© 1999 American Heart Association, Inc.
Molecular Medicine |
Thyroid Hormone Regulates Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel (HCN2) mRNA in the Rat Heart
From the Thyroid Division, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School (J.P., P.R.L.), Boston, Mass; the Division of Endocrinology and Metabolism, Department of Medicine, University of Pittsburgh School of Medicine (L.A.B.), Pa; and Department of Internal Medicine and Endocrinology, The Medical University of Warsaw (J.P.), Poland.
Correspondence to Janusz Pachucki, MD, Department of Internal Medicine and Endocrinology, The Medical University of Warsaw, ul. Banacha 1 a, 02-097 Warsaw, Poland. E-mail janusz.pachucki{at}amwaw.edu.pl
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Thyroid hormone regulation of the cardiac pacemaker gene, the hyperpolarization-activated cyclic nucleotide-gated channel gene (HCN2), was studied in rats by Northern analysis. Thyroid hormone administration to hypothyroid rats resulted in a doubling of the HCN2/ß-actin mRNA ratio. A smaller, not statistically significant, increase in HCN2 mRNA occurred when euthyroid animals were made hyperthyroid. A single large dose of L-triiodothyronine given to hypothyroid rats caused a 4.7-fold increase in myocardial HCN2 mRNA expression level and only a 2.3-fold increase in the ß-actin mRNA level. Although the rat HCN2 promoter has not been cloned, we identified a consensus thyroid hormone response element in the promoter sequence of the human HCN2 gene. Therefore, the increase in rat HCN2 mRNA is likely due to L-triiodothyronine stimulation of HCN2 gene transcription. The results suggest that the regulation of heart rate by thyroid hormone may be explained, at least in part, by the positive effect of this hormone on HCN2 gene expression.
Key Words: HCN2 • heart • triiodothyronine • transcription
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It is well known that changes in thyroid state alter heart rate. The mechanism for this effect is unknown, although intrinsic changes in myocardial genes and changes brought about by alterations in whole-body oxygen consumption are likely to be involved.1 2 3 4 Previous studies showed that the rate of contraction of the isolated, denervated heart5 6 7 or of embryonic myocardial cells in cell culture8 9 are similarly affected by thyroid hormone, indicating that thyroid hormone has an intrinsic positive chronotropic effect.
Thyroid hormone regulates the expression of mRNAs encoding several voltage-dependent potassium channels (Kv).10 11 12 13 These channels, however, are primarily responsible for the duration and shape of action potentials but not for the rate of slow diastolic depolarization.14 It is now generally accepted that pacemaker current in cardiac myocytes is related to a specific mixed sodium-potassium inward current, called If in the sinus node, rather than to deceleration of outward potassium current.15
The molecular basis for the myocardial pacemaker has been further elucidated by the cloning of cDNAs encoding the mammalian hyperpolarization-activated cyclic nucleotide-gated channels.16 17 Two mRNA isoforms of the hyperpolarization-activated cyclic nucleotide-gated channels (HCN) have been identified in myocardium, HCN2 (old names in mouse, HAC1 and BCNG-2; and in humans, IH1) and HCN4 (old name, BCNG-3). The mixed Na+/K+ current through these channels is similar to the depolarization current in the sinus node.15 17 Recent data indicate that HCN2 and HCN4 gene products might be responsible for fast and slow components of the If current.18 Moreover, HCN2 mRNA is expressed throughout the myocardium,16 17 consistent with latent pacemaker activity in all cardiac myocytes.19
We speculated that the intrinsic chronotropic effect of thyroid hormone might be explained by increases in HCN2 gene expression. To test this hypothesis, we analyzed HCN2 mRNA in rat myocardium from different thyroidal states. We found a significant positive effect of thyroid hormone on this mRNA, suggesting that this could be 1 of the mechanisms for the positive effect of thyroid hormone on heart rate.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Materials
[
-32P] dCTP and Gene Screen membranes
were purchased from New England Nuclear. Prime-it II random
hexamer labeling kit was purchased from Stratagene, and thyroxine,
L-triiodothyronine (T3), and methimazole (MMI) were
purchased from Sigma. TriZol was purchased from Gibco BRL.
Animals
All treatments were approved and in compliance with the
requirements of the Animal Welfare Committee of the Brigham and
Women's Hospital and the Animal Care and Use Committee of the
University of Pittsburgh. Adult male Sprague-Dawley rats (Harlan
Sprague-Dawley, Indianapolis, Ind, and Charles River Laboratory,
Worcester, Mass) weighing between 125 and 200 g were acclimated to
a cycle of 12 hours of light/12 hours of dark and a controlled
temperature. Rat chow and tap water were provided ad libitum.
