Integrative Physiology |
Presented in part at the 70th Scientific Sessions of the American Heart Association, Orlando, Fla, November 912, 1997.
From the Atherosclerosis Research Center (K.-Y.C., P.D., J.Z., S.K., P.K.S., B.C.), Burns and Allen Research Institute, Division of Cardiology, Cedars-Sinai Medical Center and UCLA School of Medicine, Los Angeles, California, and the Department of Medicine (J.N.), Lund University, University Hospital MAS, Malmö, Sweden.
Correspondence to Kuang-Yuh Chyu, MD, PhD, Division of Cardiology, Cedars-Sinai Medical Center, Davis Building, Room 1026, 8700 Beverly Blvd, Los Angeles, CA 90048. E-mail Chyuk{at}cshs.org
| Abstract |
|---|
|
|
|---|
Bmediated pathway
were also demonstrated in an in vitro injury model. We conclude that
mechanical injury in vivo and in vitro induces iNOS expression and that
lack of iNOS expression attenuates neointima formation
after perivascular arterial injury. Taken together, these
findings suggest that iNOS expression after vascular injury may promote
neointima formation.
Key Words: nuclear factor-
B vascular cell adhesion molecule-1 nitric oxide synthase mice, knockout neointima
| Introduction |
|---|
|
|
|---|
B (NF-
B) and the expression of vascular cell
adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 in
vascular smooth muscle cells (VSMCs).1 2 The expression of
inducible nitric oxide synthase (iNOS) has also been demonstrated in
injured arterial walls.3 4 Nitric oxide (NO)
possesses antiproliferative properties in vitro,5 6 and
its role in modulating neointima formation has been tested
using either NO donors or nonspecific NOS
inhibitors.7 8 9 Because the induction of iNOS
in the injured arterial walls leads to NO
production,3 it has been hypothesized that this NO
output may reduce neointima formation and that
neointima formation after injury would be more prominent in
iNOS knockout mice (iNOS-KO mice). However, recent studies showed that
wound repair and the regeneration of the injured liver are impaired in
iNOS-KO mice.10 11 These findings suggest that iNOS
induction after arterial injury may promote rather than
prevent cellular proliferation and growth. iNOS and VCAM-1 are expressed in VSMCs after mechanical injury in vivo.2 3 It is not clear whether iNOS in the injured arterial wall regulates VCAM-1 expression; in vitro observation revealed that NO donors reduced VCAM-1 expression.12 A recent report showed that iNOS is involved in proinflammatory signaling and that it upregulates the expression of the inflammatory cytokines interleukin-6 and granulocyte colony-stimulating factor.13 These findings also suggest that iNOS may enhance VCAM-1 expression in the injured arterial wall.
In the present study, we used a gene-knockout strategy to test the hypothesis that a lack of iNOS expression after in vivo mechanical injury reduces neointimal thickening and VCAM-1 expression. We also tested the hypothesis that mechanical injury alone induces iNOS expression in an in vitro injury model, because it is not known whether injury itself is a stimulus for the expression of iNOS in VSMCs.
| Materials and Methods |
|---|
|
|
|---|
Morphometric Measurement
Sections from the middle half of the injured segment were
collected. These sections were used because the anatomy of the
sections from cut ends was occasionally distorted when the vessel was
removed from the cuff. Serial, 4-µm-thick sections with an average
4 µm apart were obtained. Four sections were collected on each
slide, and 20 to 25 slides were collected for each arterial
segment. Slides were sequentially divided into 3 groups, and the first
3 slides from each group were stained with hematoxylin and eosin.
Computer-assisted morphometric analysis was done with
image-analysis software (Optima 5.1, Bioscan) on these
sections. The measurements of sections from the slides from each animal
were averaged and analyzed.
In Vitro Injury Experiment
Rat aortic VSMCs were cultured using DMEM/F-12 with 10% fetal
bovine serum, and confluent cells were growth-arrested for 48 hours
before injury. The injury was done as described
previously.14 For Western blotting and staining for the
iNOS protein, injured cells were harvested 24 or 48 hours after injury.
For the electrophoretic mobility shift assay (EMSA) and the
determination of cytosolic levels of NF-
B, cells were injured at 30
minutes, 2 hours, and 6 hours before harvest.
