Original Contributions |
From the Department of Medicine, New York Medical College, Valhalla, NY.
Correspondence to Piero Anversa, Department of Medicine, Vosburgh Pavilion-Room 302, New York Medical College, Valhalla, NY 10595.
| Abstract |
|---|
|
|
|---|
-Myosin and ß-myosin isoform mRNAs were affected by CAN, but
-myosin mRNA was reduced more in nontransgenic mice. In conclusion,
myocyte necrosis and replacement fibrosis are the prevailing forms of
myocardial damage induced by CAN. Constitutive overexpression of IGF-1
attenuates myocyte necrosis and tissue injury, having no effect on cell
apoptosis. These factors limit ventricular
dilation, myocardial loading, cardiac hypertrophy, and
alterations in
- and ß-myosin isoform expression.
Key Words: myocardial ischemia myocyte death ventricular remodeling myosin isoform insulin-like growth factor-1 transgenic mice
| Introduction |
|---|
|
|
|---|
Coronary artery narrowing (CAN) in mice leads to decompensated eccentric hypertrophy, tissue damage, and abnormalities in loading that mimic human ischemic cardiomyopathy.7 Moreover, overexpression of insulin-like growth factor (IGF)1 in myocytes abolishes the activation of myocyte necrosis and apoptosis in the viable myocardium after infarction, attenuating reactive hypertrophy, ventricular dilation, and wall stress.8 Apoptosis is the prevailing type of cell death after infarction, whereas the form of myocyte injury associated with CAN remains to be defined. This is relevant because defects in coronary blood flow are present with CAN, contrasting the lack of alterations in flow distribution in the noninfarcted myocardium. In the current study, we attempted to establish (1) whether myocyte necrosis and apoptosis occur in a mouse model of global ischemia in a manner comparable with that of the postinfarction heart; (2) whether IGF-1 can protect the underperfused ventricle by these forms of cell death; and (3) whether loading abnormalities change the proportion of myosin isoforms, affecting cardiac performance.
| Materials and Methods |
|---|
|
|
|---|
-myosin
heavy chain promoter. The overexpression of human IGF-1B in the mouse
heart increased postnatally, reaching its peak at 75 days; a 12-fold
higher value of IGF-1B than at 1 day was found at this interval.
Littermates did not express in the heart the human IGF-1B
gene.9 Myocytes from transgenic mice at 75 days secreted
4.3-fold more IGF-1 than myocytes from littermates of the same
age.9 For functional and anatomic studies, CAN was
surgically induced in 213 animals, and 96 survived the operation,
indicating a 55% mortality; 60 mice were excluded, and 18 littermates
and FVB.Igf+/ mice each were analyzed. An
identical number of sham-operated animals was examined in each group.
Cell death was assessed in separate groups of mice, because frozen
sections of myocardium were required. For the evaluation of
myocyte necrosis, 10 CAN littermates and 10 CAN FVB.Igf+/
mice were injected with 10 µg of myosin monoclonal antibody (clone
CCM-52) 24 hours before death.8 Control animals,
consisting of 7 littermates and 6 FVB.Igf+/ mice, were
injected also with myosin antibody. Apoptosis was measured in
these 33 mice. DNA laddering was examined in myocardial samples
obtained from mice used for the measurements of myocyte death; 5 CAN
and 5 sham-operated mice each in nontransgenic mice and transgenic mice
were studied. DNA laddering was confirmed in isolated myocytes; 4
animals in each group were included. The expression of
- and
ß-myosin was determined in isolated myocytes; 8 CAN and 8
sham-operated animals in each group were investigated. These 44 CAN
mice required successful surgery in 92 of 168 animals.
CAN
Under ether anesthesia, thoracotomy was performed,
the atrial appendage was elevated, and the left coronary artery
was partially occluded. The chest was closed, the pneumothorax was
reduced, and the mice were allowed to recover. To reduce pain,
buprenorphine hydrochloride, 0.65 mg/kg body weight, was injected
intramuscularly (Buprenex, Reckitt and Colman Pharmaceuticals).
Sham-operated mice were treated similarly, but the ligature was not
tied. Details of the procedure have been published.7
Experimental protocols were approved by New York Medical
College.
Ventricular Hemodynamics
Mice were anesthetized with chloral hydrate (400 mg/kg
body weight, IP), and the right carotid artery was cannulated with a
microtip pressure transducer catheter (model SPR-671, Millar
Instruments). The catheter was advanced into the left ventricle (LV)
for the evaluation of LV pressures and +dP/dt and dP/dt in the
closed-chest preparation.
Fixation for Anatomic Measurements
The abdominal aorta was cannulated with a PE-50 catheter, and
the heart was arrested in diastole through the aortic
injection of 0.15 mL of cadmium chloride (100 mmol/L). The
myocardium was perfused retrogradely through the aorta. The
LV chamber was filled with fixative and kept at a pressure equal to
end-diastolic pressure throughout the fixation
procedure.7 8 After fixation, the heart was excised and
cardiac weights were recorded.
Coronary Artery Diameter
The proximal 0.5- to 1.0-mm segment of the left coronary
artery was isolated and cut transversely to expose the level of the
ligature. The diameter of the lumen adjacent to the narrowed site and
at the constricted portion were measured. Constriction was evaluated by
comparing the vessel diameter above the stenosis with the
diameter at the level of stenosis.7
Ventricular Dimensions
The major intracavitary axis of LV was measured. Each LV was
then cut transversely to obtain a 1.5-mm section, halfway between the
base and the apex, in which the average thickness of the free wall and
septum and chamber luminal diameter were measured. Longitudinal and
transverse diameters were used to calculate chamber
volume.7 8 Measurements of wall thickness, chamber radius,
and end-diastolic pressure were used to compute
diastolic stress.
Myocardial Damage
Three slices of each LV, from the basal, middle, and apical
portions, were embedded in paraffin and stained with hematoxylin and
eosin. Sixty fields were examined at x400 with a 42-point reticle,
defining a tissue area of 39 205 µm2 . The fraction
of points lying over sites of replacement fibrosis and the number of
these foci in the myocardium were
measured.7
Myosin Antibody Labeling and Terminal
Deoxynucleotidyl Transferase (TdT) Assay
Frozen tissue sections were exposed to TRITC-labeled anti-mouse
IgG and fixed in 1.5% paraformaldehyde. The TdT assay
was performed by incubating sections with 5 U of TdT, 2.5 mmol/L
CoCl2, 0.2 mol/L potassium cacodylate, 25
mmol/L Tris-HCl, 0.25% BSA, and 0.5 nmol/L biotinylated
2'-deoxyuridine-5'-triphosphate (biotin-16-dUTP). After exposure to 5
µg/mL of FITC-Extravidin (Avidin, Sigma), myocytes were
stained with
-sarcomeric actin and nuclei with propidium
iodide.8 Sections were analyzed with a confocal
microscope (MRC-1000, Bio-Rad Laboratories). The number of myocyte
nuclei labeled by TdT was measured in each LV, and this
parameter was divided by the numerical density of myocyte
nuclei.6 8 10 The fraction of myocyte profiles stained by
myosin antibody was assessed in a similar manner.