Hypothyroidism was induced by the addition of MMI (0.02% or 0.025%)
to the drinking water. Hypothyroidism was assessed by plateau of weight
and by serum thyroid hormone measurements.
Three experiments were performed. In the first, a thyrotoxic state was induced in euthyroid rats by intraperitoneal injections of T3 (50 µg/100 g body weight every other day for 8 days). Two control groups were composed of age-matched euthyroid rats and hypothyroid rats (3 weeks on 0.025% MMI in drinking water). In the second experiment, rats were given 0.02% MMI in water for 5 weeks. During the last 2 weeks, they also received daily intraperitoneal injections of graded doses of T3 or L-thyroxine (T4), as previously described.20 The doses were as follows: 0, 0.25, 1, and 3 µg of T3 and 0, 0.1, 0.2, 0.5, and 1.5 µg of T4 per 100 g of body weight. Age-matched euthyroid rats served as controls. There were 6 rats in each group in the first 2 experiments. The third experiment evaluated the minimal time requirement for the T3 effect on HCN2 mRNA. MMI-treated (6 weeks) rats were given a single intraperitoneal injection of T3 (200 µg) 4, 12, and 24 hours before being euthanized. This T3 dose was previously shown to saturate all thyroid hormone receptors.21 22 Euthyroid rats were used as controls. There were 3 rats in the 4-hour response group. The remaining groups in this experiment had 4 animals. Rats were killed under pentobarbital anesthesia. Blood was collected through exsanguination, and hearts were quickly removed and stored at -80°C until RNA extraction.
Isolation and Analysis of RNA
RNA was extracted from the rat ventricular
myocardium using TriZol reagent according to the
manufacturer's instructions. RNA concentration was estimated from the
A260 value. Total RNA (10 µg) was electrophoresed through 1%
agarose, 5% formaldehyde, and 1x MOPS gel. Ethidium bromide was added
to sample buffer. Osmotic transfer of RNA to Gene Screen membranes was
done by Vacugene in 10x SSPE. The quality of RNA and completion of
transfer were confirmed by an A260 to A280 absorption ratio, 28S to 18S
ribosomal RNA band ratios on the membrane, and the absence of ribosomal
RNA bands on the gels after transfer. After cross-linking, membranes
were hybridized with specific probes under high-stringency conditions
(50% formamide, 5x SSPE, 1x Denhardt's reagent, and 50 µg/mL
denaturated salmon sperm DNA at 42°C). The membranes were washed 3
times (final wash with 0.1x SSPE and 0.1% sodium dodecyl
sulfate at 42°C). Quantification of mRNA was performed using a
PhosphorImager and software from Molecular Dynamics. All blots were
hybridized with a ß-actin probe to normalize specific mRNA signals.
Several identical samples were placed on all gels to allow comparisons
between them.
A mouse HCN2 cDNA fragment (
0.5 kb) was made by reverse
transcription–polymerase chain reaction (RT-PCR) reaction from
euthyroid mouse cortex RNA. The primer sequences AATGGGGTTGTGGGTTAATGG
for RT and TTTGACAATCTCCTGGATGATG, GATTGTGAACTTCAACTGCCG for PCR were
derived from the mouse 3.1 kb cDNA sequence (accession number,
AJ225122). The cDNA was confirmed by sequencing. Specific - and
ß-MHC fragments from nonhomologous 3' regions of rat myosin heavy
chain cDNAs (accession numbers, K01465 and X15939) were obtained by
RT-PCR reactions from euthyroid and hypothyroid rat heart RNA,
respectively. The primers for -MHC were
CGAACATTCGTATTTATTGTGGGATGGCAA for RT and AATGCACGATGAGGAATAAC
(nucleotides 221 to 240), CACCAAAATTCCCACCC
(nucleotides 340 to 356) for PCR; those for ß-MHC were
TTGGCTTGAAGGAAAATTGCTTTAT for RT and CCTGAATGAAGAGTAGATCTTG
(nucleotide 5803 to 5834), GCTTTATTGTGTTTCTGCC
(nucleotides 5889 to 5907) for PCR. Mouse ß-actin cDNA
was a gift from Dr B.M. Spiegelman (Dana Farber Cancer Institute,
Boston, Mass). Radiolabeling of HCN2 and ß-actin probes was
performed by the random hexamer method using
[32P] dCTP. Labeling of - and ß-MHC
probes was performed using Klenow (-Exo) enzyme (New England Biolabs)
with specific anti-sense primers complementary to the respective 3'-end
template in the presence of [32P] dCTP and 3
other dNTPs.
