells. Data points are fitted by a growing exponential function (solid curve).

Fast and Slow Inactivation Kinetics of NI-I_Ba
When the pulse duration was set longer than 20 ms, the NI-I_Ba exhibited a fast, monophasic inactivation (for actual traces, see, eg, Figure 3B). As has already been described above, this time course was not appreciably affected by replacing Ba²⁺ with Ca²⁺ (Figure 2Ab), excluding the involvement of the Ca²⁺-dependent mechanism. This inactivation was complete at potentials more positive than -10 mV during the first 100-ms depolarization (Figure 6A), and its time constant (evaluated by single exponential fitting) was 30 ms at 20 mV and was relatively unchanged over a wide range of membrane potentials (e-fold change per 102.1 mV; Figure 6B). This sharply contrasts with a marked voltage dependence of activation and deactivation time constants (Figures 4B and 5B). Figure 6A shows the inactivation curves of NI-I_Ba obtained with 3 conditioning pulses of different lengths (100 ms, 1 second, and 10 seconds), in which prolonged pulse duration shifted the curve toward more negative potentials. The 50% inactivation potentials evaluated by Boltzmann fitting were -30.9, -38.5, and -52.3 mV, respectively, suggesting the existence of another much longer inactivation state, of the order of seconds. Fast and complete inhibition of NI-I_Ba is entirely different from those of NS-I_Ba, which inactivates incompletely and more slowly in a similar range of membrane potentials.

View larger version (23K): [in this window] [in a new window]   Figure 6. Inactivation and recovery of NI-IBa. A, Inactivation curves evaluated by 100-ms (; n=3), 1-second (; n=5), and 10-second (•; n=5) conditioning pulses. VH=-100 mV. Solid curves are the results of Boltzmann fitting, as shown in Figure 4 legend. B, Inactivation time constant fitted by a single exponential is plotted against the membrane potential. Data are mean±SEM from 3 to 5 different cells, and the curve is fitted with a single decremental exponential function (solid curve). C, Recovery time course evaluated at -80 mV. I1 and I2 denote the amplitude of NI-IBa at 0 mV at the first pulse (10 seconds) and those during recovery with interpulses of various duration, respectively, the time course of which is fitted by a single exponential (function).

Superimposing the activation and steady-state inactivation curves reveals the existence of a potential range at which NI-I_Ba would constantly flow (ie, window current). This range is apparent between approximately -60 and -30 mV, being almost overlapping that of the physiological membrane potential (solid and dotted curves in Figure 6A; see Discussion).

Recovery of a major part of NI-I_Ba (90%) from inactivation was completed within several hundreds of milliseconds, the time course of which could be described by a single exponential with a time constant of 100 ms at -80 mV (Figure 6C). In addition, there appeared to be another slow recovery phase explaining the remaining 10% of recovery that proceeded with a time constant of the order of seconds. The time constant of initial fast recovery was considerably shorter than that typical for NS-Ca²⁺ currents (data not shown).

Effects of Increased Divalent Cation Concentration and Anomalous Mole-Fraction Dependence
Raising the concentration of Ba²⁺ or Ca²⁺ in the bath increased the amplitude of NI current with a positive shift in activation threshold and a peak of its I-V relationship (Figure 7A). For Ba²⁺, the degree of shift was 20 mV with a concentration change from 2 to 30 mmol/L. A similar degree of the shift of I-V relationship was also observed for Ca²⁺, although the peak of its I-V relationship was smaller than that of Ba²⁺ (not shown). At a concentration of 30 mmol/L, the magnitude of NI-I_Ca was about twice smaller than that of NI-I_Ba (0.56±0.11; n=5).

View larger version (19K): [in this window] [in a new window]   Figure 7. Effects of elevated Ba2+ or Ca2+ concentration on NI-Ca2+ current. A, I-V relationships with various concentrations of Ba2+ (2, 5, 10, and 30 mmol/L). VH=-80 mV. B, Anomalous mole-fraction dependence. Amplitude of mixed current (Ca2+ plus Ba2+) is normalized to that with 10 mmol/L Ba2+ alone. Bottom axis indicates ratio of Ba2+ to Ca2+, keeping the sum of Ca2+ and Ba2+ concentrations at 10 mmol/L. The number of cells tested was 5.