In Situ Ligation Assay
Taq probe was prepared using primers
5'-GTGGCCTGCCCAAGCTCTACCT-3' and
5'-GGCTGGTCTGCCGCCGTTTTCGACCCTG-3' complementary to
pBluescript-bSDI1 plasmid.11 Polymerase chain
reaction (PCR) was performed as previously described.10
After heating to 80°C, Taq polymerase, 2.5 U, was added.
Gel electrophoresis documented a single PCR product that was
purified with a PCR purification kit (Qiagen). Digoxigenin-labeled
probes were ligated to DNA using T4 ligase. Sections were treated with
proteinase K, 50 µg/mL PBS, for 30 minutes at 37°C, and a mixture
of (in mmol/L) Tris-HCl (pH 7.8) 50, MgCl2
10, DTT 10, and ATP 1; 25 µg/mL BSA; 15% polyethylene glycol; 1
µg/mL probe; and 25 U/mL T4 ligase was applied for 4 hours. After
washing at 70°C, samples were incubated with antidigoxigenin mouse
monoclonal antibody and were exposed to FITC-labeled goat anti-mouse
IgG. Sections were stained with
-sarcomeric actin antibody and
propidium iodide.8 10 For the Pfu probe, 5
U of Pfu polymerase was used in the PCR
reaction.11 For double labeling for Pfu
and TdT, Pfu was done first, and the TdT reaction was
performed with rhodamine-labeled Extravidin (Avidin, Sigma).
Myocyte Isolation
Myocytes were dissociated by collagenase following a
procedure repeatedly used in our laboratory.8 9
Contamination from nonmyocytes ranged from 1% to
3%.8 9
DNA Gel Electrophoresis
Tissue homogenates and isolated myocytes were fixed
in 70% ethanol. Fixed material was incubated in 40 µL of
phosphate-citrate buffer (pH 7.8). Supernatant was digested with RNase
and proteinase K, and samples were subjected to
electrophoresis.8 10
Northern Blot
Myocytes were frozen in liquid nitrogen and were
homogenized in Tri reagent (Molecular Research Center).
Homogenates were precipitated by isopropanol. Pellets were
washed with ethanol and dissolved in diethyl pyrocarbonatetreated
water. RNA amounts were determined by
A260/A280 (nm) ratio and by
hybridization of RNA blots with GAPDH cDNA probe.
Oligonucleotide probes for
- and ß-myosin heavy
chain mRNAs
(5'-CGAACGTTTATGTTTATTGTGGATTGGCCACAGCGAGGGTCTGCTGGAGAGG-3'
and 5' -
GCTTTATTCTGCTTCCACCTAAAGGGCTGTTGCAAAGGCTCCAGGTCTGAGGGCTTC-3')
were labeled with [
32P]ATP and RTS T4
kinase; 15 µg of RNA was size-separated in 0.7% agarose gel and
transferred onto Bio-Trans nylon membrane. After hybridization, blots
were washed with 0.5% SSC and 1% SDS and exposed to x-ray film. Blots
were then stripped with 0.2% SDS at 90°C for 15 minutes and reprobed
for GAPDH using [
32P]dCTP-labeled Ready To
Go DNA labeling beads (Pharmacia Biotechnology).
Data Analysis
Results are presented as mean±SD. Significance,
P<0.05, between 2 measurements and among multiple groups
was determined by the 2-tailed Student t test, ANOVA, and
the Bonferroni method.8 The differences in relative
changes in cardiac weights, cardiac weighttobody weight ratios, and
chamber volume between CAN nontransgenic and CAN transgenic mice were
computed from the quotient of values of non-CAN and CAN animals in each
group, according to the equation previously described.8
Subsequently, a Student t test was applied.
| Results |
|---|
|
|
|---|
49% and
70% were
included in all cases. On this basis, 60 mice were excluded from a
total of 96 for anatomic studies, and 48 from a total of 92 for
measurements of cell death and biochemical parameters.
Anatomic determinations were obtained in 36 mice, 18 nontransgenic and
18 transgenic. Sham-operated groups also included 18 animals each. In
comparison with the nonconstricted portion of the vessel, the procedure
resulted in a 59±6% (proximal, 151±18 µm; constricted,
62±12 µm; P<0.001) and 58±6% (proximal,
157±17 µm; constricted, 66±13 µm; P<0.001)
reduction in luminal diameter of the coronary artery in
littermates and FVB.Igf+/ mice, respectively.
Corresponding decreases in luminal area were 83±5% (proximal,
18 169±4233 µm2; constricted,
3067±1234 µm2; P<0.001) and
82±5% (proximal, 19 541±4295 µm2;
constricted, 3548±1349 µm2;
P<0.001). Similar values were found in mice used in other
studies. In summary, comparable degrees of CAN were produced in
littermates and FVB.Igf+/ mice.
|
Physiological Measurements
LV end-diastolic pressure increased 145%
(P<0.001) in CAN nontransgenic mice, whereas LV peak
systolic pressure decreased 12% (P<0.005), and
+dP/dt and dP/dt, 34% (P<0.001) and 29%
(P<0.001), respectively (Figure 2
). Corresponding changes in CAN
transgenic mice were 137% (P<0.001), 12%
(P<0.01), 31% (P<0.001), and 30%
(P<0.001). No difference in these indices of LV function
was found between littermates and FVB.Igf+/ mice before
and after CAN. In summary, CAN resulted in severe LV dysfunction that
affected nontransgenic and transgenic mice.
|
Body Weight and Heart Weight
CAN for 7 days was characterized by a 7% (P<0.01) and
5% (P<0.05) decrease in body weight in nontransgenic mice
(control, 22.8±0.86 g; CAN, 21.3±2.0 g) and transgenic mice (control,
24.4±1.7 g; CAN, 23.1±1.5 g), respectively. Heart weight increased
29% (P<0.001) and 19% (P<0.005), resulting in
a 38% (P<0.001) and 25% (P<0.001) increase in
heart weighttobody weight ratio in CAN littermates and CAN
FVB.Igf+/ mice (Figure 3
).
