Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1999;85:596-605

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morita, H.
Right arrow Articles by Inoue, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, H.
Right arrow Articles by Inoue, R.
Related Collections
Right arrow Animal models of human disease
Right arrow Ion channels/membrane transport
Right arrow Coronary circulation
(Circulation Research. 1999;85:596-605.)
© 1999 American Heart Association, Inc.


Cellular Biology

Predominant Distribution of Nifedipine-Insensitive, High Voltage–Activated Ca2+ Channels in the Terminal Mesenteric Artery of Guinea Pig

Hiromitsu Morita1, Helen Cousins1, Hitoshi Onoue, Yushi Ito, Ryuji Inoue

From the Department of Pharmacology (H.O., Y.I., R.I.), Graduate School of Medical Sciences, Kyushu University, and Special Patient Oral Care Unit (H.M.), Kyushu University Dental Hospital, Fukuoka, Japan, and Prince of Wales Medical Research Institute (H.C.), New South Wales, Australia.

Correspondence to Ryuji Inoue, Department of Pharmacology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582, Japan. E-mail inouery{at}pharmaco.med.kyushu-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—We have found nifedipine-insensitive (NI), rapidly inactivating, voltage-dependent Ca2+ channels (current, NI-ICa) with unique biophysical and pharmacological properties in the terminal branches of guinea pig mesenteric artery, by using a whole-cell mode of the patch-clamp technique. The fraction of NI-ICa appeared to increase dramatically along the lower branches of mesenteric artery, amounting to almost 100% of global ICa in its periphery. With 5 mmol/L Ba2+ as the charge carrier, NI-ICa was activated with a threshold of -50 mV, peaked at -10 mV, and was half-activated and inactivated at -11 and -52 mV, respectively, generating a potential range of constant activation near the resting membrane potential. The NI-ICa was rundown resistant, was not subject to Ca2+-dependent inactivation, and exhibited the pore properties typical for high voltage–activated Ca2+ channels; Ba2+ is {approx}2-fold more permeable than Ca2+, and Cd2+ is a better blocker than Ni2+ (IC50, 6 and 68 µmol/L, respectively). Relatively specific blockers for N- and P/Q-type Ca2+ channels such as {omega}-conotoxins GVIA and MVIIC (each 1 µmol/L) and {omega}-agatoxin IVA (1 µmol/L) were ineffective at inhibiting NI-ICa, whereas nimodipine partially (10 µmol/L; {approx}40%) and amiloride potently ({approx}75% with 1 mmol/L; IC50; 107 µmol/L) blocked the current. Although these properties are reminiscent of R-type Ca2+ channels, expression of the {alpha}1E mRNA was not detected using reverse transcriptase–polymerase chain reaction. These results strongly suggest the predominant presence of NI, high voltage–activated Ca2+ channels with novel properties, which may be abundantly expressed in peripheral small arterioles and contribute to their tone regulation.


Key Words: voltage-dependent Ca2+ channel • dihydropyridine insensitivity • arteriole • tone regulation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The vascular tone or the resistance of the systemic circulation is dynamically controlled by changes in the intravascular pressure as well as by many vasoactive substances released from autonomic nerves, endocrine organs, and endothelial cells.1 2 3 The mechanism involved in this regulation seems to result, in part, from depolarization or hyperpolarization of the vascular smooth muscle (VSM) membrane, which in turn alters the rate of Ca2+ entry into, and the intracellular Ca2+ concentration ([Ca2+]i) of, VSM cells (VSMCs).3 4 With respect to possible pathways for such Ca2+ entry, the importance of dihydropyridine (DHP)–sensitive, high voltage–activated (HVA) L-type Ca2+ channels has been emphasized, mainly on the basis of the ubiquity of these channels over the whole vascular tree and high susceptibility of vascular tone or diameter to L type–specific blockers, including DHPs.4 5 6 7 However, most of these studies were restricted (probably for technical reasons) to relatively proximal arteries having a diameter typically ranging between 100 and 1000 µm, with walls that contained more than a single layer of smooth muscle cells (eg, Reference 33 ). On the other hand, it is well recognized that the systemic blood pressure falls most sharply in the region of smaller, higher-order resistant arterioles that undergo denser autonomic innervation such as from sympathetic nerves.8 9 These facts raise the possibility that Ca2+-permeable channels other than L-type Ca2+ channels might more importantly contribute to the tone regulation of smaller arterioles. Indeed, we have very recently found that in submucosal arterioles of the guinea pig ileum and in terminal branches of the mesenteric artery, the density of nifedipine-insensitive (NI), voltage-dependent Ca2+ currents (or channels; VDCCs) is unexpectedly large.10 Although DHP-insensitive, transient, or T-type VDCCs have already been identified in several distinct types of VSM,11 12 13 14 15 16 17 they appear to be expressed much less abundantly than L-type Ca2+ channels (but see Reference 1111 , rat aortic cells in primary culture) and their precise physiological role remains elusive.4 The present study was therefore undertaken to characterize the putative NI-VDCCs in small branches of mesenteric circulation of the guinea pig, in terms of patch-clamp experiments. To this end, the terminal branch of mesenteric artery rather than submucosal arterioles was chosen to ease the difficulty of experiments as well as to avoid contamination from cells other than VSMCs. As a result of the study, we have found that a new subclass of VDCCs with unique properties may predominantly exist in this region.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Dispersion
Guinea pigs of either sex (200 to 250 g) were stunned and killed by decapitation. A radial segment consisting of terminal ileum ({approx}5 cm long from the ileocecal valve) and attached mesenterium was carefully excised and pinned stretched on the rubber bottom of a dissecting dish filled with low Ca2+ ({approx}0.5 mmol/L)–containing physiological salt solution (PSS). The terminal branches of mesenteric artery (40 to 100 µm in diameter) were cleaned of fats and connective tissues using a fine scissors and forceps, and from their distal halves short cylindrical pieces were made. These pieces were then transferred consecutively into nominally Ca2+-free PSS with and without 2 mg/mL collagenase (type I; Sigma) and incubated at 35°C for 30 and 45 to 70 minutes, respectively. Single cells were dissociated by triturating these digested pieces with a large-bore Pasteur pipette in Ca2+-free PSS and stored at 4°C to 10°C until use. In the case of a submucosal arteriole, a short segment of arteriole was carefully excised from the mucosa, and its surface was cleaned mechanically. This segment was then incubated in Ca2+-free PSS containing 0.5 mg/mL collagenase for 10 to 20 minutes at 35°C and triturated in collagenase-free, Ca2+-free PSS to thoroughly remove connective tissues and ileal smooth muscle cells remaining on its surface, using a large-bore Pasteur pipette ({approx}0.5 mm in orifice diameter). The following cell-dispersion procedures used were the same as for the terminal mesenteric artery. Experiments were carried out within 6 hours from the time of cell isolation. All procedures described above were performed according to the Guidelines of Local Animal Ethics of Kyushu University.