The NI current showed a complex dependence on the concentration of Ba²⁺ and Ca²⁺ when both cations were mixed (Figure 7B). By changing the molar ratio of Ba²⁺ to Ca²⁺ while keeping the sum of their concentrations at 10 mmol/L, the amplitude of the mixed current became minimal with the ratio of 8:2, even though Ba²⁺ can carry a larger current than Ca²⁺ when each cation is present alone (leftmost versus rightmost circles in Figure 7B). This phenomenon, called anomalous mole-fraction dependence,²² together with the results described in the preceding paragraph, indicates some interaction of permeating ions (Ba²⁺ and Ca²⁺) at multiple binding sites in the channel pore that has commonly been observed for other types of HVA Ca²⁺.^{23 24}

Inorganic and Organic Blockers
To further clarify similarities and differences between the NI-Ca²⁺ channels in our preparation and other types of VDCCs, the effects of known VDCC blockers were tested. Figure 8A shows the concentration-inhibition curve of NI-I_Ba for Cd²⁺ and Ni²⁺, with 5 mmol/L Ba²⁺ as the charge carrier. The IC₅₀ values evaluated by Hill analysis were 5.8 and 68 µmol/L with a similar cooperativity factor of approximately unity for Cd²⁺ and Ni²⁺, respectively, suggesting a 10-fold greater efficacy of Cd²⁺.

View larger version (40K): [in this window] [in a new window]   Figure 8. Pharmacology of NI-IBa. All data were evaluated at 0 mV. A, Concentration-inhibition curves for Cd2+, Ni2+, and amiloride, which are fitted by the Hill equation in Figure 2B. For Cd2+ and Ni2+, r is set to 0. VH=-60 mV. B, Summary of inhibition by various blockers (labeled). VH=-80 mV. Data are mean±SEM from 3 to 13 different cells. CTx indicates -conotoxin; Aga, -agatoxin.

In the next series of experiments, the inhibitory effects of several widely used L-type Ca²⁺ channel blockers other than nifedipine on NI-I_Ba were investigated. Two structurally unrelated L-channel blockers to DHP, verapamil and diltiazem, suppressed I_Ba dose dependently, but no more than nifedipine, at a concentration as high as 100 µmol/L (P>0.05 with the Tukey test; Figure 8B). In contrast, another potent DHP compound, nimodipine (10 µmol/L), which has been reported to suppress T-type Ca²⁺ channels as well,²⁵ further decreased the amplitude of the NI part of I_Ba by 40% (P<0.01 with unpaired t test; Figure 8B). A similar extent of inhibition by 10 µmol/L nimodipine was also observed when I_Ba was recorded with 5 mmol/L internal solution containing F^– (data not shown). In addition, amiloride, a well-known potent blocker of T-type Ca²⁺ currents, dose-dependently inhibited the NI-I_Ba (Figure 8A; IC₅₀, 107 µmol/L), but in this case, complete inhibition was not observed up to a concentration of 2 mmol/L.

In a final series of experiments, several peptide toxins known to block various types of HVA Ca²⁺ currents (-conotoxins GVIA and MVIIC and -agatoxin IVA) were tested. However, none of these were found to affect the NI-I_Ba recorded with 5 mmol/L Ba²⁺ (Figure 8B).

RT-PCR
The above results strongly suggest that the Ca²⁺ channels underlying NI-I_Ba may be homologous to "R-type" channels (for details, see Discussion). Thus, we explored possible expression of its molecular counterpart _1E subunit in comparison with that of the _1C subunit, which is likely to be expressed as the NS component, but to a lesser extent, in the present preparation (see Figure 1).

Figure 9 shows an ethidium bromide staining of RT-PCR products obtained from the total RNA of guinea pig cerebellum or terminal branches of mesenteric arteries. The products of both Ca²⁺ channel _1C and _1E subunits could be detected in the cerebellum (C lanes in Figure 9), whereas only the _1C was positive in the terminal branches of mesenteric artery, using the same primers (MA lane in left panel of Figure 9).