In CAN littermates, LV increased 34% (P<0.001) and right
ventricle 14% (P<0.05), whereas, in FVB.Igf+/
mice, these increases were 21% (P<0.001) and 8% (NS),
respectively. These responses resulted in a 44% (P<0.001)
and 22% (P<0.005) increase in LV and right ventricle
weighttobody weight ratios in littermates and in a 29%
(P<0.001) and 10% (P<0.05) increase in these
parameters in FVB.Igf+/ mice. In comparison
with CAN transgenic mice, 53% (P<0.05), 62%
(P<0.04) 52%, (P<0.03), and 52%
(P<0.03) higher heart weight, LV weight, and ratios of
heart weight and LV weight to body weight were found in CAN
nontransgenic mice. In summary, CAN resulted in a greater magnitude of
cardiac hypertrophy in nontransgenic than in transgenic
mice.
|
Ventricular Dimensions
CAN produced a 20% (P<0.05) and 16%
(P<0.05) increase in LV longitudinal intracavitary axis in
littermates and FVB.Igf+/ mice (Figure 4
). Chamber diameter increased 18%
(P<0.05) and 11% (P<0.005), and cavitary
volume expanded 68% (P<0.001) and 37%
(P<0.001) in nontransgenic mice and transgenic mice. Thus,
chamber volume increased 84% (P<0.02) more in littermates
than in FVB.Igf+/ mice. LV masstochamber volume ratio
decreased 23% (P<0.005) with CAN only in nontransgenic
mice. Additionally, LV thickness decreased 10% (P<0.05)
and 9% (P<0.05), and wall thicknesstochamber radius
ratio decreased 28% (P<0.001) and 20%
(P<0.005) in littermates and FVB.Igf+/ mice,
respectively. These anatomic properties and the measurements of LV
end-diastolic pressures allowed the computation of
diastolic wall stress. CAN resulted in a 263%
(P<0.001) and 189% (P<0.001) increase in
diastolic stress in nontransgenic mice and transgenic mice,
indicating a 1.4-fold (P<0.01) higher level of wall stress
in littermates than in FVB.Igf+/ mice. In summary, CAN
produced greater ventricular dilation and higher
diastolic stress in nontransgenic mice than in transgenic
mice.
|
Ventricular Damage
CAN was characterized by sites of replacement fibrosis in various
phases of healing across the LV wall (Figure 5A
through 5D). The number of lesion
profiles per mm2 of myocardium
was 1.6-fold (P<0.001) greater in CAN nontransgenic mice
than in transgenic mice (Figure 5E
). Similarly, the volume
percentage of scarring was 2.6-fold (P<0.001) more
extensive in CAN littermates (Figure 5F
). Fibrosis
represented the damage accumulated from the time of CAN to
euthanization. However, this analysis did not include ongoing
myocyte death. In summary, CAN resulted in areas of subacute
myocardial injury in the LV wall that were more severe in littermates
than in FVB.Igf+/ mice.
|
Ongoing Myocyte Death
Hearts were not fixed by perfusion, because myocyte necrosis was
identified by myosin labeling in frozen sections of
myocardium. Adjacent sections were processed for the
detection of apoptosis by TdT. CAN involved a decrease in
luminal diameter of 56% in nontransgenic mice (proximal segment,
146±20 µm; constricted segment, 64±14 µm;
P<0.001) and 60% in transgenic mice (proximal segment,
151±19 µm; constricted segment, 60±15 µm;
P<0.001). Low levels of myocyte necrosis were observed in
both control animals. After CAN, single cells and groups of myocytes
were labeled by myosin in littermates (Figure 6A
through 6C) and FVB.Igf+/
mice (Figure 6D
through 6F). In the absence of CAN, myocyte
apoptosis was identified in nontransgenic mice (Figure 6G
through 6I) and transgenic mice (Figure 6J
through 6L). CAN had little effect on apoptosis in
both groups of mice.
|
Myocyte necrosis and apoptosis were detected by 2 additional
methods, using probes generated by Pfu and Taq
polymerase, respectively.11 Pfu labeled
blunt-ended products of DNA damage (Figure 6M
through 6R) that developed during
necrosis.11 12 Conversely, Taq identified
doubleDNA strand cleavage with single-base 3' overhangs (Figure 6S
through 6X) that occurred with
apoptosis.10 11 In no instance was myosin or
Pfu labeling of myocytes associated with TdT staining.
Figure 7A
illustrates that myocyte
necrosis, recognized by myosin antibody, was similar in sham-operated
littermates and FVB.Igf+/ mice. CAN resulted in a 46-fold
(P<0.001) and 9.4-fold (P<0.001) increase in
myocyte necrosis in nontransgenic mice and transgenic mice,
respectively. In comparison with CAN transgenic mice, the 5.2-fold
higher magnitude of necrotic death in CAN nontransgenic mice was
significant (P<0.001). Myocyte apoptosis, measured
by TdT, was comparable in the 2 groups of mice at baseline (Figure 7B
). CAN modestly increased myocyte apoptosis, 1.8-fold
(P<0.05) in littermates and 3.0-fold (P<0.001)
in FVB.Igf+/ mice. Apoptosis in CAN nontransgenic
mice and CAN transgenic mice was not different (P=0.78).
When necrosis was established by Pfu, CAN resulted in a
44-fold (P<0.001) and a 9.7-fold (P<0.001)
increase of this form of cell death in littermates and
FVB.Igf+/ mice, respectively (Figure 7C
). In a
manner similar to TdT, apoptosis, measured by Taq,
increased moderately with CAN in both groups of animals. Measurements
of necrosis with myosin antibody and Pfu, and of
apoptosis with TdT and Taq, were not statistically
different. In CAN nontransgenic mice, necrosis was an average 12-fold
(P<0.001) greater than apoptosis with both
techniques. In CAN transgenic mice, the 2.3-fold higher value in
necrosis than in apoptosis was not significant
(P=0.43). In summary, myocyte necrosis was the predominant
type of cell death with CAN, and this form of injury was more severe in
FVB.Igf/ mice.
