Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1999;85:1192-1198

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Methods
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chyu, K.-Y.
Right arrow Articles by Cercek, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chyu, K.-Y.
Right arrow Articles by Cercek, B.
(Circulation Research. 1999;85:1192.)
© 1999 American Heart Association, Inc.


Integrative Physiology

Decreased Neointimal Thickening After Arterial Wall Injury in Inducible Nitric Oxide Synthase Knockout Mice

Presented in part at the 70th Scientific Sessions of the American Heart Association, Orlando, Fla, November 9–12, 1997.

Kuang-Yuh Chyu, Paul Dimayuga, Jenny Zhu, Jan Nilsson, Sanjay Kaul, Prediman K. Shah, Bojan Cercek

From the Atherosclerosis Research Center (K.-Y.C., P.D., J.Z., S.K., P.K.S., B.C.), Burns and Allen Research Institute, Division of Cardiology, Cedars-Sinai Medical Center and UCLA School of Medicine, Los Angeles, California, and the Department of Medicine (J.N.), Lund University, University Hospital MAS, Malmö, Sweden.

Correspondence to Kuang-Yuh Chyu, MD, PhD, Division of Cardiology, Cedars-Sinai Medical Center, Davis Building, Room 1026, 8700 Beverly Blvd, Los Angeles, CA 90048. E-mail Chyuk{at}cshs.org


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Mechanical injury in vivo results in the expression of the inducible form of nitric oxide synthase (iNOS) in vascular smooth muscle cells. However, the role of iNOS in modulating neointima formation after arterial wall injury is not clear. To determine whether the induction of iNOS gene expression promotes or attenuates the neointimal response to injury, we used a murine model of perivascular injury induced by placing a periadventitial collar around the carotid arteries in both wild-type and iNOS knockout mice (iNOS-KO mice). Periadventitial injury induced iNOS expression in the wild-type but not the iNOS-KO mice. Neointimal area and the intima/media ratio were significantly less in the iNOS-KO mice compared with the wild-type mice at 21 days. Injury-induced proliferation of medial cells and vascular cell adhesion molecule-1 expression were also attenuated in iNOS-KO mice compared with wild-type mice. The induction of iNOS and the activation of the nuclear factor-{kappa}B–mediated pathway were also demonstrated in an in vitro injury model. We conclude that mechanical injury in vivo and in vitro induces iNOS expression and that lack of iNOS expression attenuates neointima formation after perivascular arterial injury. Taken together, these findings suggest that iNOS expression after vascular injury may promote neointima formation.


Key Words: nuclear factor-{kappa}B • vascular cell adhesion molecule-1 • nitric oxide synthase • mice, knockout • neointima


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mechanical injury to the arterial walls results in an inflammatory response, as evidenced by the activation of nuclear factor-{kappa}B (NF-{kappa}B) and the expression of vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 in vascular smooth muscle cells (VSMCs).1 2 The expression of inducible nitric oxide synthase (iNOS) has also been demonstrated in injured arterial walls.3 4 Nitric oxide (NO) possesses antiproliferative properties in vitro,5 6 and its role in modulating neointima formation has been tested using either NO donors or nonspecific NOS inhibitors.7 8 9 Because the induction of iNOS in the injured arterial walls leads to NO production,3 it has been hypothesized that this NO output may reduce neointima formation and that neointima formation after injury would be more prominent in iNOS knockout mice (iNOS-KO mice). However, recent studies showed that wound repair and the regeneration of the injured liver are impaired in iNOS-KO mice.10 11 These findings suggest that iNOS induction after arterial injury may promote rather than prevent cellular proliferation and growth.

iNOS and VCAM-1 are expressed in VSMCs after mechanical injury in vivo.2 3 It is not clear whether iNOS in the injured arterial wall regulates VCAM-1 expression; in vitro observation revealed that NO donors reduced VCAM-1 expression.12 A recent report showed that iNOS is involved in proinflammatory signaling and that it upregulates the expression of the inflammatory cytokines interleukin-6 and granulocyte colony-stimulating factor.13 These findings also suggest that iNOS may enhance VCAM-1 expression in the injured arterial wall.

In the present study, we used a gene-knockout strategy to test the hypothesis that a lack of iNOS expression after in vivo mechanical injury reduces neointimal thickening and VCAM-1 expression. We also tested the hypothesis that mechanical injury alone induces iNOS expression in an in vitro injury model, because it is not known whether injury itself is a stimulus for the expression of iNOS in VSMCs.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Periadventitial Collar Injury of Carotid Artery
Wild-type and iNOS-KO mice (B6/129 background; 5-week-old males; Jackson Laboratory, Bar Harbor, Me) were fed regular chow throughout the duration of the experiment. At the age of 25 weeks, mice were anesthetized with Enflurane inhalation, the right carotid artery was dissected, and a nonocclusive plastic cuff (length, 3 mm; internal diameter, 0.51 mm; Cole-Parmer Instrument Co) was placed around the carotid artery. Mice were euthanized 3, 7, or 21 days after injury, and the carotid arteries were perfused with 0.9% saline for 10 minutes and frozen at -70°C after they were embedded in OCT compound (Tissue-Tek, Allegiance). The contralateral, noninjured carotid arteries were used as controls. This experimental protocol was approved by the Institutional Animal Care and Use Committee of our institution. Intravascular thrombosis, as determined by hematoxylin and eosin staining, was observed in only one wild-type mouse.

Morphometric Measurement
Sections from the middle half of the injured segment were collected. These sections were used because the anatomy of the sections from cut ends was occasionally distorted when the vessel was removed from the cuff. Serial, 4-µm-thick sections with an average 4 µm apart were obtained. Four sections were collected on each slide, and 20 to 25 slides were collected for each arterial segment. Slides were sequentially divided into 3 groups, and the first 3 slides from each group were stained with hematoxylin and eosin. Computer-assisted morphometric analysis was done with image-analysis software (Optima 5.1, Bioscan) on these sections. The measurements of sections from the slides from each animal were averaged and analyzed.

In Vitro Injury Experiment
Rat aortic VSMCs were cultured using DMEM/F-12 with 10% fetal bovine serum, and confluent cells were growth-arrested for 48 hours before injury. The injury was done as described previously.14 For Western blotting and staining for the iNOS protein, injured cells were harvested 24 or 48 hours after injury. For the electrophoretic mobility shift assay (EMSA) and the determination of cytosolic levels of NF-{kappa}B, cells were injured at 30 minutes, 2 hours, and 6 hours before harvest.

Western Blot Analysis
Cytosolic proteins underwent electrophoresis on a 7.5% SDS-PAGE gel for the detection of the iNOS protein or on 12% gels to detect p50, p65, and inhibitory-{kappa}B (I{kappa}B) proteins. Primary antibodies were rabbit polyclonal iNOS, p50, p65, or I{kappa}B antibody (Santa Cruz Biotechnology).

EMSA
The oligodeoxynucleotide used in EMSA incorporated the sequence between -113 and -92 bp in the rat iNOS promoter containing the NF-{kappa}B binding site (shown underlined; 5'-3' CCTACTGGGGACTCTCCCTTTG).15 EMSA and supershift assays were performed as previously described.1

Immunohistochemical Staining
Primary antibodies were anti-iNOS, anti-endothelial NOS (eNOS), anti–proliferating cell nuclear antigen (PCNA) (all rabbit polyclonal, Santa Cruz Biotechnology), rat monoclonal anti–macrophages/monocytes-2 (MOMA-2) (Serotec), and rat monoclonal anti-mouse VCAM-1 antibody (Pharmingen). Mucosal cells in intestinal villi from wild-type mice were used as positive controls for PCNA staining.

The semiquantitative measurement of the VCAM-1 or MOMA-2 stained area standardized against the medial area from 4 sections per animal was done with computer-assisted analysis.16 Analysis by 2 observers blinded to animal groups showed an interobserver variability of <5%.

Statistical Analysis
Optical densities of signals from EMSA or Western blot analysis were measured by computerized densitometry and presented either in text or in graph form. Numeric data are expressed as mean±SD. The number of experiments or animals used is given in the text or figure legend. The difference among groups was determined using 2-way ANOVA for multiple comparisons followed by a Tukey-Kramer test. P<0.05 was considered statistically significant.

An expanded Materials and Methods section is available online at http://www.circresaha.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Reduced Medial Proliferation and Neointima Formation After Cuff Injury in iNOS-KO Mice
eNOS immunoreactivity was present in the noninjured arterial segments from both groups of mice. Three days after cuff placement, eNOS immunoreactivity was absent, indicating deendothelialization in both groups of mice (Figure 1Down, A through D). Immunohistochemical staining showed only a minimal presence of monocytes/macrophages in the media (2.8±1.5% of medial area, n=3). Concomitant expression of iNOS protein occurred in the media of injured carotid arterial segments from wild-type mice; no iNOS expression was detected in iNOS-KO mice (Figure 1Down, E and F). Significantly more proliferating cells existed in wild-type mice (10.2±3.9 PCNA-positive cells per section; n=6) than in iNOS-KO mice (5.3±3.4 PCNA-positive cells per section; n=7; P<0.05).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 1. Noninjured carotid arterial segments showed expression of eNOS in wild-type mice (A and B). eNOS was also detected in noninjured segments from iNOS-KO mice (data not shown). Three days after injury, eNOS immunoreactivity was absent in segments from both types of mice, indicating deendothelialization (C, wild type; D, iNOS-KO mice). iNOS expression was present in arterial segments from wild-type mice (E), whereas no iNOS immunoreactivity was detected in segments from iNOS-KO mice (F).

Twenty-one days after cuff placement, a 40% reduction of the neointimal area occurred in iNOS-KO mice compared with the wild-type mice (TableDown, Figure 2Down). The intima/media ratio (I/M ratio) was also significantly smaller in iNOS-KO mice than wild-type mice. No overall difference existed in medial thickness or vessel size.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of iNOS Gene Knockout in Response to Vessel Injury



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. Elastin staining of arterial segment from wild-type mouse 21 days after injury revealed significant neointima formation (A and B), whereas only scanty neointima formation was observed in iNOS-KO mouse (C and D). Arrows indicate internal elastic lamina.