View larger version (70K): [in this window] [in a new window]   Figure 9. RT-PCR detection of VDCC 1C and 1E subunit mRNA in guinea pig cerebellum and terminal branches of guinea pig mesenteric arteries. Shown are results of nested PCR using 1 µg total RNA. Leftmost lane in each panel shows a 100-bp ladder. C indicates cerebellum; MA, mesenteric artery.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The results of this study have suggested the predominant presence of NI-Ca²⁺, HVA-Ca²⁺ channels in the terminal branches of mesenteric artery. Possible contamination of "residual" L-type Ca²⁺ current in our experiments has largely been excluded by the specificity of nifedipine (Figure 2B), as well as by its identification as the rundown-resistant I_Ca (Figure 2C). These facts strongly indicate, together with the observed distinct properties of NS-I_Ba, that NI-I_Ba in the present preparation would represent a robust molecular entity disparate from the L-type VDCCs. Although DHP-insensitive VDCCs have already been demonstrated in several different types of cardiovascular tissues (almost all categorized as T-type VDCCs),^{11 12 13 14 15 16 17 26} a few of which are somewhat similar to NI-Ca²⁺ current in the present study,^{13 26} extremely high expression and unique properties of NI-Ca²⁺ channels in the present preparation are not comparable with those of any of previous reports, for the following reasons. (1) The fraction of NI-I_Ca was found to increase dramatically along the periphery of mesenteric artery, amounting to 70% to 100% of global I_Ca in the terminal and submucosal branches (Figure 1B). This is unlikely to have resulted from the rapid rundown of L-type Ca²⁺ channels that occurs during a diffusional exchange between the cytosol and the patch pipette, because the effect of nifedipine on I_Ca was evaluated shortly after the onset of whole-cell configuration under conditions that minimize L-type Ca²⁺ current rundown (see also Figure 2C). (2) The biophysical properties of NI-I_Ba are not unequivocally accountable for by the knowledge available for hitherto-identified DHP-insensitive, rapidly inactivating VDCCs (Table). Despite similarities in gating kinetics to T-type, LVA-Ca²⁺ channels (but see below), the observed pattern of activation of NI-I_Ba (threshold and peak of I-V curve: -50 and -10 mV, respectively; V_0.5, -11 mV with 5 mmol/L Ba²⁺; Figure 3) and other properties associated with the pore structure (higher permeability of Ba²⁺ than Ca²⁺, anomalous mole-fraction dependence, and much stronger inhibitory efficacy of Cd²⁺ than Ni²⁺) are clearly of the HVA type.^{23 24} (3) The pharmacological profile of NI-I_Ba in the present study does not completely match the criteria widely used to subclassify the VDCCs.^{28 36} The total resistance of NI-I_Ba to nifedipine as well as verapamil, diltiazem, or peptide blockers (-conotoxins GVIA and MVIIC and -agatoxin IVA) is obviously incompatible with the involvement of L-, N- or P/Q-type Ca²⁺ channels, and the relatively high sensitivities of NI-I_Ba to nimodipine and amiloride does not fit with "typical" R-type Ca²⁺ channels.

View this table: [in this window] [in a new window]   Table 1. Summary of DHP-Insensitive, Rapidly Inactivating Ca2+ Currents