|
DNA Damage
Agarose gel electrophoresis of DNA from LV samples (Figure 8A
) and dissociated myocytes (Figure 8B
) documented that CAN was associated with a diffuse DNA
pattern in tissue preparations. This aspect reflected random
fragmentation of the DNA that was consistent with cell
necrosis.13 In myocytes, mononucleosomes and
oligonucleosomes were detected, indicating that laddering and
apoptosis were present in the electrophoretic profile of
low molecular weight DNA.13 In summary, CAN was
accompanied by myocyte necrosis and modest levels of
apoptosis.
|
Myosin Isoenzymes
- and ß-myosin heavy chain mRNAs were detectable in LV
myocytes from sham-operated littermates and FVB.Igf+/ mice
(Figure 9
). Similarly, these myosin
isoforms were present in myocytes of both groups of animals after
CAN (n=8 in each group of mice). However, expression of myosin isoforms
differed between littermates and FVB.Igf+/ mice. In
controls, ß-myosin mRNA was 75% (P<0.04) higher and
-myosin mRNA was 7% (P<0.04) lower in nontransgenic
mice (
-myosin, 86±4%; ß-myosin, 14±4%) than in
transgenic mice (
-myosin, 92±2%; ß-myosin, 8±2%). CAN
decreased 10% (P<0.002)
-myosin mRNAs (77±5%)
and increased 64% (P<0.002) ß-myosin mRNAs (23±5%) in
littermates. In FVB.Igf+/ mice, CAN reduced
-myosin
mRNA 9% (84±4%; P<0.005) and augmented ß-myosin mRNA
100% (16±4%; P<0.005). However,
-myosin mRNA level
was 9% (P<0.02) higher in CAN transgenic mice than in
nontransgenic mice. In summary, expression of myosin isoforms was
affected by CAN, but
-myosin mRNA was greater in transgenic mice at
baseline and after CAN.
|
| Discussion |
|---|
|
|
|---|
-myosin mRNA developed with CAN.
Overexpression of IGF-1 in myocytes attenuated the magnitude of
accumulated damage and the extent of ongoing myocyte death. This
protective effect of IGF-1 on cell survival limited the changes in
chamber volume, myocardial hypertrophy,
ventricular loading, and
- and ß-myosin mRNAs. Thus,
cell death appears to be a critical component of the onset and early
evolution of ischemic cardiomyopathy, and
interference with this process by IGF-1 may positively influence the
short- and long-term outcome of ventricular remodeling.
CAN, Myocyte Cell Death, and IGF-1
Current results and previous observations after
infarction8 indicate that differences exist between the
impact of restrictions in coronary blood flow and the
consequences of a segmental loss of tissue with coronary
occlusion. In the latter case, myocyte apoptosis occurs in the
surviving myocardium14 and markedly exceeds
cell necrosis.8 Myocyte apoptosis is responsible
for side-to-side slippage of myocytes,15 mural thinning,
and cavitary dilation acutely after infarction.6 15
Additionally, myocardial scarring is not present in the viable
tissue of the postinfarction heart shortly after coronary
artery ligation.15 Conversely, myocyte necrosis and tissue
fibrosis characterize the cardiac myopathy mediated by coronary
artery stenosis.1 Foci of replacement fibrosis in
the myocardium detected here reflected an immediate
activation of myocyte necrosis, evolving with time in multiple areas of
reparative scarring.7 Collagen accumulation is not the
consequence of myocyte apoptosis.13 Distinct forms
of cell death appear to be implicated in the restructuring of the wall
with coronary artery disease in the absence or presence of a
myocardial infarction.
IGF-1 overexpression markedly attenuated the extent of myocardial fibrosis and the magnitude of ongoing cell necrosis after CAN; volume fraction of reparative fibrosis was reduced 62% and ongoing necrotic myocyte death 80%. IGF-1 interferes with the activation of myocyte necrosis during ischemia reperfusion injury16 and myocardial infarction.8 However, the mechanism of this protective effect on cell viability has not been defined. The current results also leave this issue unresolved. The growth factor may increase the vascular component of the myocardium, minimizing the influence of global ischemia. On the other hand, this possibility is not supported by differences in infarction size with coronary artery occlusion.8 IGF-1 enhances Bcl-2 expression17 that increases the stability of cellular membranes.18 Intracellular Ca2+ homeostasis and compartmentalization of this cation are preserved by the influence of IGF-1 on antagonists of Bcl-2 such as Bad19 and Bax.20 These factors may inhibit Ca2+ overloadmediated cell necrosis.21 Bax may form pH- and voltage-dependent ion-conducting channels, altering membrane permeability.22 23 24 Bcl-2 antagonizes this phenomenon.22 23 24 Additionally, IGF-1 releases nitric oxide,25 and this may promote antithrombotic and antiinflammatory reactions,26 decreasing necrotic myocyte cell death.
Myocyte apoptosis was low in FVB.Igf+/ mice and nontransgenic animals at baseline, and CAN increased this parameter modestly. Overexpression of IGF-1 did not reduce this form of cell death in the myocardium. Apoptosis represented a minimal component of the total myocyte loss in the heart of littermates, and the amount of apoptosis and necrosis was limited in FVB.Igf+/ mice. Complex is the understanding of the distinct forms of myocyte death that take place under different conditions. Myocyte apoptosis characterizes hypertensive cardiomyopathy,27 whereas myocyte necrosis prevails with aging.28 Mechanical forces in vitro trigger apoptosis with little necrosis.6 10 Similarly, blockade of the vacuolar proton ATPase in myocytes and fibroblasts triggers apoptosis but not cell necrosis.29 30 Both forms of myocyte death may play a relevant role in the injured heart, but it is impossible to predict the type of cell death that may be critical in a specific cardiac disease state.
CAN, Ventricular Remodeling, and IGF-1
Coronary constriction leads to a dilated myopathy in which
the expansion of cavitary volume, in combination with relative thinning
of the wall, results in a decrease in wall thicknesstochamber
radius ratio and decompensated eccentric
hypertrophy.7 Cavitary dilation exceeds the
increase in muscle mass generating a profound alteration in
ventricular anatomy, characterized by a reduction
in myocardial masstochamber volume ratio. These cardiac changes
occur in experimental and human ischemic
cardiomyopathy.1 7 Moreover,
end-diastolic pressure is increased, producing a marked
elevation in diastolic wall stress, which is not
necessarily accompanied by a change in systolic
loading.15 These anatomic,
physiological, and loading abnormalities have been
found here after CAN in nontransgenic and transgenic mice. However, the
magnitude of ventricular dilation, diastolic
wall stress, and reactive hypertrophy was attenuated by the
constitutive overexpression of IGF-1 in myocytes. Comparable results
have been obtained after myocardial infarction.8 Given
that the most apparent effect of the growth factor involved the
limitation in myocyte death by necrosis with CAN and apoptosis
with infarction, the possibility may be advanced that ongoing,
scattered myocyte loss may be crucial in the onset and progression of
the ischemic cardiomyopathy. Although IGF-1
exerted a protective influence on the ischemic
myocardium after CAN, the impairment in
ventricular function was comparable in littermates and
FVB.Igf+/ mice. Despite a reduction in tissue fibrosis and
necrotic cell death with IGF-1, the alterations in cardiac
hemodynamics did not differ in the 2 groups of animals.
