Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1999;84:1007-1019

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Anversa, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Anversa, P.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Apoptosis
Right arrow Genetically altered mice
Right arrow Ischemic biology - basic studies
(Circulation Research. 1999;84:1007-1019.)
© 1999 American Heart Association, Inc.


Original Contributions

Insulin-Like Growth Factor-1 Attenuates the Detrimental Impact of Nonocclusive Coronary Artery Constriction on the Heart

Baosheng Li, Manabu Setoguchi, Xiaowei Wang, Anna Maria Andreoli, Annarosa Leri, Ashwani Malhotra, Jan Kajstura, Piero Anversa

From the Department of Medicine, New York Medical College, Valhalla, NY.

Correspondence to Piero Anversa, Department of Medicine, Vosburgh Pavilion-Room 302, New York Medical College, Valhalla, NY 10595.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Coronary artery narrowing (CAN) induces tissue injury, which may involve myocyte necrosis and apoptosis. Insulin-like growth factor (IGF)–1 may counteract cell death, modifying the detrimental effects of myocardial ischemia. On this basis, CAN was produced in female FVB.Igf+/– mice and nontransgenic littermates, and the animals were euthanized 7 days later. CAN consisted of an 82% reduction in the vessel luminal cross-sectional area in both groups of mice. Severe left ventricular dysfunction was present in CAN nontransgenic and transgenic mice, but heart and left ventricular weights increased more in littermates than in FVB.Igf+/– mice. Similarly, the changes in chamber volume and diastolic wall stress were greater in nontransgenic mice. Subacute tissue injury, represented by foci of replacement fibrosis, was 2.6-fold higher in CAN littermates than in FVB.Igf+/– mice. Ongoing myocyte necrosis was 5-fold greater in nontransgenic mice, whereas apoptosis was low and did not differ in the 2 groups of mice. In CAN nontransgenic mice, myocyte necrosis was 12-fold more frequent than apoptosis but, in CAN transgenic mice, these 2 types of cell death were comparable. {alpha}-Myosin and ß-myosin isoform mRNAs were affected by CAN, but {alpha}-myosin mRNA was reduced more in nontransgenic mice. In conclusion, myocyte necrosis and replacement fibrosis are the prevailing forms of myocardial damage induced by CAN. Constitutive overexpression of IGF-1 attenuates myocyte necrosis and tissue injury, having no effect on cell apoptosis. These factors limit ventricular dilation, myocardial loading, cardiac hypertrophy, and alterations in {alpha}- and ß-myosin isoform expression.


Key Words: myocardial ischemia • myocyte death • ventricular remodeling • myosin isoform • insulin-like growth factor-1 transgenic mice


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Ischemic heart disease sustained by nonocclusive coronary artery constriction is characterized by replacement fibrosis across the ventricular wall, cavitary dilation, and mural thinning.1 These modifications are associated with cardiac dysfunction and elevation in diastolic stress. Myocyte loss is modest, but it may continue with time.1 Dropout of myocytes, in combination with defects in coronary perfusion, may counteract reactive growth, increase chamber volume, and promote further elevation in wall stress and oxygen consumption. Cell death, whether apoptotic or necrotic, may have a differential impact on the evolution of the ischemic myopathy. Myocyte necrosis leads to an inflammatory reaction, vessel proliferation, macrophage and fibroblast activation, and scar formation.2 The increase in fibrous tissue alters muscle mechanical performance; force development is depressed, and the compliance properties of the ventricle are impaired.3 More complex is the understanding of the consequences of myocyte apoptosis. After apoptosis, the reparative process does not involve healing, and apoptotic bodies are removed by neighboring cells4 with no changes in the morphology of the myocardium.5 However, apoptosis is implicated in acute restructuring of the wall, downward shift in the length-tension curve, and decreased active tension generation of the myocardium.6

Coronary artery narrowing (CAN) in mice leads to decompensated eccentric hypertrophy, tissue damage, and abnormalities in loading that mimic human ischemic cardiomyopathy.7 Moreover, overexpression of insulin-like growth factor (IGF)–1 in myocytes abolishes the activation of myocyte necrosis and apoptosis in the viable myocardium after infarction, attenuating reactive hypertrophy, ventricular dilation, and wall stress.8 Apoptosis is the prevailing type of cell death after infarction, whereas the form of myocyte injury associated with CAN remains to be defined. This is relevant because defects in coronary blood flow are present with CAN, contrasting the lack of alterations in flow distribution in the noninfarcted myocardium. In the current study, we attempted to establish (1) whether myocyte necrosis and apoptosis occur in a mouse model of global ischemia in a manner comparable with that of the postinfarction heart; (2) whether IGF-1 can protect the underperfused ventricle by these forms of cell death; and (3) whether loading abnormalities change the proportion of myosin isoforms, affecting cardiac performance.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals
Experiments were performed in female FVB.Igf+/– mice and nontransgenic littermates at 75 days of age.9 These transgenic mice were obtained with the use of a cDNA for the human IGF-1B, which was placed under the control of a rat {alpha}-myosin heavy chain promoter. The overexpression of human IGF-1B in the mouse heart increased postnatally, reaching its peak at 75 days; a 12-fold higher value of IGF-1B than at 1 day was found at this interval. Littermates did not express in the heart the human IGF-1B gene.9 Myocytes from transgenic mice at 75 days secreted 4.3-fold more IGF-1 than myocytes from littermates of the same age.9 For functional and anatomic studies, CAN was surgically induced in 213 animals, and 96 survived the operation, indicating a 55% mortality; 60 mice were excluded, and 18 littermates and FVB.Igf+/– mice each were analyzed. An identical number of sham-operated animals was examined in each group. Cell death was assessed in separate groups of mice, because frozen sections of myocardium were required. For the evaluation of myocyte necrosis, 10 CAN littermates and 10 CAN FVB.Igf+/– mice were injected with 10 µg of myosin monoclonal antibody (clone CCM-52) 24 hours before death.8 Control animals, consisting of 7 littermates and 6 FVB.Igf+/– mice, were injected also with myosin antibody. Apoptosis was measured in these 33 mice. DNA laddering was examined in myocardial samples obtained from mice used for the measurements of myocyte death; 5 CAN and 5 sham-operated mice each in nontransgenic mice and transgenic mice were studied. DNA laddering was confirmed in isolated myocytes; 4 animals in each group were included. The expression of {alpha}- and ß-myosin was determined in isolated myocytes; 8 CAN and 8 sham-operated animals in each group were investigated. These 44 CAN mice required successful surgery in 92 of 168 animals.

CAN
Under ether anesthesia, thoracotomy was performed, the atrial appendage was elevated, and the left coronary artery was partially occluded. The chest was closed, the pneumothorax was reduced, and the mice were allowed to recover. To reduce pain, buprenorphine hydrochloride, 0.65 mg/kg body weight, was injected intramuscularly (Buprenex, Reckitt and Colman Pharmaceuticals). Sham-operated mice were treated similarly, but the ligature was not tied. Details of the procedure have been published.7 Experimental protocols were approved by New York Medical College.

Ventricular Hemodynamics
Mice were anesthetized with chloral hydrate (400 mg/kg body weight, IP), and the right carotid artery was cannulated with a microtip pressure transducer catheter (model SPR-671, Millar Instruments). The catheter was advanced into the left ventricle (LV) for the evaluation of LV pressures and +dP/dt and –dP/dt in the closed-chest preparation.

Fixation for Anatomic Measurements
The abdominal aorta was cannulated with a PE-50 catheter, and the heart was arrested in diastole through the aortic injection of 0.15 mL of cadmium chloride (100 mmol/L). The myocardium was perfused retrogradely through the aorta. The LV chamber was filled with fixative and kept at a pressure equal to end-diastolic pressure throughout the fixation procedure.7 8 After fixation, the heart was excised and cardiac weights were recorded.