Reduced VCAM-1 Expression After Injury in iNOS-KO Mice
Little detectable VCAM-1 existed in uninjured sections from both groups. At 3 and 7 days after injury, VCAM-1 expression was observed in the media of the injured arteries of both iNOS-KO and wild-type mice. As determined by computer-assisted analysis, VCAM-1 expression was significantly less in iNOS-KO mice than in wild-type mice (Figure 3Down).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3. VCAM-1 expression in injured arterial segments from wild-type mice (A) was significantly greater than in iNOS-KO mice (B) 3 days and 7 days (data not shown) after injury. iNOS-KO mice had significantly less VCAM-1 expression 3 and 7 days after injury (C). Number of animals per group is indicated.

Mechanical Injury Increases iNOS Expression In Vitro
We studied the direct effect of mechanical injury on iNOS expression in a previously characterized in vitro injury model. Injury caused a well-defined zone of injury in the monolayer of cultured VSMCs. At 24 and 48 hours after injury, VSMCs were seen migrating into the injured zone, as described previously.14 Western blot analysis revealed that injury caused a 1.7±0.9-fold increase (n=4; P=NS) in iNOS expression 24 hours after injury compared with controls, whereas 48 hours after injury, a 3.4±0.8-fold increase in iNOS expression occurred (P<0.01 compared with controls; n=4), with concomitant detectable iNOS immunoreactivity in VSMCs in the injury zone (Figure 4Down, A and B).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. iNOS protein expression was significantly increased 48 hours after mechanical injury, as shown by Western blot analysis (A). Positive iNOS immunoreactivity in VSMCs was detected at injury zone (B). Incubation with non-immune rabbit IgG isotype antibody (NIA) served as negative control.

Mechanical Injury Increases iNOS NF-{kappa}B Binding Activity
NF-{kappa}B activation in response to injury was studied using an oligodeoxynucleotide containing the NF-{kappa}B sequence from the promoter region of the rat iNOS gene. An increase of iNOS NF-{kappa}B binding was observed 30 minutes after injury, with a subsequent decline at 2 and 6 hours after injury (Figure 5Down, A and B). A supershift experiment revealed mobility retardation and decreased binding, indicating specific nuclear binding (Figure 5CDown). The observation that cytosolic I{kappa}B, p50, and p65 levels decreased time-dependently after injury further confirms the activation of the transcription factor NF-{kappa}B (Figure 5DDown).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 5. A, EMSA showed time-dependent effect of mechanical injury on activation of NF-{kappa}B using an oligodeoxynucleotide containing NF-{kappa}B sequence from promoter region of iNOS gene. Arrows indicate specific binding. Specificity of nuclear binding was confirmed by adding excess unlabelled oligodeoxynucleotide (Comp) to samples from 30-minute injury. B, Densitometric analysis of NF-{kappa}B binding activity revealed an average 2-fold increase of binding activity 30 minutes after injury. *P<0.05 compared with other groups; n=5 per group. C, p50 and p65 supershift assays using extract 30 minutes after injury. Incubation with p50 antibody resulted in reduced binding (top arrow) and mobility shift of complex (arrowhead). Incubation with p65 antibody resulted in faint, shifted complex (arrowhead) and reduced binding (top arrow). Absence of antibodies (No Ab) or incubation with IgG were used as negative controls. Representative of 3 experiments is shown. D, Western blot analysis revealed a time-dependent decrease of cytosolic levels of p50, p65, and I{kappa}B after mechanical injury in cultured rat VSMCs. This indicates phosphorylation and degradation of I{kappa}B, with concomitant nuclear translocation of NF-{kappa}B subunits. n=4.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
This study demonstrated that a lack of iNOS expression after in vivo arterial injury in iNOS-KO mice was associated with reduced proliferation of medial VSMCs, reduced VCAM-1 expression, and decreased neointima formation. Furthermore, we also demonstrated that in vitro mechanical injury induced iNOS expression in VSMCs.

iNOS produced a sustained increase in NO compared with eNOS, and it was expressed in the arterial walls of VSMCs after mechanical injury. Because NO inhibits VSMC proliferation in vitro, the inhibition of NO output by iNOS was expected to increase neointima formation after injury. However, NG-nitro-L-arginine methyl ester treatment in a rat carotid injury experiment failed to demonstrate such an increase.9 This chemical may possess effects other than the inhibition of NO production,17 which may confound the interpretation of the data. Our study in iNOS gene knockout mice avoided such problems. We observed that periadventitial cuff injury induced iNOS expression in wild-type mice, which confirmed a previous observation by Moroi et al.18 Twenty-one days after injury, less neointima formation existed in iNOS-KO mice than in wild-type mice. Also, less proliferation of medial VSMCs occurred in iNOS-KO mice than in wild-type mice. Our findings support the hypothesis that iNOS expression in injured VSMCs promotes proliferation and neointima formation. Neointima formation has been viewed as a general wound-healing response to injury.19 Yamasaki et al10 reported that wound healing was delayed in iNOS-KO mice. Rai et al11 also reported that the proliferation of regenerating hepatocytes after liver injury was significantly less in iNOS-KO mice. Our results, together with their findings, suggest that iNOS is involved in wound healing after injury in vivo and that it contributes to neointima formation after arterial injury.

The I/M ratio in the mouse injury model reported in the literature shows substantial variation. This may be due to the method used to injure the artery and to differences in the sex or genetic background of the mice. Guidewire-induced injury of the common carotid artery did not produce neointima formation in C57BL/6J mice20 ; however, injuring the carotid artery by ligation showed an I/M ratio of 1.13±0.2 in mice with the same genetic background.21 Using a periadventitial cuff femoral artery injury model similar to ours, Moroi et al18 demonstrated a mean I/M volume ratio of 27% and 18%, respectively, in male and female C57BL/6 mice and 31% and 17%, respectively, in male and female SV129 mice. Our results of a mean I/M ratio of 29% in wild-type mice is comparable to their findings.