IGF-1 was unable to diminish the impact of ischemia on
myocardial performance. A similar adaptation was observed after
myocardial infarction.8 Importantly, IGF-1 may
increase the coronary vasculature and microvasculature of the
ischemic myocardium, enhancing its
viability.31
CAN, Myosin Heavy Chain Expression, and IGF-1
Changes in the relative proportion of myosin isoenzyme mRNAs and
proteins occur in the rat heart after pathological
loads.32 A reduction in the expression of the predominant
V1 isoform and an increase in the slow migrating
V3 isoenzyme have been observed. A
transcriptional upregulation of ß-myosin heavy chain has also been
found in mice with aortic banding.33 A similar phenomenon
has recently been described in the failing human
heart.34 35 In the current study, CAN resulted in an
increase in ß-myosin heavy chain mRNA and a decrease in
-myosin
mRNA in myocytes of littermates and FVB.Igf+/ mice,
paralleling the observations summarized above. However, IGF-1
maintained
-myosin heavy chain mRNA levels higher in transgenic mice
than in nontransgenic mice at baseline and after CAN. Although these
findings are consistent with a more efficient mechanical
performance of myocytes in transgenic mice, the basis for the
differential expression of these 2 myosin isoenzymes is unknown. A
possible explanation may involve the ability of IGF-1 to promote
myocyte proliferation during postnatal life,9 and
this mechanism of cell growth may be coupled with a higher proportion
of younger myocytes and a greater quantity of V1
isoform in the cells.
Myocyte Necrosis, Oncosis, and Apoptosis
The identification of myocyte death in ischemic
heart disease by nick end labeling has been challenged.12
Similarly, the discrimination between necrotic and apoptotic
myocyte death by the use of myosin monoclonal antibody has been
questioned.36 This is relevant because cell death is a
critical event of cardiac pathology. Morphological alterations of
myocytes may help in the recognition of the form of cell death when
combined with specific markers of DNA damage. However, the use of
electron microscopy in immersion-fixed myocardium is
unacceptable in view of the numerous artifacts identified with this
preparation more than 25 years ago. In our experience, immersion
fixation of rabbit myocardium, under control conditions and
after acute and chronic pressure overload, results in poor preservation
of myocytes, particularly of the mitochondria and sarcoplasmic
reticulum compartments.37 38 To avoid possible
misinterpretation of morphological images, a PCR-generated
Pfu polymerase probe was used here to detect blunt DNA ends
(ie, necrosis).5 11 12 This methodology will also
identify DNA fragmentation associated with possible oncosis or cell
swelling.36 Moreover, a PCR-generated Taq
polymerase probe was used to identify double-strand cleavage of the DNA
with single-base 3' overhangs that occur exclusively with
apoptosis mediated by activation of
Ca2+-dependent DNase I.5 10 11 12
As recently emphasized, probes capable of detecting different aspects
of DNA fragmentation12 represent the most valid
approach for the distinction between apoptosis and oncosis.
Oncosis is a form of cell death characterized by cellular swelling and
increased membrane permeability, which evolves into typical
necrosis.12 Conversely, "necrosis" should reflect the
end stage of any type of cell death.39 However, the
terms oncosis and necrosis have been used interchangeably.
Unfortunately, at times, they have been interpreted as separate forms
of cell death. To avoid confusion and misinterpretation, "oncosis"
should not be introduced in the absence of a clear definition of its
significance. In the current study, 2 methodologies have each been
applied for the quantitative estimation of myocyte apoptosis
(TdT and Taq) and necrosis (myosin antibody and
Pfu). Almost identical values were obtained with both
techniques in each form of cell death in sham-operated and CAN
littermates and FVB.Igf+/ mice. Necrosis was demonstrated
as the dominant mechanism of cell death with CAN, in contrast with the
infarcted heart, in which apoptosis is the prevailing factor of
wall restructuring.8
| Acknowledgments |
|---|
Received December 21, 1998; accepted February 16, 1999.
| References |
|---|
|
|
|---|
2.
Willems IEMG, Havenith MG, De Mey JGR, Daemen MJAP.
The
-smooth muscle actin-positive cells in healing human
myocardial scars. Am J Pathol. 1994;145:868875.[Abstract]
3. Weber KT, Janicki JS, Shroff S. Mechanical and structural aspects of hypertrophied human myocardium. In: Tarazi RC, Dunbar JB, eds. Cardiac Hypertrophy in Hypertension. New York, NY: Raven Press; 1983:201210. Perspectives in Cardiovascular Research; vol 8.
4.
Haunstetter A, Izumo S. Apoptosis: basic
mechanisms and implications for cardiovascular disease.
Circ Res. 1998;82:11111129.
5. Anversa P, Leri A, Beltrami CA, Guerra S, Kajstura J. Myocyte death and growth in the failing heart. Lab Invest. 1998;78:767786.[Medline] [Order article via Infotrieve]
6. Cheng W, Li B, Kajstura J, Li P, Wolin MS, Sonnenblick EH, Hintze TH, Olivetti G, Anversa P. Stretch induced programmed myocyte cell death. J Clin Invest. 1995;96:22472259.
7.
Li B, Li Q, Wang X, Jana KP, Redaelli G, Kajstura J,
Anversa P. Coronary constriction impairs cardiac function and
induces myocardial damage and ventricular remodeling in
mice. Am J Physiol. 1997;273:H2508H2519.
8. Li Q, Li B, Wang X, Leri A, Jana KP, Liu Y, Kajstura J, Baserga R, Anversa P. Overexpression of insulin-like growth factor-1 in mice protects from myocyte death after infarction, attenuating ventricular dilation, wall stress, and cardiac hypertrophy. J Clin Invest. 1997;100:19911999.[Medline] [Order article via Infotrieve]
9.
Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B,
Olivetti G, Homcy CJ, Baserga R, Anversa P. Overexpression of
insulin-like growth factor-1 in the heart is coupled with myocyte
proliferation in transgenic mice. Proc Natl Acad Sci
U S A. 1996;93:86308635.
10. Leri A, Claudio PP, Li Q, Wang X, Reiss K, Wang S, Malhotra A, Kajstura J, Anversa P. Stretch-mediated release of angiotensin II induces myocyte apoptosis by activating p53 that enhances the local renin-angiotensin system and decreases the Bcl-2-to-Bax protein ratio in the cell. J Clin Invest. 1998;101:13261342.[Medline] [Order article via Infotrieve]
11.
Didenko VV, Hornsby PJ. Presence of double-strand
breaks with single-base 3' overhangs in cells undergoing
apoptosis but not necrosis. J Cell Biol. 1996;135:13691376.
12.
Buja LM, Entman ML. Modes of myocardial cell injury and
cell death in ischemic heart disease. Circulation. 1998;98:13551357.
13. Gerschenson LE, Rotello RJ. Apoptosis: a different type of cell death. FASEB J. 1992;6:24502455.[Abstract]
14.
Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W,
Nitahara JA, Quaini E, Di Loreto C, Beltrami CA, Krajewski S, Reed JC,
Anversa P. Apoptosis in the failing human heart. N
Engl J Med. 1997;336:11311141.
15. Anversa P, Olivetti G, Meggs LG, Sonnenblick EH, Capasso JM. Cardiac anatomy and ventricular loading after myocardial infarction. Circulation. 1993;87(suppl VII):VII-22VII-27.
16.
Buerke M, Murohara T, Skurk C, Nuss C, Tomaselli K,
Lefer AM. Cardioprotective effect of insulin-like growth factor-1 in
myocardial ischemia followed by reperfusion. Proc Natl
Acad Sci U S A. 1995;92:80318035.
17. Toms SA, Hercbergs A, Liu J, Kondo S, Haqqi T, Casey G, Iwasaki K, Barnett GH, Barna BP. Antagonist effect of insulin-like growth factor I on protein kinase inhibitor-mediated apoptosis in human glioblastoma cells in association with bcl-2 and bcl-xL. J Neurosurg. 1998;88:884889.[Medline] [Order article via Infotrieve]
18. Zamzami N, Brenner C, Marzo T, Susin SA, Kroemer G. Subcellular and submitochondrial mode of action of Bcl-2-like oncoproteins. Oncogene. 1998;16:22652282.[Medline] [Order article via Infotrieve]
19. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 1997;91:231241.[Medline] [Order article via Infotrieve]
20.
Wang L, Ma W, Markovich R, Lee WL, Wang PH.
Insulin-like growth factor I modulates induction of apoptotic
signaling in H9C2 cardiac muscle cells. Endocrinology. 1998;139:13541360.
21. Jennings RB, Reimer KA. Lethal myocardial ischemic injury. Am J Pathol. 1981;102:241255.[Medline] [Order article via Infotrieve]
22.
Antonsson B, Conti F, Ciavatta A, Montessuit S, Lewis
S, Martinou T, Bernasconi L, Bernard A, Mermod JJ, Mazzei G, Maudrell
K, Gambale F, Sadoul R, Martinou JC. Inhibition of Bax channel-forming
activity by Bcl-2. Science. 1997;277:370372.
23. Ishibashi Y, Nishimaki K, Asoh S, Nanbu-Wakao R, Yamada T, Ohta S. Pore formation domain of human pro-apoptotic Bax induces mammalian apoptosis as well as bacterial death without antagonizing anti-apoptotic factors. Biochem Biophys Res Commun. 1998;243:609616.[Medline] [Order article via Infotrieve]
24.
Pastorino JG, Chen ST, Tafani M, Snyder JW, Farber JL.
The overexpression of Bax produces cell death upon induction of the
mitochondrial permeability transition. J Biol Chem. 1998;273:77707775.
25. Tsukahara H, Gordienko DV, Tonshoff B, Gelato MC, Goligorsky MS. Direct demonstration of insulin-like growth factor-I-induced nitric oxide production by endothelial cells. Kidney Int. 1994;45:598604.[Medline] [Order article via Infotrieve]
26.
Kubes P, Suzuki M, Granger DN. Nitric oxide: an
endogenous modulator of leukocyte adhesion. Proc Natl
Acad Sci U S A. 1991;88:46514655.
27.
Li Z, Bing OHL, Long X, Robinson KG, Lakatta EG.
Increased cardiomyocyte apoptosis during the
transition of heart failure in the spontaneously hypertensive rat.
Am J Physiol. 1997;272:H2313H2319.
28. Kajstura J, Cheng W, Sarangarajan R, Li P, Li B, Nitahara JA, Chapnick S, Reiss K, Olivetti G, Anversa P. Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am J Physiol. 1996;217:H1215H1228.
29. Long X, Crow MT, Sollott SJ, O'Neill L, Menees DS, de Lourdes Hipolito M, Boluyt MO, Asai T, Lakatta EG. Enhanced expression of p53 and apoptosis induced by blockade of the vacuolar proton ATPase in cardiomyocytes. J Clin Invest. 1998;101:14531461.[Medline] [Order article via Infotrieve]
30.
Karwatowska-Prokopczuk E, Nordberg JA, Li HL, Engler
RL, Gottlieb RA. Effect of vacuolar proton ATPase on pHi,
Ca2+, and apoptosis in neonatal
cardiomyocytes during metabolic
inhibition/recovery. Circ Res. 1998;82:11391144.
31. Kluge A, Zimmermann R, Munkel B, Mohri M, Sack S, Schaper J, Schaper W. Insulin-like growth factor I is involved in inflammation linked angiogenic processes after microembolization in porcine heart. Cardiovasc Res. 1995;29:407415.[Medline] [Order article via Infotrieve]
32.
Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks
WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene
expression during the transition from stable hypertrophy to
heart failure: marked upregulation of genes encoding extracellular
matrix components. Circ Res. 1994;75:2332.
33.
Dorn GW, Robbins J, Ball N, Walsh RA. Myosin heavy
chain regulation and myocyte contractile depression after LV
hypertrophy in aortic-banded mice. Am J
Physiol. 1994;267:H400H405.
34. Lowes BD, Minobe W, Abraham WT, Rizeq MN, Bohlmeyer TJ, Quaife RA, Roden RL, Dutcher DL, Robertson AD, Voelkel NF, Badesch DB, Groves BM, Gilbert EM, Bristow MR. Changes in gene expression in the intact human heart. J Clin Invest. 1997;100:23152324.[Medline] [Order article via Infotrieve]
35. Nakao K, Minobe W, Roden R, Bristow MR, Leinwand LA. Myosin heavy chain gene expression in human heart failure. J Clin Invest. 1997;100:23622370.[Medline] [Order article via Infotrieve]
36.