Electrophysiology
The details of electrophysiological recordings in this study are very similar to those described previously.18 Briefly, a low-noise, high-performance patch clamp amplifier (Axopatch 1D, Axon Instruments) driven by an IBM-compatible computer (Aptiva) in conjunction with an A/D, D/A board (TL-1, Axon Instruments) was used to generate and apply voltage pulses to clamped cells and to record the corresponding membrane currents. Current signals were low-pass filtered at 1 kHz and digitized at 2 kHz before being stored on a computer hard disk. Linear leak subtraction was made using the hyperpolarizing P/4 or P/2 routine. Under the present experimental conditions, the series resistance of cells stayed almost constant throughout the experiment (11±0.4 M{Omega}; n=245); 50% to 70% of this resistance was compensated. All data were analyzed offline and illustrations made using pClamp version 6.03 (Axon Instruments) and KaleidaGraph version 3.04 (Hulinks), respectively. All experiments were performed at room temperature (20°C to 25°C).

Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA was isolated from cerebellum or terminal branches of mesenteric arteries of the guinea pig (either sex, 200 to 250 g), using the total RNA extraction kit (RNeasy Mini-Kit, Qiagen), according to the manufacturer's suggestions. Oligonucleotide primers specific for the {alpha}1C and {alpha}1E subunits of VDCCs were designed according to the published calcium channel sequence or previously reported primer sequence19 20 (see below). Total RNA (1 µg) was reverse transcribed into cDNA using random primer (hexamer) and RT (Superscript II, Gibco-BRL) with a reaction volume of 20 µL. The PCR protocol used was as follows: denaturing at 95°C for 30 seconds, annealing at 50°C ({alpha}1C) or 54°C ({alpha}1E) for 30 seconds, and extension at 72°C for 1 minute, with 20 cycles for first PCR and 30 cycles for nested PCR. PCR products were electrophoresed on a 2% agarose gel, stained by ethidium bromide, and photographed. The sequences of primers were as follows: for {alpha}1C, forward, GGAGTTGGACAAGGCTATGAAGGA (first PCR) and CACCGTCCCATGAGAAGCT (nested PCR), and reverse, GACCTAGAGAGGCAGAGCGAAGGA (first and nested PCRs); for {alpha}1E, forward, CTTCCTGAGGATGACAAGACC (first PCR) and GAAGTCCATCATGAAGGCCA (nested PCR), and reverse, TCAATGGAAGGCATGTTGG (first PCR) and AGCAAGCATGACTTCCTCTG (nested PCR).

Solutions
We used a modified Krebs solution containing (in mmol/L) Na+ 140, K+ 6, Mg2+ 1.2, Ca2+ 2, Cl- 151.4, glucose 10, and HEPES 10 (adjusted to pH 7.4 with Tris base). To obtain elevated Ba2+- or Ca2+-containing solutions, Na+ was replaced isosmotically by Ba2+ or Ca2+. Low Ca2+–containing and Ca2+-free solutions were made by reducing the concentration of Ca2+. The Cs+ internal solution contained (in mmol/L) Cs+ 140, Mg2+ 2.0, Cl- 144, phosphocreatine 5, Na2ATP 1, EGTA 10, and HEPES 10 (adjusted to pH 7.2 with Tris base).

Chemicals
ATP, GTP, HEPES, and EGTA were purchased from Dojin; nifedipine, nimodipine, diltiazem, verapamil, amiloride, CdCl2, NiCl2 and N-methyl-D-glucamine from Sigma; and {omega}-conotoxin GVIA, {omega}-conotoxin MVIIC, and {omega}-agatoxin IVA from Calbiochem.

Statistics
All data are expressed as mean±SEM, and 2-tailed paired or unpaired t tests and the Tukey multiple comparison test were used where appropriate for statistical evaluation.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Prominence of NI-Ca2+ Current in Mesenteric Arterioles
Single myocytes dissociated from the terminal branches of guinea pig mesenteric artery showed a rectangular or ellipsoidal appearance measuring 50 to 80 µm in length and 5 µm in width and had an input capacitance of 13.6±0.2 pF (n=205; range, 8 to 23 pF). These myocytes rapidly contracted to external ATP diffusing out of a patch pipette and thus were readily distinguishable from nonmuscular cells.

Figure 1Down compares Ca2+ currents (ICa) evoked by a depolarizing pulse to 0 mV in the absence and presence of 10 µmol/L nifedipine, between myocytes dissociated from the proximal, terminal, and submucosal branches of guinea pig mesenteric artery. Nifedipine differentially affected ICa. In proximal branches, the majority of ICa was abolished, whereas in the terminal and submucosal branches only a minor part was inhibited, leaving a transient, fast-inactivating component. The magnitude of this NI component was unaffected by pretreatment with 10 µmol/L tetrodotoxin or 100 µmol/L DIDS or by substituting external Na+ and Cl with N-methyl-D-glucamine and benzensulfonate, respectively (data not shown), suggesting that the current is not carried by Na+ and Cl and is likely to be carried by Ca2+. As summarized in Figure 1BDown, the fraction of NI-ICa to the global ICa was significantly larger in submucosal and terminal than in more proximal branches (98±1%, 87±3%, and 30±3%, respectively). These results strongly suggest that the NI-ICa may be more abundantly expressed in the periphery of the mesenteric vasculature.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Differential distribution of NI-ICa. Bath and pipette contained PSS (2 mmol/L Ca2+) and Cs+ internal solution, respectively. Holding potential (VH), -60 mV. A, Inward currents evoked by 400-ms pulses to 0 mV, in the absence (thin curve) and presence (thick curve) of 10 µmol/L nifedipine, in proximal (a; 2nd, 3rd) and submucosal (b) branches. B, Percentage of NI-ICa to global ICa. The numbers of cells tested were 8, 7, and 3 for proximal, terminal, and submucosal branches, respectively. P values indicate the results of the Tukey multiple-comparison test.