It is interesting to note that neointima formation is reportedly enhanced in eNOS KO mice,18 which is in sharp contrast to our results in iNOS-KO mice. We speculate that this difference may be due to intrinsic differences in their expression. eNOS is constitutively expressed and may continuously modulate vascular responses. Lack of eNOS, therefore, could be detrimental to vascular functions. This concept is supported by experiments in eNOS-KO mice. eNOS KO mice have higher systemic and pulmonary arterial pressures22 23 than wild-type mice. The observation that neointima formation is enhanced in eNOS-KO mice18 further strengthens this concept. In contrast, the expression of iNOS is tightly regulated. Hence, its physiological role in the vascular response to injury could be entirely different from that of eNOS. In published reports, the expression of iNOS is mostly associated with pathological states, such as atherosclerosis and transplant vasculopathy.24 25 26 Experiments using iNOS-KO mice have demonstrated delayed wound healing and a lower proliferative response to injury.10 11 These findings suggest that the expression of iNOS in response to injury may promote cellular proliferation. Our experimental data support this possibility. It is also interesting to note that in gene-transfer studies, eNOS or iNOS overexpression decreased neointimal thickening. We speculate that these discrepant findings may be due to the amount of NO being produced. The amount of NO produced by the overexpression of eNOS or iNOS may be much different from the amount produced by endogenous iNOS expression induced by arterial injury. NO enhances the proliferation of VSMCs at low concentrations, but it has antiproliferative effects at higher concentrations.27

Mechanical injury evokes an inflammatory response characterized by the activation of NF-{kappa}B and the expression of various adhesion molecules in the vessel wall.1 2 We demonstrated that the expression of VCAM-1 in injured carotid arteries was increased 3 and 7 days after injury in both groups of mice, which is consistent with previous reports2 28 ; however, VCAM-1 expression was significantly less in the iNOS-KO mice than in the wild-type mice. This finding suggests that increased iNOS expression in the injured arterial wall may promote VCAM-1 expression. These observations are further supported by the study by Hierholzer et al13 ; they reported that iNOS participates in proinflammatory signaling and upregulates several inflammatory molecules in a hypoxia-reperfusion injury model, possibly via a redox-sensitive mechanism. NO generated from iNOS expression could react with superoxide and lead to the formation of peroxynitrite, a potent oxidant.29 The reductase domain in iNOS is capable of generating superoxide, independent of NO production.30 It is therefore possible that superoxide produced by the reductase domain, coupled with peroxynitrite formation, could alter the redox state in the cells and result in a persistent activation of inflammatory signaling, thereby leading to more neointimal thickening.

In vivo experiments showed that iNOS is expressed in VSMCs in injured arteries.3 4 However it is not known whether injury itself is a stimulus for the expression of iNOS in VSMCs or whether the injury acts in concert with other stimuli, such as platelets, mononuclear cells, or serum growth factors. Hence, we tested the hypothesis that mechanical injury alone can elicit iNOS expression by using an in vitro model. Although this model does not reproduce the in vivo condition in an exact fashion, the replication and migration of VSMCs in the injury zone14 could mimic in vivo processes.

We observed iNOS expression in cultured rat VSMCs after injury by Western blot analysis and immunocytochemistry. Transcription factor NF-{kappa}B played an important role in the iNOS expression induced by cytokines in VSMCs.31 Its activation required the phosphorylation and degradation of the cytosolic inhibitor I{kappa}B to allow the nuclear translocation of p50 and p65, with subsequent initiation of gene transcription.32 Our observation that injury increased iNOS NF-{kappa}B binding activity with a concomitant decrease of cytosolic p50, p65, and I{kappa}B levels is consistent with this view. Other mechanical forces, such as pulsatile stretch, increase superoxide production, with subsequent activation of NF-{kappa}B in human coronary smooth muscle cells.33 The early appearance of superoxide 20 minutes after application of stretch is consistent with our time points as a mediator for the activation of the NF-{kappa}B system in this current study. Our observation of injury-induced iNOS expression in cultured VSMCs suggests that injury itself is a stimulus for the induction of iNOS in VSMCs. However, our results do not exclude the possibility that injury-induced growth factor expression may induce iNOS expression. The very early activation of iNOS NF-{kappa}B in our study makes this possibility less likely.

In summary, we demonstrated that mechanical injury induced reduced neointima formation in injured carotid arteries from iNOS-KO mice; this was associated with reduced VCAM-1 expression when compared with wild-type mice. These findings are in sharp contrast to those from eNOS KO mice, in which increased neointima formation after injury has been reported.18 Thus, our findings highlight the divergent functional roles of eNOS and iNOS genes, which is likely to be of biological significance. Molecular mechanisms responsible for this diversity remain to be defined.


*    Acknowledgments
 
This work was supported by a Research Fellowship Award from the American Heart Association, Greater Los Angeles Affiliate, to Dr Kuang-Yuh Chyu.

Received June 21, 1999; accepted September 20, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Cercek B, Yamashita M, Dimayuga P, Zhu J, Fishbein MC, Kaul S, Shah PK, Nilsson J, Regnstrom J. Nuclear factor-{kappa}B activity and arterial response to balloon injury. Atherosclerosis. 1997;131:59–66.[Medline] [Order article via Infotrieve]

2. Landry DB, Couper LL, Bryant SR, Lindner V. Activation of the NF-{kappa}B and I{kappa}B system in smooth muscle cells after rat arterial injury: induction of vascular cell adhesion molecule-1 and monocyte chemoattractant protein-1. Am J Pathol. 1997;151:1085–1095.[Abstract]

3. Hansson GK, Geng Y-J, Holm J, Hårdhammar P, Wennmalm Å, Jennische E. Arterial smooth muscle cells express nitric oxide synthase in response to endothelial injury. J Exp Med. 1994;180:733–738.[Abstract/Free Full Text]

4. Arthur JF, Yin ZL, Yound HM, Dusting GJ. Induction of nitric oxide synthase in the neointima induced by a periarterial collar in rabbits. Arterioscler Thromb Vasc Biol. 1997;17:737–740.[Abstract/Free Full Text]

5. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:1774–1777.

6. Mooradian DL, Hutsell TC, Keefer LK. Nitric oxide (NO) donor molecules: effect of NO release rate on vascular smooth muscle cell proliferation in vitro. J Cardiovasc Pharmacol. 1995;25:674–678.[Medline] [Order article via Infotrieve]

7. Lee JS, Adrie C, Jacob HJ, Roberts JD Jr, Zapol WM, Bloch KD. Chronic inhalation of nitric oxide inhibits neointimal formation after balloon-induced arterial injury. Circ Res. 1996;78:337–342.[Abstract/Free Full Text]

8. Guo JP, Milhoan KA, Tuan RS, Lefer AM. Beneficial effect of SPM-5185, a cysteine-containing nitric oxide donor, in rat carotid artery intimal injury. Circ Res. 1994;75:77–84.[Abstract/Free Full Text]

9. Watkins RW, Pula K, Cook J, Hoos L, McLeod R, Prioli NA, Davis HR Jr. NG-nitro-L-arginine methyl ester does not affect balloon catheter-induced intimal hyperplasia in rats. Biochem Biophys Res Commun. 1993;197:304–309.[Medline] [Order article via Infotrieve]

10. Yamasaki K, Edington HDJ, McClosky C, Tzeng E, Lizonova A, Kovesdi I, Steed DL, Billiar TR. Reversal of impaired wound repair in iNOS-deficient mice by topical adenoviral-mediated iNOS gene transfer. J Clin Invest. 1998;101:967–971.[Medline] [Order article via Infotrieve]

11. Rai RM, Lee FYJ, Rosen A, Yang SQ, Lin HZ, Koteish A, Liew FY, Zaragoza C, Lowenstein C, Diehl AM. Impaired liver regeneration in inducible nitric oxide synthase-deficient mice. Proc Natl Acad Sci U S A. 1998;95:13829–13834.[Abstract/Free Full Text]

12. Shin WS, Hong Y-H, Peng H-B, De Caterina R, Libby P, Liao JK. Nitric oxide attenuates vascular smooth muscle cell activation by interferon-{gamma}. The role of constitutive NF-{kappa}B activity. J Biol Chem. 1996;271:11317–11324.[Abstract/Free Full Text]

13. Hierholzer C, Harbrecht B, Menezes JM, Kane J, MacMicking J, Nathan CF, Peitzman AB, Billiar TR, Tweardy DJ. Essential role of induced nitric oxide in the initiation of the inflammatory response after hemorrhagic shock. J Exp Med. 1998;187:917–928.[Abstract/Free Full Text]

14. Calara F, Ameli S, Hultgårdh-Nilsson A, Cercek B, Kupfer J, Hedin U, Forrester J, Shah PK, Nilsson J. Autocrine induction of DNA synthesis by mechanical injury of cultured smooth muscle cells, potential role of FGF and PDGF. Arterioscler Thromb Vasc Biol. 1996;16:187–193.[Abstract/Free Full Text]

15. Eberhardt W, Kunz D, Hummel R, Pfeilschifter J. Molecular cloning of the rat inducible nitric oxide synthase gene promoter. Biochem Biophys Res Comun. 1996;223:752–756.[Medline] [Order article via Infotrieve]

16. Shah PK, Nilsson J, Kaul S, Fishbein MC, Ageland H, Hamsten A, Johansson J, Karpe F, Cercek B. Effects of recombinant apolipoprotein A-Imilano on aortic atherosclerosis in apolipoprotein E-deficient mice. Circulation. 1998;97:780–785.[Abstract/Free Full Text]

17. Luvarà G, Pueyo ME, Philippe M, Mandet C, Savoie F, Henrion D, Michel J-B. Chronic blockade of NO synthase activity induces a proinflammatory phenotype in the arterial wall. Prevention by angiotensin II antagonism. Arterioscler Thromb Vasc Biol. 1998;18:1408–1416.[Abstract/Free Full Text]

18. Moroi M, Zhang L, Yasuda T, Virmani R, Gold HK, Fishman MC, Huang PL. Interaction of genetic deficiency of endothelial nitric oxide, gender, and pregnancy in vascular response to injury in mice. J Clin Invest. 1998;101:1225–1232.[Medline] [Order article via Infotrieve]

19. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol. 1991;17:758–769.[Abstract]

20. De Geest B, Zhao Z, Collen D, Holvoet P. Effects of adenovirus-mediated human Apo A-1 gene transfer on neointima formation after endothelial denudation in Apo E-deficient mice. Circulation. 1997;96:4349–4356.[Abstract/Free Full Text]

21. Kumar A, Hoover JL, Simmons CA, Lindner V, Shebuski RJ. Remodeling and neointimal formation in the carotid artery of normal and P-selectin-deficient mice. Circulation. 1997;96:4333–4342.[Abstract/Free Full Text]

22. Shesely EG, Maeda N, Kim HS, Desai KM, Krege JH, Laubach VE, Sherman PA, Sessa WC, Smithies O. Elevated blood pressures in mice lacking endothelial nitric oxide synthase. Proc Natl Acad Sci U S A. 1996;93:13176–13181.[Abstract/Free Full Text]

23. Steudel W, Ichinose F, Huang PL, Hurford WE, Jones RC, Bevan JA, Fishman MC, Zapol WM. Pulmonary vasoconstriction and hypertension in mice with targeted disruption of the endothelial nitric oxide synthase (NOS 3) gene. Circ Res. 1997;81:34–41.[Abstract/Free Full Text]

24. Luoma JS, Strålin P, Marklund SL, Hiltunen TP, Särkioja T, Ylä-Herttuala S. Expression of extracellular SOD and iNOS in macrophages and smooth muscle cells in human and rabbit atherosclerotic lesions: colocalization with epitopes characteristic of oxidized LDL and peroxynitrite-modified proteins. Arterioscler Thromb Vasc Biol. 1998;18:157–167.[Abstract/Free Full Text]

25. Russell ME, Wallace AF, Wyner LR, Newell JB, Karnovsky MJ. Upregulation and modulation of inducible nitric oxide synthase in rat cardiac allografts with chronic rejection and transplant arteriosclerosis. Circulation. 1995;92:457–464.[Abstract/Free Full Text]

26. Lafond-Walker A, Chen C-L, Augustine S, Wu T-C, Hruban RH, Lowenstein CJ. Inducible nitric oxide synthase expression in coronary arteries of transplanted human hearts with accelerated graft arteriosclerosis. Am J Pathol. 1997;151:919–925.[Abstract]

27. Thomae KR, Nakayama DK, Billiar TR, Simmons RL, Pitt BR, Davies P. The effect of nitric oxide on fetal pulmonary artery smooth muscle growth. J Surg Res. 1995;59:337–343.[Medline] [Order article via Infotrieve]

28. Oguchi S, Zhu J, Dimayuga P, Yano J, Kaul S, Shah PK, Cercek B. Increased intimal thickening after arterial injury in hypercholesterolemic apolipoprotein E deficient mice: finding a novel model. Circulation. 1998;96(suppl I):I-548. Abstract.

29. Beckman JS, Koppenol WH. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and the ugly. Am J Physiol. 1996;271:C1424–C1437.[Abstract/Free Full Text]

30. Xia Y, Roman LJ, Masters BSS, Zweier JL. Inducible nitric-oxide synthase generates superoxide from the reductase doman. J Biol Chem. 1998;273:22635–22639.[Abstract/Free Full Text]

31. Spink J, Cohen J, Evans TJ. The cytokine responsive vascular smooth muscle cell enhancer of inducible nitric oxide synthase: activation by nuclear factor-{kappa}B. J Biol Chem. 1995;270:29541–29547.[Abstract/Free Full Text]

32. Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-{kappa}B and cytokine-inducible enhancers. FASEB J. 1995;9:899–909.[Abstract]

33. Hishikawa K, Oemar BS, Yang Z, Lüscher TF. Pulsatile stretch stimulates superoxide production and activates nuclear factor-kB in human coronary smooth muscle. Circ Res. 1997;81:797–803.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. C. Dimayuga, F. H. Y. Cesena, K.-Y. Chyu, J. Yano, A. Amorn, M. C. Fishbein, P. K. Shah, and B. Cercek
Natural antibodies and complement modulate intimal thickening after arterial injury
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1593 - R1600.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Matsumoto, P. C. Dimayuga, C. Wang, J. Kirzner, M. Cercek, J. Yano, K.-Y. Chyu, P. K. Shah, and B. Cercek
Exogenous heat shock protein-70 inhibits cigarette smoke-induced intimal thickening
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1320 - R1327.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Lukowski, P. Weinmeister, D. Bernhard, S. Feil, M. Gotthardt, J. Herz, S. Massberg, A. Zernecke, C. Weber, F. Hofmann, et al.
Role of Smooth Muscle cGMP/cGKI Signaling in Murine Vascular Restenosis
Arterioscler Thromb Vasc Biol, July 1, 2008; 28(7): 1244 - 1250.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
S. Schmidt, T. H. Westhoff, P. Krauser, W. Zidek, and M. van der Giet
The uraemic toxin phenylacetic acid increases the formation of reactive oxygen species in vascular smooth muscle cells
Nephrol. Dial. Transplant., January 1, 2008; 23(1): 65 - 71.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Nakata, M. Tsutsui, H. Shimokawa, T. Yamashita, A. Tanimoto, H. Tasaki, K. Ozumi, K. Sabanai, T. Morishita, O. Suda, et al.
Statin Treatment Upregulates Vascular Neuronal Nitric Oxide Synthase Through Akt/NF-{kappa}B Pathway
Arterioscler Thromb Vasc Biol, January 1, 2007; 27(1): 92 - 98.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
S Moncada
Adventures in vascular biology: a tale of two mediators
Phil Trans R Soc B, May 29, 2006; 361(1469): 735 - 759.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C.-Y. Wei, K.-C. Huang, Y.-H. Chou, P.-F. Hsieh, K.-H. Lin, and W.-W. Lin
The Role of Rho-Associated Kinase in Differential Regulation by Statins of Interleukin-1beta- and Lipopolysaccharide-Mediated Nuclear Factor {kappa}B Activation and Inducible Nitric-Oxide Synthase Gene Expression in Vascular Smooth Muscle Cells
Mol. Pharmacol., March 1, 2006; 69(3): 960 - 967.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Strom, A. I. Olin, A. Aspberg, and A. Hultgardh-Nilsson
Fibulin-2 is present in murine vascular lesions and is important for smooth muscle cell migration
Cardiovasc Res, February 15, 2006; 69(3): 755 - 763.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Hofmann, R. Feil, T. Kleppisch, and J. Schlossmann
Function of cGMP-Dependent Protein Kinases as Revealed by Gene Deletion
Physiol Rev, January 1, 2006; 86(1): 1 - 23.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Nakata, M. Tsutsui, H. Shimokawa, M. Tamura, H. Tasaki, T. Morishita, O. Suda, S. Ueno, Y. Toyohira, Y. Nakashima, et al.
Vascular Neuronal NO Synthase Is Selectively Upregulated by Platelet-Derived Growth Factor: Involvement of the MEK/ERK Pathway
Arterioscler Thromb Vasc Biol, December 1, 2005; 25(12): 2502 - 2508.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. C. Dimayuga, H. Li, K.-Y. Chyu, G. N. Fredrikson, J. Nilsson, M. C. Fishbein, P. K. Shah, and B. Cercek
T Cell Modulation of Intimal Thickening After Vascular Injury: The Bimodal Role of IFN-{gamma} in Immune Deficiency
Arterioscler Thromb Vasc Biol, December 1, 2005; 25(12): 2528 - 2534.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y.-H. Liu, O. A. Carretero, O. H. Cingolani, T.-D. Liao, Y. Sun, J. Xu, L. Y. Li, P. J. Pagano, J. J. Yang, and X.-P. Yang
Role of inducible nitric oxide synthase in cardiac function and remodeling in mice with heart failure due to myocardial infarction
Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2616 - H2623.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Y. Sun, O. A. Carretero, J. Xu, N.-E. Rhaleb, F. Wang, C. Lin, J. J. Yang, P. J. Pagano, and X.-P. Yang
Lack of Inducible NO Synthase Reduces Oxidative Stress and Enhances Cardiac Response to Isoproterenol in Mice With Deoxycorticosterone Acetate-Salt Hypertension
Hypertension, December 1, 2005; 46(6): 1355 - 1361.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
Z. W. Q. Moore and D. Y. Hui
Apolipoprotein E inhibition of vascular hyperplasia and neointima formation requires inducible nitric oxide synthase
J. Lipid Res., October 1, 2005; 46(10): 2083 - 2090.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Anazawa, P. C. Dimayuga, H. Li, S. Tani, J. Bradfield, K.-Y. Chyu, S. Kaul, P. K. Shah, and B. Cercek
Effect of Exposure to Cigarette Smoke on Carotid Artery Intimal Thickening: The Role of Inducible NO Synthase
Arterioscler Thromb Vasc Biol, September 1, 2004; 24(9): 1652 - 1658.
[Abstract] [Full Text] [PDF]


Home page
Vasc MedHome page
K.-Y. Chyu, P. C Dimayuga, X. Zhao, J. Nilsson, P. K Shah, and B. Cercek
Altered AP-1/Ref-1 redox pathway and reduced proliferative response in iNOS-deficient vascular smooth muscle cells
Vascular Medicine, August 1, 2004; 9(3): 177 - 183.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. C. Browner, H. Sellak, and T. M. Lincoln
Downregulation of cGMP-dependent protein kinase expression by inflammatory cytokines in vascular smooth muscle cells
Am J Physiol Cell Physiol, July 1, 2004; 287(1): C88 - C96.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K.-Y. Chyu, S. M. Babbidge, X. Zhao, R. Dandillaya, A. G. Rietveld, J. Yano, P. Dimayuga, B. Cercek, and P. K. Shah
Differential Effects of Green Tea-Derived Catechin on Developing Versus Established Atherosclerosis in Apolipoprotein E-Null Mice
Circulation, May 25, 2004; 109(20): 2448 - 2453.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Feil, S. M. Lohmann, H. de Jonge, U. Walter, and F. Hofmann
Cyclic GMP-Dependent Protein Kinases and the Cardiovascular System: Insights From Genetically Modified Mice
Circ. Res., November 14, 2003; 93(10): 907 - 916.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Dixit, D. Zhuang, B. Ceacareanu, and A. Hassid
Treatment With Insulin Uncovers the Motogenic Capacity of Nitric Oxide in Aortic Smooth Muscle Cells: Dependence on Gab1 and Gab1-SHP2 Association
Circ. Res., November 14, 2003; 93 (10): e113 - e123.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
M. Zanetti, L. V. d'Uscio, I. Kovesdi, Z. S. Katusic, and T. O'Brien
In Vivo Gene Transfer of Inducible Nitric Oxide Synthase to Carotid Arteries From Hypercholesterolemic Rabbits
Stroke, May 1, 2003; 34(5): 1293 - 1298.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
H. Li, P. Dimayuga, M. Yamashita, J. Yano, M. Fournier, M. Lewis, and B. Cercek
Arterial Injury in Mice with Severe Insulin-Like Growth Factor-1 (IGF-1) Deficiency
Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2002; 7(4): 227 - 233.
[Abstract] [PDF]