Hormone Measurements
Plasma T4 and T3 concentrations were measured by RIA in the NIH
General Clinical Research Center core laboratory of the Brigham and
Women's Hospital or by RIA kit (Coat-A-Count, Diagnostic
Product Corp).
Statistical Analysis
Statistical analysis was done using a general linear
model algorithm from the SPSS program, version 7.0 (SPSS Inc). Groups
were compared by Tukey's test when ANOVA within a given family of
groups was statistically significant. When indicated, log
transformation was performed to equalize variances between the groups.
The signal intensity of all mRNA bands was expressed relative to the
ß-actin mRNA content in the same blot. The units for the mRNA
quantities shown on the figures are normalized to the average
euthyroid level for that specific mRNA. For example, a value of 1 of
ß-MHC mRNA equals the average of all the euthyroid levels for ß-MHC
mRNA (corrected for ß-actin mRNA) from all 3 experiments.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the initial experiment, the level of HCN2 and
- and ß-MHC
mRNAs were quantified in myocardial RNA from hypothyroid, euthyroid,
and hyperthyroid rats (Figure 1
).
Hypothyroidism resulted in a decrease of both serum T4 and T3 levels as
well as in lower weight. All T3-treated rats had an increase in serum
T3 concentrations above the euthyroid level. A linear relationship
between thyroidal state and HCN2 mRNA levels was found
(P<0.001 for linear contrast), with the highest level in
the hyperthyroid and the lowest in the hypothyroid state. The
difference between the hypothyroid and the euthyroid groups was greater
than that between the euthyroid and the hyperthyroid groups (Figure 1). As expected, -MHC mRNA content was significantly
decreased and ß-MHC mRNA significantly increased in hypothyroid
myocardium. Hyperthyroidism, however, was not associated
with any further increase in -MHC mRNA or decrease in ß-MHC mRNA.
Paradoxically, the ß-MHC mRNA was slightly, but significantly, higher
in the hyperthyroid than the euthyroid group (P=0.003).
Still, both were much lower than in hypothyroid myocardium.
The explanation for the deviation from the usual pattern of response of
this mRNA is unknown.
|
To determine whether a dose-response relationship exists in the thyroid
hormone-dependent alteration of myocardial HCN2 mRNA content,
hypothyroid rats were treated with vehicle or with increasing doses of
T3 or T4. The thyroid state was confirmed by serum thyroid hormone
radioimmunoassay.20 As in the initial experiment,
myocardial HCN2 mRNA was significantly decreased in hypothyroid rats
compared with euthyroid rats (Figures 2C and 2G). Increasing T3 doses administered to hypothyroid rats
caused a significant rise in myocardial HCN2 mRNA (Figure 2C).
There was, however, no significant difference between the effects of
the various T3 doses, indicating that the lowest dose produced maximal
effect. Increasing T4 doses induced a significant, dose-dependent
increase in HCN2 mRNA, again to a level not different from that in
euthyroid rats (Figure 2G). The changes in the - and ß-MHC
mRNAs confirmed the well-recognized positive and negative effects,
respectively, of thyroid hormone on expression of those mRNAs (Figures 2A, 2B, 2E, and 2F). Similarly, all T3
doses, but only the highest T4 dose, resulted in maximal growth, as
assessed by weight gain, with no significant differences between any of
the T3 groups (Figures 3A and 3B).
In the T4-treated groups, a clear dose-response relationship existed in
growth velocity, with significant differences between all T4 doses
(Figure 3B).
|
P<0.05 when compared with highest T4 dose
(1.5 µg/100 g of body weight).
|
Hypothyroidism caused a reduction of the heart weight to body
weight ratio (H/B ratio) (hypothyroid rats: H/B ratio=3.015 ·
10-3, n=12; euthyroid rats: H/B ratio=3.440
· 10-3, n= 6; P<0.05 by
t test). Treatment with graded T3 doses caused a significant
linear increase in H/B ratio (Figure 3C
). In contrast, T4
treatment did not cause a significant increase in H/B ratio, which was
consistent with the milder biological effect of these
relatively small T4 doses (Figure 3D).