The amplitude of NI-ICa recorded with the physiological concentration of Ca2+ (1 to 2 mmol/L) was so small (5 to 20 pA) that its quantitative evaluation was often unreliable because of poor signal-to-noise ratio. To circumvent this problem, as well as to avoid secondary complications caused by Ca2+-induced currents and progressive cell contracture caused by repeated large amounts of Ca2+ entry relative to a small cell volume, external Ca2+ (2 mmol/L) was replaced by a slightly elevated concentration of Ba2+ (5 mmol/L), a procedure that was reported to enhance the amplitude of L-type Ca2+ current with little change in its voltage dependence.21 Indeed, under these ionic conditions, the amplitude of NI-ICa was nearly doubled (Figure 2ADowna), whereas its waveform remained almost unchanged (Figure 2ADownb), and corresponding I-V relationships were almost superimposable when normalized to their peaks (data not shown). In addition, the decay of NI-ICa did not appreciably change by replacing Ca2+ with Ba2+ (Figure 2ADownb), indicating the absence of Ca2+-dependent inactivation in this current component.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Absence of Ca2+-dependent inactivation, nifedipine insensitivity, and rundown-resistant properties of NI-ICa. A, NI-ICa recorded with 2 and 5 mmol/L Ca2+ or 5 mmol/L Ba2+ from the same cell (a). To compare the waveform, the currents are scaled to give the same peak amplitude (b). B, Concentration-inhibition curve for nifedipine fitted to an empirical Hill equation: (1-r)/{1+([drug]/Ki)n}+r, where [drug], Ki, n, and r denote the drug concentration, its IC50 value, cooperativity factor, and the fraction of unblocked current, respectively. Data were evaluated at 0 mV, with from 3 to 6 cells. VH=-80 mV. C, Rundown time course of global ({circ}) and NI (10 µmol/L)–ICa (•) during internal dialysis of nucleotide-free Cs+ internal solution. Bottom axis denotes time elapsed after onset of whole-cell configuration.

Concentration dependence of ICa inhibition by nifedipine was tested with 5 mmol/L Ba2+ in the bath. As summarized in Figure 2BUp, this relationship was well described by a Hill-type equation with an IC50 of 34 nmol/L. At concentrations higher than 1 µmol/L or so, no further inhibition was observed. The IC50 value of 34 nmol/L is comparable with those reported for L-type Ca2+ channels in other tissues, suggesting that the nifedipine-sensitive (NS) component in this preparation reflects a typical L-type Ca2+ current. In fact, other properties of this NS component coincided very well with those of L-type Ca2+ channels (see below), including its rapid rundown on elimination of nucleotide phosphates from, or with inclusion of, 5 mmol/L F in the patch pipette (Figure 2CUp).11 In contrast, the NI component stayed relatively resistant to these procedures (Figure 2CUp, •). Thus, progressive convergence of NI and rundown-resistant components of global ICa was observed, both of which eventually became indistinguishable (Figure 2CUp); the maximally effective concentrations of nifedipine (1 or 10 µmol/L) did not exert any effects on remaining ICa (101±1% of control; n=5). These results strongly indicate that the component of global ICa insensitive to nifedipine does not represent a residual L-type Ca2+ current that was impartially blocked by this compound, thus validating the specificity of nifedipine as a tool to separate putative NI-Ca2+ channels from L-type Ca2+ channels in the present preparation.

NI-ICa Is an HVA Ca2+ Channel
Figure 3Down shows typical I-V relationships of IBa in the absence and presence of 10 µmol/L nifedipine (holding potential, -100 mV; Figure 3ADown), together with that of the latter (NI-IBa) averaged from 5 to 8 different cells (Figure 3BDown; holding potential, -60 or -100 mV). Regardless of holding potential, activation of NI-IBa was detectable at a potential above -50 mV and its peak found around -10 mV. On the other hand, the I-V relationship for NS-IBa showed a slightly more positive activation threshold and peak, but these differed by no more than 10 mV, compared with NI-IBa (dotted curve in Figure 3ADown). Accordingly, the relationships between the degree of activation and the membrane potential of NS-IBa (Figure 4ADown, {circ}) and NI-IBa (Figure 4ADown, •) exhibited a similar sigmoidal pattern; Boltzmann fitting of these relationships gave similar values for the 50% activation potential and slope factor (-15.5 and -8.4 mV for NS-IBa, respectively [dotted curve in Figure 4ADown]; -11.0 and -11.3 mV for NI-IBa, respectively [solid curve in Figure 4ADown]). These results strongly indicate that the channels underlying NI-IBa would pertain to a class of HVA-VDCCs.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. I-V relationships of NS-IBa and NI-IBa. Bath contained 5 mmol/L Ba2+ in this and the following figures, unless otherwise stated. A, I-V relationships of IBa obtained from the same cell, in the absence (•) and presence ({circ}) of 10 µmol/L nifedipine, and their difference (dotted curve). Values are corrected for the leak using 300 µmol/L Cd2+. VH=-100 mV. B, Summary of I-V relationship of NI-IBa with VH of -100 mV ({circ}; n=5) and -60 mV (•; n=8). Data are mean±SEM. Illustrations on the right side indicate actual traces at -60, -40, -30, -10, and 0 mV.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Activation characteristics of NI-IBa. A, Activation curves evaluated by tail current analysis (inset). •, Solid curve, NI-IBa (n=7); {circ}, dotted curve, NS-IBa (ie, global minus NI-IBa; n=11). Curves are drawn according to the best nonlinear fit of data points with the Boltzmann equation, as follows: I=Imax/[1+exp(Vm-V0.5)/k], where I, Imax, Vm, V0.5, and k denote the tail current amplitude conditioned to Vm, its maximum, membrane potential, 50% activation potential, and slope factor, respectively. B, Relationship between the membrane potential and the time constant for 10% to 90% activation. Data are mean±SEM from 4 cells.

Voltage Dependence of Activation and Deactivation Kinetics
Activation of NI-IBa was rapid (of the order of milliseconds) and accelerated by stronger depolarizations (for actual traces see Figures 2AUp, 3BUp, and 5ADown). As summarized in Figure 4BUp (solid curve), the time required for 10% to 90% activation was markedly dependent on the membrane potential (13±2 ms at -30 mV versus 4±1 ms at 20 mV), decreasing e-fold by 48.2 mV. Similarly, the deactivating time course of NI-IBa evaluated by single exponential fitting of tail currents showed a clear dependence on the membrane potential (Figure 5ADown). By reducing the degree of hyperpolarization from a preceding short depolarization to 20 mV, the time constant of deactivation was increased e-fold by 22.9 mV (Figure 5BDown).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Deactivation of NI-IBa. A, Deactivation time course on repolarization to various voltage levels (-110 to 50 mV, 20-mV increments) after full activation at 20 mV. Smooth solid curves are the results of single exponential fits. B, Relationship of deactivation time constant vs membrane potential, evaluated from 5 cells. Data points are fitted by a growing exponential function (solid curve).

Fast and Slow Inactivation Kinetics of NI-IBa
When the pulse duration was set longer than {approx}20 ms, the NI-IBa exhibited a fast, monophasic inactivation (for actual traces, see, eg, Figure 3BUp). As has already been described above, this time course was not appreciably affected by replacing Ba2+ with Ca2+ (Figure 2AUpb), excluding the involvement of the Ca2+-dependent mechanism. This inactivation was complete at potentials more positive than -10 mV during the first 100-ms depolarization (Figure 6ADown), and its time constant (evaluated by single exponential fitting) was {approx}30 ms at 20 mV and was relatively unchanged over a wide range of membrane potentials (e-fold change per 102.1 mV; Figure 6BDown). This sharply contrasts with a marked voltage dependence of activation and deactivation time constants (Figures 4BUp and 5BUp). Figure 6ADown shows the inactivation curves of NI-IBa obtained with 3 conditioning pulses of different lengths (100 ms, 1 second, and 10 seconds), in which prolonged pulse duration shifted the curve toward more negative potentials. The 50% inactivation potentials evaluated by Boltzmann fitting were -30.9, -38.5, and -52.3 mV, respectively, suggesting the existence of another much longer inactivation state, of the order of seconds. Fast and complete inhibition of NI-IBa is entirely different from those of NS-IBa, which inactivates incompletely and more slowly in a similar range of membrane potentials.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Inactivation and recovery of NI-IBa. A, Inactivation curves evaluated by 100-ms ({blacksquare}; n=3), 1-second ({blacktriangleup}; n=5), and 10-second (•; n=5) conditioning pulses. VH=-100 mV. Solid curves are the results of Boltzmann fitting, as shown in Figure 4Up legend. B, Inactivation time constant fitted by a single exponential is plotted against the membrane potential. Data are mean±SEM from 3 to 5 different cells, and the curve is fitted with a single decremental exponential function (solid curve). C, Recovery time course evaluated at -80 mV. I1 and I2 denote the amplitude of NI-IBa at 0 mV at the first pulse (10 seconds) and those during recovery with interpulses of various duration, respectively, the time course of which is fitted by a single exponential (function).

Superimposing the activation and steady-state inactivation curves reveals the existence of a potential range at which NI-IBa would constantly flow (ie, window current). This range is apparent between approximately -60 and -30 mV, being almost overlapping that of the physiological membrane potential (solid and dotted curves in Figure 6AUp; see Discussion).

Recovery of a major part of NI-IBa ({approx}90%) from inactivation was completed within several hundreds of milliseconds, the time course of which could be described by a single exponential with a time constant of {approx}100 ms at -80 mV (Figure 6CUp). In addition, there appeared to be another slow recovery phase explaining the remaining {approx}10% of recovery that proceeded with a time constant of the order of seconds. The time constant of initial fast recovery was considerably shorter than that typical for NS-Ca2+ currents (data not shown).

Effects of Increased Divalent Cation Concentration and Anomalous Mole-Fraction Dependence
Raising the concentration of Ba2+ or Ca2+ in the bath increased the amplitude of NI current with a positive shift in activation threshold and a peak of its I-V relationship (Figure 7ADown). For Ba2+, the degree of shift was {approx}20 mV with a concentration change from 2 to 30 mmol/L. A similar degree of the shift of I-V relationship was also observed for Ca2+, although the peak of its I-V relationship was smaller than that of Ba2+ (not shown). At a concentration of 30 mmol/L, the magnitude of NI-ICa was about twice smaller than that of NI-IBa (0.56±0.11; n=5).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Effects of elevated Ba2+ or Ca2+ concentration on NI-Ca2+ current. A, I-V relationships with various concentrations of Ba2+ (2, 5, 10, and 30 mmol/L). VH=-80 mV. B, Anomalous mole-fraction dependence. Amplitude of mixed current (Ca2+ plus Ba2+) is normalized to that with 10 mmol/L Ba2+ alone. Bottom axis indicates ratio of Ba2+ to Ca2+, keeping the sum of Ca2+ and Ba2+ concentrations at 10 mmol/L. The number of cells tested was 5.

The NI current showed a complex dependence on the concentration of Ba2+ and Ca2+ when both cations were mixed (Figure 7BUp). By changing the molar ratio of Ba2+ to Ca2+ while keeping the sum of their concentrations at 10 mmol/L, the amplitude of the mixed current became minimal with the ratio of 8:2, even though Ba2+ can carry a larger current than Ca2+ when each cation is present alone (leftmost versus rightmost circles in Figure 7BUp). This phenomenon, called anomalous mole-fraction dependence,22 together with the results described in the preceding paragraph, indicates some interaction of permeating ions (Ba2+ and Ca2+) at multiple binding sites in the channel pore that has commonly been observed for other types of HVA Ca2+.23 24

Inorganic and Organic Blockers
To further clarify similarities and differences between the NI-Ca2+ channels in our preparation and other types of VDCCs, the effects of known VDCC blockers were tested. Figure 8ADown shows the concentration-inhibition curve of NI-IBa for Cd2+ and Ni2+, with 5 mmol/L Ba2+ as the charge carrier. The IC50 values evaluated by Hill analysis were 5.8 and 68 µmol/L with a similar cooperativity factor of approximately unity for Cd2+ and Ni2+, respectively, suggesting a {approx}10-fold greater efficacy of Cd2+.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 8. Pharmacology of NI-IBa. All data were evaluated at 0 mV. A, Concentration-inhibition curves for Cd2+, Ni2+, and amiloride, which are fitted by the Hill equation in Figure 2BUp. For Cd2+ and Ni2+, r is set to 0. VH=-60 mV. B, Summary of inhibition by various blockers (labeled). VH=-80 mV. Data are mean±SEM from 3 to 13 different cells. CTx indicates {omega}-conotoxin; Aga, {omega}-agatoxin.

In the next series of experiments, the inhibitory effects of several widely used L-type Ca2+ channel blockers other than nifedipine on NI-IBa were investigated. Two structurally unrelated L-channel blockers to DHP, verapamil and diltiazem, suppressed IBa dose dependently, but no more than nifedipine, at a concentration as high as 100 µmol/L (P>0.05 with the Tukey test; Figure 8BUp). In contrast, another potent DHP compound, nimodipine (10 µmol/L), which has been reported to suppress T-type Ca2+ channels as well,25 further decreased the amplitude of the NI part of IBa by {approx}40% (P<0.01 with unpaired t test; Figure 8BUp). A similar extent of inhibition by 10 µmol/L nimodipine was also observed when IBa was recorded with 5 mmol/L internal solution containing F (data not shown). In addition, amiloride, a well-known potent blocker of T-type Ca2+ currents, dose-dependently inhibited the NI-IBa (Figure 8AUp; IC50, 107 µmol/L), but in this case, complete inhibition was not observed up to a concentration of 2 mmol/L.

In a final series of experiments, several peptide toxins known to block various types of HVA Ca2+ currents ({omega}-conotoxins GVIA and MVIIC and {omega}-agatoxin IVA) were tested. However, none of these were found to affect the NI-IBa recorded with 5 mmol/L Ba2+ (Figure 8BUp).

RT-PCR
The above results strongly suggest that the Ca2+ channels underlying NI-IBa may be homologous to "R-type" channels (for details, see Discussion). Thus, we explored possible expression of its molecular counterpart {alpha}1E subunit in comparison with that of the {alpha}1C subunit, which is likely to be expressed as the NS component, but to a lesser extent, in the present preparation (see Figure 1Up).

Figure 9Down shows an ethidium bromide staining of RT-PCR products obtained from the total RNA of guinea pig cerebellum or terminal branches of mesenteric arteries. The products of both Ca2+ channel {alpha}1C and {alpha}1E subunits could be detected in the cerebellum (C lanes in Figure 9Down), whereas only the {alpha}1C was positive in the terminal branches of mesenteric artery, using the same primers (MA lane in left panel of Figure 9Down).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 9. RT-PCR detection of VDCC {alpha}1C and {alpha}1E subunit mRNA in guinea pig cerebellum and terminal branches of guinea pig mesenteric arteries. Shown are results of nested PCR using 1 µg total RNA. Leftmost lane in each panel shows a 100-bp ladder. C indicates cerebellum; MA, mesenteric artery.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The results of this study have suggested the predominant presence of NI-Ca2+, HVA-Ca2+ channels in the terminal branches of mesenteric artery. Possible contamination of "residual" L-type Ca2+ current in our experiments has largely been excluded by the specificity of nifedipine (Figure 2BUp), as well as by its identification as the rundown-resistant ICa (Figure 2CUp). These facts strongly indicate, together with the observed distinct properties of NS-IBa, that NI-IBa in the present preparation would represent a robust molecular entity disparate from the L-type VDCCs. Although DHP-insensitive VDCCs have already been demonstrated in several different types of cardiovascular tissues (almost all categorized as T-type VDCCs),11 12 13 14 15 16 17 26 a few of which are somewhat similar to NI-Ca2+ current in the present study,13 26 extremely high expression and unique properties of NI-Ca2+ channels in the present preparation are not comparable with those of any of previous reports, for the following reasons. (1) The fraction of NI-ICa was found to increase dramatically along the periphery of mesenteric artery, amounting to 70% to 100% of global ICa in the terminal and submucosal branches (Figure 1BUp). This is unlikely to have resulted from the rapid rundown of L-type Ca2+ channels that occurs during a diffusional exchange between the cytosol and the patch pipette, because the effect of nifedipine on ICa was evaluated shortly after the onset of whole-cell configuration under conditions that minimize L-type Ca2+ current rundown (see also Figure 2CUp). (2) The biophysical properties of NI-IBa are not unequivocally accountable for by the knowledge available for hitherto-identified DHP-insensitive, rapidly inactivating VDCCs (TableDownDown). Despite similarities in gating kinetics to T-type, LVA-Ca2+ channels (but see below), the observed pattern of activation of NI-IBa (threshold and peak of I-V curve: -50 and -10 mV, respectively; V0.5, -11 mV with 5 mmol/L Ba2+; Figure 3Up) and other properties associated with the pore structure (higher permeability of Ba2+ than Ca2+, anomalous mole-fraction dependence, and much stronger inhibitory efficacy of Cd2+ than Ni2+) are clearly of the HVA type.23 24 (3) The pharmacological profile of NI-IBa in the present study does not completely match the criteria widely used to subclassify the VDCCs.28 36 The total resistance of NI-IBa to nifedipine as well as verapamil, diltiazem, or peptide blockers ({omega}-conotoxins GVIA and MVIIC and {omega}-agatoxin IVA) is obviously incompatible with the involvement of L-, N- or P/Q-type Ca2+ channels, and the relatively high sensitivities of NI-IBa to nimodipine and amiloride does not fit with "typical" R-type Ca2+ channels.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of DHP-Insensitive, Rapidly Inactivating Ca2+ Currents


View this table:
[in this window]
[in a new window]
 