Western Blot Analysis
Cytosolic proteins underwent electrophoresis on a 7.5% SDS-PAGE
gel for the detection of the iNOS protein or on 12% gels to detect
p50, p65, and inhibitory-
B (I
B) proteins. Primary
antibodies were rabbit polyclonal iNOS, p50, p65, or I
B antibody
(Santa Cruz Biotechnology).
EMSA
The oligodeoxynucleotide used in EMSA incorporated
the sequence between -113 and -92 bp in the rat iNOS promoter
containing the NF-
B binding site (shown underlined; 5'-3'
CCTACTGGGGACTCTCCCTTTG).15 EMSA and
supershift assays were performed as previously
described.1
Immunohistochemical Staining
Primary antibodies were anti-iNOS,
anti-endothelial NOS (eNOS), antiproliferating cell
nuclear antigen (PCNA) (all rabbit polyclonal, Santa Cruz
Biotechnology), rat monoclonal antimacrophages/monocytes-2
(MOMA-2) (Serotec), and rat monoclonal anti-mouse VCAM-1
antibody (Pharmingen). Mucosal cells in intestinal villi from wild-type
mice were used as positive controls for PCNA staining.
The semiquantitative measurement of the VCAM-1 or MOMA-2 stained area standardized against the medial area from 4 sections per animal was done with computer-assisted analysis.16 Analysis by 2 observers blinded to animal groups showed an interobserver variability of <5%.
Statistical Analysis
Optical densities of signals from EMSA or Western blot
analysis were measured by computerized densitometry and
presented either in text or in graph form. Numeric data are
expressed as mean±SD. The number of experiments or animals used is
given in the text or figure legend. The difference among groups was
determined using 2-way ANOVA for multiple comparisons followed by a
Tukey-Kramer test. P<0.05 was considered statistically
significant.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
| Results |
|---|
|
|
|---|
|
Twenty-one days after cuff placement, a 40% reduction of the
neointimal area occurred in iNOS-KO mice compared with the
wild-type mice (Table
, Figure 2
). The intima/media ratio (I/M ratio)
was also significantly smaller in iNOS-KO mice than wild-type mice. No
overall difference existed in medial thickness or vessel size.
|
|
Reduced VCAM-1 Expression After Injury in iNOS-KO Mice
Little detectable VCAM-1 existed in uninjured sections from both
groups. At 3 and 7 days after injury, VCAM-1 expression was observed in
the media of the injured arteries of both iNOS-KO and wild-type mice.
As determined by computer-assisted analysis, VCAM-1 expression
was significantly less in iNOS-KO mice than in wild-type mice (Figure 3
).
|
Mechanical Injury Increases iNOS Expression In Vitro
We studied the direct effect of mechanical injury on iNOS
expression in a previously characterized in vitro injury model. Injury
caused a well-defined zone of injury in the monolayer of cultured
VSMCs. At 24 and 48 hours after injury, VSMCs were seen migrating into
the injured zone, as described previously.14 Western blot
analysis revealed that injury caused a 1.7±0.9-fold increase
(n=4; P=NS) in iNOS expression 24 hours after injury
compared with controls, whereas 48 hours after injury, a 3.4±0.8-fold
increase in iNOS expression occurred (P<0.01 compared with
controls; n=4), with concomitant detectable iNOS immunoreactivity in
VSMCs in the injury zone (Figure 4
, A and
B).
|
Mechanical Injury Increases iNOS NF-
B Binding Activity
NF-
B activation in response to injury was studied using an
oligodeoxynucleotide containing the NF-
B sequence from
the promoter region of the rat iNOS gene. An increase of iNOS NF-
B
binding was observed 30 minutes after injury, with a subsequent decline
at 2 and 6 hours after injury (Figure 5
, A and B). A supershift experiment revealed mobility retardation and
decreased binding, indicating specific nuclear binding (Figure 5C
). The observation that cytosolic I
B, p50, and p65 levels
decreased time-dependently after injury further confirms the activation
of the transcription factor NF-
B (Figure 5D
).