View this table: [in this window] [in a new window]   Table 1A. Continued

Recent cloning and expression studies have disclosed that the major properties of VDCCs such as divalent cation permeation/block and pharmacological sensitivities to drugs such as the DHPs (but see Reference 37³⁷ ) and peptide toxins would be conferred exclusively by the structural differences in the ₁ subunit that not only forms the ion conductive pore but also contains the binding sites for various blockers and agonists. In contrast, the current amplitude (thus, the number of channels inserted in the cell membrane) and the gating properties (ie, activation and inactivation kinetics) of VDCCs could strongly be modified by other auxiliary subunits, ß and ₂- subunits.^{36 38} For example, it has been reported that coexpression of distinct ß subunits with the _1A, _1B, or _1E subunit results in a markedly enhanced current amplitude and a variable extent of hyperpolarizing shifts in activation and steady-state inactivation curves with significantly altered kinetics.^{30 32 38 39 40} In light of these molecular data, the apparently confounding properties of NI-Ca²⁺ channels described above could be explained by the following interpretation. The putative ₁ subunit responsible for the NI-Ca²⁺ channels would be homologous to those constituting HVA-VDCCs (ie, _1C, _1D, _1S, _1B, _1A, or _1E) and devoid of the sequence essential for binding to DHP and toxins, because the observed properties representing the pore structure and blocker sensitivities are clearly of HVA type (see above) (Table). On the other hand, an apparent resemblance of NI-Ca²⁺ channels to T-type Ca²⁺ channels in gating kinetics and pharmacology such as relatively slow rates of activation and deactivation (millisecond order), the presence of fast and slow phases of inactivation,¹¹ and partial sensitivities to nimodipine and amiloride would not necessarily reflect their essential similarities in the primary structure of the ₁ subunit but could to some extent be accounted for by complex interactions between the ₁ and auxiliary subunits. It may thus be reasonable to speculate that the most closely related member of VDCCs to the NI-Ca²⁺ channels in the present study is the R-type Ca²⁺ channel (or its most likely molecular counterpart, the _1E subunit), and some differences found between them such as differential deactivation rates (millisecond versus submillisecond) and sensitivities to nimodipine or amiloride (intermediate versus null or low) may be attributable to a rather broad diversity of R-type Ca²⁺ channels or _1E subunits (Table). However, the results of RT-PCR do not simply support this possibility. Using the specific primers discriminating the _1C and _1E subunits in cerebellum, only the _1C subunit, which seems functionally less abundantly expressed (Figure 1), was detected in the terminal branches of mesenteric artery (Figure 9). Although inadequacy of the primers used for detecting the _1E mRNA in the present preparation remains to be excluded, the most intriguing possibility is that an entirely new ₁ subunit encoded by a yet-to-be-identified gene(s) or a novel isoform of the ₁ subunit produced by alternative RNA splicing from known NI-HVA ₁-encoding genes (eg, _1B, _1A, or _1E) might be abundantly expressed in the periphery of mesenteric circulation. Moreover, if alternative splicing could alter the properties of VDCC ₁ subunit such as DHP sensitivity³⁷ and voltage dependence more dramatically than currently envisaged, the involvement of _1C, _1G, or _1H could not be completely excluded either. A more extensive database on single-channel recording and molecular technologies will be necessary to distinguish between these possibilities.

Possible Physiological Implications
Despite its rapidly inactivating nature, a significant overlap of activation and steady-state inactivation curves of NI-I_Ba strongly suggest that there is a range of membrane potentials in which a small but significant magnitude of Ca²⁺ current would continuously flow (Figure 6A). This noninactivating current, the so-called "window current," would not be an "artifact" because of the use of 5 mmol/L Ba²⁺ as a charge carrier, given that substitution of Ca²⁺ with Ba²⁺ did not significantly affect the inactivation time course (Figure 2Ab) and the observed I-V relationship with 5 mmol/L Ba²⁺ was comparable to that with the physiological concentration of Ca²⁺ (2 mmol/L) (see Results; see also Reference 21²¹ ). The predicted range of window current (Figure 6A) would overlap the physiological range of membrane potential of VSMCs (-75 to 50 mV),¹ and its magnitude would change severalfold by small changes in this potential range. For example, a 5-fold increase (from 0.1 to 0.5 pA) is expected with a potential change from -80 to -50 mV, taking the mean current density of 1.6 pA/pF at -10 mV (Figure 3B), capacitance of 13.6 pF, and the parameters for activation and inactivation. This means that small depolarizations or hyperpolarizations caused by neurotransmitters and other vasoactive substances, such as noradrenaline, calcitonin gene–related peptide, vasoactive intestinal peptide, and endothelin,^{1 2 9} could significantly alter the rate of Ca²⁺ influx through NI-Ca²⁺ channels, thereby profoundly affecting the [Ca²⁺]_i of arteriolar smooth muscle cells, which have an extremely small cell volume (of the order of subpicoliters). This is strikingly similar to the postulated role of L-type Ca²⁺ channels in tone regulation of more proximal and larger-sized arteries.⁴ In addition, our preliminary data have suggested that NI-Ca²⁺ currents showing almost identical properties to the NI-Ca²⁺ current in the present study may also exist in the rabbit and rat terminal mesenteric arteries (H. Morita et al, unpublished data, 1999). This fact, combined with our observation that the fraction of NI-Ca²⁺ channels appears to approach 100% in the more peripheral branches of mesenteric artery, may further imply an intriguing role of these channels, together with L-type Ca²⁺ channels,⁴¹ for regulating the small arteriolar circulation.