In the third experiment, we examined the time course of the myocardial
HCN2 mRNA response to thyroid hormone. A single high T3 dose (200 µg)
was injected intraperitoneally at various time
intervals 24 hours before being euthanized. This dose was designed to
cause rapid and complete saturation of all thyroid hormone
receptors.21 22 A significant increase in both myocardial
HCN2 and -MHC mRNAs and a decrease in ß-MHC mRNA occurred within 4
hours (Figures 4 and 5). By 24 hours, all mRNAs had
reached normal levels. Interestingly, we noted an increase in
myocardial ß-actin mRNA content as well. The ratio of specific
ß-actin mRNA content to the 28S ribosomal band (as assessed by
ethidium bromide staining of the gel) increased 2.3-fold after 24 hours
(P<0.01 for difference between the hypothyroid and either
the 12-hour or 24-hour group). Similarly, a small increase was also
seen in the level of GAPDH mRNA (Figure 4). In addition, the H/B
ratio also normalized 24 hours after a single T3 dose (hypothyroid
versus 24-hour group, P<0.05; euthyroid versus 24-hour
group, P=0.82), which indicated a rapid
physiological and transcriptional response to
thyroid hormone.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
These results are the first demonstration that myocardial HCN2 mRNA content is thyroid hormone–dependent. The time course and direction of the thyroid hormone–induced effect is similar to that of
-MHC mRNA. Specifically, HCN2 mRNA is decreased in hypothyroid
myocardium relative to that of euthyroid and hyperthyroid
tissues. Although the overall pattern of response of these 2 mRNAs is
the same, differences exist in the magnitude of the changes. The
average HCN2 mRNA content in hypothyroid myocardium was
50% of normal, whereas -MHC mRNA was <5% of normal in the same
rats (P<0.001 for both t tests when all
euthyroid and hypothyroid rats were pooled). The differences in HCN2
and -MHC mRNA content between euthyroid and hyperthyroid animals are
not significant (Figure 1). Thus, the major portion of the
thyroid hormone–dependent increases in these 2 mRNAs in the rat occurs
between the hypothyroid and euthyroid states.
In nonworking, isolated, perfused hearts of rats and other species,
hypothyroidism and hyperthyroidism have been consistently
associated with a decrease or increase, respectively, in heart
rate.23 24 However, in a working heart model, the
transition from the euthyroid to the hyperthyroid state in rats was not
associated with any further chronotropic effect, which was similar to
the effect on HCN2 and -MHC mRNA.25 26 If the human
HCN2 mRNA gene responds in the same way as that of the rat, one would
expect that HCN2 mRNA is not responsible for the
tachycardia of hyperthyroidism. However, the regulation of
gene expression by thyroid hormone varies between species, and humans
may be different from rats in that respect. For example, ß-MHC had
only a minimal response to depletion of thyroid hormone in 1
well-documented human subject.27
It is well recognized that T3 stimulates the transcription of the rat
-MHC gene,28 29 30 which contains a potent thyroid
hormone response element in the promoter.31 The mechanism
for the thyroid hormone–dependent increase in rat HCN2 mRNA is not
known. In this regard, however, and pertinent to the potential effect
of T3 on human myocardial HCN2, is the fact that the entire human HCN2
gene, including its promoter, has been cloned as a part of human
chromosome 19 p11.3 (accession numbers, AC005559 and AC005577).
Although the location of the transcriptional start site has not been
precisely mapped, we noted the presence of a canonical direct repeat
thyroid hormone response element (GGGTCAcctgAGGTCA)32
within 2 kb from the most 5' portion of the human cDNA sequence
(accession number, AF065164). This strongly suggests that transcription
of the human HCN2 gene will be stimulated by T3 and likely accounts for
the T3-induced augmentation in rat HCN2 mRNA.
The regulation of heart rate by thyroid hormone is complex. Some cardiovascular effects of hyperthyroidism can be modulated by ß-adrenergic blockers.1 In some studies in rats, the density of ß-adrenergic receptors was increased in hyperthyroid and decreased in hypothyroid myocardium.33 34 Thyroid hormone also regulates the shaker-related potassium channel mRNA level in rat myocardium.10 Blockade of these channels can increase the duration and change the shape of the action potential, and it can indirectly decrease heart rate.14 35 In 5 of these channels (Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2), only the level of the mRNA for Kv1.5 was reduced by hypothyroidism and restored by thyroid hormone treatment10 36 in rat hearts. Two other channels (Kv1.2 and Kv1.4) showed opposite regulation of mRNA by thyroidal state.10 In cultured rat neonatal myocytes or in early postnatal rat heart, T3 treatment enhanced the expression of Kv4.2 and Kv4.3 and decreased expression of Kv1.4.11 12 13 If we assume that changes in HCN2 mRNA in pacemaking tissue are similar to those seen in the ventricular myocardium, the increase in HCN2 mRNA observed in our experiments can, at least in part, explain the intrinsic effect of thyroid hormone to increase heart rate.
As previously described and confirmed in our experiments, the effects
of thyroid hormone on rat heart hypertrophy are apparent
across the spectrum of thyroid states (Figure 3).5 37 For example, the H/B ratio continuously
increases from the hypothyroid to the hyperthyroid state. This
contrasts with the regulation of known thyroid hormone–responsive
genes in rat myocardium in which the effect of thyroid
hormone is primary seen in the transition from the hypothyroid to the
euthyroid state. It also indicates that this
physiological response to thyroid hormone might
have a different molecular mechanism.
The significant increase in ß-actin mRNA in myocardium
after a single dose of T3 in hypothyroid rats was somewhat surprising
(Figures 4 and 5). In the long-term hypothyroid or
hyperthyroid rats (the first 2 experiments), differences in ß-actin
mRNA between groups were not significant (experiment 1) or had no
consistent pattern (experiment 2). Thyroid hormone rapidly
increases total cellular mRNA. For example, a 70% increase in total
polyadenylated RNA synthesis in the liver occurs shortly
after a single T3 dose.38 Similar studies of the
short-term T3 effect on total or polyadenylated RNA in
the hypothyroid or euthyroid heart have not been reported, but the
increase in ß-actin mRNA may reflect such generalized effects. In
addition, the level of GAPDH mRNA also increased significantly 24 hours
after T3 injection (P<0.001; Figure 4).
It should be noted that the effect of T3 on HCN2 and MHC mRNAs is
corrected for changes in ß-actin mRNA (Figure 5). Accordingly,
if the effect on ß-actin mRNA is specific, then the true increase in
HCN2 is underestimated.
Opposite to what one would expect, the ß-MHC mRNA level was slightly
increased and the -MHC level was slightly decreased (but not
significantly) in the hearts of euthyroid rats given T3 for 8 days.
This effect is present with or without normalization with
ß-actin. This cannot be explained by the lower serum T3
concentrations at the time of death because these levels were still
above 12 nmol/L (about 12-fold the euthyroid level) at that time. We
have no explanation for this deviation from the expected results.
Nonetheless, the ß-MHC mRNA was much higher in the hypothyroid hearts
than in the euthyroid or hyperthyroid hearts.
In summary, we demonstrated that the levels of mRNA encoding the hyperpolarization-activated cyclic nucleotide-gated channel (HCN2) parallel thyroid state, which is consistent with a potential role for this gene in the thyroid hormone effect on heart rate.
|
Acknowledgments |
|---|
This work was supported by the following grants: Endocrine Fellow Foundation Grant 1996 (to J.P.), National Institutes of Health grants DK-02147 (to L.A.B.) and DK-44128 (to P.R.L.), and GCRC Grant RR02635 (to P.R.L.).
Received December 3, 1998; accepted July 16, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Klein I, Levey GS. The cardiovascular system in thyrotoxicosis. In: Braverman LS, Utiger RD, eds. The Thyroid. Philadelphia: Lippincott-Raven; 1996:607–615.
2. Klein I. Thyroid hormone and the cardiovascular system. Am J Med. 1990;88:631–637.[Medline] [Order article via Infotrieve]
3.
Polikar R, Burger AG, Scherrer U, Nicod P. The thyroid
and the heart. Circulation. 1993;87:1435–1441.
4. Dillmann WH. Biochemical basis of thyroid hormone action in the heart. Am J Med. 1990;88:626–630.[Medline] [Order article via Infotrieve]
5. Klein I, Hong C. Effects of thyroid hormone on cardiac size and myosin content of the heterotopically transplanted rat heart. J Clin Invest. 1986;77:1694–1698.
6. Valente M, De Santo C, de Martino Rosaroll P, Di Maio V, Di Meo S, De Leo T. The direct effect of the thyroid hormone on cardiac chronotropism. Arch Int Physiol Biochim. 1989;97:431–440.[Medline] [Order article via Infotrieve]
7. Buccino RA, Spann JF Jr, Pool PE, Sonnenblick EH, Braunwald E. Influence of the thyroid state on the intrinsic contractile properties and energy stores of the myocardium. J Clin Invest. 1967;46:1669–82.
8. Kessler-Icekson G. Effect of triiodothyronine on cultured neonatal rat heart cells: beating rate, myosin subunits and CK-isozymes. J Mol Cell Cardiol. 1988;20:649–655.[Medline] [Order article via Infotrieve]
9. Kim D, Smith TW. Effects of thyroid hormone on sodium pump sites, sodium content, and contractile responses to cardiac glycosides in cultured chick ventricular cells. J Clin Invest. 1984;74:1481–1488.
10. Abe A, Yamamoto T, Isome M, Ma M, Yaoita E, Kawasaki K, Kihara I, Aizawa Y. Thyroid hormone regulates expression of shaker-related potassium channel mRNA in rat heart. Biochem Biophys Res Commun. 1998;245:226–230.[Medline] [Order article via Infotrieve]
11. Guo W, Kamiya K, Hojo M, Kodama I, Toyama J. Regulation of Kv4.2 and Kv1.4 K+ channel expression by myocardial hypertrophic factors in cultured newborn rat ventricular cells. J Mol Cell Cardiol. 1998;30:1449–1455.[Medline] [Order article via Infotrieve]
12.
Shimoni Y, Fiset C, Clark RB, Dixon JE, McKinnon D,
Giles WR. Thyroid hormone regulates postnatal expression of transient
K+ channel isoforms in rat ventricle. J Physiol (Lond). 1997;500:65–73.
13.
Wickenden AD, Kaprielian R, Parker TG, Jones OT, Backx
PH. Effects of development and thyroid hormone on K+ currents and K+
channel gene expression in rat ventricle. J Physiol
(Lond). 1997;504:271–286.
14. Barry DM, Nerbonne JM. Myocardial potassium channels: electrophysiological and molecular diversity. Annu Rev Physiol. 1996;58:363–394.[Medline] [Order article via Infotrieve]
15. DiFrancesco D. Pacemaker mechanisms in cardiac tissue. Annu Rev Physiol. 1993;55:455–472.[Medline] [Order article via Infotrieve]
16. Santoro B, Liu DT, Yao H, Bartsch D, Kandel ER, Siegelbaum SA, Tibbs GR. Identification of a gene encoding a hyperpolarization-activated pacemaker channel of brain. Cell. 1998;93:717–729.[Medline] [Order article via Infotrieve]
17. Ludwig A, Zong X, Jeglitsch M, Hofmann F, Biel M. A family of hyperpolarization-activated mammalian cation channels. Nature. 1998;393:587–591.[Medline] [Order article via Infotrieve]
18. Ludwig A, Zong X, Stieber J, Hullin R, Hofmann F, Biel M. Two pacemaker channels from human heart with profoundly different activation kinetics. EMBO J. 1999;18:2323–2329.[Medline] [Order article via Infotrieve]
19.
Yu H, Chang F, Cohen IS. Pacemaker current exists in
ventricular myocytes. Circ Res. 1993;72:232–236.
20.
Burmeister LA, Pachucki J, St Germain DL. Thyroid
hormones inhibit type 2 iodothyronine deiodinase in the rat cerebral
cortex by both pre- and posttranslational mechanisms.
Endocrinology. 1997;138:5231–5237.
21. Coulombe P, Schwartz HL, Oppenheimer JH. Relationship between the accumulation of pituitary growth hormone and nuclear occupancy by triiodothyronine in the rat. J Clin Invest. 1978;62:1020–1028.
22. Oppenheimer JH, Silva E, Schwartz HL, Surks MI. Stimulation of hepatic mitochondrial alpha-glycerophosphate dehydrogenase and malic enzyme by L-triiodothyronine: characteristics of the response with specific nuclear thyroid hormone binding sites fully saturated. J Clin Invest. 1977;59:517–527.
23.
Read LC, Wallace PG, Berry MN. Effects of thyroid state
on respiration of perfused rat and guinea pig hearts. Am J
Physiol. 1987;253:H519–H523.
24.
McDonough KH, Chen V, Spitzer JJ. Effect of altered
thyroid status on in vitro cardiac performance in rats.
Am J Physiol. 1987;252:H788–H795.
25. Marcus RH, Butkow N, Wheatley AM, Lippe I, Norton G, Rosendorff C. Independent mechanisms for the chronotropic and inotropic responses in hyperthyroidism. Basic Res Cardiol. 1987;82:261–270.
26. Wheatley AM, Butkow N, Marcus RH, Lippe IT, Rosendorff C. Enhanced myocardial contractility but not tachycardia persists in isolated working hyperthyroid rat hearts. Basic Res Cardiol. 1988;83:634–646.[Medline] [Order article via Infotrieve]
27.
Ladenson PW, Sherman SI, Baughman KL, Ray PE, Feldman
AM. Reversible alterations in myocardial gene expression in a young man
with dilated cardiomyopathy and hypothyroidism
[published erratum appears in Proc Natl Acad Sci U S A. 1992;89:8856]. Proc Natl Acad Sci U S A.
1992;89:5251–5255.
28.
Izumo S, Nadal-Ginard B, Mahdavi V. All members of the
MHC multigene family respond to thyroid hormone in a highly
tissue-specific manner. Science. 1986;231:597–600.
29.
Balkman C, Ojamaa K, Klein I. Time course of the in
vivo effects of thyroid hormone on cardiac gene expression.
Endocrinology. 1992;130:2001–2006.
30.
Ojamaa K, Klein I. In vivo regulation of recombinant
cardiac myosin heavy chain gene expression by thyroid hormone.
Endocrinology. 1993;132:1002–1006.
31.
Tsika RW, Bahl JJ, Leinwand LA, Morkin E. Thyroid
hormone regulates expression of a transfected human alpha-myosin
heavy-chain fusion gene in fetal rat heart cells. Proc Natl Acad
Sci U S A. 1990;87:379–383.
32. Brent GA, Moore DD, Larsen PR. Thyroid hormone regulation of gene expression. Annu Rev Physiol. 1991;53:17–35.[Medline] [Order article via Infotrieve]
33. Hawthorn MH, Gengo P, Wei XY, Rutledge A, Moran JF, Gallant S, Triggle DJ. Effect of thyroid status on beta-adrenoceptors and calcium channels in rat cardiac and vascular tissue [published erratum appears in Naunyn Schmiedebergs Arch Pharmacol. 1988;338:708]. Naunyn Schmiedebergs Arch Pharmacol. 1988;337:539–544.
34.
Williams LT, Lefkowitz RJ, Watanabe AM, Hathaway DR,
Besch HR Jr. Thyroid hormone regulation of ß-adrenergic receptor
number. J Biol Chem. 1977;252:2787–2789.
35.
Drici MD, Arrighi I, Chouabe C, Mann JR, Lazdunski M,
Romey G, Barhanin J. Involvement of IsK-associated K+ channel in
heart rate control of repolarization in a murine engineered model of
Jervell and Lange- Nielsen syndrome. Circ Res. 1998;83:95–102.
36. Nishiyama A, Kambe F, Kamiya K, Yamaguchi S, Murata Y, Seo H, Toyama J. Effects of thyroid and glucocorticoid hormones on Kv1.5 potassium channel gene expression in the rat left ventricle. Biochem Biophys Res Commun. 1997;237:521–526.[Medline] [Order article via Infotrieve]
37.
Heron MI, Rakusan K. Geometry of coronary
capillaries in hyperthyroid and hypothyroid rat heart. Am J
Physiol. 1994;267:H1024–H1031.
38.
Dillmann WH, Mendecki J, Koerner D, Schwartz HL,
Oppenheimer JH. Triiodothyronine-stimulated formation of
poly(A)-containing nuclear RNA and mRNA in rat liver.
Endocrinology. 1978;102:568–575.
This article has been cited by other articles:
 |
|
 |
|
  S. Kuratomi, Y. Ohmori, M. Ito, K. Shimazaki, S.-i. Muramatsu, H. Mizukami, H. Uosaki, J. K. Yamashita, Y. Arai, K. Kuwahara, et al. The cardiac pacemaker-specific channel Hcn4 is a direct transcriptional target of MEF2 Cardiovasc Res, September 1, 2009; 83(4): 682 - 687. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Gereben, A. M. Zavacki, S. Ribich, B. W. Kim, S. A. Huang, W. S. Simonides, A. Zeold, and A. C. Bianco Cellular and Molecular Basis of Deiodinase-Regulated Thyroid Hormone Signaling Endocr. Rev., December 1, 2008; 29(7): 898 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Mangoni and J. Nargeot Genesis and Regulation of the Heart Automaticity Physiol Rev, July 1, 2008; 88(3): 919 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Medina-Gomez, R. M. Calvo, and M.-J. Obregon Thermogenic effect of triiodothyroacetic acid at low doses in rat adipose tissue without adverse side effects in the thyroid axis Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E688 - E697. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Klein and S. Danzi Thyroid Disease and the Heart Circulation, October 9, 2007; 116(15): 1725 - 1735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Goulart da Silva, G. Giannocco, M. F. Santos, and M. T. Nunes Thyroid Hormone Induction of Actin Polymerization in Somatotrophs of Hypothyroid Rats: Potential Repercussions in Growth Hormone Synthesis and Secretion Endocrinology, December 1, 2006; 147(12): 5777 - 5785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I Stoykov, B Zandieh-Doulabi, A F M Moorman, V Christoffels, W M Wiersinga, and O Bakker Expression pattern and ontogenesis of thyroid hormone receptor isoforms in the mouse heart. J. Endocrinol., May 1, 2006; 189(2): 231 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Vargas, J. M. Moreno, I. Rodriguez-Gomez, R. Wangensteen, A. Osuna, M. Alvarez-Guerra, and J. Garcia-Estan Vascular and renal function in experimental thyroid disorders Eur. J. Endocrinol., February 1, 2006; 154(2): 197 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. D. Carvalho-Bianco, B. W. Kim, J. X. Zhang, J. W. Harney, R. S. Ribeiro, B. Gereben, A. C. Bianco, U. Mende, and P. R. Larsen Chronic Cardiac-Specific Thyrotoxicosis Increases Myocardial {beta}-Adrenergic Responsiveness Mol. Endocrinol., July 1, 2004; 18(7): 1840 - 1849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Bachman, T. G. Hampton, H. Dhillon, I. Amende, J. Wang, J. P. Morgan, and A. N. Hollenberg The Metabolic and Cardiovascular Effects of Hyperthyroidism Are Largely Independent of {beta}-Adrenergic Stimulation Endocrinology, June 1, 2004; 145(6): 2767 - 2774. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Fellet, P. Arza, N. Arreche, C. Arranz, and A. M. Balaszczuk Nitric oxide and thyroid gland: modulation of cardiovascular function in autonomic-blocked anaesthetized rats Exp Physiol, May 1, 2004; 89(3): 303 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Dentice, C. Morisco, M. Vitale, G. Rossi, G. Fenzi, and D. Salvatore The Different Cardiac Expression of the Type 2 Iodothyronine Deiodinase Gene between Human and Rat Is Related to the Differential Response of the dio2 Genes to Nkx-2.5 and GATA-4 Transcription Factors Mol. Endocrinol., August 1, 2003; 17(8): 1508 - 1521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Bussemaker, R. Popp, B. Fisslthaler, C.M. Larson, I. Fleming, R. Busse, and R.P. Brandes Hyperthyroidism enhances endothelium-dependent relaxation in the rat renal artery Cardiovasc Res, July 1, 2003; 59(1): 181 - 188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Danzi, K. Ojamaa, and I. Klein Triiodothyronine-mediated myosin heavy chain gene transcription in the heart Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2255 - H2262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Brewster, R. A. Bender, Y. Chen, C. Dube, M. Eghbal-Ahmadi, and T. Z. Baram Developmental Febrile Seizures Modulate Hippocampal Gene Expression of Hyperpolarization-Activated Channels in an Isoform- and Cell-Specific Manner J. Neurosci., June 1, 2002; 22(11): 4591 - 4599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Bianco, D. Salvatore, B. Gereben, M. J. Berry, and P. R. Larsen Biochemistry, Cellular and Molecular Biology, and Physiological Roles of the Iodothyronine Selenodeiodinases Endocr. Rev., February 1, 2002; 23(1): 38 - 89. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Yen Physiological and Molecular Basis of Thyroid Hormone Action Physiol Rev, July 1, 2001; 81(3): 1097 - 1142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Klein and K. Ojamaa Editorial: Thyroid Hormone--Targeting the Heart Endocrinology, January 1, 2001; 142(1): 11 - 12. [Full Text] [PDF]
|
|
|
|
|
|
J. Pachucki, J. Hopkins, R. Peeters, H. Tu, S. D. Carvalho, H. Kaulbach, E. D. Abel, F. E. Wondisford, J. S. Ingwall, and P. R. Larsen Type 2 Iodothyronine Deiodinase Transgene Expression in the Mouse Heart Causes Cardiac-Specific Thyrotoxicosis Endocrinology, January 1, 2001; 142(1): 13 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Biondi, E. A. Palmieri, S. Fazio, C. Cosco, M. Nocera, L. Saccà, S. Filetti, G. Lombardi, and F. Perticone Endogenous Subclinical Hyperthyroidism Affects Quality of Life and Cardiac Morphology and Function in Young and Middle-Aged Patients J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4701 - 4705. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. Qu, I. S Cohen, and R. B Robinson Sympathetic innervation alters activation of pacemaker current (If) in rat ventricle J. Physiol., August 1, 2000; 526(3): 561 - 569. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||