Home page
Circ. Res.Home page
J.-Y. Qian, A. Haruno, Y. Asada, T. Nishida, Y. Saito, T. Matsuda, and H. Ueno
Local Expression of C-Type Natriuretic Peptide Suppresses Inflammation, Eliminates Shear Stress-Induced Thrombosis, and Prevents Neointima Formation Through Enhanced Nitric Oxide Production in Rabbit Injured Carotid Arteries
Circ. Res., November 29, 2002; 91(11): 1063 - 1069.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Chang, B. Ceacareanu, M. Dixit, N. Sreejayan, and A. Hassid
Nitric Oxide-Induced Motility in Aortic Smooth Muscle Cells: Role of Protein Tyrosine Phosphatase SHP-2 and GTP-Binding Protein Rho
Circ. Res., September 6, 2002; 91(5): 390 - 397.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
C.A. Gunnett, D.D. Lund, M.A. Howard III, Y. Chu, F.M. Faraci, and D.D. Heistad
Gene Transfer of Inducible Nitric Oxide Synthase Impairs Relaxation in Human and Rabbit Cerebral Arteries
Stroke, September 1, 2002; 33(9): 2292 - 2296.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Dimayuga, B. Cercek, S. Oguchi, G. N. Fredrikson, J. Yano, P. K. Shah, S. Jovinge, and J. Nilsson
Inhibitory Effect on Arterial Injury-Induced Neointimal Formation by Adoptive B-Cell Transfer in Rag-1 Knockout Mice
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 644 - 649.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Tolbert, J. A. Thompson, P. Bouchard, and S. Oparil
Estrogen-Induced Vasoprotection Is Independent of Inducible Nitric Oxide Synthase Expression: Evidence From the Mouse Carotid Artery Ligation Model
Circulation, November 27, 2001; 104(22): 2740 - 2745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Brown, Y. Lin, and A. Hassid
Requirement of protein tyrosine phosphatase SHP2 for NO-stimulated vascular smooth muscle cell motility
Am J Physiol Heart Circ Physiol, October 1, 2001; 281(4): H1598 - H1605.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
T. M. Lincoln, N. Dey, and H. Sellak
Signal Transduction in Smooth Muscle: Invited Review: cGMP-dependent protein kinase signaling mechanisms in smooth muscle: from the regulation of tone to gene expression
J Appl Physiol, September 1, 2001; 91(3): 1421 - 1430.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. K. Lee, M. Borhani, T. L. Ennis, G. R. Upchurch Jr, and R. W. Thompson
Experimental Abdominal Aortic Aneurysms in Mice Lacking Expression of Inducible Nitric Oxide Synthase
Arterioscler Thromb Vasc Biol, September 1, 2001; 21(9): 1393 - 1401.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
B. C Kone
Molecular biology of natriuretic peptides and nitric oxide synthases
Cardiovasc Res, August 15, 2001; 51(3): 429 - 441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Sasu, A. L. Cooper, and D. Beasley
Juxtacrine effects of IL-1{alpha} precursor promote iNOS expression in vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, April 1, 2001; 280(4): H1615 - H1623.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Sinnaeve, J.-D. Chiche, Z. Nong, O. Varenne, N. Van Pelt, H. Gillijns, D. Collen, K. D. Bloch, and S. Janssens
Soluble Guanylate Cyclase {{alpha}}1 and {beta}1 Gene Transfer Increases NO Responsiveness and Reduces Neointima Formation After Balloon Injury in Rats via Antiproliferative and Antimigratory Effects
Circ. Res., January 19, 2001; 88(1): 103 - 109.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Oguchi, P. Dimayuga, J. Zhu, K.-Y. Chyu, J. Yano, P. K. Shah, J. Nilsson, and B. Cercek
Monoclonal Antibody Against Vascular Cell Adhesion Molecule-1 Inhibits Neointimal Formation After Periadventitial Carotid Artery Injury in Genetically Hypercholesterolemic Mice
Arterioscler Thromb Vasc Biol, July 1, 2000; 20(7): 1729 - 1736.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Dimayuga, B. Cercek, S. Oguchi, G. N. Fredrikson, J. Yano, P. K. Shah, S. Jovinge, and J. Nilsson
Inhibitory Effect on Arterial Injury-Induced Neointimal Formation by Adoptive B-Cell Transfer in Rag-1 Knockout Mice
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 644 - 649.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Methods
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chyu, K.-Y.
Right arrow Articles by Cercek, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chyu, K.-Y.
Right arrow Articles by Cercek, B.