	Acknowledgments

 
We thank the Ian Potter Foundation and the National Health and Medical Research Council of Australia (Grant 960196) for travel and research funding (to H.C.). Thanks are also due to Dr Y. Mori, National Institute for Physiological Sciences (Okazaki, Japan) for pertinent advice about RT-PCR.

	Footnotes

 
¹ Both authors contributed equally to the study.

Received March 22, 1999; accepted July 13, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Kuriyama H, Kitamura K, Nabata H. Pharmacological and physiological significance of ion channels and factors that modulate them in vascular tissues. Pharmacol Rev. 1995;47:387–573.[Medline] [Order article via Infotrieve]
2. Lundberg JM. Pharmacology of cotransmission in the autonomic nervous system: integrative aspects on amines, neuropeptides, adenosine trisphosphate, amino acids and nitric oxide. Pharmacol Rev. 1996;48:113–178.[Medline] [Order article via Infotrieve]
3. Meininger GA, Davis MJ. Cellular mechanisms involved in the vascular myogenic response. Am J Physiol. 1992;263:H647–H659.[Abstract/Free Full Text]
4. Nelson MT, Patlak JB, Worley JF, Standen NB. Calcium channels, potassium channels, and voltage dependence of arterial smooth muscle tone. Am J Physiol. 1990;259:C3–C18.[Abstract/Free Full Text]
5. Knot HJ, Nelson MT. Regulation of arterial diameter and wall [Ca²⁺]_i in cerebral arteries of rat by membrane potential and intravascular pressure. J Physiol (Lond). 1998;598:199–209.
6. McCarron JG, Crichton CA, Langton PD, Mackenzie A, Smith GL. Myogenic contraction by modulation of voltage-dependent calcium currents in isolated rat cerebral arteries. J Physiol (Lond). 1997;498:371–379.[Medline] [Order article via Infotrieve]
7. Nelson MT, Worley JF. Dihydropyridine inhibition of single calcium channels and contraction in rabbit mesenteric artery depends on voltage. J Physiol (Lond). 1989;412:65–91.[Abstract/Free Full Text]
8. Guyton AC, Hall JE. Overview of the circulation: medical physics of pressure, flow, and resistance. Chapter 14. In: Guyton AC, Hall JE, eds. Textbook of Medical Physiology. Philadelphia, Pa: WB Saunders Co Inc; 1996:161–169.
9. Hirst GDS, Edwards FR. Sympathetic neuroeffector transmission in arteries and arterioles. Physiol Rev. 1989;69:546–604.[Free Full Text]
10. Morita H, Inoue R, Cousins H, Ito Y. Dihydropyridine (DHP)-insensitive high-voltage activated (HVA) Ca²⁺ currents in the guinea-pig mesenteric arteriole. Jpn J Pharmacol. 1999;79(suppl I):40P.
11. Akaike N, Kanaide H, Kuga T, Nakamura M, Sadoshima J, Tomoike H. Low-voltage-activated calcium current in rat aorta smooth muscle cells in primary culture. J Physiol (Lond). 1989;416:141–160.[Abstract/Free Full Text]
12. Benham CD, Hess P, Tsien RW. Two types of calcium channels in single smooth muscle cells from rabbit ear artery studied with whole-cell and single-channel recordings. Circ Res. 1987;61(suppl I):I-10–I-16.
13. Friedman ME, Suarez-Kurtz G, Kaczorowski J, Katz GM, Reuben JP. Two calcium currents in a smooth muscle cell line. Am J Physiol. 1986;250:H699–H703.
14. Ganitkevich VY_A, Isenberg G. Contribution of two types of calcium channels to membrane conductance of single myocytes from guinea-pig coronary artery. J Physiol (Lond). 1990;426:19–42.[Abstract/Free Full Text]
15. Loirand G, Mironneau C, Mironneau J, Pacaud P. Two types of calcium currents in single smooth muscle cells from rat portal vein. J Physiol (Lond). 1989;412:333–349.[Abstract/Free Full Text]
16. Smirnov SV, Aaronson PI. Ca²⁺ currents in single myocytes from human mesenteric arteries: evidence for a physiological role of L-type channels. J Physiol (Lond). 1992;457:455–475.[Abstract/Free Full Text]
17. Yatani A, Seidel CL, Allen J, Brown AM. Whole-cell and single-channel calcium currents of isolated smooth muscle cells from saphenous vein. Circ Res. 1987;60:523–533.[Abstract/Free Full Text]
18. Waniishi Y, Inoue R, Morita H, Teramoto N, Abe K, Ito Y. Cyclic GMP-dependent but G-kinase-independent inhibition of Ca²⁺-dependent Cl^– currents by NO donors in cat tracheal smooth muscle. J Physiol (Lond). 1998;511:719–731.[Abstract/Free Full Text]
19. Borman B, Lakaye B, Minet A, Zorzi W, Vergnes M, Marescaux C, Grisar T. Expression of mRNA encoding 1E and 1G subunit in the brain of a rat model of absence epilepsy. NeuroReport. 1999;10:569–574.[Medline] [Order article via Infotrieve]