Coronary Artery Diameter
The proximal 0.5- to 1.0-mm segment of the left coronary artery was isolated and cut transversely to expose the level of the ligature. The diameter of the lumen adjacent to the narrowed site and at the constricted portion were measured. Constriction was evaluated by comparing the vessel diameter above the stenosis with the diameter at the level of stenosis.7

Ventricular Dimensions
The major intracavitary axis of LV was measured. Each LV was then cut transversely to obtain a 1.5-mm section, halfway between the base and the apex, in which the average thickness of the free wall and septum and chamber luminal diameter were measured. Longitudinal and transverse diameters were used to calculate chamber volume.7 8 Measurements of wall thickness, chamber radius, and end-diastolic pressure were used to compute diastolic stress.

Myocardial Damage
Three slices of each LV, from the basal, middle, and apical portions, were embedded in paraffin and stained with hematoxylin and eosin. Sixty fields were examined at x400 with a 42-point reticle, defining a tissue area of 39 205 µm2 . The fraction of points lying over sites of replacement fibrosis and the number of these foci in the myocardium were measured.7

Myosin Antibody Labeling and Terminal Deoxynucleotidyl Transferase (TdT) Assay
Frozen tissue sections were exposed to TRITC-labeled anti-mouse IgG and fixed in 1.5% paraformaldehyde. The TdT assay was performed by incubating sections with 5 U of TdT, 2.5 mmol/L CoCl2, 0.2 mol/L potassium cacodylate, 25 mmol/L Tris-HCl, 0.25% BSA, and 0.5 nmol/L biotinylated 2'-deoxyuridine-5'-triphosphate (biotin-16-dUTP). After exposure to 5 µg/mL of FITC-Extravidin (Avidin, Sigma), myocytes were stained with {alpha}-sarcomeric actin and nuclei with propidium iodide.8 Sections were analyzed with a confocal microscope (MRC-1000, Bio-Rad Laboratories). The number of myocyte nuclei labeled by TdT was measured in each LV, and this parameter was divided by the numerical density of myocyte nuclei.6 8 10 The fraction of myocyte profiles stained by myosin antibody was assessed in a similar manner.

In Situ Ligation Assay
Taq probe was prepared using primers 5'-GTGGCCTGCCCAAGCTCTACCT-3' and 5'-GGCTGGTCTGCCGCCGTTTTCGACCCTG-3' complementary to pBluescript-bSDI1 plasmid.11 Polymerase chain reaction (PCR) was performed as previously described.10 After heating to 80°C, Taq polymerase, 2.5 U, was added. Gel electrophoresis documented a single PCR product that was purified with a PCR purification kit (Qiagen). Digoxigenin-labeled probes were ligated to DNA using T4 ligase. Sections were treated with proteinase K, 50 µg/mL PBS, for 30 minutes at 37°C, and a mixture of (in mmol/L) Tris-HCl (pH 7.8) 50, MgCl2 10, DTT 10, and ATP 1; 25 µg/mL BSA; 15% polyethylene glycol; 1 µg/mL probe; and 25 U/mL T4 ligase was applied for 4 hours. After washing at 70°C, samples were incubated with antidigoxigenin mouse monoclonal antibody and were exposed to FITC-labeled goat anti-mouse IgG. Sections were stained with {alpha}-sarcomeric actin antibody and propidium iodide.8 10 For the Pfu probe, 5 U of Pfu polymerase was used in the PCR reaction.11 For double labeling for Pfu and TdT, Pfu was done first, and the TdT reaction was performed with rhodamine-labeled Extravidin (Avidin, Sigma).

Myocyte Isolation
Myocytes were dissociated by collagenase following a procedure repeatedly used in our laboratory.8 9 Contamination from nonmyocytes ranged from 1% to 3%.8 9

DNA Gel Electrophoresis
Tissue homogenates and isolated myocytes were fixed in 70% ethanol. Fixed material was incubated in 40 µL of phosphate-citrate buffer (pH 7.8). Supernatant was digested with RNase and proteinase K, and samples were subjected to electrophoresis.8 10

Northern Blot
Myocytes were frozen in liquid nitrogen and were homogenized in Tri reagent (Molecular Research Center). Homogenates were precipitated by isopropanol. Pellets were washed with ethanol and dissolved in diethyl pyrocarbonate–treated water. RNA amounts were determined by A260/A280 (nm) ratio and by hybridization of RNA blots with GAPDH cDNA probe. Oligonucleotide probes for {alpha}- and ß-myosin heavy chain mRNAs (5'-CGAACGTTTATGTTTATTGTGGATTGGCCACAGCGAGGGTCTGCTGGAGAGG-3' and 5' - GCTTTATTCTGCTTCCACCTAAAGGGCTGTTGCAAAGGCTCCAGGTCTGAGGGCTTC-3') were labeled with [{gamma}32P]ATP and RTS T4 kinase; 15 µg of RNA was size-separated in 0.7% agarose gel and transferred onto Bio-Trans nylon membrane. After hybridization, blots were washed with 0.5% SSC and 1% SDS and exposed to x-ray film. Blots were then stripped with 0.2% SDS at 90°C for 15 minutes and reprobed for GAPDH using [{alpha}32P]dCTP-labeled Ready To Go DNA labeling beads (Pharmacia Biotechnology).

Data Analysis
Results are presented as mean±SD. Significance, P<0.05, between 2 measurements and among multiple groups was determined by the 2-tailed Student t test, ANOVA, and the Bonferroni method.8 The differences in relative changes in cardiac weights, cardiac weight–to–body weight ratios, and chamber volume between CAN nontransgenic and CAN transgenic mice were computed from the quotient of values of non-CAN and CAN animals in each group, according to the equation previously described.8 Subsequently, a Student t test was applied.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Perfusion Fixation and CAN
Figure 1Down illustrates degrees of CAN ranging from 52% to 61%. To reduce the variability of CAN, only mice with reduction in luminal diameter >=49% and <=70% were included in all cases. On this basis, 60 mice were excluded from a total of 96 for anatomic studies, and 48 from a total of 92 for measurements of cell death and biochemical parameters. Anatomic determinations were obtained in 36 mice, 18 nontransgenic and 18 transgenic. Sham-operated groups also included 18 animals each. In comparison with the nonconstricted portion of the vessel, the procedure resulted in a 59±6% (proximal, 151±18 µm; constricted, 62±12 µm; P<0.001) and 58±6% (proximal, 157±17 µm; constricted, 66±13 µm; P<0.001) reduction in luminal diameter of the coronary artery in littermates and FVB.Igf+/– mice, respectively. Corresponding decreases in luminal area were 83±5% (proximal, 18 169±4233 µm2; constricted, 3067±1234 µm2; P<0.001) and 82±5% (proximal, 19 541±4295 µm2; constricted, 3548±1349 µm2; P<0.001). Similar values were found in mice used in other studies. In summary, comparable degrees of CAN were produced in littermates and FVB.Igf+/– mice.



View larger version (147K):
[in this window]
[in a new window]
 
Figure 1. Light micrographs of paraffin-embedded segments of nonconstricted and constricted left coronary arteries near their origin. A and B, Two examples of coronary arteries in sham-operated nontransgenic (A; luminal diameter=153 µm) and transgenic (B; luminal diameter=165 µm) mice. C and D, Two examples of CAN in nontransgenic (C; luminal diameter=76 µm) and transgenic (D; luminal diameter=63 µm) mice. A 52% and a 61% reduction in luminal diameter is depicted in these 2 micrographs (C and D). Internal diameters of the nonconstricted portions of the vessels were 157 and 161 µm, respectively. An inflammatory reaction is noted around the vessel wall. Fragments of the ligature are also visible (arrows). Empty space corresponds to the location of the suture that detached in part during sectioning. Magnification, A, B, C, and D, x190.