Table 1A. Continued

Recent cloning and expression studies have disclosed that the major properties of VDCCs such as divalent cation permeation/block and pharmacological sensitivities to drugs such as the DHPs (but see Reference 3737 ) and peptide toxins would be conferred exclusively by the structural differences in the {alpha}1 subunit that not only forms the ion conductive pore but also contains the binding sites for various blockers and agonists. In contrast, the current amplitude (thus, the number of channels inserted in the cell membrane) and the gating properties (ie, activation and inactivation kinetics) of VDCCs could strongly be modified by other auxiliary subunits, ß and {alpha}2-{delta} subunits.36 38 For example, it has been reported that coexpression of distinct ß subunits with the {alpha}1A, {alpha}1B, or {alpha}1E subunit results in a markedly enhanced current amplitude and a variable extent of hyperpolarizing shifts in activation and steady-state inactivation curves with significantly altered kinetics.30 32 38 39 40 In light of these molecular data, the apparently confounding properties of NI-Ca2+ channels described above could be explained by the following interpretation. The putative {alpha}1 subunit responsible for the NI-Ca2+ channels would be homologous to those constituting HVA-VDCCs (ie, {alpha}1C, {alpha}1D, {alpha}1S, {alpha}1B, {alpha}1A, or {alpha}1E) and devoid of the sequence essential for binding to DHP and toxins, because the observed properties representing the pore structure and blocker sensitivities are clearly of HVA type (see above) (TableUpUp). On the other hand, an apparent resemblance of NI-Ca2+ channels to T-type Ca2+ channels in gating kinetics and pharmacology such as relatively slow rates of activation and deactivation (millisecond order), the presence of fast and slow phases of inactivation,11 and partial sensitivities to nimodipine and amiloride would not necessarily reflect their essential similarities in the primary structure of the {alpha}1 subunit but could to some extent be accounted for by complex interactions between the {alpha}1 and auxiliary subunits. It may thus be reasonable to speculate that the most closely related member of VDCCs to the NI-Ca2+ channels in the present study is the R-type Ca2+ channel (or its most likely molecular counterpart, the {alpha}1E subunit), and some differences found between them such as differential deactivation rates (millisecond versus submillisecond) and sensitivities to nimodipine or amiloride (intermediate versus null or low) may be attributable to a rather broad diversity of R-type Ca2+ channels or {alpha}1E subunits (TableUpUp). However, the results of RT-PCR do not simply support this possibility. Using the specific primers discriminating the {alpha}1C and {alpha}1E subunits in cerebellum, only the {alpha}1C subunit, which seems functionally less abundantly expressed (Figure 1Up), was detected in the terminal branches of mesenteric artery (Figure 9Up). Although inadequacy of the primers used for detecting the {alpha}1E mRNA in the present preparation remains to be excluded, the most intriguing possibility is that an entirely new {alpha}1 subunit encoded by a yet-to-be-identified gene(s) or a novel isoform of the {alpha}1 subunit produced by alternative RNA splicing from known NI-HVA {alpha}1-encoding genes (eg, {alpha}1B, {alpha}1A, or {alpha}1E) might be abundantly expressed in the periphery of mesenteric circulation. Moreover, if alternative splicing could alter the properties of VDCC {alpha}1 subunit such as DHP sensitivity37 and voltage dependence more dramatically than currently envisaged, the involvement of {alpha}1C, {alpha}1G, or {alpha}1H could not be completely excluded either. A more extensive database on single-channel recording and molecular technologies will be necessary to distinguish between these possibilities.

Possible Physiological Implications
Despite its rapidly inactivating nature, a significant overlap of activation and steady-state inactivation curves of NI-IBa strongly suggest that there is a range of membrane potentials in which a small but significant magnitude of Ca2+ current would continuously flow (Figure 6AUp). This noninactivating current, the so-called "window current," would not be an "artifact" because of the use of 5 mmol/L Ba2+ as a charge carrier, given that substitution of Ca2+ with Ba2+ did not significantly affect the inactivation time course (Figure 2AUpb) and the observed I-V relationship with 5 mmol/L Ba2+ was comparable to that with the physiological concentration of Ca2+ (2 mmol/L) (see Results; see also Reference 2121 ). The predicted range of window current (Figure 6AUp) would overlap the physiological range of membrane potential of VSMCs (-75 to 50 mV),1 and its magnitude would change severalfold by small changes in this potential range. For example, a {approx}5-fold increase (from 0.1 to 0.5 pA) is expected with a potential change from -80 to -50 mV, taking the mean current density of 1.6 pA/pF at -10 mV (Figure 3BUp), capacitance of 13.6 pF, and the parameters for activation and inactivation. This means that small depolarizations or hyperpolarizations caused by neurotransmitters and other vasoactive substances, such as noradrenaline, calcitonin gene–related peptide, vasoactive intestinal peptide, and endothelin,1 2 9 could significantly alter the rate of Ca2+ influx through NI-Ca2+ channels, thereby profoundly affecting the [Ca2+]i of arteriolar smooth muscle cells, which have an extremely small cell volume (of the order of subpicoliters). This is strikingly similar to the postulated role of L-type Ca2+ channels in tone regulation of more proximal and larger-sized arteries.4 In addition, our preliminary data have suggested that NI-Ca2+ currents showing almost identical properties to the NI-Ca2+ current in the present study may also exist in the rabbit and rat terminal mesenteric arteries (H. Morita et al, unpublished data, 1999). This fact, combined with our observation that the fraction of NI-Ca2+ channels appears to approach 100% in the more peripheral branches of mesenteric artery, may further imply an intriguing role of these channels, together with L-type Ca2+ channels,41 for regulating the small arteriolar circulation.


*    Acknowledgments
 
We thank the Ian Potter Foundation and the National Health and Medical Research Council of Australia (Grant 960196) for travel and research funding (to H.C.). Thanks are also due to Dr Y. Mori, National Institute for Physiological Sciences (Okazaki, Japan) for pertinent advice about RT-PCR.


*    Footnotes
 
1 Both authors contributed equally to the study. Back

Received March 22, 1999; accepted July 13, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Kuriyama H, Kitamura K, Nabata H. Pharmacological and physiological significance of ion channels and factors that modulate them in vascular tissues. Pharmacol Rev. 1995;47:387–573.[Medline] [Order article via Infotrieve]

2. Lundberg JM. Pharmacology of cotransmission in the autonomic nervous system: integrative aspects on amines, neuropeptides, adenosine trisphosphate, amino acids and nitric oxide. Pharmacol Rev. 1996;48:113–178.[Medline] [Order article via Infotrieve]

3. Meininger GA, Davis MJ. Cellular mechanisms involved in the vascular myogenic response. Am J Physiol. 1992;263:H647–H659.[Abstract/Free Full Text]

4. Nelson MT, Patlak JB, Worley JF, Standen NB. Calcium channels, potassium channels, and voltage dependence of arterial smooth muscle tone. Am J Physiol. 1990;259:C3–C18.[Abstract/Free Full Text]

5. Knot HJ, Nelson MT. Regulation of arterial diameter and wall [Ca2+]i in cerebral arteries of rat by membrane potential and intravascular pressure. J Physiol (Lond). 1998;598:199–209.

6. McCarron JG, Crichton CA, Langton PD, Mackenzie A, Smith GL. Myogenic contraction by modulation of voltage-dependent calcium currents in isolated rat cerebral arteries. J Physiol (Lond). 1997;498:371–379.[Abstract/Free Full Text]

7. Nelson MT, Worley JF. Dihydropyridine inhibition of single calcium channels and contraction in rabbit mesenteric artery depends on voltage. J Physiol (Lond). 1989;412:65–91.[Abstract/Free Full Text]

8. Guyton AC, Hall JE. Overview of the circulation: medical physics of pressure, flow, and resistance. Chapter 14. In: Guyton AC, Hall JE, eds. Textbook of Medical Physiology. Philadelphia, Pa: WB Saunders Co Inc; 1996:161–169.

9. Hirst GDS, Edwards FR. Sympathetic neuroeffector transmission in arteries and arterioles. Physiol Rev. 1989;69:546–604.[Free Full Text]

10. Morita H, Inoue R, Cousins H, Ito Y. Dihydropyridine (DHP)-insensitive high-voltage activated (HVA) Ca2+ currents in the guinea-pig mesenteric arteriole. Jpn J Pharmacol. 1999;79(suppl I):40P.

11. Akaike N, Kanaide H, Kuga T, Nakamura M, Sadoshima J, Tomoike H. Low-voltage-activated calcium current in rat aorta smooth muscle cells in primary culture. J Physiol (Lond). 1989;416:141–160.[Abstract/Free Full Text]

12. Benham CD, Hess P, Tsien RW. Two types of calcium channels in single smooth muscle cells from rabbit ear artery studied with whole-cell and single-channel recordings. Circ Res. 1987;61(suppl I):I-10–I-16.

13. Friedman ME, Suarez-Kurtz G, Kaczorowski J, Katz GM, Reuben JP. Two calcium currents in a smooth muscle cell line. Am J Physiol. 1986;250:H699–H703.

14. Ganitkevich VYA, Isenberg G. Contribution of two types of calcium channels to membrane conductance of single myocytes from guinea-pig coronary artery. J Physiol (Lond). 1990;426:19–42.[Abstract/Free Full Text]

15. Loirand G, Mironneau C, Mironneau J, Pacaud P. Two types of calcium currents in single smooth muscle cells from rat portal vein. J Physiol (Lond). 1989;412:333–349.[Abstract/Free Full Text]

16. Smirnov SV, Aaronson PI. Ca2+ currents in single myocytes from human mesenteric arteries: evidence for a physiological role of L-type channels. J Physiol (Lond). 1992;457:455–475.[Abstract/Free Full Text]

17. Yatani A, Seidel CL, Allen J, Brown AM. Whole-cell and single-channel calcium currents of isolated smooth muscle cells from saphenous vein. Circ Res. 1987;60:523–533.[Abstract/Free Full Text]

18. Waniishi Y, Inoue R, Morita H, Teramoto N, Abe K, Ito Y. Cyclic GMP-dependent but G-kinase-independent inhibition of Ca2+-dependent Cl currents by NO donors in cat tracheal smooth muscle. J Physiol (Lond). 1998;511:719–731.[Abstract/Free Full Text]

19. Borman B, Lakaye B, Minet A, Zorzi W, Vergnes M, Marescaux C, Grisar T. Expression of mRNA encoding {alpha}1E and {alpha}1G subunit in the brain of a rat model of absence epilepsy. NeuroReport. 1999;10:569–574.[Medline] [Order article via Infotrieve]

20. Wyatt CN, Page KM, Berrow NS, Brice NL, Dolphin AC. The effect of overexpression of auxiliary Ca2+ channel subunits on native Ca2+ channel currents in undifferentiated mammalian NG108–15 cells. J Physiol (Lond). 1998;510:347–360.[Abstract/Free Full Text]

21. Ganitkevich VYA, Shuba MF, Smirnov SV. Saturation of calcium channels in single isolated smooth muscle cells of guinea-pig taenia caeci. J Physiol (Lond). 1988;399:419–436.[Abstract/Free Full Text]

22. Hille B. Selective permeability: saturation and binding. Chapter 14. In: Ion Channels of Excitable Membrane. 2nd ed. Sunderland, Mass: Sinauer Associates, Inc; 1992.

23. Hess P, Tsien RW. Mechanism of ion permeation through calcium channels. Nature. 1984;309:453–456.[Medline] [Order article via Infotrieve]

24. Wakamori M, Strobec M, Niidome T, Teramoto T, Imoto K, Mori Y. Functional characterization of ion permeation pathway in the N-type Ca2+ channel. J Neurophysiol. 1998;79:622–634.[Abstract/Free Full Text]

25. Randall AD, Tsien RW. Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology.. 1997;36:879–893.[Medline] [Order article via Infotrieve]

26. Tohse N, Masuda H, Sperelakis N. Novel isoform of Ca2+ channel in rat fetal cardiomyocytes. J Physiol (Lond). 1992;451:295–306.[Abstract/Free Full Text]

27. Ellinor PT, Zhang JF, Randall AD, Zhou M, Scharz TL, Tsien RW, Horne WA. Functional expression of a rapidly inactivating neuronal calcium channel. Nature. 1993;363:455–458.[Medline] [Order article via Infotrieve]

28. Zhang JF, Randall AD, Ellinor PT, Horne WA, Sather WA, Tanabe T, Scharz T, Tsien RW. Neuropharmacology. 1993;32:1075–1088.[Medline] [Order article via Infotrieve]

29. Soong TW, Stea A, Hodson CD, Dubel SJ, Vincent SR, Snutch TP. Structure and functional expression of a member of the low voltage-activated calcium channel family. Science. 1993;260:1133–1136.[Abstract/Free Full Text]

30. Stephens GJ, Page KM, Burley JR, Berrow NS, Dolphin AC. Functional expression of rat brain cloned {alpha}1E calcium channels in COS-7 cells. Pflugers Arch. 1997;433:523–532.[Medline] [Order article via Infotrieve]

31. Wakamori M, Niidome T, Furutama D, Furuichi T, Mikoshiba K, Fujita Y, Tanaka I, Katayama K, Yatani A, Schartz A, Mori Y. Distinctive functional properties of the neuronal BII (Class E) calcium channel. Receptors and Channels. 1994;2:303–314.[Medline] [Order article via Infotrieve]

32. Williams ME, Marubio LM, Deal CR, Hans M, Brust PF, Philipson LH, Miller RJ, Johnson EC, Harpold MM, Ellis SB. Structure and functional characterization of neuronal {alpha}1E calcium channel subtypes. J Biol Chem. 1994;269:22347–22357.[Abstract/Free Full Text]

33. Nooney JM, Lambert RC, Feltz A. Identifying neuronal non-L Ca2+ channels: more than stamp collecting? Trends Pharmacol Sci. 1997;18:363–371.[Medline] [Order article via Infotrieve]

34. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, Lee JH. Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature. 1998;391:896–900.[Medline] [Order article via Infotrieve]

35. Cribbs LL, Lee JH, Yang J, Satin J, Zhang Y, Daud A, Barclay J, Williamson MP, Fox M, Rees M, Perez-Reyes E. Cloning and characterization of {alpha}1H from human heart, a member of the T-type Ca2+ channel gene family. Circ Res. 1998;83:103–109.[Abstract/Free Full Text]

36. Mori Y, Mikala G, Kobayashi T, Koch S, Wakamori M, Schwarz A. Molecular pharmacology of voltage-dependent calcium channels. Jpn J Pharmacol. 1996;72:83–109.[Medline] [Order article via Infotrieve]

37. Welling A, Kwan YW, Bosse E, Flockerzi V, Hofmann F, Kass RS. Subunit-dependent modulation of recombinant L-type calcium channels: molecular basis for dihydropyridine tissue selectivity. Circ Res. 1993;73:974–980.[Abstract/Free Full Text]

38. Walker D, Waard MD. Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function. Trends Neurosci. 1998;21:148–154.[Medline] [Order article via Infotrieve]

39. Stephens GJ, Brice NL, Berrow NS, Dolphin AC. Facilitation of rabbit {alpha}1B calcium channels: involvement of endogenous Gß{gamma} subunits. J Physiol (Lond). 1998;509:15–27.[Abstract/Free Full Text]

40. Waard MD, Campbell KP. Subunit regulation of the neuronal {alpha}1A Ca2+ channel expressed in Xenopus oocytes. J Physiol (Lond). 1995;485:619–634.[Abstract/Free Full Text]

41. Bowles DK, Hu Q, Laughlin MH, Sturek M. Exercise training increases L-type calcium current density in coronary smooth muscle. Am J Physiol. 1998;275:H2159–H2169.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Physiol.Home page
E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald
Voltage-dependent calcium channels of dog basilar artery
J. Physiol., April 15, 2007; 580(2): 523 - 541.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S.-Z. Xu, G. Boulay, R. Flemming, and D. J. Beech
E3-targeted anti-TRPC5 antibody inhibits store-operated calcium entry in freshly isolated pial arterioles
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2653 - H2659.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. R. Kovac, H. G. Preiksaitis, and S. M. Sims
Functional and molecular analysis of L-type calcium channels in human esophagus and lower esophageal sphincter smooth muscle
Am J Physiol Gastrointest Liver Physiol, December 1, 2005; 289(6): G998 - G1006.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Ishiguro, T. L. Wellman, A. Honda, S. R. Russell, B. I. Tranmer, and G. C. Wellman
Emergence of a R-Type Ca2+ Channel (CaV 2.3) Contributes to Cerebral Artery Constriction After Subarachnoid Hemorrhage
Circ. Res., March 4, 2005; 96(4): 419 - 426.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
V. Pucovsky, R. F Moss, and T. B Bolton
Non-Contractile Cells with Thin Processes Resembling Interstitial Cells of Cajal Found in the Wall of Guinea-Pig Mesenteric Arteries
J. Physiol., October 1, 2003; 552(1): 119 - 133.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
E. Perez-Reyes
Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels
Physiol Rev, January 1, 2003; 83(1): 117 - 161.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Salomonsson, F. Gustafsson, D. Andreasen, B. L. Jensen, and N.-H. Holstein-Rathlou
Local electric stimulation causes conducted calcium response in rat interlobular arteries
Am J Physiol Renal Physiol, September 1, 2002; 283(3): F473 - F480.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Y. Chul Kim, S. Don Koh, and K. M Sanders
Voltage-dependent inward currents of interstitial cells of Cajal from murine colon and small intestine
J. Physiol., June 15, 2002; 541(3): 797 - 810.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R E Haddock, G D S Hirst, and C E Hill
Voltage independence of vasomotion in isolated irideal arterioles of the rat
J. Physiol., April 1, 2002; 540(1): 219 - 229.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H. Morita, T. Sharada, T. Takewaki, Y. Ito, and R. Inoue
Multiple regulation by external ATP of nifedipine-insensitive, high voltage-activated Ca2+ current in guinea-pig mesenteric terminal arteriole
J. Physiol., March 15, 2002; 539(3): 805 - 816.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Eto, Y. Ohya, Y. Nakamura, I. Abe, and M. Iida
Intracellular Angiotensin II Stimulates Voltage-Operated Ca2+ Channels in Arterial Myocytes
Hypertension, February 1, 2002; 39(2): 474 - 478.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
K. M. Sanders
Signal Transduction in Smooth Muscle: Invited Review: Mechanisms of calcium handling in smooth muscles
J Appl Physiol, September 1, 2001; 91(3): 1438 - 1449.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. A. Hill, H. Zou, S. J. Potocnik, G. A. Meininger, and M. J. Davis
Signal Transduction in Smooth Muscle: Invited Review: Arteriolar smooth muscle mechanotransduction: Ca2+ signaling pathways underlying myogenic reactivity
J Appl Physiol, August 1, 2001; 91(2): 973 - 983.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. Gustafsson, D. Andreasen, M. Salomonsson, B. L. Jensen, and N.-H. Holstein-Rathlou
Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca2+ channels
Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H582 - H590.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. B. Hansen, B. L. Jensen, D. Andreasen, U. G. Friis, and O. Skott
Vascular Smooth Muscle Cells Express the {alpha}1A Subunit of a P-/Q-Type Voltage-Dependent Ca2+Channel, and It Is Functionally Important in Renal Afferent Arterioles
Circ. Res., November 10, 2000; 87(10): 896 - 902.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Pignier and D. Potreau
Characterization of nifedipine-resistant calcium current in neonatal rat ventricular cardiomyocytes
Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2259 - H2268.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Evans and C. H. Gelband
A Novel Ca2+ Channel in Vascular Smooth Muscle?
Circ. Res., October 1, 1999; 85(7): 651 - 652.
[Full Text] [PDF]


Home page
J. Physiol.Home page
R E Haddock, G D S Hirst, and C E Hill
Voltage independence of vasomotion in isolated irideal arterioles of the rat
J. Physiol., April 1, 2002; 540(1): 219 - 229.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morita, H.
Right arrow Articles by Inoue, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, H.
Right arrow Articles by Inoue, R.
Related Collections
Right arrow Animal models of human disease
Right arrow Ion channels/membrane transport
Right arrow Coronary circulation