20. Wyatt CN, Page KM, Berrow NS, Brice NL, Dolphin AC. The effect of overexpression of auxiliary Ca²⁺ channel subunits on native Ca²⁺ channel currents in undifferentiated mammalian NG108–15 cells. J Physiol (Lond). 1998;510:347–360.[Abstract/Free Full Text]
21. Ganitkevich VYA, Shuba MF, Smirnov SV. Saturation of calcium channels in single isolated smooth muscle cells of guinea-pig taenia caeci. J Physiol (Lond). 1988;399:419–436.[Abstract/Free Full Text]
22. Hille B. Selective permeability: saturation and binding. Chapter 14. In: Ion Channels of Excitable Membrane. 2nd ed. Sunderland, Mass: Sinauer Associates, Inc; 1992.
23. Hess P, Tsien RW. Mechanism of ion permeation through calcium channels. Nature. 1984;309:453–456.[Medline] [Order article via Infotrieve]
24. Wakamori M, Strobec M, Niidome T, Teramoto T, Imoto K, Mori Y. Functional characterization of ion permeation pathway in the N-type Ca²⁺ channel. J Neurophysiol. 1998;79:622–634.[Abstract/Free Full Text]
25. Randall AD, Tsien RW. Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology.. 1997;36:879–893.[Medline] [Order article via Infotrieve]
26. Tohse N, Masuda H, Sperelakis N. Novel isoform of Ca²⁺ channel in rat fetal cardiomyocytes. J Physiol (Lond). 1992;451:295–306.[Abstract/Free Full Text]
27. Ellinor PT, Zhang JF, Randall AD, Zhou M, Scharz TL, Tsien RW, Horne WA. Functional expression of a rapidly inactivating neuronal calcium channel. Nature. 1993;363:455–458.[Medline] [Order article via Infotrieve]
28. Zhang JF, Randall AD, Ellinor PT, Horne WA, Sather WA, Tanabe T, Scharz T, Tsien RW. Neuropharmacology. 1993;32:1075–1088.[Medline] [Order article via Infotrieve]
29. Soong TW, Stea A, Hodson CD, Dubel SJ, Vincent SR, Snutch TP. Structure and functional expression of a member of the low voltage-activated calcium channel family. Science. 1993;260:1133–1136.[Abstract/Free Full Text]
30. Stephens GJ, Page KM, Burley JR, Berrow NS, Dolphin AC. Functional expression of rat brain cloned 1E calcium channels in COS-7 cells. Pflugers Arch. 1997;433:523–532.[Medline] [Order article via Infotrieve]
31. Wakamori M, Niidome T, Furutama D, Furuichi T, Mikoshiba K, Fujita Y, Tanaka I, Katayama K, Yatani A, Schartz A, Mori Y. Distinctive functional properties of the neuronal BII (Class E) calcium channel. Receptors and Channels. 1994;2:303–314.[Medline] [Order article via Infotrieve]
32. Williams ME, Marubio LM, Deal CR, Hans M, Brust PF, Philipson LH, Miller RJ, Johnson EC, Harpold MM, Ellis SB. Structure and functional characterization of neuronal _1E calcium channel subtypes. J Biol Chem. 1994;269:22347–22357.[Abstract/Free Full Text]
33. Nooney JM, Lambert RC, Feltz A. Identifying neuronal non-L Ca²⁺ channels: more than stamp collecting? Trends Pharmacol Sci. 1997;18:363–371.[Medline] [Order article via Infotrieve]
34. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, Lee JH. Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature. 1998;391:896–900.[Medline] [Order article via Infotrieve]
35. Cribbs LL, Lee JH, Yang J, Satin J, Zhang Y, Daud A, Barclay J, Williamson MP, Fox M, Rees M, Perez-Reyes E. Cloning and characterization of _1H from human heart, a member of the T-type Ca²⁺ channel gene family. Circ Res. 1998;83:103–109.[Abstract/Free Full Text]
36. Mori Y, Mikala G, Kobayashi T, Koch S, Wakamori M, Schwarz A. Molecular pharmacology of voltage-dependent calcium channels. Jpn J Pharmacol. 1996;72:83–109.[Medline] [Order article via Infotrieve]
37. Welling A, Kwan YW, Bosse E, Flockerzi V, Hofmann F, Kass RS. Subunit-dependent modulation of recombinant L-type calcium channels: molecular basis for dihydropyridine tissue selectivity. Circ Res. 1993;73:974–980.[Abstract/Free Full Text]
38. Walker D, Waard MD. Subunit interaction sites in voltage-dependent Ca²⁺ channels: role in channel function. Trends Neurosci. 1998;21:148–154.[Medline] [Order article via Infotrieve]
39. Stephens GJ, Brice NL, Berrow NS, Dolphin AC. Facilitation of rabbit _1B calcium channels: involvement of endogenous Gß subunits. J Physiol (Lond). 1998;509:15–27.[Abstract/Free Full Text]
40. Waard MD, Campbell KP. Subunit regulation of the neuronal _1A Ca²⁺ channel expressed in Xenopus oocytes. J Physiol (Lond). 1995;485:619–634.[Medline] [Order article via Infotrieve]
41. Bowles DK, Hu Q, Laughlin MH, Sturek M. Exercise training increases L-type calcium current density in coronary smooth muscle. Am J Physiol. 1998;275:H2159–H2169.[Abstract/Free Full Text]

This article has been cited by other articles:

				E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald Voltage-dependent calcium channels of dog basilar artery J. Physiol., April 15, 2007; 580(2): 523 - 541. [Abstract] [Full Text] [PDF]

				S.-Z. Xu, G. Boulay, R. Flemming, and D. J. Beech E3-targeted anti-TRPC5 antibody inhibits store-operated calcium entry in freshly isolated pial arterioles Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2653 - H2659. [Abstract] [Full Text] [PDF]

				J. R. Kovac, H. G. Preiksaitis, and S. M. Sims Functional and molecular analysis of L-type calcium channels in human esophagus and lower esophageal sphincter smooth muscle Am J Physiol Gastrointest Liver Physiol, December 1, 2005; 289(6): G998 - G1006. [Abstract] [Full Text] [PDF]

				M. Ishiguro, T. L. Wellman, A. Honda, S. R. Russell, B. I. Tranmer, and G. C. Wellman Emergence of a R-Type Ca2+ Channel (CaV 2.3) Contributes to Cerebral Artery Constriction After Subarachnoid Hemorrhage Circ. Res., March 4, 2005; 96(4): 419 - 426. [Abstract] [Full Text] [PDF]

				E. Perez-Reyes Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels Physiol Rev, January 1, 2003; 83(1): 117 - 161. [Abstract] [Full Text] [PDF]