Physiological Measurements
LV end-diastolic pressure increased 145% (P<0.001) in CAN nontransgenic mice, whereas LV peak systolic pressure decreased 12% (P<0.005), and +dP/dt and –dP/dt, 34% (P<0.001) and 29% (P<0.001), respectively (Figure 2Down). Corresponding changes in CAN transgenic mice were 137% (P<0.001), 12% (P<0.01), 31% (P<0.001), and 30% (P<0.001). No difference in these indices of LV function was found between littermates and FVB.Igf+/– mice before and after CAN. In summary, CAN resulted in severe LV dysfunction that affected nontransgenic and transgenic mice.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Effects of CAN on ventricular hemodynamics in nontransgenic littermates and transgenic mice. Results are presented as mean±SD. *Significant difference, P<0.05. SO indicates sham-operated mice; LVEDP, left ventricular end-diastolic pressure; and LVSP, left ventricular systolic pressure. n=18 in each group.

Body Weight and Heart Weight
CAN for 7 days was characterized by a 7% (P<0.01) and 5% (P<0.05) decrease in body weight in nontransgenic mice (control, 22.8±0.86 g; CAN, 21.3±2.0 g) and transgenic mice (control, 24.4±1.7 g; CAN, 23.1±1.5 g), respectively. Heart weight increased 29% (P<0.001) and 19% (P<0.005), resulting in a 38% (P<0.001) and 25% (P<0.001) increase in heart weight–to–body weight ratio in CAN littermates and CAN FVB.Igf+/– mice (Figure 3Down). In CAN littermates, LV increased 34% (P<0.001) and right ventricle 14% (P<0.05), whereas, in FVB.Igf+/– mice, these increases were 21% (P<0.001) and 8% (NS), respectively. These responses resulted in a 44% (P<0.001) and 22% (P<0.005) increase in LV and right ventricle weight–to–body weight ratios in littermates and in a 29% (P<0.001) and 10% (P<0.05) increase in these parameters in FVB.Igf+/– mice. In comparison with CAN transgenic mice, 53% (P<0.05), 62% (P<0.04) 52%, (P<0.03), and 52% (P<0.03) higher heart weight, LV weight, and ratios of heart weight and LV weight to body weight were found in CAN nontransgenic mice. In summary, CAN resulted in a greater magnitude of cardiac hypertrophy in nontransgenic than in transgenic mice.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Effects of CAN on cardiac weights, and cardiac weight–to–body weight ratio in nontransgenic littermates and transgenic mice. Results are presented as mean±SD. *Significant difference, P<0.05. SO indicates sham-operated mice. n=18 in each group.

Ventricular Dimensions
CAN produced a 20% (P<0.05) and 16% (P<0.05) increase in LV longitudinal intracavitary axis in littermates and FVB.Igf+/– mice (Figure 4Down). Chamber diameter increased 18% (P<0.05) and 11% (P<0.005), and cavitary volume expanded 68% (P<0.001) and 37% (P<0.001) in nontransgenic mice and transgenic mice. Thus, chamber volume increased 84% (P<0.02) more in littermates than in FVB.Igf+/– mice. LV mass–to–chamber volume ratio decreased 23% (P<0.005) with CAN only in nontransgenic mice. Additionally, LV thickness decreased 10% (P<0.05) and 9% (P<0.05), and wall thickness–to–chamber radius ratio decreased 28% (P<0.001) and 20% (P<0.005) in littermates and FVB.Igf+/– mice, respectively. These anatomic properties and the measurements of LV end-diastolic pressures allowed the computation of diastolic wall stress. CAN resulted in a 263% (P<0.001) and 189% (P<0.001) increase in diastolic stress in nontransgenic mice and transgenic mice, indicating a 1.4-fold (P<0.01) higher level of wall stress in littermates than in FVB.Igf+/– mice. In summary, CAN produced greater ventricular dilation and higher diastolic stress in nontransgenic mice than in transgenic mice.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. Effects of CAN on cardiac anatomy and diastolic wall stress in nontransgenic littermates and transgenic mice. Results are presented as mean±SD. *Significant difference, P<0.05. SO indicates sham-operated mice. n=18 in each group.

Ventricular Damage
CAN was characterized by sites of replacement fibrosis in various phases of healing across the LV wall (Figure 5ADown through 5D). The number of lesion profiles per mm2 of myocardium was 1.6-fold (P<0.001) greater in CAN nontransgenic mice than in transgenic mice (Figure 5EDown). Similarly, the volume percentage of scarring was 2.6-fold (P<0.001) more extensive in CAN littermates (Figure 5FDown). Fibrosis represented the damage accumulated from the time of CAN to euthanization. However, this analysis did not include ongoing myocyte death. In summary, CAN resulted in areas of subacute myocardial injury in the LV wall that were more severe in littermates than in FVB.Igf+/– mice.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 5. Light micrographs of paraffin-embedded left ventricular myocardium. A large area of reparative fibrosis (A), several foci of similar damage of smaller dimensions (B), and a higher magnification of collagen deposition and healing (C) are shown in FVB.Igf+/– mice. D, Site of replacement fibrosis in a FVB.Igf+/– mouse. Magnification: panel A, x150; panel B, x230; panel C, x600; and panel D, x350 (hematoxylin and eosin staining). E and F, Effects of CAN on the number of foci of replacement fibrosis and volume percentage of this form of damage in the left ventricular myocardium of nontransgenic and transgenic mice. SO indicates sham-operated mice. Results are presented as mean±SD. n=10 in each group of mice. *Significant difference from sham-operated mice (P<0.05). {dagger}Significant difference between CAN littermates and transgenic mice (P<0.05).

Ongoing Myocyte Death
Hearts were not fixed by perfusion, because myocyte necrosis was identified by myosin labeling in frozen sections of myocardium. Adjacent sections were processed for the detection of apoptosis by TdT. CAN involved a decrease in luminal diameter of 56% in nontransgenic mice (proximal segment, 146±20 µm; constricted segment, 64±14 µm; P<0.001) and 60% in transgenic mice (proximal segment, 151±19 µm; constricted segment, 60±15 µm; P<0.001). Low levels of myocyte necrosis were observed in both control animals. After CAN, single cells and groups of myocytes were labeled by myosin in littermates (Figure 6ADown through 6C) and FVB.Igf+/– mice (Figure 6DDown through 6F). In the absence of CAN, myocyte apoptosis was identified in nontransgenic mice (Figure 6GDown through 6I) and transgenic mice (Figure 6JDown through 6L). CAN had little effect on apoptosis in both groups of mice.






View larger version (296K):
[in this window]
[in a new window]
 
Figure 6. Confocal microscopy of myosin antibody labeling of necrotic myocytes (A, green fluorescence) and {alpha}-sarcomeric actin antibody staining of the myocyte cytoplasm (B, red fluorescence) in a CAN nontransgenic mouse. These 2 confocal images are combined in panel C: red fluorescence corresponds to myocytes and yellow fluorescence reflects necrotic cells. D through F, Similarly, localization of necrotic myocytes in a CAN transgenic mouse. Panels G through I illustrate nuclear fragmentation in a CAN nontransgenic mouse by confocal microscopy (G, red fluorescence of propidium iodide), TdT labeling of nuclei (H, green fluorescence) and {alpha}-sarcomeric actin staining of the myocyte cytoplasm (I, red fluorescence). Yellow fluorescence in panel I reflects the combination of propidium iodide and TdT labeling shown in panels G and H. Arrows indicate the position of the apoptotic nucleus. J through L, Similarly, apoptosis of a myocyte nucleus in a CAN transgenic mouse. Loss of DNA and features preceding nuclear fragmentation are apparent. Arrows indicate position of the apoptotic nucleus. M through O, In a CAN nontransgenic mouse by confocal microscopy nuclei (M, red fluorescence of propidium iodide), Pfu labeling of a nucleus (N, green fluorescence), and {alpha}-sarcomeric actin staining of the myocyte cytoplasm (O, red fluorescence). Yellow fluorescence in panel O reflects the combination of propidium iodide and Pfu labeling shown in panels M and N. Arrows indicate position of the necrotic nucleus. P through R, Similarly, necrosis of a myocyte nucleus in a CAN transgenic mouse. S through U, In a CAN nontransgenic mouse by confocal microscopy nuclei (S, red fluorescence of propidium iodide), Taq labeling of a nucleus (T, green fluorescence), and {alpha}-sarcomeric actin staining of the myocyte cytoplasm (U, red fluorescence). Yellow fluorescence in panel U reflects the combination of propidium iodide and Taq labeling shown in panels S and T. Arrows indicate position of the apoptotic nucleus. V through X, Similarly, apoptosis of a myocyte nucleus in a CAN transgenic mouse. Magnification: panels A through F, x1500; panels G through I and panels M through X, x2000; and panels J through L, x2500.

Myocyte necrosis and apoptosis were detected by 2 additional methods, using probes generated by Pfu and Taq polymerase, respectively.11 Pfu labeled blunt-ended products of DNA damage (Figure 6MUp through 6R) that developed during necrosis.11 12 Conversely, Taq identified double–DNA strand cleavage with single-base 3' overhangs (Figure 6SUp through 6X) that occurred with apoptosis.10 11 In no instance was myosin or Pfu labeling of myocytes associated with TdT staining. Figure 7ADown illustrates that myocyte necrosis, recognized by myosin antibody, was similar in sham-operated littermates and FVB.Igf+/– mice. CAN resulted in a 46-fold (P<0.001) and 9.4-fold (P<0.001) increase in myocyte necrosis in nontransgenic mice and transgenic mice, respectively. In comparison with CAN transgenic mice, the 5.2-fold higher magnitude of necrotic death in CAN nontransgenic mice was significant (P<0.001). Myocyte apoptosis, measured by TdT, was comparable in the 2 groups of mice at baseline (Figure 7BDown). CAN modestly increased myocyte apoptosis, 1.8-fold (P<0.05) in littermates and 3.0-fold (P<0.001) in FVB.Igf+/– mice. Apoptosis in CAN nontransgenic mice and CAN transgenic mice was not different (P=0.78). When necrosis was established by Pfu, CAN resulted in a 44-fold (P<0.001) and a 9.7-fold (P<0.001) increase of this form of cell death in littermates and FVB.Igf+/– mice, respectively (Figure 7CDown). In a manner similar to TdT, apoptosis, measured by Taq, increased moderately with CAN in both groups of animals. Measurements of necrosis with myosin antibody and Pfu, and of apoptosis with TdT and Taq, were not statistically different. In CAN nontransgenic mice, necrosis was an average 12-fold (P<0.001) greater than apoptosis with both techniques. In CAN transgenic mice, the 2.3-fold higher value in necrosis than in apoptosis was not significant (P=0.43). In summary, myocyte necrosis was the predominant type of cell death with CAN, and this form of injury was more severe in FVB.Igf–/– mice.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Effects of CAN on myocyte death in nontransgenic littermates and transgenic mice. Results are presented as mean±SD. *Significant difference from sham-operated mice (SO), P<0.05. {dagger}Significant difference between CAN littermates and transgenic mice, P<0.05. Sham-operated littermates, n=7; sham-operated transgenic mice, n=6; CAN littermates, n=10; CAN transgenic mice, n=10.

DNA Damage
Agarose gel electrophoresis of DNA from LV samples (Figure 8ADown) and dissociated myocytes (Figure 8BDown) documented that CAN was associated with a diffuse DNA pattern in tissue preparations. This aspect reflected random fragmentation of the DNA that was consistent with cell necrosis.13 In myocytes, mononucleosomes and oligonucleosomes were detected, indicating that laddering and apoptosis were present in the electrophoretic profile of low molecular weight DNA.13 In summary, CAN was accompanied by myocyte necrosis and modest levels of apoptosis.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 8. Electrophoretic pattern of DNA extracted from myocardial tissue (A) and isolated left ventricular myocytes (B) obtained from sham-operated (SO) and CAN nontransgenic littermates (L) and transgenic mice (T). MW, molecular weight markers. In panel A, DNA diffusion is apparent in CAN nontransgenic littermates, whereas in panel B mononucleosomes and oligonucleosomes are visible in CAN nontransgenic and transgenic mice.

Myosin Isoenzymes
{alpha}- and ß-myosin heavy chain mRNAs were detectable in LV myocytes from sham-operated littermates and FVB.Igf+/– mice (Figure 9Down). Similarly, these myosin isoforms were present in myocytes of both groups of animals after CAN (n=8 in each group of mice). However, expression of myosin isoforms differed between littermates and FVB.Igf+/– mice. In controls, ß-myosin mRNA was 75% (P<0.04) higher and {alpha}-myosin mRNA was 7% (P<0.04) lower in nontransgenic mice ({alpha}-myosin, 86±4%; ß-myosin, 14±4%) than in transgenic mice ({alpha}-myosin, 92±2%; ß-myosin, 8±2%). CAN decreased 10% (P<0.002) {alpha}-myosin mRNAs (77±5%) and increased 64% (P<0.002) ß-myosin mRNAs (23±5%) in littermates. In FVB.Igf+/– mice, CAN reduced {alpha}-myosin mRNA 9% (84±4%; P<0.005) and augmented ß-myosin mRNA 100% (16±4%; P<0.005). However, {alpha}-myosin mRNA level was 9% (P<0.02) higher in CAN transgenic mice than in nontransgenic mice. In summary, expression of myosin isoforms was affected by CAN, but {alpha}-myosin mRNA was greater in transgenic mice at baseline and after CAN.



View larger version (77K):
[in this window]
[in a new window]
 
Figure 9. Northern blot analysis of {alpha}- and ß-myosin heavy chain mRNA in ventricular myocytes isolated from sham-operated nontransgenic (lanes 1 and 2), sham-operated transgenic (lanes 3 and 4), CAN nontransgenic (lanes 5 and 6), and CAN transgenic (lanes 7 and 8) mice. GAPDH probe was used to normalize variations in loading.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The results of this study indicate that severe reductions in luminal diameter of a major epicardial coronary artery led to chronic loss of myocytes that altered cardiac anatomy and impaired ventricular function. Cell death occurred by apoptosis and necrosis, but necrosis was the predominant form of myocyte injury. Cavitary dilation, reactive hypertrophy, elevated diastolic stress, increased ß-myosin mRNA, and decreased {alpha}-myosin mRNA developed with CAN. Overexpression of IGF-1 in myocytes attenuated the magnitude of accumulated damage and the extent of ongoing myocyte death. This protective effect of IGF-1 on cell survival limited the changes in chamber volume, myocardial hypertrophy, ventricular loading, and {alpha}- and ß-myosin mRNAs. Thus, cell death appears to be a critical component of the onset and early evolution of ischemic cardiomyopathy, and interference with this process by IGF-1 may positively influence the short- and long-term outcome of ventricular remodeling.

CAN, Myocyte Cell Death, and IGF-1
Current results and previous observations after infarction8 indicate that differences exist between the impact of restrictions in coronary blood flow and the consequences of a segmental loss of tissue with coronary occlusion. In the latter case, myocyte apoptosis occurs in the surviving myocardium14 and markedly exceeds cell necrosis.8 Myocyte apoptosis is responsible for side-to-side slippage of myocytes,15 mural thinning, and cavitary dilation acutely after infarction.6 15 Additionally, myocardial scarring is not present in the viable tissue of the postinfarction heart shortly after coronary artery ligation.15 Conversely, myocyte necrosis and tissue fibrosis characterize the cardiac myopathy mediated by coronary artery stenosis.1 Foci of replacement fibrosis in the myocardium detected here reflected an immediate activation of myocyte necrosis, evolving with time in multiple areas of reparative scarring.7 Collagen accumulation is not the consequence of myocyte apoptosis.13 Distinct forms of cell death appear to be implicated in the restructuring of the wall with coronary artery disease in the absence or presence of a myocardial infarction.

IGF-1 overexpression markedly attenuated the extent of myocardial fibrosis and the magnitude of ongoing cell necrosis after CAN; volume fraction of reparative fibrosis was reduced 62% and ongoing necrotic myocyte death 80%. IGF-1 interferes with the activation of myocyte necrosis during ischemia reperfusion injury16 and myocardial infarction.8 However, the mechanism of this protective effect on cell viability has not been defined. The current results also leave this issue unresolved. The growth factor may increase the vascular component of the myocardium, minimizing the influence of global ischemia. On the other hand, this possibility is not supported by differences in infarction size with coronary artery occlusion.8 IGF-1 enhances Bcl-2 expression17 that increases the stability of cellular membranes.18 Intracellular Ca2+ homeostasis and compartmentalization of this cation are preserved by the influence of IGF-1 on antagonists of Bcl-2 such as Bad19 and Bax.20 These factors may inhibit Ca2+ overload–mediated cell necrosis.21 Bax may form pH- and voltage-dependent ion-conducting channels, altering membrane permeability.22 23 24 Bcl-2 antagonizes this phenomenon.22 23 24 Additionally, IGF-1 releases nitric oxide,25 and this may promote antithrombotic and antiinflammatory reactions,26 decreasing necrotic myocyte cell death.

Myocyte apoptosis was low in FVB.Igf+/– mice and nontransgenic animals at baseline, and CAN increased this parameter modestly. Overexpression of IGF-1 did not reduce this form of cell death in the myocardium. Apoptosis represented a minimal component of the total myocyte loss in the heart of littermates, and the amount of apoptosis and necrosis was limited in FVB.Igf+/– mice. Complex is the understanding of the distinct forms of myocyte death that take place under different conditions. Myocyte apoptosis characterizes hypertensive cardiomyopathy,27 whereas myocyte necrosis prevails with aging.28 Mechanical forces in vitro trigger apoptosis with little necrosis.6 10 Similarly, blockade of the vacuolar proton ATPase in myocytes and fibroblasts triggers apoptosis but not cell necrosis.29 30 Both forms of myocyte death may play a relevant role in the injured heart, but it is impossible to predict the type of cell death that may be critical in a specific cardiac disease state.

CAN, Ventricular Remodeling, and IGF-1
Coronary constriction leads to a dilated myopathy in which the expansion of cavitary volume, in combination with relative thinning of the wall, results in a decrease in wall thickness–to–chamber radius ratio and decompensated eccentric hypertrophy.7 Cavitary dilation exceeds the increase in muscle mass generating a profound alteration in ventricular anatomy, characterized by a reduction in myocardial mass–to–chamber volume ratio. These cardiac changes occur in experimental and human ischemic cardiomyopathy.1 7 Moreover, end-diastolic pressure is increased, producing a marked elevation in diastolic wall stress, which is not necessarily accompanied by a change in systolic loading.15 These anatomic, physiological, and loading abnormalities have been found here after CAN in nontransgenic and transgenic mice. However, the magnitude of ventricular dilation, diastolic wall stress, and reactive hypertrophy was attenuated by the constitutive overexpression of IGF-1 in myocytes. Comparable results have been obtained after myocardial infarction.8 Given that the most apparent effect of the growth factor involved the limitation in myocyte death by necrosis with CAN and apoptosis with infarction, the possibility may be advanced that ongoing, scattered myocyte loss may be crucial in the onset and progression of the ischemic cardiomyopathy. Although IGF-1 exerted a protective influence on the ischemic myocardium after CAN, the impairment in ventricular function was comparable in littermates and FVB.Igf+/– mice. Despite a reduction in tissue fibrosis and necrotic cell death with IGF-1, the alterations in cardiac hemodynamics did not differ in the 2 groups of animals. IGF-1 was unable to diminish the impact of ischemia on myocardial performance. A similar adaptation was observed after myocardial infarction.8 Importantly, IGF-1 may increase the coronary vasculature and microvasculature of the ischemic myocardium, enhancing its viability.31

CAN, Myosin Heavy Chain Expression, and IGF-1
Changes in the relative proportion of myosin isoenzyme mRNAs and proteins occur in the rat heart after pathological loads.32 A reduction in the expression of the predominant V1 isoform and an increase in the slow migrating V3 isoenzyme have been observed. A transcriptional upregulation of ß-myosin heavy chain has also been found in mice with aortic banding.33 A similar phenomenon has recently been described in the failing human heart.34 35 In the current study, CAN resulted in an increase in ß-myosin heavy chain mRNA and a decrease in {alpha}-myosin mRNA in myocytes of littermates and FVB.Igf+/– mice, paralleling the observations summarized above. However, IGF-1 maintained {alpha}-myosin heavy chain mRNA levels higher in transgenic mice than in nontransgenic mice at baseline and after CAN. Although these findings are consistent with a more efficient mechanical performance of myocytes in transgenic mice, the basis for the differential expression of these 2 myosin isoenzymes is unknown. A possible explanation may involve the ability of IGF-1 to promote myocyte proliferation during postnatal life,9 and this mechanism of cell growth may be coupled with a higher proportion of younger myocytes and a greater quantity of V1 isoform in the cells.

Myocyte Necrosis, Oncosis, and Apoptosis
The identification of myocyte death in ischemic heart disease by nick end labeling has been challenged.12 Similarly, the discrimination between necrotic and apoptotic myocyte death by the use of myosin monoclonal antibody has been questioned.36 This is relevant because cell death is a critical event of cardiac pathology. Morphological alterations of myocytes may help in the recognition of the form of cell death when combined with specific markers of DNA damage. However, the use of electron microscopy in immersion-fixed myocardium is unacceptable in view of the numerous artifacts identified with this preparation more than 25 years ago. In our experience, immersion fixation of rabbit myocardium, under control conditions and after acute and chronic pressure overload, results in poor preservation of myocytes, particularly of the mitochondria and sarcoplasmic reticulum compartments.37 38 To avoid possible misinterpretation of morphological images, a PCR-generated Pfu polymerase probe was used here to detect blunt DNA ends (ie, necrosis).5 11 12 This methodology will also identify DNA fragmentation associated with possible oncosis or cell swelling.36 Moreover, a PCR-generated Taq polymerase probe was used to identify double-strand cleavage of the DNA with single-base 3' overhangs that occur exclusively with apoptosis mediated by activation of Ca2+-dependent DNase I.5 10 11 12 As recently emphasized, probes capable of detecting different aspects of DNA fragmentation12 represent the most valid approach for the distinction between apoptosis and oncosis. Oncosis is a form of cell death characterized by cellular swelling and increased membrane permeability, which evolves into typical necrosis.12 Conversely, "necrosis" should reflect the end stage of any type of cell death.39 However, the terms oncosis and necrosis have been used interchangeably. Unfortunately, at times, they have been interpreted as separate forms of cell death. To avoid confusion and misinterpretation, "oncosis" should not be introduced in the absence of a clear definition of its significance. In the current study, 2 methodologies have each been applied for the quantitative estimation of myocyte apoptosis (TdT and Taq) and necrosis (myosin antibody and Pfu). Almost identical values were obtained with both techniques in each form of cell death in sham-operated and CAN littermates and FVB.Igf+/– mice. Necrosis was demonstrated as the dominant mechanism of cell death with CAN, in contrast with the infarcted heart, in which apoptosis is the prevailing factor of wall restructuring.8


*    Acknowledgments
 
This work was supported by National Institutes of Health Grants HL-38132, HL-39902, HL-43023, and AG-15756 and by American Heart Association Grant-in-Aid 97-GIA-038.

Received December 21, 1998; accepted February 16, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Buja LM, Willerson JT. The role of coronary artery lesions in ischemic heart disease: insights from recent clinicopathologic, coronary arteriography and experimental studies. Hum Pathol. 1987;18:451–461.[Medline] [Order article via Infotrieve]

2. Willems IEMG, Havenith MG, De Mey JGR, Daemen MJAP. The {alpha}-smooth muscle actin-positive cells in healing human myocardial scars. Am J Pathol. 1994;145:868–875.[Abstract]

3. Weber KT, Janicki JS, Shroff S. Mechanical and structural aspects of hypertrophied human myocardium. In: Tarazi RC, Dunbar JB, eds. Cardiac Hypertrophy in Hypertension. New York, NY: Raven Press; 1983:201–210. Perspectives in Cardiovascular Research; vol 8.

4. Haunstetter A, Izumo S. Apoptosis: basic mechanisms and implications for cardiovascular disease. Circ Res. 1998;82:1111–1129.[Free Full Text]

5. Anversa P, Leri A, Beltrami CA, Guerra S, Kajstura J. Myocyte death and growth in the failing heart. Lab Invest. 1998;78:767–786.[Medline] [Order article via Infotrieve]

6. Cheng W, Li B, Kajstura J, Li P, Wolin MS, Sonnenblick EH, Hintze TH, Olivetti G, Anversa P. Stretch induced programmed myocyte cell death. J Clin Invest. 1995;96:2247–2259.

7. Li B, Li Q, Wang X, Jana KP, Redaelli G, Kajstura J, Anversa P. Coronary constriction impairs cardiac function and induces myocardial damage and ventricular remodeling in mice. Am J Physiol. 1997;273:H2508–H2519.[Abstract/Free Full Text]

8. Li Q, Li B, Wang X, Leri A, Jana KP, Liu Y, Kajstura J, Baserga R, Anversa P. Overexpression of insulin-like growth factor-1 in mice protects from myocyte death after infarction, attenuating ventricular dilation, wall stress, and cardiac hypertrophy. J Clin Invest. 1997;100:1991–1999.[Medline] [Order article via Infotrieve]

9. Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homcy CJ, Baserga R, Anversa P. Overexpression of insulin-like growth factor-1 in the heart is coupled with myocyte proliferation in transgenic mice. Proc Natl Acad Sci U S A. 1996;93:8630–8635.[Abstract/Free Full Text]

10. Leri A, Claudio PP, Li Q, Wang X, Reiss K, Wang S, Malhotra A, Kajstura J, Anversa P. Stretch-mediated release of angiotensin II induces myocyte apoptosis by activating p53 that enhances the local renin-angiotensin system and decreases the Bcl-2-to-Bax protein ratio in the cell. J Clin Invest. 1998;101:1326–1342.[Medline] [Order article via Infotrieve]

11. Didenko VV, Hornsby PJ. Presence of double-strand breaks with single-base 3' overhangs in cells undergoing apoptosis but not necrosis. J Cell Biol. 1996;135:1369–1376.[Abstract/Free Full Text]

12. Buja LM, Entman ML. Modes of myocardial cell injury and cell death in ischemic heart disease. Circulation. 1998;98:1355–1357.[Free Full Text]

13. Gerschenson LE, Rotello RJ. Apoptosis: a different type of cell death. FASEB J. 1992;6:2450–2455.[Abstract]

14. Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara JA, Quaini E, Di Loreto C, Beltrami CA, Krajewski S, Reed JC, Anversa P. Apoptosis in the failing human heart. N Engl J Med. 1997;336:1131–1141.[Abstract/Free Full Text]

15. Anversa P, Olivetti G, Meggs LG, Sonnenblick EH, Capasso JM. Cardiac anatomy and ventricular loading after myocardial infarction. Circulation. 1993;87(suppl VII):VII-22–VII-27.

16. Buerke M, Murohara T, Skurk C, Nuss C, Tomaselli K, Lefer AM. Cardioprotective effect of insulin-like growth factor-1 in myocardial ischemia followed by reperfusion. Proc Natl Acad Sci U S A. 1995;92:8031–8035.[Abstract/Free Full Text]

17. Toms SA, Hercbergs A, Liu J, Kondo S, Haqqi T, Casey G, Iwasaki K, Barnett GH, Barna BP. Antagonist effect of insulin-like growth factor I on protein kinase inhibitor-mediated apoptosis in human glioblastoma cells in association with bcl-2 and bcl-xL. J Neurosurg. 1998;88:884–889.[Medline] [Order article via Infotrieve]

18. Zamzami N, Brenner C, Marzo T, Susin SA, Kroemer G. Subcellular and submitochondrial mode of action of Bcl-2-like oncoproteins. Oncogene. 1998;16:2265–2282.[Medline] [Order article via Infotrieve]

19. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 1997;91:231–241.[Medline] [Order article via Infotrieve]

20. Wang L, Ma W, Markovich R, Lee WL, Wang PH. Insulin-like growth factor I modulates induction of apoptotic signaling in H9C2 cardiac muscle cells. Endocrinology. 1998;139:1354–1360.[Abstract/Free Full Text]

21. Jennings RB, Reimer KA. Lethal myocardial ischemic injury. Am J Pathol. 1981;102:241–255.[Medline] [Order article via Infotrieve]

22. Antonsson B, Conti F, Ciavatta A, Montessuit S, Lewis S, Martinou T, Bernasconi L, Bernard A, Mermod JJ, Mazzei G, Maudrell K, Gambale F, Sadoul R, Martinou JC. Inhibition of Bax channel-forming activity by Bcl-2. Science. 1997;277:370–372.[Abstract/Free Full Text]

23. Ishibashi Y, Nishimaki K, Asoh S, Nanbu-Wakao R, Yamada T, Ohta S. Pore formation domain of human pro-apoptotic Bax induces mammalian apoptosis as well as bacterial death without antagonizing anti-apoptotic factors. Biochem Biophys Res Commun. 1998;243:609–616.[Medline] [Order article via Infotrieve]

24. Pastorino JG, Chen ST, Tafani M, Snyder JW, Farber JL. The overexpression of Bax produces cell death upon induction of the mitochondrial permeability transition. J Biol Chem. 1998;273:7770–7775.[Abstract/Free Full Text]

25. Tsukahara H, Gordienko DV, Tonshoff B, Gelato MC, Goligorsky MS. Direct demonstration of insulin-like growth factor-I-induced nitric oxide production by endothelial cells. Kidney Int. 1994;45:598–604.[Medline] [Order article via Infotrieve]

26. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A. 1991;88:4651–4655.[Abstract/Free Full Text]

27. Li Z, Bing OHL, Long X, Robinson KG, Lakatta EG. Increased cardiomyocyte apoptosis during the transition of heart failure in the spontaneously hypertensive rat. Am J Physiol. 1997;272:H2313–H2319.[Abstract/Free Full Text]

28. Kajstura J, Cheng W, Sarangarajan R, Li P, Li B, Nitahara JA, Chapnick S, Reiss K, Olivetti G, Anversa P. Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am J Physiol. 1996;217:H1215–H1228.

29. Long X, Crow MT, Sollott SJ, O'Neill L, Menees DS, de Lourdes Hipolito M, Boluyt MO, Asai T, Lakatta EG. Enhanced expression of p53 and apoptosis induced by blockade of the vacuolar proton ATPase in cardiomyocytes. J Clin Invest. 1998;101:1453–1461.[Medline] [Order article via Infotrieve]

30. Karwatowska-Prokopczuk E, Nordberg JA, Li HL, Engler RL, Gottlieb RA. Effect of vacuolar proton ATPase on pHi, Ca2+, and apoptosis in neonatal cardiomyocytes during metabolic inhibition/recovery. Circ Res. 1998;82:1139–1144.[Abstract/Free Full Text]

31. Kluge A, Zimmermann R, Munkel B, Mohri M, Sack S, Schaper J, Schaper W. Insulin-like growth factor I is involved in inflammation linked angiogenic processes after microembolization in porcine heart. Cardiovasc Res. 1995;29:407–415.[Medline] [Order article via Infotrieve]

32. Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matrix components. Circ Res. 1994;75:23–32.[Abstract/Free Full Text]

33. Dorn GW, Robbins J, Ball N, Walsh RA. Myosin heavy chain regulation and myocyte contractile depression after LV hypertrophy in aortic-banded mice. Am J Physiol. 1994;267:H400–H405.[Abstract/Free Full Text]

34. Lowes BD, Minobe W, Abraham WT, Rizeq MN, Bohlmeyer TJ, Quaife RA, Roden RL, Dutcher DL, Robertson AD, Voelkel NF, Badesch DB, Groves BM, Gilbert EM, Bristow MR. Changes in gene expression in the intact human heart. J Clin Invest. 1997;100:2315–2324.[Medline] [Order article via Infotrieve]

35. Nakao K, Minobe W, Roden R, Bristow MR, Leinwand LA. Myosin heavy chain gene expression in human heart failure. J Clin Invest. 1997;100:2362–2370.[Medline] [Order article via Infotrieve]

36. Ohno M, Takemura G, Ohno A, Misao J, Hayakawa Y, Minatoguchi S, Fujiwara T, Fujiwara H. "Apoptotic" myocytes in infarct area in rabbit hearts may be oncotic myocytes with DNA fragmentation: analysis by immunogold electron microscopy combined with in situ nick end-labeling. Circulation. 1998;98:1422–1430.[Abstract/Free Full Text]

37. Anversa P, Vitali-Mazza L, Visioli O, Marchetti G. Experimental cardiac hypertrophy: a quantitative ultrastructural study in the compensatory stage. J Mol Cell Cardiol. 1971;3:213–227.[Medline] [Order article via Infotrieve]

38. Vitali-Mazza L, Anversa P, Tedeschi F, Mastandrea R, Mavilla V, Visioli O. Ultrastructural basis of acute left ventricular failure from severe acute aortic stenosis in the rabbit. J Mol Cell Cardiol. 1972;4:661–671.[Medline] [Order article via Infotrieve]

39. Majno G, Joris I. Apoptosis, oncosis, and necrosis: an overview of cell death. Am J Pathol. 1995;146:3–15.[Abstract]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
R. J. Hassink, K. B. Pasumarthi, H. Nakajima, M. Rubart, M. H. Soonpaa, A. B. de la Riviere, P. A. Doevendans, and L. J. Field
Cardiomyocyte cell cycle activation improves cardiac function after myocardial infarction
Cardiovasc Res, April 1, 2008; 78(1): 18 - 25.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Ungvari, C. Parrado-Fernandez, A. Csiszar, and R. de Cabo
Mechanisms Underlying Caloric Restriction and Lifespan Regulation: Implications for Vascular Aging
Circ. Res., March 14, 2008; 102(5): 519 - 528.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
H. Soran, N. Younis, P. Currie, J. Silas, I.R. Jones, and G. Gill
Influence of diabetes on the maintenance of sinus rhythm after a successful direct current cardioversion in patients with atrial fibrillation
QJM, March 1, 2008; 101(3): 181 - 187.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. S. Hu, L. K. Landeen, N. Aroonsakool, and W. R. Giles
An analysis of the effects of stretch on IGF-I secretion from rat ventricular fibroblasts
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H677 - H683.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. C. Kaplan, A. P. McGinn, M. N. Pollak, L. H. Kuller, H. D. Strickler, T. E. Rohan, A. R. Cappola, X. Xue, and B. M. Psaty
Association of Total Insulin-Like Growth Factor-I, Insulin-Like Growth Factor Binding Protein-1 (IGFBP-1), and IGFBP-3 Levels with Incident Coronary Events and Ischemic Stroke
J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1319 - 1325.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Vincent, L. Perrone, K. A. Sullivan, C. Backus, A. M. Sastry, C. Lastoskie, and E. L. Feldman
Receptor for Advanced Glycation End Products Activation Injures Primary Sensory Neurons via Oxidative Stress
Endocrinology, February 1, 2007; 148(2): 548 - 558.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. Yazdanpanah, F. A Sayed-Tabatabaei, J. A M J L Janssen, I. Rietveld, A. Hofman, T. Stijnen, H. A P Pols, S. W J Lamberts, J. C M Witteman, and C. M van Duijn
IGF-I gene promoter polymorphism is a predictor of survival after myocardial infarction in patients with type 2 diabetes.
Eur. J. Endocrinol., November 1, 2006; 155(5): 751 - 756.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Bisping, S. Ikeda, S. W. Kong, O. Tarnavski, N. Bodyak, J. R. McMullen, S. Rajagopal, J. K. Son, Q. Ma, Z. Springer, et al.
Gata4 is required for maintenance of postnatal cardiac function and protection from pressure overload-induced heart failure
PNAS, September 26, 2006; 103(39): 14471 - 14476.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Dawn, Y. Guo, A. Rezazadeh, Y. Huang, A. B. Stein, G. Hunt, S. Tiwari, J. Varma, Y. Gu, S. D. Prabhu, et al.
Postinfarct Cytokine Therapy Regenerates Cardiac Tissue and Improves Left Ventricular Function
Circ. Res., April 28, 2006; 98(8): 1098 - 1105.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. Limana, A. Germani, A. Zacheo, J. Kajstura, A. Di Carlo, G. Borsellino, O. Leoni, R. Palumbo, L. Battistini, R. Rastaldo, et al.
Exogenous High-Mobility Group Box 1 Protein Induces Myocardial Regeneration After Infarction via Enhanced Cardiac C-Kit+ Cell Proliferation and Differentiation
Circ. Res., October 14, 2005; 97(8): e73 - e83.
[Abstract] [Full Text] [PDF]


Home page
ANGIOLOGYHome page
Y. Okura, Y. Nakashima, H. Tojo, E. Tashiro, and K. Saku
Valsartan, an Angiotensin II Type-I Receptor Blocker, and Left Ventricular Diastolic Function: A Case Report
Angiology, July 1, 2005; 56(4): 467 - 473.
[Abstract] [PDF]


Home page
Mol. Cell. Biol.Home page
B. C. Harrison, C. R. Roberts, D. B. Hood, M. Sweeney, J. M. Gould, E. W. Bush, and T. A. McKinsey
The CRM1 Nuclear Export Receptor Controls Pathological Cardiac Gene Expression
Mol. Cell. Biol., December 15, 2004; 24(24): 10636 - 10649.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
E. Conti, C. Carrozza, E. Capoluongo, M. Volpe, F. Crea, C. Zuppi, and F. Andreotti
Insulin-Like Growth Factor-1 as a Vascular Protective Factor
Circulation, October 12, 2004; 110(15): 2260 - 2265.
[Full Text] [PDF]


Home page
Endocr. Rev.Home page
Z. Y. Fang, J. B. Prins, and T. H. Marwick
Diabetic Cardiomyopathy: Evidence, Mechanisms, and Therapeutic Implications
Endocr. Rev., August 1, 2004; 25(4): 543 - 567.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. McMullen, T. Shioi, W.-Y. Huang, L. Zhang, O. Tarnavski, E. Bisping, M. Schinke, S. Kong, M. C. Sherwood, J. Brown, et al.
The Insulin-like Growth Factor 1 Receptor Induces Physiological Heart Growth via the Phosphoinositide 3-Kinase(p110{alpha}) Pathway
J. Biol. Chem., February 6, 2004; 279(6): 4782 - 4793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. A. Fortuno, A. Gonzalez, S. Ravassa, B. Lopez, and J. Diez
Clinical implications of apoptosis in hypertensive heart disease
Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1495 - H1506.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. J. Su, C. L. Cioffi, S. Stefansson, N. Mittereder, M. Garay, D. Hreniuk, and G. Liau
Gene therapy vector-mediated expression of insulin-like growth factors protects cardiomyocytes from apoptosis and enhances neovascularization
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1429 - H1440.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. Liu, C. Chin-Chance, E.-J. Lee, and W. L. Lowe Jr.
Activation of Phosphatidylinositol 3-Kinase Contributes to Insulin-Like Growth Factor I-Mediated Inhibition of Pancreatic {beta}-Cell Death
Endocrinology, October 1, 2002; 143(10): 3802 - 3812.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Matsui, L. Li, J. C. Wu, S. A. Cook, T. Nagoshi, M. H. Picard, R. Liao, and A. Rosenzweig
Phenotypic Spectrum Caused by Transgenic Overexpression of Activated Akt in the Heart
J. Biol. Chem., June 14, 2002; 277(25): 22896 - 22901.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Limana, K. Urbanek, S. Chimenti, F. Quaini, A. Leri, J. Kajstura, B. Nadal-Ginard, S. Izumo, and P. Anversa
bcl-2 overexpression promotes myocyte proliferation
PNAS, April 30, 2002; 99(9): 6257 - 6262.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Welch, D. Plank, S. Witt, B. Glascock, E. Schaefer, S. Chimenti, A. M. Andreoli, F. Limana, A. Leri, J. Kajstura, et al.
Cardiac-Specific IGF-1 Expression Attenuates Dilated Cardiomyopathy in Tropomodulin-Overexpressing Transgenic Mice
Circ. Res., April 5, 2002; 90(6): 641 - 648.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
N. WINN, A. PAUL, A. MUSARO, and N. ROSENTHAL
Insulin-like Growth Factor Isoforms in Skeletal Muscle Aging, Regeneration, and Disease
Cold Spring Harb Symp Quant Biol, January 1, 2002; 67(0): 507 - 518.
[Abstract] [PDF]


Home page
HeartHome page
A-A Kotlyar, Z Vered, I Goldberg, P Chouraqui, D Nas, E Fridman, Z Chen-Levy, S Fytlovich, G Sangiorgi, L G Spagnoli, et al.
Insulin-like growth factor I and II preserve myocardial structure in postinfarct swine
Heart, December 1, 2001; 86(6): 693 - 700.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Galderisi, G. Vitale, G. Lupoli, M. Barbieri, G. Varricchio, C. Carella, O. de Divitiis, and G. Paolisso
Inverse Association Between Free Insulin-Like Growth Factor-1 and Isovolumic Relaxation in Arterial Systemic Hypertension
Hypertension, October 1, 2001; 38(4): 840 - 845.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Orlic, J. Kajstura, S. Chimenti, F. Limana, I. Jakoniuk, F. Quaini, B. Nadal-Ginard, D. M. Bodine, A. Leri, and P. Anversa
Mobilized bone marrow cells repair the infarcted heart, improving function and survival
PNAS, August 10, 2001; (2001) 181177898.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Matsui, J. Tao, F. del Monte, K.-H. Lee, L. Li, M. Picard, T. L. Force, T. F. Franke, R. J. Hajjar, and A. Rosenzweig
Akt Activation Preserves Cardiac Function and Prevents Injury After Transient Cardiac Ischemia In Vivo
Circulation, July 17, 2001; 104(3): 330 - 335.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
E. Conti, F. Andreotti, A. Sciahbasi, P. Riccardi, G. Marra, E. Menini, G. Ghirlanda, and A. Maseri
Markedly reduced insulin-like growth factor-1 in the acute phase of myocardial infarction
J. Am. Coll. Cardiol., July 1, 2001; 38(1): 26 - 32.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. M.C. Dixon
Help from within: cardioprotective properties of hepatocyte growth factor
Cardiovasc Res, July 1, 2001; 51(1): 4 - 6.
[Full Text] [PDF]


Home page
DiabetesHome page
J. Kajstura, F. Fiordaliso, A. M. Andreoli, B. Li, S. Chimenti, M. S. Medow, F. Limana, B. Nadal-Ginard, A. Leri, and P. Anversa
IGF-1 Overexpression Inhibits the Development of Diabetic Cardiomyopathy and Angiotensin II-Mediated Oxidative Stress
Diabetes, June 1, 2001; 50(6): 1414 - 1424.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
K. Yamashita, J. Kajstura, D. J. Discher, B. J. Wasserlauf, N. H. Bishopric, P. Anversa, and K. A. Webster
Reperfusion-Activated Akt Kinase Prevents Apoptosis in Transgenic Mouse Hearts Overexpressing Insulin-Like Growth Factor-1
Circ. Res., March 30, 2001; 88(6): 609 - 614.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K.C. Wollert and H. Drexler
Growth hormone and insulin-like growth factor--friends of the infarcted heart?
Eur. Heart J., September 2, 2000; 21(18): 1499 - 1501.
[PDF]


Home page
Am. J. Pathol.Home page
A. Leri, F. Fiordaliso, M. Setoguchi, F. Limana, N. H. Bishopric, J. Kajstura, K. Webster, and P. Anversa
Inhibition of p53 Function Prevents Renin-Angiotensin System Activation and Stretch-Mediated Myocyte Apoptosis
Am. J. Pathol., September 1, 2000; 157(3): 843 - 857.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Anversa
Myocyte Death in the Pathological Heart
Circ. Res., February 4, 2000; 86(2): 121 - 124.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. Guerra, A. Leri, X. Wang, N. Finato, C. Di Loreto, C. A. Beltrami, J. Kajstura, and P. Anversa
Myocyte Death in the Failing Human Heart Is Gender Dependent
Circ. Res., October 29, 1999; 85(9): 856 - 866.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Orlic, J. Kajstura, S. Chimenti, F. Limana, I. Jakoniuk, F. Quaini, B. Nadal-Ginard, D. M. Bodine, A. Leri, and P. Anversa
Mobilized bone marrow cells repair the infarcted heart, improving function and survival
PNAS, August 28, 2001; 98(18): 10344 - 10349.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Welch, D. Plank, S. Witt, B. Glascock, E. Schaefer, S. Chimenti, A. M. Andreoli, F. Limana, A. Leri, J. Kajstura, et al.
Cardiac-Specific IGF-1 Expression Attenuates Dilated Cardiomyopathy in Tropomodulin-Overexpressing Transgenic Mice
Circ. Res., April 5, 2002; 90(6): 641 - 648.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Anversa, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Anversa, P.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Apoptosis
Right arrow Genetically altered mice
Right arrow Ischemic biology - basic studies