Ohno M, Takemura G, Ohno A, Misao J, Hayakawa Y,
Minatoguchi S, Fujiwara T, Fujiwara H. "Apoptotic" myocytes
in infarct area in rabbit hearts may be oncotic myocytes with DNA
fragmentation: analysis by immunogold electron microscopy
combined with in situ nick end-labeling. Circulation. 1998;98:14221430.
37. Anversa P, Vitali-Mazza L, Visioli O, Marchetti G. Experimental cardiac hypertrophy: a quantitative ultrastructural study in the compensatory stage. J Mol Cell Cardiol. 1971;3:213227.[Medline] [Order article via Infotrieve]
38. Vitali-Mazza L, Anversa P, Tedeschi F, Mastandrea R, Mavilla V, Visioli O. Ultrastructural basis of acute left ventricular failure from severe acute aortic stenosis in the rabbit. J Mol Cell Cardiol. 1972;4:661671.[Medline] [Order article via Infotrieve]
39. Majno G, Joris I. Apoptosis, oncosis, and necrosis: an overview of cell death. Am J Pathol. 1995;146:315.[Abstract]
This article has been cited by other articles:
![]() |
R. J. Hassink, K. B. Pasumarthi, H. Nakajima, M. Rubart, M. H. Soonpaa, A. B. de la Riviere, P. A. Doevendans, and L. J. Field Cardiomyocyte cell cycle activation improves cardiac function after myocardial infarction Cardiovasc Res, April 1, 2008; 78(1): 18 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ungvari, C. Parrado-Fernandez, A. Csiszar, and R. de Cabo Mechanisms Underlying Caloric Restriction and Lifespan Regulation: Implications for Vascular Aging Circ. Res., March 14, 2008; 102(5): 519 - 528. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Soran, N. Younis, P. Currie, J. Silas, I.R. Jones, and G. Gill Influence of diabetes on the maintenance of sinus rhythm after a successful direct current cardioversion in patients with atrial fibrillation QJM, March 1, 2008; 101(3): 181 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Hu, L. K. Landeen, N. Aroonsakool, and W. R. Giles An analysis of the effects of stretch on IGF-I secretion from rat ventricular fibroblasts Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H677 - H683. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Kaplan, A. P. McGinn, M. N. Pollak, L. H. Kuller, H. D. Strickler, T. E. Rohan, A. R. Cappola, X. Xue, and B. M. Psaty Association of Total Insulin-Like Growth Factor-I, Insulin-Like Growth Factor Binding Protein-1 (IGFBP-1), and IGFBP-3 Levels with Incident Coronary Events and Ischemic Stroke J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1319 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vincent, L. Perrone, K. A. Sullivan, C. Backus, A. M. Sastry, C. Lastoskie, and E. L. Feldman Receptor for Advanced Glycation End Products Activation Injures Primary Sensory Neurons via Oxidative Stress Endocrinology, February 1, 2007; 148(2): 548 - 558. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yazdanpanah, F. A Sayed-Tabatabaei, J. A M J L Janssen, I. Rietveld, A. Hofman, T. Stijnen, H. A P Pols, S. W J Lamberts, J. C M Witteman, and C. M van Duijn IGF-I gene promoter polymorphism is a predictor of survival after myocardial infarction in patients with type 2 diabetes. Eur. J. Endocrinol., November 1, 2006; 155(5): 751 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bisping, S. Ikeda, S. W. Kong, O. Tarnavski, N. Bodyak, J. R. McMullen, S. Rajagopal, J. K. Son, Q. Ma, Z. Springer, et al. Gata4 is required for maintenance of postnatal cardiac function and protection from pressure overload-induced heart failure PNAS, September 26, 2006; 103(39): 14471 - 14476. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dawn, Y. Guo, A. Rezazadeh, Y. Huang, A. B. Stein, G. Hunt, S. Tiwari, J. Varma, Y. Gu, S. D. Prabhu, et al. Postinfarct Cytokine Therapy Regenerates Cardiac Tissue and Improves Left Ventricular Function Circ. Res., April 28, 2006; 98(8): 1098 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Limana, A. Germani, A. Zacheo, J. Kajstura, A. Di Carlo, G. Borsellino, O. Leoni, R. Palumbo, L. Battistini, R. Rastaldo, et al. Exogenous High-Mobility Group Box 1 Protein Induces Myocardial Regeneration After Infarction via Enhanced Cardiac C-Kit+ Cell Proliferation and Differentiation Circ. Res., October 14, 2005; 97(8): e73 - e83. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Okura, Y. Nakashima, H. Tojo, E. Tashiro, and K. Saku Valsartan, an Angiotensin II Type-I Receptor Blocker, and Left Ventricular Diastolic Function: A Case Report Angiology, July 1, 2005; 56(4): 467 - 473. [Abstract] [PDF] |
||||
![]() |
B. C. Harrison, C. R. Roberts, D. B. Hood, M. Sweeney, J. M. Gould, E. W. Bush, and T. A. McKinsey The CRM1 Nuclear Export Receptor Controls Pathological Cardiac Gene Expression Mol. Cell. Biol., December 15, 2004; 24(24): 10636 - 10649. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Conti, C. Carrozza, E. Capoluongo, M. Volpe, F. Crea, C. Zuppi, and F. Andreotti Insulin-Like Growth Factor-1 as a Vascular Protective Factor Circulation, October 12, 2004; 110(15): 2260 - 2265. [Full Text] [PDF] |
||||
![]() |
Z. Y. Fang, J. B. Prins, and T. H. Marwick Diabetic Cardiomyopathy: Evidence, Mechanisms, and Therapeutic Implications Endocr. Rev., August 1, 2004; 25(4): 543 - 567. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. McMullen, T. Shioi, W.-Y. Huang, L. Zhang, O. Tarnavski, E. Bisping, M. Schinke, S. Kong, M. C. Sherwood, J. Brown, et al. The Insulin-like Growth Factor 1 Receptor Induces Physiological Heart Growth via the Phosphoinositide 3-Kinase(p110{alpha}) Pathway J. Biol. Chem., February 6, 2004; 279(6): 4782 - 4793. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Fortuno, A. Gonzalez, S. Ravassa, B. Lopez, and J. Diez Clinical implications of apoptosis in hypertensive heart disease Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1495 - H1506. [Full Text] [PDF] |
||||
![]() |
E. J. Su, C. L. Cioffi, S. Stefansson, N. Mittereder, M. Garay, D. Hreniuk, and G. Liau Gene therapy vector-mediated expression of insulin-like growth factors protects cardiomyocytes from apoptosis and enhances neovascularization Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1429 - H1440. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, C. Chin-Chance, E.-J. Lee, and W. L. Lowe Jr. Activation of Phosphatidylinositol 3-Kinase Contributes to Insulin-Like Growth Factor I-Mediated Inhibition of Pancreatic {beta}-Cell Death Endocrinology, October 1, 2002; 143(10): 3802 - 3812. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsui, L. Li, J. C. Wu, S. A. Cook, T. Nagoshi, M. H. Picard, R. Liao, and A. Rosenzweig Phenotypic Spectrum Caused by Transgenic Overexpression of Activated Akt in the Heart J. Biol. Chem., June 14, 2002; 277(25): 22896 - 22901. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Limana, K. Urbanek, S. Chimenti, F. Quaini, A. Leri, J. Kajstura, B. Nadal-Ginard, S. Izumo, and P. Anversa bcl-2 overexpression promotes myocyte proliferation PNAS, April 30, 2002; 99(9): 6257 - 6262. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welch, D. Plank, S. Witt, B. Glascock, E. Schaefer, S. Chimenti, A. M. Andreoli, F. Limana, A. Leri, J. Kajstura, et al. Cardiac-Specific IGF-1 Expression Attenuates Dilated Cardiomyopathy in Tropomodulin-Overexpressing Transgenic Mice Circ. Res., April 5, 2002; 90(6): 641 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. WINN, A. PAUL, A. MUSARO, and N. ROSENTHAL Insulin-like Growth Factor Isoforms in Skeletal Muscle Aging, Regeneration, and Disease Cold Spring Harb Symp Quant Biol, January 1, 2002; 67(0): 507 - 518. [Abstract] [PDF] |
||||
![]() |
A-A Kotlyar, Z Vered, I Goldberg, P Chouraqui, D Nas, E Fridman, Z Chen-Levy, S Fytlovich, G Sangiorgi, L G Spagnoli, et al. Insulin-like growth factor I and II preserve myocardial structure in postinfarct swine Heart, December 1, 2001; 86(6): 693 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Galderisi, G. Vitale, G. Lupoli, M. Barbieri, G. Varricchio, C. Carella, O. de Divitiis, and G. Paolisso Inverse Association Between Free Insulin-Like Growth Factor-1 and Isovolumic Relaxation in Arterial Systemic Hypertension Hypertension, October 1, 2001; 38(4): 840 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Orlic, J. Kajstura, S. Chimenti, F. Limana, I. Jakoniuk, F. Quaini, B. Nadal-Ginard, D. M. Bodine, A. Leri, and P. Anversa Mobilized bone marrow cells repair the infarcted heart, improving function and survival PNAS, August 10, 2001; (2001) 181177898. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsui, J. Tao, F. del Monte, K.-H. Lee, L. Li, M. Picard, T. L. Force, T. F. Franke, R. J. Hajjar, and A. Rosenzweig Akt Activation Preserves Cardiac Function and Prevents Injury After Transient Cardiac Ischemia In Vivo Circulation, July 17, 2001; 104(3): 330 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Conti, F. Andreotti, A. Sciahbasi, P. Riccardi, G. Marra, E. Menini, G. Ghirlanda, and A. Maseri Markedly reduced insulin-like growth factor-1 in the acute phase of myocardial infarction J. Am. Coll. Cardiol., July 1, 2001; 38(1): 26 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M.C. Dixon Help from within: cardioprotective properties of hepatocyte growth factor Cardiovasc Res, July 1, 2001; 51(1): 4 - 6. [Full Text] [PDF] |
||||
![]() |
J. Kajstura, F. Fiordaliso, A. M. Andreoli, B. Li, S. Chimenti, M. S. Medow, F. Limana, B. Nadal-Ginard, A. Leri, and P. Anversa IGF-1 Overexpression Inhibits the Development of Diabetic Cardiomyopathy and Angiotensin II-Mediated Oxidative Stress Diabetes, June 1, 2001; 50(6): 1414 - 1424. [Abstract] [Full Text] |
||||
![]() |
K. Yamashita, J. Kajstura, D. J. Discher, B. J. Wasserlauf, N. H. Bishopric, P. Anversa, and K. A. Webster Reperfusion-Activated Akt Kinase Prevents Apoptosis in Transgenic Mouse Hearts Overexpressing Insulin-Like Growth Factor-1 Circ. Res., March 30, 2001; 88(6): 609 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.C. Wollert and H. Drexler Growth hormone and insulin-like growth factor--friends of the infarcted heart? Eur. Heart J., September 2, 2000; 21(18): 1499 - 1501. [PDF] |
||||
![]() |
A. Leri, F. Fiordaliso, M. Setoguchi, F. Limana, N. H. Bishopric, J. Kajstura, K. Webster, and P. Anversa Inhibition of p53 Function Prevents Renin-Angiotensin System Activation and Stretch-Mediated Myocyte Apoptosis Am. J. Pathol., September 1, 2000; 157(3): 843 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anversa Myocyte Death in the Pathological Heart Circ. Res., February 4, 2000; 86(2): 121 - 124. [Full Text] [PDF] |
||||
![]() |
S. Guerra, A. Leri, X. Wang, N. Finato, C. Di Loreto, C. A. Beltrami, J. Kajstura, and P. Anversa Myocyte Death in the Failing Human Heart Is Gender Dependent Circ. Res., October 29, 1999; 85(9): 856 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Orlic, J. Kajstura, S. Chimenti, F. Limana, I. Jakoniuk, F. Quaini, B. Nadal-Ginard, D. M. Bodine, A. Leri, and P. Anversa Mobilized bone marrow cells repair the infarcted heart, improving function and survival PNAS, August 28, 2001; 98(18): 10344 - 10349. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Welch, D. Plank, S. Witt, B. Glascock, E. Schaefer, S. Chimenti, A. M. Andreoli, F. Limana, A. Leri, J. Kajstura, et al. Cardiac-Specific IGF-1 Expression Attenuates Dilated Cardiomyopathy in Tropomodulin-Overexpressing Transgenic Mice Circ. Res., April 5, 2002; 90(6): 641 - 648. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |