© 1999 American Heart Association, Inc.
Molecular Medicine |
Species-Specific Differences in Positive and Negative Regulatory Elements in the Renin Gene Enhancer
From the Departments of Internal Medicine and Physiology & Biophysics (Q.S., C.D.S.), University of Iowa College of Medicine, Iowa City, Iowa, and Department of Molecular and Cellular Biology (T.A.B., K.W.G.), Roswell Park Cancer Institute, Buffalo, NY.
Correspondence to Curt D. Sigmund, PhD, Director, Transgenic Animal Facility, Departments of Internal Medicine and Physiology & Biophysics, The University of Iowa College of Medicine, 2191 Medical Laboratory (ML), Iowa City, IA 52242. E-mail curt-sigmund{at}uiowa.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—A distal transcriptional enhancer has been previously reported upstream of the mouse renin gene. A homologous sequence is also present upstream of the human renin gene, but the mouse and human renin enhancers differ markedly in their ability to activate transcription of a renin promoter. Although the 2 enhancers share high homology in their 202-bp promoter distal portions, their 40-bp proximal portions are heterogeneous. Chimeric enhancers were used to test the role of the 40-bp segment (m40) of the enhancer by using transient transfection analysis in mouse kidney renin-expressing As4.1 cells. Deletion of m40 from the mouse renin enhancer or its addition to the human renin enhancer did not significantly change transcriptional activity when placed close to a mouse or human renin promoter. However, when placed further upstream of a renin promoter, the same deletion and substitution markedly altered enhancer activity. Electrophoretic gel mobility shift analysis identified 2 elements, a and b, in m40 that specifically bound nuclear proteins from As4.1 cells. Mutagenesis and transient transfection analysis revealed that element b accounts for the function of m40 and that element a antagonizes the positive influence of element b. Gel competition and supershift analysis revealed that nuclear factor-Y, a ubiquitous CAAT-box binding protein, binds to element a. Sequence analysis revealed that the human renin enhancer has a natural loss-of-function mutation in element b that affects its ability to transactivate when placed far upstream of a promoter. Reversion of the human renin element b to match the mouse sequence restored transactivation of the enhancer in mouse As4.1 cells. These data suggest that element b cooperates with the rest of the enhancer to maintain full enhancer activity, whereas element a may regulate enhancer activity. Sequence differences in these elements may explain the functional differences in the mouse and human renin enhancer sequences.
Key Words: transfection • transcription factor • kidney • juxtaglomerular cell • electrophoretic mobility shift assay
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Renin (REN) is thought to be the rate-limiting enzyme controlling the generation of angiotensin II, the effector hormone of the REN-angiotensin system. The main source of circulating REN is juxtaglomerular cells of the kidney, although REN expression has been reported in a number of extrarenal tissues. Expression of REN mRNA and its release from the kidney is thought to be controlled at the transcriptional, posttranscriptional, and posttranslational level and is regulated by physiological cues such as arterial pressure, plasma sodium, and sympathetic nerve activity.1 Although the REN-angiotensin system has been studied for decades, the molecular mechanisms controlling the regulation of REN gene expression and REN release remain unclear (reviewed in Reference 22 ).
Initial clues for the existence of a major regulatory element(s) controlling REN gene expression came from a number of transgenic studies that implicated a region between -2.5 kb and -4.6 kb as controlling the spatial and temporal expression of the mouse REN (mREN) gene.3 4 5 6 7 An enhancer of transcription was later found by deletion mutagenesis and transient transfection analysis to lie from -2866 to -2625 bp relative to the initiation of transcription of the mREN gene.8 The studies were performed using a REN-expressing mouse kidney cell line (As4.1) sharing many properties in common with bona fide juxtaglomerular cells.9 The enhancer can stimulate an 80- to 100-fold increase in the activity of a basal mREN promoter in these cells in an orientation- and position-independent manner consistent with its definition as a classical enhancer of transcription. Moreover, reporter constructs containing the enhancer respond similarly to physiological cues controlling expression of the endogenous REN gene.10
In contrast, studies of the human REN (hREN) gene 5'-flanking
sequence extending to -5 kb failed to identify sequences with
enhancer-like activity. Indeed, most regulatory studies initially
focused on determining the importance of the relatively small
transcriptional effects imparted by 2 elements close to the promoter, a
cAMP-responsive element (CRE) and a POU-domain factor binding
site with homology to Pit-1.11 12 13 14 Although genomic
transgenes containing the entire hREN coding region and relatively
small amounts of 5'-flanking sequence are cell-specifically expressed
in renal juxtaglomerular cells, they also exhibit ectopic
expression suggesting the absence of potentially important regulatory
sequences.15 16 Moreover, reporter genes containing up to
5 kb of 5'-flanking sequence either are not expressed or are
inappropriately expressed in transgenic mice (C.D. Sigmund, unpublished
observations, 1998). Recent studies suggest the presence of a
sequence homologous to the mREN enhancer 
12 kb upstream of the hREN
promoter.17 However, despite having substantial homology,
transcriptional activity of DNA fragments containing the hREN
enhancer-like sequence are markedly lower than corresponding fragments
containing the mREN enhancer.
In this report, we examined the molecular mechanism regulating mouse and human REN enhancer activity by using chimeric mouse/human REN enhancers that were generated by taking advantage of natural sequence variation between them. Our results reveal that the promoter proximal 40 bp of the mREN enhancer is critical for its full transcription-inducing activity. Moreover, we demonstrate that this region contains both positive and negative regulatory elements and that the hREN enhancer sequence is deficient in its transcriptional activation because of a natural loss-of-function mutation in the positive element.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmid Construction
Two hREN P1 artificial chromosome (PAC) clones were obtained from Genome Systems (St. Louis, Mo) by screening a PAC library with a previously described polymerase chain reaction (PCR)–amplified cDNA clone encompassing exons I through V.18 The presence of the entire coding region of hREN was established, and a 23-kb KpnI fragment was identified by Southern blot analysis as containing the mREN enhancer homology. The 23-kb KpnI was subcloned into pBluescript II SK– to form clone 67. PAC clones were handled and PAC DNA was purified according to directions provided by the manufacturer. Similar P1 clones containing hREN were previously described.17
A 4.1-kb 5'-flanking DNA of the mouse Ren-1c gene was subcloned from RIC-4.1CAT8 first into the pGEM-2 vector to form pGEM-m4.1K and then into pGL2-basic to form the construct m4.1kP-luc. This segment provided a positive control containing the mREN enhancer in its normal orientation and context upstream of the mREN promoter. The mREN test promoters, m2.6kP and m117P, each extending upstream to the coordinate indicated and downstream to +6, were derived from pGEM-m4.1K, and cloned into pGL2-basic to form the plasmids m2.6kP-luc and m117P-luc, respectively. The hREN test promoters, h896P and h149P, derived from a longer subclone containing 2.75 kb of hREN 5'-flanking DNA and extending upstream to the coordinate indicated and downstream to +13, were subcloned into pGL2-basic to form the plasmids h896P-luc and h149P-luc, respectively. All 4 promoters have their own endogenous mouse or human REN transcription start site. All 4 promoters were cloned upstream of the luciferase reporter gene in pGL2-basic in the forward orientation except those otherwise specified in text.
The 1018-bp PstI fragment containing the hREN enhancer homology was subcloned from clone 67 as a PstI fragment into pSL301 (Invitrogen) to form the plasmid pSL-h1018E. The hREN enhancer fragment consisting of the entire homologous region (h242E) was PCR amplified with the primers CGGGATCCACACTGGGAGAAGACCCTC and GCGCTAGCATGCTGTTGGAAATGGGGCCCC from pSL-h1018E and cloned first into pCR2.1 (Invitrogen) and then into pSL301 as a BamHI-to-SphI fragment. Both restriction sites (underlined) were engineered into the primers. The hREN enhancer fragment consisting of only the highly homologous region (h202E) was subcloned after PCR amplification of clone 67 with the following pair of oligonucleotides: GGGATCCGACACTGGGAGAAGACCCTC and CGGGATCCGCCAGGTCACCATCTGCCTGG. The product was digested with BamHI (underlined) and cloned into h896P-luc. The minimal functional mREN enhancer fragment (m242E) was obtained from (-2625>-2866)m117-CAT as previously described8 and subcloned into pSL301. The m40 sequence was obtained by directly cloning overlapping oligonucleotides containing the sequence GATCCTGTACTCTGACCTCTGAGTGGCTGGTTGTGATAGCGCATG and GATCCCATGCGCTATCACAACCAGCCACTCAGAGGTCAGAGTACA into pBluescript-II-SK– as a BamHI fragment utilizing the BamHI sticky ends (underlined) engineered into the oligonucleotides. Each of these subcloned enhancer fragments was excised as a cassette and inserted upstream of 1 of the 4 promoter plasmids described above to generate the final transfection constructs. The sequence and orientation of all clones was confirmed by endonuclease restriction digestion and DNA sequencing.
To generate chimeric enhancers (ie, the mREN enhancer lacking the m40 element [m242E–m40] and the hREN enhancer plus the m40 element [h202+m40]), SmaI to BstXI fragments were exchanged between the plasmids m242E-h896P-luc and h202E-h896P-luc to form [m242E–m40]-h896P-luc and [h202E+m40]-h896P-luc, respectively. The SmaI-to-BstX1 fragment contains the 202-bp segment of highest homology between the mouse and human minimal enhancers. The chimeric enhancers were then subcloned upstream of the other promoters described above. The m40 segment was removed from the positive control plasmid m4.1kP-luc by cloning a SmaI-BstXI fragment from m4.1kP-luc, containing 5'-flanking DNA from -4.1 to -2665 kb (including m242E without m40) upstream of m2.6kP-luc.
To generate mutations in transcription factor binding sites a and b, site-directed mutagenesis was performed in the plasmid containing the entire minimal mREN enhancer (m242E) cloned into pGem-7Zf(–) (Promega). Oligonucleotides generated by Genosys Biotechnologies Inc were used for the mutagenesis after phosphorylation. Mutation in site a was generated with the mX30µa oligonucleotide TGTACTCTGACCTCTTCGCTGCTGGTTGTG and mutation in site b was generated with the mJµb oligonucleotide CAGATGGTGACCTGGCTGTACTCTTTCCTC. The G-to-A mutation in h242E and h1018E was generated with the mX30 m1 oligonucleotide CATACTGACCTCTCAGATCCTTGGGGCCCC. The phosphorylated selection oligonucleotide was CCGCGAGACCCACCCTTGGAGGCTCCAGATTTATC, and mutations were generated using the GeneEditor in vitro Site-Directed Mutagenesis System (Promega). The sequence of these mutations was confirmed by direct fluorescent DNA sequencing. To place the mutations in the appropriate context in the human/mouse chimeric enhancer constructs (h202+m40), the upstream segment of the mouse minimal enhancer (m202) was exchanged with h202 by SmaI-BstXI. The mutated enhancer sequences were then cloned upstream of the m2.6kP promoter in m2.6kP-luc.
To generate the A-to-G mutation in m242E, overlapping double-stranded oligonucleotides with the sequence GATCCTGTACTCTGGCCTCTGAGTGGCTGGTTGTGATAGCGCATG and CGCTATCACAACCAGCCACTCAGAGGCCAGAGTACAG were cloned into pGem7zf(–) using the BamHI and SphI sticky ends into oligonucleotides. The mutants were then transferred to m242E by swapping an RsaI to SphI fragment containing the mutations.
Cell Culture and Transfection
The generation and characterization of the mouse kidney
REN-expressing As4.1 cell line (American Type Culture Collection,
CRL2193) was previously described.9 As4.1 cells were
propagated in DMEM containing 10% FBS, penicillin (100 U/mL), and
streptomycin (100 µg/mL). Seventy-two hours before transfection,
As4.1 cells were split and cultured in 75-cm2
flasks. Forty-eight hours before transfection, the cell culture medium
was switched to Opti-MEM reduced-serum medium supplemented with 2%
FBS, 1 mg/mL Albumax-II (Gibco-BRL), penicillin (100 U/mL), and
streptomycin (100 µg/mL). The conditioned As4.1 cells were
transfected with plasmid DNA by electroporation. In brief, the cells
were lifted with trypsin-EDTA solution, washed, and suspended in
Dulbecco's PBS (5.0x107/mL). Plasmid DNA was
mixed with 0.5 mL of cells (2.5x107), and the
cell-DNA mixture was transferred into an electroporation chamber
(0.4-cm electrode spacing) and electrically shocked using a Cell
Porator (Life Technologies, Inc). A single electric impulse was used at
260 V and 1180 µF. After electroporation, the transfected cells were
grown in a 60-mm dish containing 5 mL of the supplemented Opti-MEM
reduced-serum medium. After 4 hours of incubation, culture media were
changed with fresh supplemented Opti-MEM reduced-serum medium. Cells
were harvested and assayed for luciferase and ß-galactosidase
activities 48 hours after initial transfection.
The Rous sarcoma virus (RSV) promoter–LUC vector was always used as a standard positive control in each experiment. Test constructs were transfected in equal molar ratios using 25 µg of m4.1kP-LUC as the starting point. In addition, the amount of nucleic acid in each transfection was brought to a total of 27 µg using pUC19 vector DNA as a carrier. A cytomegalovirus-promoter–ß-galactosidase reporter vector (0.1 µg) (a gift from Dr Andrew F. Russo, University of Iowa) was cotransfected as an internal control to monitor transfection efficiency. Plasmid DNA for transfection was prepared by using the DNA Purification System (Promega) and purified by 2 ultracentrifugation steps through cesium chloride/ethidium bromide density gradients.
Luciferase and ß-galactosidase activity assays were performed using the Luciferase Assay System (Promega) and the Galacto-Light Plus chemiluminescent reporter assay system (Tropix Inc) according to the instructions provided by the manufacturers and as previously reported.14 Luminescence was determined as light units on a Monolight 2010 luminometer (Analytical Luminescence Laboratory). All assays were performed in duplicate, and the average of 2 readings was used as 1 data point. Luciferase activity was normalized to ß-galactosidase activity from the same cytoplasmic extract and expressed as a percentage of relative transcriptional activity of the RSV promoter.
Statistical Analysis
All data are presented as mean±SEM. Data were
analyzed by 1-way ANOVA with correction for multiple
analyses using the Bonferroni t test. When the test
for normalization failed, the analysis was performed by
Kruskal-Wallace ANOVA on ranks. All analysis was performed
using the using SigmaStat for Windows software package (SPSS
Scientific).
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear extract was prepared from As4.1 cells as
previously described.19 The concentration of the nuclear
protein was determined by using the Bio-Rad Protein Assay (Bio-Rad
Laboratories). Aliquots of the dialyzed nuclear extract were stored at
-80°C. Double-stranded oligonucleotides were made by
heating equal amounts of 2 complementary single-stranded
oligonucleotides (Genosys Biotechnologies Inc) at
94°C for 5 minutes, followed by slow cooling to room temperature. The
probes were made from double-stranded oligonucleotides
(10 pmol) containing a 5'-GATC overhang at both ends using Klenow DNA
polymerase incorporating [
-32P]dATP (NEN
Life Science Products) and 3 other cold nucleotides
into full-length double-stranded oligonucleotides. The
binding reactions contained 0.02 pmol of labeled probe (60 000
cpm), 3 µg of nuclear extract, 1 µg poly[d(I-C)]
(Boehringer Mannheim), and binding buffer (containing, in
mmol/L, Tris-HCl [pH 7.5] 10, EDTA 1, DTT 1,
MgCl2 1, and KCl 300, as well as 5% glycerol).
Competitor DNA was preincubated with the nuclear extract for 15 minutes
on ice before the addition of probes. After the addition of probes, the
binding reactions were incubated on ice for 15 minutes. For supershift,
1, 2, and 3 µg of antibody to nuclear factor-Y (NF-Y) subunit A or B
(BioDesign International [catalog Nos. K59100R and K59101R,
respectively]) were incubated with nuclear proteins at
4oC for 15 minutes either before or after
complex formation. Both antibodies were generated to N-terminal
peptides. Loading dye was added to the reactions, and the binding
products were resolved on a 6% nondenaturing
polyacrylamide gel (40% stock; acrylamide:
bisacrylamide, 19:1) in 0.25x Tris borate–EDTA (pH 8.5)
running buffer.14 After electrophoresis at 4°C,
the gels were dried for autoradiography.
Southern Blot Analysis
m4.1kP-LUC (100 ng) and clone 67 plasmid DNA (200 ng) was
restriction digested and then run on a 0.7% agarose gel. The gel was
first stained with ethidium bromide, photographed, and then blotted to
a nylon-supported nitrocellulose membrane using standard procedures.
The blot was probed with a single-stranded
oligonucleotide matching the antisense of m40 that was
labeled with 32P by T4 polynucleotide
kinase.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The absence of a functional enhancer element or a sequence homologous to the mREN enhancer within the proximal 5000 bp of known 5'-flanking DNA sequence of the hREN gene led us to consider the possibility that an enhancer element might be present in the distal flanking regions. To test this possibility, 2 PAC clones containing the entire hREN gene were obtained from Genome Systems. Southern blot analysis using a 242-bp fragment encoding the minimal functional mREN enhancer (m242E)8 revealed the presence of a sequence homologous to the enhancer within a 23-kb KpnI, a 3733-bp HindIII, and a 1018-bp PstI fragment (Figure 1B
). Sequence analysis of
the ends of the KpnI fragment revealed the upstream end to
be new, unique sequence and the downstream anchor end to be contiguous
with another KpnI fragment that spans most of the hREN
coding region. Interestingly, the hREN enhancer homology is located
12 to 13 kb upstream from the hREN promoter, 9 kb farther upstream
than in the mREN gene.17 Sequence analysis of
5943 bp of hREN 5'-flanking DNA centering on the enhancer homology (-9
to -15 kb) revealed a number of blocks of segmental homology with the
mREN 5'-flanking sequence between -4.1 and +1 (Figure 1A). The
blocks ranged in homology from >50% to >80% with the enhancer lying
in a region of highest homology (block 7).
|
We first tested whether the hREN enhancer homology was functional
by cloning a 1018-bp PstI fragment (h1018E) containing the
homology directly upstream of 2 hREN promoters differing in length of
5'-flanking DNA (149 and 896 bp) fused to luciferase. As a control the
minimal mREN enhancer (m242E) was also fused to the same promoters.
Transient transfection analysis showed that m242E strongly
enhanced hREN promoter activity (25-fold for h149P and 10-fold for
h896P), whereas h1018E was much less effective in inducing the activity
of either promoter (2-fold for h149P and 3-fold for h896P, Figure 2). This initial result suggested that
the hREN enhancer homology may not function as a classical enhancer
element. This may be due to the presence of a negative regulatory
element in the h1018 sequence or the absence of critical elements
required for full enhancer activity.
|
DNA sequence analysis of the minimal mREN enhancer and
the 1018-bp PstI fragment revealed that the enhancer
sequences shares 71% DNA-sequence identity. With respect to the
promoters, the distal 202-bp portions (h202 and m202) share higher
homology (80% similarity), whereas their proximal 40-bp sequences (h40
and m40) are quite different (45% similarity) (Figure 1C
). To
rule out the presence of negative regulatory elements within h1018E, we
subcloned the region of highest homology between the mREN and hREN
enhancers. The 202-bp distal portion of the hREN enhancer (h202E) was
cloned upstream of the h149P and h896P promoters. In contrast to the
h1018E sequence, h202E homology induced transcriptional activity of
h149P by 19-fold in comparison with 25-fold caused by m242E, a
difference of only 1.3-fold that was not statistically significant,
suggesting that the h202E sequence does have intrinsic enhancer-like
activity (Figure 2A). In contrast, however, the same sequence
only marginally stimulated transcription from the longer h896P
promoter, suggesting that h202E does not contain all the essential
cis-acting elements needed to act as a classical
enhancer when placed a greater distance upstream from the promoter
(Figure 2B).
m242E and h202E differ in that m242E contains the
promoter-proximal 40-bp sequence (termed m40), whereas this sequence is
lacking from h202E. Recall that m40 and h40 shared <50% identity. We
next tested the hypothesis that m40 may be required for full enhancer
activity when it is located at a distance from the promoter. To
accomplish this, we designed a set of chimeric enhancers in which m40
is removed from m242E (m242E–m40) and placed behind h202E (h202E+m40).
We speculated that if m40 is required for full enhancer function when
located a distance from the promoter, then deletion of m40 from m242E
would diminish its activity, whereas addition of m40 to h202E would
confer full enhancer activity when located a distance from a REN
promoter. All 4 enhancers (m242E, m242E-m40, h202E, and h202E+m40)
increased transcriptional activity of the short h149P promoter from 16-
to 25-fold (Figure 3B). However, removal
of m40 from m242E significantly lowered transcriptional induction of
the longer h896P promoter from 10-fold to 3-fold (Figure 3D).
Consistent with the hypothesis, addition of m40 to the
promoter-proximal end of h202E increased promoter activity from 2-fold
to 8-fold (Figure 3D). Similarly, only modest changes in
enhancer activity were obtained when the 4 enhancer combinations were
placed upstream of a short 117-bp mREN promoter (m117P, Figure 3A). Although the difference in enhancer-driven activity was
significantly lower for h202E than for m242E, both enhancers still
markedly stimulated the activity of the basal m117 promoter. However,
as with the h896P promoter, elimination of m40 from m242E or its
addition to h202E caused a significant change in the activity of the
longer 2.6-kb mREN promoter (m2.6kP, Figure 3C). The 3-fold
change in enhancer-driven activity in response to elimination of m40
from m242E or its addition to h202E was similar on both h896P and
m2.6kP. The function of m40 was further confirmed by examining the
consequences of its removal from its native position within m4.1kP and
comparison with m2.6kP lacking the mREN enhancer. Transcriptional
induction in response to the 4.1-kb segment of mREN 5'-flanking DNA
lacking m40 was 3-fold lower than that of intact m4.1kP (Figure 4A). These data suggest that m40,
although not absolutely required for full enhancer activity when the
REN enhancer is placed close to a REN promoter, is required for full
enhancer activity when located a distance from the promoter.
Interestingly, the m40 segment on its own does not have significant
intrinsic enhancer activity when placed upstream of either a short or
long mREN or hREN promoter (Figure 4B).
|
|
We next used EMSAs to identify DNA-protein interactions that may
regulate the function of m40. EMSAs were performed using
double-stranded DNA oligonucleotides encoding the m40
sequence and nuclear extracts prepared from As4.1 cells. These studies
revealed the formation of 2 major complexes on m40, labeled a and b,
which were efficiently competed by increasing molar excess of unlabeled
m40 oligonucleotide (Figure 5). The specificity of binding was
confirmed by the inability of 3 different unrelated
oligonucleotides (encoding the hREN CRE and
activator protein 1 and 2 consensus sequences) to compete
for m40 binding (data not shown). To begin to narrow down the location
of the 2 complexes on m40, competition was performed using two 30-bp
overlapping double-stranded oligonucleotides, mX30 and
mY30. Complexes a and b were both easily competed with mX30, but not
with mY30 (Figure 5), suggesting that the 2 specific DNA-nuclear
protein complexes require sequences on the promoter distal portion of
m40.
|
We next assessed which bases are important for the DNA-nuclear
protein interactions by EMSA and competition using mutant
oligonucleotides. In the first experiment, we
introduced 9 sequential 3-bp deletion mutations in mX30, generating 9
different double- stranded mutant oligonucleotides (1
to 9 in Figure 6A). Deletion mutants 1,
2, 8, and 9 were able to efficiently compete for both complexes a and b
(Figure 6B). Mutants 3 to 7 were unable to effectively compete
for complex a, whereas mutants 3 and 4 were unable to compete for
complex b. These data suggest that 2 sequence motifs, GACCTCTGAGTGGCT
and GACCTC, form complexes a and b, respectively, with nuclear extracts
from As4.1 cells. Interestingly, sites a and b appear to overlap (see
below).
|
Oligonucleotides with specific base-substitution
mutations were then used as competitors to confirm these findings
(Figure 6A). We made 3 mutant oligonucleotides
in mX30. The mX30µa contains a 4-base change of the central
GAGTG motif to TCGCT.
These residues were selected to avoid the region overlapped by element
b. The mX30µb oligonucleotide contains a
2-nucleotide change from GACCTC to
TTCCTC, and mX30µba contains both mutations. mX30µa
lost its ability to compete for complex a but not b, mX30µb
lost its ability to compete for complex b but not a, and mX30µba
cannot effectively compete for either complex, clearly demonstrating
the specificity of the binding and the location of binding sites
(Figure 6C).
The binding site for complex a has homology with the binding site
for NF-Y, a ubiquitous CAAT-box transcription factor. The homology
extends over the entire 14-bp recognition sequence (NCTGATTGGYTASY)
except for 1 nucleotide within the core binding region
(AGTGG for ATTGG), which forms the CCAAT motif on the
antisense strand and is invariant in other NF-Y binding sites. To test
whether complex a involves NF-Y, we first performed EMSA
analysis using mX30 as a probe and a series of competitors
(Figure 7A). Both mX30 and a mutant
replacing the G with the invariant T in other NF-Y binding sites
competed for complex a formation. In addition, the wild-type NF-Y site
from the major histocompatibility class II E gene competed for
complex a formation, whereas a mutant NF-Y site did
not.20 21 Moreover, neither wild-type nor mutant binding
sites for CRE binding protein competed for complex a (or complex b).
The formation of a complex between site a and NF-Y was further
validated by supershift analysis (Figure 7B). A strong
supershift was observed with antisera to NF-Y subunit A (NF-Ya), and a
weak but detectable supershift was obtained with antisera to NF-Y
subunit B (NF-Yb). A stronger supershift with the NF-Yb antisera was
obtained after an extended incubation with nuclear proteins (data not
shown). Both antibodies supershifted complex a when added to nuclear
proteins either before or after DNA:protein complex formation.
|
To experimentally test the function of these binding sites in
vivo, we generated a series of base-substitution and -deletion
mutations in the m40 segment of m242E using site-directed mutagenesis.
The same m40µa, m40µb, and m40µab mutations used for the EMSA
experiments were placed upstream of the m2.6kP-luc reporter.
Importantly, by using the m2.6kP promoter, we are retaining the normal
positioning of the enhancer relative to the mREN promoter. As in
previous experiments, m242E caused a significant induction of promoter
activity that was significantly attenuated by the removal of the m40
sequence (Figure 8A). Mutation of site b
(or of both sites a and b together) attenuated enhancer-driven activity
similar to that caused by the loss of the entire m40 segment,
suggesting that the activity of m40 is dependent on complex b. Indeed,
there was no statistically significant difference in the
transcriptional induction caused by m242E-m40 and m242Eµb.
Interestingly, mutation of the NF-Y binding site (m242Eµa) resulted
in increased enhancer activity, suggesting that complex a may play a
role in regulating the activity of the mREN enhancer. That complex b is
necessary for this induction is evidenced by the loss of enhancer
activity in the double mutant (m242Eµab).
|
We showed above that the m40 sequence can confer increased
enhancer-driven activity to h202E when placed a distance upstream from
a REN promoter (Figure 3). We therefore asked whether this
property requires protein binding to element b. To accomplish this, we
replaced the m40 element in the chimeric enhancer, h202E+m40, with the
m40µa, m40µb, and m40µba mutants and then inserted them upstream
of the m2.6kP-luc reporter construct. As above, addition of m40 to
H202E significantly increased enhancer activity, and this was
further increased by the mutation of the NF-Y binding site (Figure 8B). However, removal of complex b (or a and b) results in an
attenuation of the enhancer activity stimulated by addition of m40.
Again, there was no significant difference in enhancer activity between
h202E and h202E+m40µb, both of which lack element b.
The data presented above indicate that site b and the
nuclear proteins binding to it can account for the stimulating function
of m40. Removal of site b attenuates (1) the activity of the mREN
minimal enhancer and (2) the increase in transcriptional activity
caused by the addition of m40 to the hREN enhancer homology. We
therefore asked whether the 40-bp segment immediately downstream of the
h202E functions similarly to m40. Recall that h40 and m40 share <50%
overall sequence identity and that a 1018-bp PstI fragment
containing the entire hREN enhancer homology (including h40) failed to
stimulate transcription (Figure 2). Moreover, Southern blot
analysis revealed the absence of a sequence homologous to m40
within a 23-kb KpnI restriction fragment containing hREN
5'-flanking DNA from approximately -23 kb to -149, whereas it was
easily detected in the control plasmid containing 4.1 kb of mREN
5'-flanking DNA (Figure 9).
Sequence analysis of h40 revealed that it contains a complex b
binding site similarly positioned but with a single
nucleotide mismatch (GGCCTC) compared with
complex b in m40 (GACCTC). The data in Figure 6C
indicate this to be 1 of 2 sites that when mutated (GACCTC
to TTCCTC) result in loss of complex b formation. Indeed,
the hX30 oligonucleotide (analogous to mX30 used in
Figure 5) fails to compete for complex b formation unless an
oligonucleotide containing a reversion mutation
generating a G-to-A transition within the complex b binding site is
used (Figure 10). Similarly, mutation
of GACCTC to GGCCTC in m40 causes a loss of
competition for complex b and significantly attenuates the activity of
the m242E enhancer in As4.1 cells (Figure 11A). The loss of activity in the
A-to-G mutant is similar to that caused by the m40µb mutation tested
above.
|
DNA cut with HindIII (M*), and selected sizes
are indicated in kb. Left, Representative ethidium
bromide staining pattern. Right, Southern blot of an identical gel run
with only 100 ng of m4.1K and 200 ng of h23.0K probed with an end-label
antisense m40 probe. Hybridization was observed to 10-, 4.1-, and
1.5-kb bands from m4.1K demonstrating the presence of m40 in mREN
5'-flanking DNA and the selectivity of the probe. No hybridization was
detected in hREN plasmid DNA containing 23 kb of 5'-flanking DNA, even
on very long exposures.
|
|
Finally, we made a set of chimeric enhancers to examine whether
h40 has any m40-like function. As above, the chimeric enhancers were
placed at the native position of the mREN enhancer upstream of the
m2.6kP promoter. The results indicate that addition of h40 to the h202E
sequence (to form h242E) does not induce an increase in promoter
activity (Figure 11B). However, a G-to-A mutation restoring the
GACCTC motif in h40 results in a marked increase in enhancer activity
when placed upstream of the m2.6kP promoter (Figure 11B) and
when introduced in the h1018-bp PstI fragment (Figure 11C). It is interesting to note that enhancer activity in the
G-to-A mutants is greater than the activity of the minimal mREN
enhancer (m242E). It is therefore not surprising to note that (1) the
positionally equivalent site a in h40 differs from site a in m40 at 3
of 9 bases, including 3 of the 4 positions that are mutated in m40µA;
(2) the hX30 oligonucleotide cannot effectively compete
for complex a formation (Figure 10); and (3) the increase in
transcription in the G-to-A mutants is similar to that induced by
mutation of site a in m40 (Figure 11B).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Classical transcriptional enhancers are position- and orientation-independent cis-acting DNA elements, and the mREN gene enhancer functions as a classical enhancer.8 A homologous enhancer-like sequence was found 12 to 13 kb upstream of the human REN promoter.17 Although an hREN sequence containing the minimal homologous region could stimulate the activity of short REN promoters, it failed to induce transcriptional activity when placed farther upstream from the promoter. The data imply that sequences present in the mREN enhancer but lacking in the homologous hREN sequence are required for enhancer activity over a distance. Using a set of chimeric enhancers and REN promoter/5'-flanking sequences of differing length, we demonstrated that the promoter-proximal 40 bp of the mREN enhancer is required to mediate full transcriptional induction of the enhancer, without having intrinsic enhancer activity itself. Mutagenesis studies identified the element as a hexanucleotide containing the sequence GACCTC. Evidence supporting the importance of this sequence include the following: (1) mREN enhancer mutations that result in a loss of complex b formation are correlated with the loss of transcriptional induction, (2) mutation of element b in m40 disrupts its ability to transactivate when coupled with the h202 element, and (3) the hREN enhancer has a single nucleotide natural loss-of-function mutation in this sequence that when reverted rescues transcriptional induction. A search of the transcription factor database revealed some homology with CRE and the binding site for activating transcription factor, although element b differed from both of these in at least 1 position invariant among the consensus sequence. However, a consensus CRE failed to compete for complex b formation, suggesting that neither CREB nor other members of the activating transcription factor family contribute to complex b.
The mREN enhancer functions as a classical enhancer of transcription when intact, but is highly sensitive to distance effects when element b is mutated. Numerous examples of functional synergism between transcription factors in enhancer-mediated transcriptional activation have been reported.22 23 24 25 That m40 does not itself have intrinsic enhancer activity makes it tempting to speculate that complex b may cooperate with other transcription factors that bind to the enhancer to activate transcription from a REN promoter. Among these may be additional sites for the formation of complex b, as sequence analysis identified 2 other stretches containing the GACCT heptanucleotide identified within element b (GACCTC). Interestingly, one of these motifs (termed element c) is present 16 bp upstream from element b. With a spacing of 1 to 2 turns of the helix it is possible that GACCT-bound nuclear factors may interact with each other as a multimer. If this is proven to be the case, the interaction of the GACCT nuclear protein(s) could be the molecular foundation for the functional synergism between the m40 and m202. Preliminary results suggest that mutation of element c has the same effect as mutation of element b, suggesting that both sites are required for enhancer activity (Q. Shi and C.D. Sigmund, unpublished observation, 1999). Nevertheless, it is also possible that the GACCT-bound nuclear protein(s) might cooperate with other nuclear protein(s) that bind elsewhere in the enhancer. Indeed, preliminary results suggest the formation of at least 5 different DNA:protein complexes on the mREN enhancer (T.A. Black and K.W. Gross, unpublished observation, 1998).
The fact that element b is not required when the enhancer is close to the promoter perhaps suggests that direct contacts between enhancer binding proteins and proximal promoter binding proteins could take place when they are physically close to each other. Given that element b is required for enhancer activity when placed at a distance from the promoter suggests, but does not prove, that it may be required for the formation of a higher-order transcription complex involving not only enhancer-binding proteins, but also proteins binding close to the promoter. It is tempting to speculate that complex b might be involved in protein-protein interactions between the enhancer and proximal promoter that would bring them in close proximity (ie, through the formation of a loop in genomic DNA). A transcription factor identified to bind to a conserved AT-rich sequence at -60 with respect to the transcription start site may be a potential candidate, as mutations in that sequence severely diminish enhancer activity.8
We also identified a second functional element in m40, element a, mutation of which markedly enhanced transcriptional induction of the enhancer. These results suggest that element a may act as a negative regulator of the enhancer. Potential mechanisms include the following: (1) competition for sequences in the m40 segment by proteins binding to elements a and b, where formation of complex a precludes the binding and formation of complex b, and (2) formation of complex a having some direct negative effect on formation of the transcription complex or initiation of transcription independent of complex b. Experiments are currently in progress to distinguish these mechanisms. We currently favor the former mechanism, because the induction of transcription caused by mutation of element a required a functional element b. This mechanism is not unique, given that 2 partially overlapped binding sites (one for hepatocyte nuclear factor 4 and the other for Sp1) compete for binding in the promoter region of the blood coagulation factor X gene,26 and DNA-bound Oct-1 inhibits IL-8 promoter activity by competing against the positive nuclear factor C/EBP.27
Interestingly, a search of the transcription factor database revealed homology between sequences within element a and the binding site for NF-Y. Element a was homologous in 12 of 13 nucleotides with a NF-Y binding site but was different at one position (CTGAGTGGCTGGT) that is invariant in other known NF-Y binding sites in the database. Despite this invariant base, both competition and supershift assays clearly identified NF-Y as the protein binding to element a. NF-Y is a ubiquitous transcription factor that acts as a CCAAT-box binding protein and is generally thought to impart a positive influence on transcription initiation by facilitating the binding of additional transcription factors to nearby promoter elements.28 29 CCAAT has also been reported to exert negative effects on transcription of the varicella-zoster virus immediate-early 62 promoter and the human CYP1A1 gene.30 31 NF-Y was also demonstrated to negatively regulate the transcriptional activity of the transforming growth factor-ß receptor gene in embryonal carcinoma cells.32
Our data suggest that a complex regulatory circuit may be operating to regulate the mREN enhancer and therefore transcriptional activity of the mREN gene in As4.1 cells and perhaps in JG cells in vivo. Clearly, this leaves unresolved the function, if any, of the enhancer sequence upstream of the hREN gene. The hREN enhancer homology lies an additional 10 kb upstream compared with the mREN enhancer. This suggests that the hREN enhancer may function over a large distance. However, we demonstrated that the homologous element b upstream of hREN is nonfunctional because of a single nucleotide substitution and that reversion of that mutation in either a minimal enhancer (h242E) or a larger fragment (h1018E) caused marked transcriptional induction. No other regulatory elements closely linked to the enhancer homology could substitute for the loss of element b function, because a 3733-bp HindIII fragment containing the enhancer was also unable to stimulate transcription of a REN promoter (data not shown). It is possible that the lack of function of element b in hREN (GGCCTC) is caused by an experimental artifact of its analysis in a mouse cell line. In light of this possibility, it is important to point out that both h202E and h242E had minimal effects (either no induction or 1.2-fold induction) on the transcriptional activity of the h896 promoter in Calu-6 cells, the only permanent cell line expressing human REN mRNA endogenously (data not shown), indeed suggesting that our findings are not due to artifacts of the experimental system.14 33 34 35
It is further surprising that in addition to element b, there was no evidence for a functional element a in the hREN enhancer sequence. Of course, if element b has been rendered nonfunctional, there would be little need for another element to regulate its activity. This suggests the provocative hypothesis that the hREN enhancer is itself nonfunctional or does not act as a classical enhancer of hREN transcription. If so, there would be little selective pressure to maintain its position and sequence as suggested by mutational analysis. Circulating levels of REN in humans are substantially lower than those in mice, suggesting less of a demand to maintain high-level transcription of the hREN gene. It is also possible that transcription of the hREN gene depends on additional sequences present between -13kb and the promoter. Our Southern blot analysis suggests the absence of an additional m40-like sequence in this region. However, Germain et al36 recently identified an additional transcriptional enhancer in the hREN gene that is active in chorionic cells. In vivo, there may be cooperation between transcription factors binding to the "kidney" and "chorionic" enhancers to regulate hREN transcription, and experiments to directly test this possibility are in progress. Indeed, it is interesting to note that large hREN transgenes containing 5'-flanking DNA extending past the hREN enhancer (and containing both enhancer sequences) are expressed in a highly tissue-specific, cell-specific, and regulated manner.37 38
|
Acknowledgments |
|---|
This work was supported by NIH Grants HL56006 and HL48058 (to C.D.S.) and HL48459 (to K.W.G.) and by the American Heart Association. C.D.S. was an AHA Established Investigator at the time of this research. DNA sequencing was performed at the University of Iowa DNA Core Facility. We thank Debbie Davis, Xiaoji Zhang, and Julie Lang for their excellent technical assistance and Dr Trudy Burns for advice on statistical analysis.
Received April 30, 1999; accepted June 30, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Hackenthal E, Paul M, Ganten D, Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev. 1990;70:1067–1116.
2. Sinn PL, Sigmund CD. Understanding the regulation of renin gene expression through in vitro and in vivo models. In: Husain A, Graham RM, eds. Drugs, Enzymes and Receptors of the Renin Angiotensin System: A Century of Discovery. Sydney, Australia: Harwood Academic Publishers/Gordon and Breach Scientific International Publishers; 1999:259–278.
3. Sola C, Tronik D, Dreyfus M, Babinet C, Rougeon F. Renin-promoter SV40 large T-antigen transgenes induce tumors irrespective of normal cellular expression of renin genes. Oncogene Res. 1989;5:149–153.[Medline] [Order article via Infotrieve]
4.
Jones CA, Sigmund CD, McGowan R, Kane-Haas C,
Gross KW. Temporal and spatial expression of the murine renin genes
during fetal development. Mol Endocrinol. 1990;4:375–383.
5. Sigmund CD, Jones CA, Fabian JR, Mullins JJ, Gross KW. Tissue and cell-specific expression of a renin promoter-T antigen reporter gene construct in transgenic mice. Biochem Biophys Res Commun. 1990;170:344–350.[Medline] [Order article via Infotrieve]
6.
Sigmund CD, Jones CA, Jacob H, Ingelfinger J,
Kim U, Gamble D, Dzau VJ, Gross KW. Pathophysiology of vascular smooth
muscle in renin promoter-T antigen transgenic mice. Am J
Physiol. 1991;260:F249–F257.
7.
Sigmund CD, Jones CA, Kim U, Mullins JJ, Gross
KW. Expression of the murine renin genes in subcutaneous connective
tissue. Proc Natl Acad Sci U S A. 1990;87:7993–7997.
8.
Petrovic N, Black TA, Fabian JR, Kane CM, Jones
CA, Loudon JA, Abonia JP, Sigmund CD, Gross KW. Role of proximal
promoter elements in regulation of renin gene transcription.
J Biol Chem. 1996;271:22499–22505.
9.
Sigmund CD, Okuyama K, Ingelfinger J, Jones CA,
Mullins JJ, Kim U, Kane-Haas C, Wu C, Kenney L, Rustum Y, Dzau V, Gross
KW. Isolation and characterization of renin expressing cell lines from
transgenic mice containing a renin promoter viral oncogene fusion
construct. J Biol Chem. 1990;265:19916–19922.
10.
Petrovic N, Kane CM, Sigmund CD, Gross KW.
Down-regulation of the renin gene expression by interleukin-1.
Hypertension. 1997;30:230–235.
11. Catanzaro DF, Sun J, Gilbert MT, Yan Y, Black T, Sigmund CD, Gross KW. A Pit-1 binding site in the human renin gene promoter stimulates activity in pituitary, placental and juxtaglomerular cells. Kidney Int. 1994;46:1513–1515.[Medline] [Order article via Infotrieve]
12.
Sun J, Oddoux C, Gilbert MT, Yan Y, Lazarus A,
Campbell WG, Catanzaro DF. Pituitary-specific transcription factor
(Pit-1) binding site in the human renin gene 5'-flanking DNA stimulates
promoter activity in placental cell primary cultures and pituitary
lactosomatotropic cell lines. Circ Res. 1994;75:624–629.
13.
Borensztein P, Germain S, Fuchs S, Philippe
J, Corvol P, Pinet F. cis-regulatory elements and
trans-acting factors directing basal and cAMP-stimulated
human renin gene expression in chorionic cells. Circ Res. 1994;74:764–773.
14.
Ying L, Morris BJ, Sigmund CD. Transactivation of
the human renin promoter by the cyclic AMP/protein kinase A pathway is
mediated by both CREB-dependent and CREB-independent mechanisms in
Calu-6 cells. J Biol Chem. 1997;272:2412–2420.
15.
Sigmund CD, Jones CA, Kane CM, Wu C, Lang JA,
Gross KW. Regulated tissue- and cell-specific expression of the human
renin gene in transgenic mice. Circ Res. 1992;70:1070–1079.
16. Fukamizu A, Hatae T, Kon Y, Sugimura M, Hasegawa T, Yokoyama M, Nomura T, Katsuki M, Murakami K. Human renin in transgenic mouse kidney is localized to juxtaglomerular cells. Biochem J. 1991;278:601–603.
17.
Yan Y, Jones CA, Sigmund CD, Gross KW, Catanzaro
DF. Conserved enhancer elements in human and mouse renin genes have
different transcriptional effects in As4.1 cells. Circ Res. 1997;81:558–566.
18.
Davisson RL, Nuutinen N, Coleman ST, Sigmund CD.
Inappropriate splicing of a chimeric gene containing a large internal
exon results in exon skipping in transgenic mice. Nucleic Acids
Res. 1996;24:4023–4028.
19. Lee KA, Green MR. Small-scale preparation of extracts from radiolabeled cells efficient in pre-mRNA splicing. Methods Enzymol. 1990;181:20–30.[Medline] [Order article via Infotrieve]
20. Hooft vH, Li XY, Black D, Matthes H, Benoist C, Mathis D. Co-evolution from yeast to mouse: cDNA cloning of the 2 NF-Y (CP-1/CBF) subunits. EMBO J. 1990;9:3119–3127.[Medline] [Order article via Infotrieve]
21. Dorn A, Bollekens J, Staub A, Benoist C, Mathis D. A multiplicity of CCAAT box-binding proteins. Cell. 1987;50:863–872.[Medline] [Order article via Infotrieve]
22.
Harnish DC, Malik S, Kilbourne E, Costa R,
Karathanasis SK. Control of apolipoprotein AI gene expression through
synergistic interactions between hepatocyte nuclear factors
3 and 4. J Biol Chem. 1996;271:13621–13628.
23.
Mayall TP, Sheridan PL, Montminy MR, Jones KA.
Distinct roles for P-CREB and LEF-1 in TCR alpha enhancer assembly and
activation on chromatin templates in vitro. Genes Dev. 1997;11:887–899.
24. Ambrosetti DC, Basilico C, Dailey L. Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol Cell Biol. 1997;17:6321–6329.[Abstract]
25.
Butscher WG, Powers C, Olive M, Vinson C, Gardner
K. Coordinate transactivation of the interleukin-2 CD28 response
element by c-Rel and ATF-1/CREB2. J Biol Chem. 1998;273:552–560.
26.
Hung HL, High KA. Liver-enriched transcription
factor HNF-4 and ubiquitous factor NF-Y are critical for expression of
blood coagulation factor X. J Biol Chem. 1996;271:2323–2331.
27.
Wu GD, Lai EJ, Huang N, Wen X. Oct-1 and
CCAAT/enhancer-binding protein (C/EBP) bind to overlapping elements
within the interleukin-8 promoter: the role of Oct-1 as a
transcriptional repressor. J Biol Chem. 1997;272:2396–2403.
28.
Reith W, Kobr M, Emery P, Durand B, Siegrist CA,
Mach B. Cooperative binding between factors RFX and X2bp to the X and
X2 boxes of MHC class II promoters. J Biol Chem. 1994;269:20020–20025.
29.
Hinkley C, Perry M. Histone H2B gene
transcription during Xenopus early development requires
functional cooperation between proteins bound to the CCAAT and octamer
motifs. Mol Cell Biol. 1992;12:4400–4411.
30. Moriuchi H, Moriuchi M, Cohen JI. The varicella-zoster virus immediate-early 62 promoter contains a negative regulatory element that binds transcriptional factor NF-Y. Virology. 1995;214:256–258.[Medline] [Order article via Infotrieve]
31. Boucher PD, Piechocki MP, Hines RN. Partial characterization of the human CYP1A1 negatively acting transcription factor and mutational analysis of its cognate DNA recognition sequence. Mol Cell Biol. 1995;15:5144–5151.[Abstract]
32.
Kelly D, Kim SJ, Rizzino A. Transcriptional
activation of the type II transforming growth factor-beta receptor gene
upon differentiation of embryonal carcinoma cells. J Biol
Chem. 1998;273:21115–21124.
33.
Lang JA, Yang G, Kern JA, Sigmund CD.
Endogenous human renin expression and promoter activity in
a pulmonary carcinoma cell line (Calu-6).
Hypertension. 1995;25:704–710.
34.
Sinn PL, Sigmund CD. Human renin mRNA stability
is increased in response to cAMP in Calu-6 cells.
Hypertension. 1999;33:900–905.
35.
Lang JA, Ying L-H, Morris BJ, Sigmund CD.
Transcription and post-transcriptional mechanisms regulate expression
of the human renin gene in Calu-6 cells. Am J Physiol. 1996;271:F94–F100.
36.
Germain S, Bonnet F, Philippe J, Fuchs S, Corvol
P, Pinet F. A novel distal enhancer confers chorionic expression on the
human renin gene. J Biol Chem. 1998;273:25292–25300.
37.
Yan Y, Hu LF, Chen RP, Sealey JE, Laragh JH,
Catanzaro DF. Appropriate regulation of human renin gene expression and
secretion in 45-kb human renin transgenic mice.
Hypertension. 1998;32:205–214.
38. Sinn PL, Sigmund CD. Expression of human renin in transgenic mice containing 140 kb or 160 kb human renin transgenes. FASEB J. 1999;13:A380. Abstract.
This article has been cited by other articles:
 |
|
 |
|
  S. T. Glenn, C. A. Jones, L. Pan, and K. W. Gross In vivo analysis of key elements within the renin regulatory region Physiol Genomics, November 12, 2008; 35(3): 243 - 253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Markus, C. Goy, D. J. Adams, F. J. Lovicu, and B. J. Morris Renin Enhancer Is Crucial for Full Response in Renin Expression to an In Vivo Stimulus Hypertension, November 1, 2007; 50(5): 933 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Mrowka, A. Steege, C. Kaps, H. Herzel, B. J. Thiele, P. B. Persson, and N. Bluthgen Dissecting the action of an evolutionary conserved non-coding region on renin promoter activity Nucleic Acids Res., August 1, 2007; 35(15): 5120 - 5129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene Endocrinology, March 1, 2007; 148(3): 1424 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, Q. Shi, and C. D. Sigmund Interleukin-1{beta} Attenuates Renin Gene Expression Via a Mitogen-Activated Protein Kinase Kinase-Extracellular Signal-Regulated Kinase and Signal Transducer and Activator of Transcription 3-Dependent Mechanism in As4.1 Cells Endocrinology, December 1, 2006; 147(12): 6011 - 6018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhoux, D. R. Davis, and C. D. Sigmund The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Adams, G. A. Head, M. A. Markus, F. J. Lovicu, L. van der Weyden, F. Kontgen, M. J. Arends, S. Thiru, D. N. Mayorov, and B. J. Morris Renin Enhancer Is Critical for Control of Renin Gene Expression and Cardiovascular Function J. Biol. Chem., October 20, 2006; 281(42): 31753 - 31761. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Lavoie, X. Liu, R. A. Bianco, T. G. Beltz, A. K. Johnson, and C. D. Sigmund Evidence Supporting a Functional Role for Intracellular Renin in the Brain Hypertension, March 1, 2006; 47(3): 461 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. T. Todorov, S. Volkl, J. Friedrich, L. A. Kunz-Schughart, T. Hehlgans, L. Vermeulen, G. Haegeman, M. L. Schmitz, and A. Kurtz Role of CREB1 and NF{kappa}B-p65 in the Down-regulation of Renin Gene Expression by Tumor Necrosis Factor {alpha} J. Biol. Chem., July 1, 2005; 280(26): 24356 - 24362. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Pan, Y. Wang, C. A. Jones, S. T. Glenn, H. Baumann, and K. W. Gross Enhancer-dependent inhibition of mouse renin transcription by inflammatory cytokines Am J Physiol Renal Physiol, January 1, 2005; 288(1): F117 - F124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan and K. W. Gross Transcriptional Regulation of Renin: An Update Hypertension, January 1, 2005; 45(1): 3 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan, C. A. Jones, S. T. Glenn, and K. W. Gross Identification of a novel region in the proximal promoter of the mouse renin gene critical for expression Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1107 - F1115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Nistala, X. Zhang, and C. D. Sigmund Differential expression of the closely linked KISS1, REN, and FLJ10761 genes in transgenic mice Physiol Genomics, March 12, 2004; 17(1): 4 - 10. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. B. Persson, A. Skalweit, R. Mrowka, and B.-J. Thiele Control of renin synthesis Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2003; 285(3): R491 - R497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Liu, X. Huang, and C. D. Sigmund Identification of a Nuclear Orphan Receptor (Ear2) as a Negative Regulator of Renin Gene Transcription Circ. Res., May 16, 2003; 92(9): 1033 - 1040. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Mrowka, K. Steinhage, A. Patzak, and P. B. Persson An evolutionary approach for identifying potential transcription factor binding sites: the renin gene as an example Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1147 - R1150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Ryan, T. A. Black, S. L. Millard, K. W. Gross, and G. Hajduczok Endothelin-1 increases calcium and attenuates renin gene expression in As4.1 cells Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2458 - H2465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan, T. A. Black, Q. Shi, C. A. Jones, N. Petrovic, J. Loudon, C. Kane, C. D. Sigmund, and K. W. Gross Critical Roles of a Cyclic AMP Responsive Element and an E-box in Regulation of Mouse Renin Gene Expression J. Biol. Chem., November 30, 2001; 276(49): 45530 - 45538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Shi, H. T. Nguyen, G. D. Sharma, L. G. Navar, and K. N. Pandey Genetic disruption of atrial natriuretic peptide receptor-A alters renin and angiotensin II levels Am J Physiol Renal Physiol, October 1, 2001; 281(4): F665 - F673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Shi, K. W. Gross, and C. D. Sigmund NF-Y Antagonizes Renin Enhancer Function by Blocking Stimulatory Transcription Factors Hypertension, September 1, 2001; 38(3): 332 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. L. Keen and C. D. Sigmund Paradoxical Regulation of Short Promoter Human Renin Transgene by Angiotensin II Hypertension, February 1, 2001; 37(2): 403 - 407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Ryan, T. A. Black, K. W. Gross, and G. Hajduczok Cyclic mechanical distension regulates renin gene transcription in As4.1 cells Am J Physiol Endocrinol Metab, October 1, 2000; 279(4): E830 - E837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Shi, K. W. Gross, and C. D. Sigmund Retinoic Acid-mediated Activation of the Mouse Renin Enhancer J. Biol. Chem., January 26, 2001; 276(5): 3597 - 3603. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||