|
| Discussion |
|---|
|
|
|---|
iNOS produced a sustained increase in NO compared with eNOS, and it was expressed in the arterial walls of VSMCs after mechanical injury. Because NO inhibits VSMC proliferation in vitro, the inhibition of NO output by iNOS was expected to increase neointima formation after injury. However, NG-nitro-L-arginine methyl ester treatment in a rat carotid injury experiment failed to demonstrate such an increase.9 This chemical may possess effects other than the inhibition of NO production,17 which may confound the interpretation of the data. Our study in iNOS gene knockout mice avoided such problems. We observed that periadventitial cuff injury induced iNOS expression in wild-type mice, which confirmed a previous observation by Moroi et al.18 Twenty-one days after injury, less neointima formation existed in iNOS-KO mice than in wild-type mice. Also, less proliferation of medial VSMCs occurred in iNOS-KO mice than in wild-type mice. Our findings support the hypothesis that iNOS expression in injured VSMCs promotes proliferation and neointima formation. Neointima formation has been viewed as a general wound-healing response to injury.19 Yamasaki et al10 reported that wound healing was delayed in iNOS-KO mice. Rai et al11 also reported that the proliferation of regenerating hepatocytes after liver injury was significantly less in iNOS-KO mice. Our results, together with their findings, suggest that iNOS is involved in wound healing after injury in vivo and that it contributes to neointima formation after arterial injury.
The I/M ratio in the mouse injury model reported in the literature shows substantial variation. This may be due to the method used to injure the artery and to differences in the sex or genetic background of the mice. Guidewire-induced injury of the common carotid artery did not produce neointima formation in C57BL/6J mice20 ; however, injuring the carotid artery by ligation showed an I/M ratio of 1.13±0.2 in mice with the same genetic background.21 Using a periadventitial cuff femoral artery injury model similar to ours, Moroi et al18 demonstrated a mean I/M volume ratio of 27% and 18%, respectively, in male and female C57BL/6 mice and 31% and 17%, respectively, in male and female SV129 mice. Our results of a mean I/M ratio of 29% in wild-type mice is comparable to their findings.
It is interesting to note that neointima formation is reportedly enhanced in eNOS KO mice,18 which is in sharp contrast to our results in iNOS-KO mice. We speculate that this difference may be due to intrinsic differences in their expression. eNOS is constitutively expressed and may continuously modulate vascular responses. Lack of eNOS, therefore, could be detrimental to vascular functions. This concept is supported by experiments in eNOS-KO mice. eNOS KO mice have higher systemic and pulmonary arterial pressures22 23 than wild-type mice. The observation that neointima formation is enhanced in eNOS-KO mice18 further strengthens this concept. In contrast, the expression of iNOS is tightly regulated. Hence, its physiological role in the vascular response to injury could be entirely different from that of eNOS. In published reports, the expression of iNOS is mostly associated with pathological states, such as atherosclerosis and transplant vasculopathy.24 25 26 Experiments using iNOS-KO mice have demonstrated delayed wound healing and a lower proliferative response to injury.10 11 These findings suggest that the expression of iNOS in response to injury may promote cellular proliferation. Our experimental data support this possibility. It is also interesting to note that in gene-transfer studies, eNOS or iNOS overexpression decreased neointimal thickening. We speculate that these discrepant findings may be due to the amount of NO being produced. The amount of NO produced by the overexpression of eNOS or iNOS may be much different from the amount produced by endogenous iNOS expression induced by arterial injury. NO enhances the proliferation of VSMCs at low concentrations, but it has antiproliferative effects at higher concentrations.27
Mechanical injury evokes an inflammatory response characterized by the
activation of NF-
B and the expression of various adhesion molecules
in the vessel wall.1 2 We demonstrated that the expression
of VCAM-1 in injured carotid arteries was increased 3 and 7 days after
injury in both groups of mice, which is consistent with
previous reports2 28 ; however, VCAM-1 expression was
significantly less in the iNOS-KO mice than in the wild-type mice. This
finding suggests that increased iNOS expression in the injured
arterial wall may promote VCAM-1 expression. These
observations are further supported by the study by Hierholzer et
al13 ; they reported that iNOS participates in
proinflammatory signaling and upregulates several inflammatory
molecules in a hypoxia-reperfusion injury model, possibly via a
redox-sensitive mechanism. NO generated from iNOS expression could
react with superoxide and lead to the formation of peroxynitrite, a
potent oxidant.29 The reductase domain in iNOS is capable
of generating superoxide, independent of NO
production.30 It is therefore possible that
superoxide produced by the reductase domain, coupled with peroxynitrite
formation, could alter the redox state in the cells and result in a
persistent activation of inflammatory signaling, thereby leading to
more neointimal thickening.
In vivo experiments showed that iNOS is expressed in VSMCs in injured arteries.3 4 However it is not known whether injury itself is a stimulus for the expression of iNOS in VSMCs or whether the injury acts in concert with other stimuli, such as platelets, mononuclear cells, or serum growth factors. Hence, we tested the hypothesis that mechanical injury alone can elicit iNOS expression by using an in vitro model. Although this model does not reproduce the in vivo condition in an exact fashion, the replication and migration of VSMCs in the injury zone14 could mimic in vivo processes.
We observed iNOS expression in cultured rat VSMCs after injury by
Western blot analysis and immunocytochemistry. Transcription
factor NF-
B played an important role in the iNOS expression induced
by cytokines in VSMCs.31 Its activation required
the phosphorylation and degradation of the cytosolic
inhibitor I
B to allow the nuclear translocation of p50
and p65, with subsequent initiation of gene
transcription.32 Our observation that injury increased
iNOS NF-
B binding activity with a concomitant decrease of cytosolic
p50, p65, and I
B levels is consistent with this view. Other
mechanical forces, such as pulsatile stretch, increase superoxide
production, with subsequent activation of NF-
B in human
coronary smooth muscle cells.33 The early
appearance of superoxide 20 minutes after application of stretch is
consistent with our time points as a mediator for the
activation of the NF-
B system in this current study. Our observation
of injury-induced iNOS expression in cultured VSMCs suggests that
injury itself is a stimulus for the induction of iNOS in VSMCs.
However, our results do not exclude the possibility that injury-induced
growth factor expression may induce iNOS expression. The very early
activation of iNOS NF-
B in our study makes this possibility less
likely.
In summary, we demonstrated that mechanical injury induced reduced neointima formation in injured carotid arteries from iNOS-KO mice; this was associated with reduced VCAM-1 expression when compared with wild-type mice. These findings are in sharp contrast to those from eNOS KO mice, in which increased neointima formation after injury has been reported.18 Thus, our findings highlight the divergent functional roles of eNOS and iNOS genes, which is likely to be of biological significance. Molecular mechanisms responsible for this diversity remain to be defined.
| Acknowledgments |
|---|
Received June 21, 1999; accepted September 20, 1999.
| References |
|---|
|
|
|---|
B activity and arterial response to balloon
injury. Atherosclerosis. 1997;131:5966.[Medline]
[Order article via Infotrieve]
2.
Landry DB, Couper LL, Bryant SR, Lindner V. Activation
of the NF-
B and I
B system in smooth muscle cells after rat
arterial injury: induction of vascular cell adhesion
molecule-1 and monocyte chemoattractant protein-1. Am J
Pathol. 1997;151:10851095.[Abstract]
3.
Hansson GK, Geng Y-J, Holm J, Hårdhammar P, Wennmalm
Å, Jennische E. Arterial smooth muscle cells express
nitric oxide synthase in response to endothelial
injury. J Exp Med. 1994;180:733738.
4.
Arthur JF, Yin ZL, Yound HM, Dusting GJ.
Induction of nitric oxide synthase in the neointima induced
by a periarterial collar in rabbits. Arterioscler
Thromb Vasc Biol. 1997;17:737740.
5. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:17741777.
6. Mooradian DL, Hutsell TC, Keefer LK. Nitric oxide (NO) donor molecules: effect of NO release rate on vascular smooth muscle cell proliferation in vitro. J Cardiovasc Pharmacol. 1995;25:674678.[Medline] [Order article via Infotrieve]
7.
Lee JS, Adrie C, Jacob HJ, Roberts JD Jr, Zapol WM,
Bloch KD. Chronic inhalation of nitric oxide inhibits
neointimal formation after balloon-induced
arterial injury. Circ Res. 1996;78:337342.
8.
Guo JP, Milhoan KA, Tuan RS, Lefer AM. Beneficial
effect of SPM-5185, a cysteine-containing nitric oxide donor, in rat
carotid artery intimal injury. Circ Res. 1994;75:7784.
9. Watkins RW, Pula K, Cook J, Hoos L, McLeod R, Prioli NA, Davis HR Jr. NG-nitro-L-arginine methyl ester does not affect balloon catheter-induced intimal hyperplasia in rats. Biochem Biophys Res Commun. 1993;197:304309.[Medline] [Order article via Infotrieve]
10. Yamasaki K, Edington HDJ, McClosky C, Tzeng E, Lizonova A, Kovesdi I, Steed DL, Billiar TR. Reversal of impaired wound repair in iNOS-deficient mice by topical adenoviral-mediated iNOS gene transfer. J Clin Invest. 1998;101:967971.[Medline] [Order article via Infotrieve]
11.
Rai RM, Lee FYJ, Rosen A, Yang SQ, Lin HZ, Koteish A,
Liew FY, Zaragoza C, Lowenstein C, Diehl AM. Impaired liver
regeneration in inducible nitric oxide synthase-deficient mice.
Proc Natl Acad Sci U S A. 1998;95:1382913834.
12.
Shin WS, Hong Y-H, Peng H-B, De Caterina R, Libby
P, Liao JK. Nitric oxide attenuates vascular smooth muscle cell
activation by interferon-
. The role of constitutive NF-
B
activity. J Biol Chem. 1996;271:1131711324.
13.
Hierholzer C, Harbrecht B, Menezes JM, Kane J,
MacMicking J, Nathan CF, Peitzman AB, Billiar TR, Tweardy DJ. Essential
role of induced nitric oxide in the initiation of the inflammatory
response after hemorrhagic shock. J Exp Med. 1998;187:917928.
14.
Calara F, Ameli S, Hultgårdh-Nilsson A, Cercek B,
Kupfer J, Hedin U, Forrester J, Shah PK, Nilsson J. Autocrine induction
of DNA synthesis by mechanical injury of cultured smooth muscle cells,
potential role of FGF and PDGF. Arterioscler Thromb Vasc
Biol. 1996;16:187193.
15. Eberhardt W, Kunz D, Hummel R, Pfeilschifter J. Molecular cloning of the rat inducible nitric oxide synthase gene promoter. Biochem Biophys Res Comun. 1996;223:752756.[Medline] [Order article via Infotrieve]
16.
Shah PK, Nilsson J, Kaul S, Fishbein MC, Ageland H,
Hamsten A, Johansson J, Karpe F, Cercek B. Effects of recombinant
apolipoprotein A-Imilano on aortic
atherosclerosis in apolipoprotein E-deficient mice.
Circulation. 1998;97:780785.
17.
Luvarà G, Pueyo ME, Philippe M, Mandet C, Savoie
F, Henrion D, Michel J-B. Chronic blockade of NO synthase activity
induces a proinflammatory phenotype in the arterial
wall. Prevention by angiotensin II antagonism.
Arterioscler Thromb Vasc Biol. 1998;18:14081416.
18. Moroi M, Zhang L, Yasuda T, Virmani R, Gold HK, Fishman MC, Huang PL. Interaction of genetic deficiency of endothelial nitric oxide, gender, and pregnancy in vascular response to injury in mice. J Clin Invest. 1998;101:12251232.[Medline] [Order article via Infotrieve]
19. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol. 1991;17:758769.[Abstract]
20.
De Geest B, Zhao Z, Collen D, Holvoet P. Effects of
adenovirus-mediated human Apo A-1 gene transfer on
neointima formation after endothelial
denudation in Apo E-deficient mice. Circulation. 1997;96:43494356.
21.
Kumar A, Hoover JL, Simmons CA, Lindner V, Shebuski RJ.
Remodeling and neointimal formation in the carotid artery
of normal and P-selectin-deficient mice. Circulation. 1997;96:43334342.
22.
Shesely EG, Maeda N, Kim HS, Desai KM, Krege JH,
Laubach VE, Sherman PA, Sessa WC, Smithies O. Elevated blood pressures
in mice lacking endothelial nitric oxide synthase.
Proc Natl Acad Sci U S A. 1996;93:1317613181.
23.
Steudel W, Ichinose F, Huang PL, Hurford WE, Jones RC,
Bevan JA, Fishman MC, Zapol WM. Pulmonary vasoconstriction and
hypertension in mice with targeted disruption of the
endothelial nitric oxide synthase (NOS 3) gene.
Circ Res. 1997;81:3441.
24.
Luoma JS, Strålin P, Marklund SL, Hiltunen TP,
Särkioja T, Ylä-Herttuala S. Expression of extracellular
SOD and iNOS in macrophages and smooth muscle cells in human
and rabbit atherosclerotic lesions: colocalization with epitopes
characteristic of oxidized LDL and peroxynitrite-modified proteins.
Arterioscler Thromb Vasc Biol. 1998;18:157167.
25.
Russell ME, Wallace AF, Wyner LR, Newell JB, Karnovsky
MJ. Upregulation and modulation of inducible nitric oxide synthase in
rat cardiac allografts with chronic rejection and transplant
arteriosclerosis. Circulation. 1995;92:457464.
26. Lafond-Walker A, Chen C-L, Augustine S, Wu T-C, Hruban RH, Lowenstein CJ. Inducible nitric oxide synthase expression in coronary arteries of transplanted human hearts with accelerated graft arteriosclerosis. Am J Pathol. 1997;151:919925.[Abstract]
27. Thomae KR, Nakayama DK, Billiar TR, Simmons RL, Pitt BR, Davies P. The effect of nitric oxide on fetal pulmonary artery smooth muscle growth. J Surg Res. 1995;59:337343.[Medline] [Order article via Infotrieve]
28. Oguchi S, Zhu J, Dimayuga P, Yano J, Kaul S, Shah PK, Cercek B. Increased intimal thickening after arterial injury in hypercholesterolemic apolipoprotein E deficient mice: finding a novel model. Circulation. 1998;96(suppl I):I-548. Abstract.
29.
Beckman JS, Koppenol WH. Nitric oxide, superoxide, and
peroxynitrite: the good, the bad, and the ugly. Am J
Physiol. 1996;271:C1424C1437.
30.
Xia Y, Roman LJ, Masters BSS, Zweier JL. Inducible
nitric-oxide synthase generates superoxide from the reductase doman.
J Biol Chem. 1998;273:2263522639.
31.
Spink J, Cohen J, Evans TJ. The cytokine
responsive vascular smooth muscle cell enhancer of inducible nitric
oxide synthase: activation by nuclear factor-
B. J
Biol Chem. 1995;270:2954129547.
32.
Collins T, Read MA, Neish AS, Whitley MZ, Thanos D,
Maniatis T. Transcriptional regulation of endothelial
cell adhesion molecules: NF-
B and cytokine-inducible
enhancers. FASEB J. 1995;9:899909.[Abstract]
33.
Hishikawa K, Oemar BS, Yang Z, Lüscher TF.
Pulsatile stretch stimulates superoxide production and
activates nuclear factor-kB in human coronary smooth
muscle. Circ Res. 1997;81:797803.
This article has been cited by other articles:
![]() |
M. Matsumoto, P. C. Dimayuga, C. Wang, J. Kirzner, M. Cercek, J. Yano, K.-Y. Chyu, P. K. Shah, and B. Cercek Exogenous heat shock protein-70 inhibits cigarette smoke-induced intimal thickening Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1320 - R1327. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lukowski, P. Weinmeister, D. Bernhard, S. Feil, M. Gotthardt, J. Herz, S. Massberg, A. Zernecke, C. Weber, F. Hofmann, et al. Role of Smooth Muscle cGMP/cGKI Signaling in Murine Vascular Restenosis Arterioscler. Thromb. Vasc. Biol., July 1, 2008; 28(7): 1244 - 1250. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schmidt, T. H. Westhoff, P. Krauser, W. Zidek, and M. van der Giet The uraemic toxin phenylacetic acid increases the formation of reactive oxygen species in vascular smooth muscle cells Nephrol. Dial. Transplant., January 1, 2008; 23(1): 65 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakata, M. Tsutsui, H. Shimokawa, T. Yamashita, A. Tanimoto, H. Tasaki, K. Ozumi, K. Sabanai, T. Morishita, O. Suda, et al. Statin Treatment Upregulates Vascular Neuronal Nitric Oxide Synthase Through Akt/NF-{kappa}B Pathway Arterioscler. Thromb. Vasc. Biol., January 1, 2007; 27(1): 92 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Moncada Adventures in vascular biology: a tale of two mediators Phil Trans R Soc B, May 29, 2006; 361(1469): 735 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Wei, K.-C. Huang, Y.-H. Chou, P.-F. Hsieh, K.-H. Lin, and W.-W. Lin The Role of Rho-Associated Kinase in Differential Regulation by Statins of Interleukin-1beta- and Lipopolysaccharide-Mediated Nuclear Factor {kappa}B Activation and Inducible Nitric-Oxide Synthase Gene Expression in Vascular Smooth Muscle Cells Mol. Pharmacol., March 1, 2006; 69(3): 960 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Strom, A. I. Olin, A. Aspberg, and A. Hultgardh-Nilsson Fibulin-2 is present in murine vascular lesions and is important for smooth muscle cell migration Cardiovasc Res, February 15, 2006; 69(3): 755 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hofmann, R. Feil, T. Kleppisch, and J. Schlossmann Function of cGMP-Dependent Protein Kinases as Revealed by Gene Deletion Physiol Rev, January 1, 2006; 86(1): 1 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakata, M. Tsutsui, H. Shimokawa, M. Tamura, H. Tasaki, T. Morishita, O. Suda, S. Ueno, Y. Toyohira, Y. Nakashima, et al. Vascular Neuronal NO Synthase Is Selectively Upregulated by Platelet-Derived Growth Factor: Involvement of the MEK/ERK Pathway Arterioscler. Thromb. Vasc. Biol., December 1, 2005; 25(12): 2502 - 2508. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Dimayuga, H. Li, K.-Y. Chyu, G. N. Fredrikson, J. Nilsson, M. C. Fishbein, P. K. Shah, and B. Cercek T Cell Modulation of Intimal Thickening After Vascular Injury: The Bimodal Role of IFN-{gamma} in Immune Deficiency Arterioscler. Thromb. Vasc. Biol., December 1, 2005; 25(12): 2528 - 2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Liu, O. A. Carretero, O. H. Cingolani, T.-D. Liao, Y. Sun, J. Xu, L. Y. Li, P. J. Pagano, J. J. Yang, and X.-P. Yang Role of inducible nitric oxide synthase in cardiac function and remodeling in mice with heart failure due to myocardial infarction Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2616 - H2623. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, O. A. Carretero, J. Xu, N.-E. Rhaleb, F. Wang, C. Lin, J. J. Yang, P. J. Pagano, and X.-P. Yang Lack of Inducible NO Synthase Reduces Oxidative Stress and Enhances Cardiac Response to Isoproterenol in Mice With Deoxycorticosterone Acetate-Salt Hypertension Hypertension, December 1, 2005; 46(6): 1355 - 1361. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. W. Q. Moore and D. Y. Hui Apolipoprotein E inhibition of vascular hyperplasia and neointima formation requires inducible nitric oxide synthase J. Lipid Res., October 1, 2005; 46(10): 2083 - 2090. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Anazawa, P. C. Dimayuga, H. Li, S. Tani, J. Bradfield, K.-Y. Chyu, S. Kaul, P. K. Shah, and B. Cercek Effect of Exposure to Cigarette Smoke on Carotid Artery Intimal Thickening: The Role of Inducible NO Synthase Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1652 - 1658. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Chyu, P. C Dimayuga, X. Zhao, J. Nilsson, P. K Shah, and B. Cercek Altered AP-1/Ref-1 redox pathway and reduced proliferative response in iNOS-deficient vascular smooth muscle cells Vascular Medicine, August 1, 2004; 9(3): 177 - 183. [Abstract] [PDF] |
||||
![]() |
N. C. Browner, H. Sellak, and T. M. Lincoln Downregulation of cGMP-dependent protein kinase expression by inflammatory cytokines in vascular smooth muscle cells Am J Physiol Cell Physiol, July 1, 2004; 287(1): C88 - C96. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Chyu, S. M. Babbidge, X. Zhao, R. Dandillaya, A. G. Rietveld, J. Yano, P. Dimayuga, B. Cercek, and P. K. Shah Differential Effects of Green Tea-Derived Catechin on Developing Versus Established Atherosclerosis in Apolipoprotein E-Null Mice Circulation, May 25, 2004; 109(20): 2448 - 2453. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Feil, S. M. Lohmann, H. de Jonge, U. Walter, and F. Hofmann Cyclic GMP-Dependent Protein Kinases and the Cardiovascular System: Insights From Genetically Modified Mice Circ. Res., November 14, 2003; 93(10): 907 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dixit, D. Zhuang, B. Ceacareanu, and A. Hassid Treatment With Insulin Uncovers the Motogenic Capacity of Nitric Oxide in Aortic Smooth Muscle Cells: Dependence on Gab1 and Gab1-SHP2 Association Circ. Res., November 14, 2003; 93 (10): e113 - e123. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zanetti, L. V. d'Uscio, I. Kovesdi, Z. S. Katusic, and T. O'Brien In Vivo Gene Transfer of Inducible Nitric Oxide Synthase to Carotid Arteries From Hypercholesterolemic Rabbits Stroke, May 1, 2003; 34(5): 1293 - 1298. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, P. Dimayuga, M. Yamashita, J. Yano, M. Fournier, M. Lewis, and B. Cercek Arterial Injury in Mice with Severe Insulin-Like Growth Factor-1 (IGF-1) Deficiency Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2002; 7(4): 227 - 233. [Abstract] [PDF] |
||||
![]() |
J.-Y. Qian, A. Haruno, Y. Asada, T. Nishida, Y. Saito, T. Matsuda, and H. Ueno Local Expression of C-Type Natriuretic Peptide Suppresses Inflammation, Eliminates Shear Stress-Induced Thrombosis, and Prevents Neointima Formation Through Enhanced Nitric Oxide Production in Rabbit Injured Carotid Arteries Circ. Res., November 29, 2002; 91(11): 1063 - 1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chang, B. Ceacareanu, M. Dixit, N. Sreejayan, and A. Hassid Nitric Oxide-Induced Motility in Aortic Smooth Muscle Cells: Role of Protein Tyrosine Phosphatase SHP-2 and GTP-Binding Protein Rho Circ. Res., September 6, 2002; 91(5): 390 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.A. Gunnett, D.D. Lund, M.A. Howard III, Y. Chu, F.M. Faraci, and D.D. Heistad Gene Transfer of Inducible Nitric Oxide Synthase Impairs Relaxation in Human and Rabbit Cerebral Arteries Stroke, September 1, 2002; 33(9): 2292 - 2296. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dimayuga, B. Cercek, S. Oguchi, G. N. Fredrikson, J. Yano, P. K. Shah, S. Jovinge, and J. Nilsson Inhibitory Effect on Arterial Injury-Induced Neointimal Formation by Adoptive B-Cell Transfer in Rag-1 Knockout Mice Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 644 - 649. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tolbert, J. A. Thompson, P. Bouchard, and S. Oparil Estrogen-Induced Vasoprotection Is Independent of Inducible Nitric Oxide Synthase Expression: Evidence From the Mouse Carotid Artery Ligation Model Circulation, November 27, 2001; 104(22): 2740 - 2745. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Brown, Y. Lin, and A. Hassid Requirement of protein tyrosine phosphatase SHP2 for NO-stimulated vascular smooth muscle cell motility Am J Physiol Heart Circ Physiol, October 1, 2001; 281(4): H1598 - H1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Lincoln, N. Dey, and H. Sellak Signal Transduction in Smooth Muscle: Invited Review: cGMP-dependent protein kinase signaling mechanisms in smooth muscle: from the regulation of tone to gene expression J Appl Physiol, September 1, 2001; 91(3): 1421 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Lee, M. Borhani, T. L. Ennis, G. R. Upchurch Jr, and R. W. Thompson Experimental Abdominal Aortic Aneurysms in Mice Lacking Expression of Inducible Nitric Oxide Synthase Arterioscler. Thromb. Vasc. Biol., September 1, 2001; 21(9): 1393 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C Kone Molecular biology of natriuretic peptides and nitric oxide synthases Cardiovasc Res, August 15, 2001; 51(3): 429 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sasu, A. L. Cooper, and D. Beasley Juxtacrine effects of IL-1{alpha} precursor promote iNOS expression in vascular smooth muscle cells Am J Physiol Heart Circ Physiol, April 1, 2001; 280(4): H1615 - H1623. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sinnaeve, J.-D. Chiche, Z. Nong, O. Varenne, N. Van Pelt, H. Gillijns, D. Collen, K. D. Bloch, and S. Janssens Soluble Guanylate Cyclase {{alpha}}1 and {beta}1 Gene Transfer Increases NO Responsiveness and Reduces Neointima Formation After Balloon Injury in Rats via Antiproliferative and Antimigratory Effects Circ. Res., January 19, 2001; 88(1): 103 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oguchi, P. Dimayuga, J. Zhu, K.-Y. Chyu, J. Yano, P. K. Shah, J. Nilsson, and B. Cercek Monoclonal Antibody Against Vascular Cell Adhesion Molecule-1 Inhibits Neointimal Formation After Periadventitial Carotid Artery Injury in Genetically Hypercholesterolemic Mice Arterioscler. Thromb. Vasc. Biol., July 1, 2000; 20(7): 1729 - 1736. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dimayuga, B. Cercek, S. Oguchi, G. N. Fredrikson, J. Yano, P. K. Shah, S. Jovinge, and J. Nilsson Inhibitory Effect on Arterial Injury-Induced Neointimal Formation by Adoptive B-Cell Transfer in Rag-1 Knockout Mice Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 644 - 649. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |