This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wung, B. S. Articles by Wang, D. L. Search for Related Content PubMed PubMed Citation Articles by Wung, B. S. Articles by Wang, D. L. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB HYDROGEN PEROXIDE Related Collections Cell signalling/signal transduction Gene expression Endothelium/vascular type/nitric oxide

(Circulation Research. 1999;84:804-812.)
© 1999 American Heart Association, Inc.

Original Contribution

Modulation of Ras/Raf/Extracellular Signal–Regulated Kinase Pathway by Reactive Oxygen Species Is Involved in Cyclic Strain–Induced Early Growth Response-1 Gene Expression in Endothelial Cells

B. S. Wung, J. J. Cheng, Y. J. Chao, H. J. Hsieh, D. L. Wang

From the Cardiovascular Division (B.S.W., J.J.C., Y.J.C., D.L.W.), Institute of Biomedical Sciences, Academia Sinica, and Department of Chemical Engineering (H.J.H.), National Taiwan University, Taipei, Taiwan, ROC.

Correspondence to Dr D.L. Wang, Cardiovascular Division, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, ROC. E-mail lingwang{at}ibms.sinica.edu.tw

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—Endothelial cells (ECs) exposed to cyclic strain induce gene expression. To elucidate the signaling mechanisms involved, we studied the effects of cyclic strain on ECs by using early growth response-1 (Egr-1) as a target gene. Cyclic strain induced a transient increase of Egr-1 mRNA levels that resulted in an increase of binding of nuclear proteins to the Egr-1 binding sequences in the platelet-derived growth factor-A promoter region. ECs subjected to strain enhanced Egr-1 transcription as revealed by promoter activities. Catalase pretreatment inhibited this induction. ECs, transfected with a dominant positive mutant of Ras (RasL61), increased Egr-1 promoter activities. In contrast, transfection with a dominant negative mutant of Ras (RasN17) attenuated this strain inducibility. ECs transfected with a dominant negative mutant of Raf-1 (Raf301) or the catalytically inactive mutant of extracellular signal–regulated kinase (ERK)-2 (mERK2) diminished strain-induced promoter activities. However, little effect on strain inducibility was observed in ECs transfected with a dominant negative mutant of Rac (RacN17) or a catalytically inactive mutant of JNK (JNK[K-R]). Consistently, strain-induced Egr-1 expression was inhibited after ECs were treated with a specific inhibitor (PD98059) to mitogen-activated protein kinase kinase. Moreover, strain to ECs induced mitogen-activated protein kinase/ERK activity. The activation of the ERK pathway was further substantiated by an increase of strain-induced transcriptional activity of Elk1, an ERK substrate. This strain-induced ERK activity was attenuated after ECs were treated with N-acetylcysteine or catalase. Consequently, this Egr-1 gene induction was abolished after ECs were treated with N-acetylcysteine or catalase. Deletion analyses of the promoter region (–698 bp) indicated that cyclic strain and H₂O₂ shared a common serum response element. Our data clearly indicate that cyclic strain–induced Egr-1 expression is mediated mainly via the Ras/Raf-1/ERK pathway and that strain-induced reactive oxygen species can modulate Egr-1 expression at least partially via this signaling pathway.

Key Words: endothelial cell • cyclic strain • Egr-1 • ERK signaling pathway • reactive oxygen species

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Vascular endothelial cells (ECs) play an important role in maintaining vessel integrity. Injuries or disturbance of ECs contributes to pathogenesis of various cardiovascular disorders, including atherosclerosis. Focal deposition of low-density lipoproteins and atherosclerotic lesions in the regions of disturbed flow suggest that hemodynamics play an important role during atherogenesis. Although hemodynamic effects have been intensively studied,¹ the role of hemodynamics in pathological events is still not fully understood. It is clear that hemodynamic forces, including flow-induced shear stress and pressure-induced cyclic strain, can modulate the expression of various genes in ECs.^{1 2} However, the intracellular signaling mechanisms of cellular response to hemodynamic forces remain largely unclear. Studies have demonstrated that intracellular signals, including calcium influx³ and protein kinase C and G protein activation,^{4 5} are involved in shear-induced endothelial responses. Recent studies further demonstrate that signaling pathway mitogen-activated protein kinase (MAPK)/extracellular signal–regulated kinase (ERK)-1/ERK2 is activated by shear stress.⁶ However, studies by Li et al⁷ indicate that shear stress primarily activates the Ras/JNK pathway in inducing endothelial gene expression. Thus, the detailed mechanisms particularly regarding the synergism or cross-talk among different signaling pathways in hemodynamic-treated ECs remain unclear.

Early growth response-1 (Egr-1), a transcription factor and an immediate-early gene, has been suggested to be involved in the regulation of gene expression of platelet-derived growth factor (PDGF), tissue factor, and the intercellular adhesion molecule-1 (ICAM-1).^{8 9 10 11 12 13} These genes that are known to be involved in atherosclerosis are also sensitive to hemodynamic force.^{14 15 16 17 18 19} Egr-1 encodes a serum-inducible zinc finger nuclear phosphoprotein that is capable of competing with Sp-1 to bind to GC-rich sequences in the promoter region for gene induction in cells exposed to various stimuli, including growth factors and oxidative agents.^{11 12 13 20 21 22} Thus, Egr-1 plays an important role in the modulation of vascular physiology and function.^{11 13} Because Egr-1 can be induced under oxidative stress and is involved in subsequent gene expression, Egr-1 induction is very important in determining endothelial responses under hemodynamic conditions. In the present study, we have demonstrated that cyclic strain to bovine ECs induces Egr-1 expression, and this induction is mediated via the Ras/Raf-1/ERK pathway. Our study thus confirms that cyclic strain to ECs can activate signaling mechanisms that result in the change of gene expression.

Reactive oxygen species (ROS), including superoxide, H₂O₂, and hydroxyl radicals, are believed to be potentially cytotoxic to cells. Excess ROS will induce oxidative stress to cells possibly through the synergetic effects of calcium mobilization and activation of protein kinase C and adenyl cyclase.^{23 24 25} However, recent studies suggest that a modest increase of intracellular ROS may modulate signal transduction.^{26 27 28 29} ROS have been demonstrated to be involved in growth factor–induced or cytokine-induced gene expression.^{26 27 28 29} Further studies have indicated that signaling transduction pathways, including Ras and mitogen-activated protein kinase (MAPK), can be activated by ROS generated in cells after various stimuli.^{30 31 32 33} Recent findings indicate that shear flow can induce several redox-sensitive genes, including cyclooxygenase-2, nitric oxide synthase, manganese, and Cu/Zn superoxide dismutase in ECs.^{34 35} Our previous reports demonstrated that an increase of intracellular ROS levels could modulate shear- or strain-induced expression of monocyte chemotactic protein-1 (MCP-1) and ICAM-1 and the release of plasminogen activator inhibitor-1.^{36 37 38 39} We also illustrated that strain-induced MCP-1 expression was a result of increased activator protein-1 binding by ROS generated during strain.³⁶ The present study further demonstrates that strain-induced ROS are involved in the modulation of cyclic strain-induced Ras/Raf-1/ERK activity and thus affect gene expression.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials
The Egr-1 cDNA probe was a gift from J.J. Shyy (University of California at San Diego). The catalytically inactive mutant of ERK2 (mERK2) was a gift from R.J. Davis (University of Massachusetts Medical School, Worcester, Mass). RasN17, RasL61, Raf301, JNK(K-R), and RacN17 were previously described.^{40 41 42} An Elk1 trans-reporting system was purchased from Stratagene Ltd. 18S cDNA probe was obtained from American Type Culture Collection. All other chemicals of reagent grade were obtained from Sigma.

EC Cultures
Bovine aortic ECs (BAECs) were cultured in DMEM supplemented with 10% FCS (GIBCO-BRL), 100 U of penicillin/mL, and 100 µg of streptomycin/mL as described.³⁶ BAECs (2x10⁵ cells per well) at no more than 15 passages were seeded on the flexible membrane base of a culture well (Flex 1, Flexcell Co) and grown for 2 more days until the monolayer became confluent. The medium of the cultured ECs was then changed with medium that was identical except that it contained only 0.5% FCS, and the cells were incubated 24 hours before the experiment.

In Vitro Cyclic Strain on Cultured ECs
The strain unit Flexcell FX-2000 (Flexcell), which has been previously described,^{43 44} consists of a vacuum unit linked to a valve controlled by a computer program. The flexible membrane supporting the cultured cells was deformed by sinusoidal negative pressure with a peak level of –20 kPa, which produces a strain on cells ranging from minimal strain at the center of the membrane to a peak value of 25% at the periphery (maximal strain, 25%; average strain, 12%), at a frequency of 1 Hz (60 cycles/min) for various intervals. After the strain experiment, the total RNA from the strained cells was collected for Northern blot analysis.

RNA Isolation and Northern Blot Analysis
Total RNA was isolated from the ECs by the guanidinium isothiocyanate/phenol-chloroform method.⁴³ RNA (10 µg per lane) was separated by electrophoresis on a 1.2% agarose formaldehyde gel and transferred onto a nylon membrane (Nytran, Schleicher & Schuell Inc) by a vacuum blotting system (VacuGene XL, Pharmacia). After hybridizing with the ³²P-labeled cDNA probes, the membrane was washed with 1x SSC containing 1% SDS at room temperature for 30 minutes and then exposed to x-ray film (Kodak X-Omat-AR) at –70°C. Autoradiographic results were scanned and analyzed using a densitometer (Computing Densitometer 300S, Molecular Dynamics).

Electrophoretic Mobility Shift Assay (EMSA)
To prepare nuclear protein extracts, ECs were washed with cold PBS and then immediately removed by scraping in PBS. After centrifugation of the cell suspension at 2000 rpm, the cell pellets were resuspended in cold buffer A containing (in mmol/L) KCl 10, EDTA 0.1, DTT 1, and phenylmethylsulfonyl fluoride (PMSF) 1 for 15 minutes. The cells were lysed by adding 10% NP-40 and then centrifuged at 6000 rpm to obtain a pellet of nuclei. The nuclei pellets were resuspended in cold buffer B containing (in mmol/L) HEPES 20, EDTA 1, DTT 1, and PMSF 1, as well as 0.4 mol/L NaCl; vigorously agitated from time to time; and then centrifuged. The supernatant containing the nuclear proteins was used for the EMSA or stored at –70°C until used.

Double-stranded oligonucleotides (30 bp) containing the Egr-1 binding site in the proximal region of the PDGF-A promoter was prepared as described.^{11 12 13} The oligonucleotides were end labeled with [-³²P]ATP. Extracted nuclear proteins (10 µg) were incubated with 0.1 ng of ³²P-labeled DNA for 15 minutes at room temperature in 25 µL of binding buffer containing 1 µg poly(dI-dC). In an antibody supershift assay, anti-Egr-1 antibody (1 µg, Santa Cruz Biotechnology) was incubated with the mixture for 10 minutes at room temperature before the addition of the labeled probe. The mixtures were electrophoresed on 4% nondenaturing polyacrylamide gels under high ionic strength. Gels were dried and imaged by autoradiography.

Egr-1 Reporter Gene Constructs
Two oligonucleotide primers (CAGCCGCTCCTCCCCCGCAC) and (GCTGGATCTCTCGCGACTCCC) were designed on the basis of the human Egr-1 promoter sequence.⁴⁵ Primers were applied into a polymerase chain reaction (PCR) by using Taq polymerase with normal human genomic DNA as template. The PCR product of 720 bp, beginning with the –698 nucleotide of the transcription initiation site, was subcloned into the TA cloning PCR II vector (Invitrogen). The clone was then digested with KpnI/XhoI for an orientation check and then subcloned into the KpnI/XhoI sites of the luciferase reporter gene vector PGL2-basic (Promega) to construct egr698Luc. egr231Luc was constructed by SacI/BglII digestion of egr698Luc and subcloned into PGL2. The deletion constructs egr120Luc and egr93Luc were made by PCR with designed restriction sites in primers corresponding with the egr698Luc sequence.

DNA Plasmids, Transfection, and Luciferase Assay
An Elk1 transduction pathway–reporting system obtained from Stratagene (catalog No. 219005, Stratagene) contains plasmids GAL4/Elk1-(307–428) and GAL4-Luc. GAL4/Elk1-(307–428) encodes the fusion protein of the GAL4 DNA-binding domain fused to the activation domain of Elk1. GAL4-Luc is a chimeric construct consisting of 5 copies of the GAL4-binding sequences and the luciferase reporter. DNA transfection and luciferase assay were performed as previously described.³⁶ Briefly, DNA plasmids were transfected into BAECs at their 60% confluence level by using the lipofectamine method (GIBCO-BRL). The pSV-ß-galatosidase plasmid was cotransfected to normalize the transfection efficiency. After transfection, cells were incubated overnight to reach confluence. The cells were seeded on flexible membranes for cyclic strain. Luciferase activity was measured with the cell extract by using the Biotec assay system (Promega). Each reading was recorded as a single photon count by using a microplate scintillation counter (Topcount, Packard Instrument Co). ß-Galactosidase activity was assayed by adding the substrate o-nitrophenyl-ß-D-galactopyranoside to 20 µL of cell lysate and incubated at 37°C before recording at 420 nm.

MAPK/ERK Assay
MAPK/ERK activity was assayed according to the method previously described,⁷ with minor modification. Briefly, after treatments, ECs were lysed with buffer containing 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and a mixture of protease inhibitors (PMSF, aprotinin, and sodium orthovanadate). Cells were disrupted by repeated aspiration through a 21-gauge needle. After removing cellular debris, supernatants were assayed for protein concentration. An equal amount of protein from each sample was incubated with anti-MAPK antibody (Santa Cruz Biotechnology) for 2 hours at 4°C with gentle shaking. The immune complex was then incubated with protein A/G agarose for 1 hour. After centrifugation and washing, this agarose-bound immune complex was incubated with kinase reaction buffer containing myelin basic protein (MBP). The kinase reaction was carried out for 20 minutes at 30°C in buffer containing 0.3 g/L MBP, 50 µmol/L ATP, and 1 µCi [-³²P]ATP. The reaction was stopped by adding an equal volume of sample buffer containing SDS and boiling for 3 minutes. The samples were electrophoresed on a 15% polyacrylamide gel. After drying, the gel was exposed to x-ray film.

Statistical Analysis
Statistical analyses were performed with the Student t test for experiments consisting of 2 groups only and with ANOVA for experiments consisting of more than 2 groups. Data were presented as mean±SEM. Statistical significance was defined as P<0.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cyclic Strain–Induced Egr-1 Expression Resulted in an Increase of Its Binding to the Promoter region of PDGF-A
ECs cultured on flexible membrane bases were subjected to cyclic strain. Strained ECs rapidly increased their Egr-1 mRNA levels in a time-dependent manner (Figure 1A). This increase reached its maximum within 1 hour followed by a decline but with the level still elevated at 2 hours after strain treatment. To elucidate the functional role of this strain-induced Egr-1 expression, we further investigated whether this increased Egr-1 expression would result in an increase of binding of nuclear proteins to the proximal region of the PDGF-A promoter. The promoter region of PDGF-A consists of multiple Egr-1 binding sites, and the increase of this binding enhances PDGF-A gene expression.^{11 12 13} We used this Egr-1 binding sequence for EMSAs. When nuclear proteins extracted from ECs after strain for 1 or 3 hours were incubated with an oligonucleotide corresponding to this Egr-1 binding sequence, an increased binding activity was observed (Figure 1B). This binding was specific to Egr-1, because this binding could be abolished by coincubation with 100-fold unlabeled oligonucleotide. This specificity was further substantiated by observed supershifting in the electrophoretic mobility of the Egr-1–oligonucleotide complex after preincubation of nuclear proteins with Egr-1 antibody. These results indicate that cyclic strain can induce Egr-1 protein that subsequently results in an induction of later genes, including PDGF-A, that contain the Egr-1 binding sequence in their promoter region.

View larger version (42K): [in this window] [in a new window]   Figure 1. Cyclic strain induced Egr-1 gene expression and an increase of Egr-1 binding to the PDGF-A promoter region. A, ECs were in unstrained control conditions (C) or were subjected to cyclic strain for 30 (S30'), 60 (S60'), and 120 (S120') minutes. Total RNA was analyzed for Egr-1 levels by Northern blot hybridization with 32P-labeled Egr-1 probe. 18 S indicates 10 µg of RNA applied to each lane. Data are representative of duplicate experiments. B, ECs were in static condition (C) or were treated with cyclic strain for 1 hour (S1) or 3 hours (S3) or were exposed to PMA for 1 hour (PMA). Total nuclear extracts were prepared and analyzed by EMSA using a 32P-labeled oligonucleotide probe containing multiple Egr-1 binding sites corresponding to the PDGF-A promoter region. The specificity of the retarded complexes (Egr-1) was assessed by preincubating the nuclear extracts either with excess unlabeled oligonucleotides containing Egr-1 binding sequences as competitors (C+100x and S3+100x) or with antibody to Egr-1 (S3+Ab). EMSA from nuclear extracts preincubated with Egr-1 antibody (1 µg, S3+Ab) shows a supershift band (S). 32P-labeled oligonucleotide probe incubated with reaction buffer only was used as a blank control (B). Results are representative of duplicate experiments with similar results.

Cyclic Strain–Induced Egr-1 Gene Expression Is a Transcriptional Event
In an attempt to elucidate the molecular mechanisms of strain-induced Egr-1 expression, we examined the promoter activity of Egr-1 by using egr698Luc, which contains the nucleotide –698 to +22 of the human Egr-1 promoter. ECs were transiently transfected with egr698Luc and then subjected to cyclic strain before luciferase assay. Cyclic strain to ECs showed a marked increase in luciferase activity, similar to those cells treated with oxidant agents (ie, H₂O₂, phorbol 12-myristate 13-acetate [PMA], or sodium arsenite) (Figure 2). This strain inducibility of Egr-1 promoter activity, however, was significantly attenuated in ECs pretreated with catalase. This result suggests that strain-induced Egr-1 expression is a transcriptional event and that strain-induced ROS levels are involved in this Egr-1 gene induction.

View larger version (27K): [in this window] [in a new window]   Figure 2. Cyclic strain–induced Egr-1 promoter activities in ECs similar to those of ECs treated with H2O2, PMA, or arsenite. ECs were cotransfected with an Egr-1 promoter construct (e698Luc) and pSV-ß-galactosidase plasmid by the lipofectamine method as previously described.26 Transfected ECs were then subjected to treatment with H2O2 (100 µmol/L), PMA (100 µg/L), sodium arsenite (20 µmol/L), or cyclic strain for 12 hours. Some ECs were pretreated with catalase (CAT, 5x105 U/L) before strain treatment. Luciferase activities were measured and normalized to ß-galactosidase activity for transfection efficiency. Results are shown as folds of induction of reporter luciferase activities from experimental groups compared with those of untreated controls. Results are shown as mean±SEM from at least 3 separate experiments. *P<0.05 vs untreated ECs. #P<0.05 vs strained ECs.

Ras Mediates Cyclic Strain–Induced Egr-1 Transcription
To elucidate the signaling pathways involved in cyclic strain–induced Egr-1 expression, we first sought to determine whether Ras was involved in this Egr-1 induction. We cotransfected Egr-1 promoter/Luc reporter genes with either Ras-positive (RasL61) or Ras-negative (RasN17) mutants into ECs. ECs cotransfected with RasL61 increased their promoter activities in a dose-dependent manner, whereas the nonpromoter vector (PGL2) was unable to elicit this response (Figure 3A). In contrast, when the ECs were cotransfected with RasL61 and RasN17, the increased promoter activities were significantly reduced. To further confirm that Ras is involved in the signaling pathway for cyclic strain–treated cells, ECs were transfected with negative mutant RasN17. As shown in Figure 3B, RasN17 attenuated cyclic strain–induced Egr-1 promoter activities. Interestingly, ECs treated with H₂O₂ showed a similar induction of Egr-1 promoter activity, and this induction could be inhibited with RasN17. These results indicate that cyclic strain–induced Egr-1 promoter activity is mediated via the signaling molecule Ras, and H₂O₂ appears to exert its effect on ECs via the same or a similar signaling molecule.

View larger version (23K): [in this window] [in a new window]   Figure 3. Ras mediates Egr-1 promoter activities induced by cyclic strain and H2O2. A, Nonpromoter vector PGL2 or chimeric construct e698Luc cotransfected with an expression plasmid encoding RasL61 and/or RasN17 into BAECs in a tissue culture plate. Total amount of plasmids for each transfection was 3 µg (ie, total RasL61 plasmid varied from 0.5 to 2 µg). *P<0.05 vs ECs cotransfected with 2 µg of RasL61 and PGL2. #P<0.05 vs ECs transfected with RasL61 (2 µg) only. B, BAECs cotransfected with e698Luc (2 µg) and 1 µg of RasN17 or empty vector PSR were seeded on a flexible membrane for H2O2 or strain treatment. Relative luciferase activities represent the fold induction of reporter luciferase activities from strain- or H2O2-treated groups compared with those of PSR-only–transfected cells. *P<0.05 and #P<0.05 vs respective controls. Results are shown as mean±SEM from at least 3 separate experiments.

Cyclic Strain–Induced Egr-1 Expression Is Mediated via the Ras/Raf-1/ERK–Dependent Signaling Pathway
We further investigated the downstream of Ras-dependent signaling pathways attributed to strain-induced Egr-1 expression. When cells are exposed to various stimuli, Ras/Raf-1/ERK, Ras/Rac/JNK, or both signaling pathways are activated,^{46 47 48} leading to the activation of downstream transcriptional factors, including activator protein-1 and ternary complex factors (TCF). To determine the signaling pathways triggered by cyclic strain, we cotransfected the ECs with various dominant negative mutants (ie, Ras [RasN17], Raf [Raf301], or ERK2 [mERK2]) that are associated with the Ras/Raf/ERK pathway to check their effects on strain-induced Egr-1 promoter activity. As shown in Figure 4A, in contrast to the noninhibition in ECs cotransfected with empty vector control PSR, the cells transfected with RasN17, Raf301, or mERK2 had significant inhibition on Egr-1 promoter activity. Furthermore, when ECs were cotransfected with the dominant negative mutant of Rac (RacN17) or the catalytically inactive mutant JNK (JNK[K-R]) that corresponds to the Ras/Rac/JNK pathway, the strain inducibility of RacN17- and JNK(K-R)-transfected cells was either not effected or only minimally effected. To further confirm that the Ras/Raf/ERK pathway is involved in strain-induced Egr-1 expression, we pretreated ECs with an inhibitor to MAPK kinase (MEK) (ie, PD98059), followed by strain or H₂O₂ treatment. As shown in Figure 4B, those ECs pretreated with PD98059 were significantly inhibited in their strain- or H₂O₂-induced Egr-1 expression. Since ERK1/ERK2 increases the transcriptional activity of Elk1 by phosphorylation,⁴⁶ we investigated whether cyclic strain can elicit the transcriptional activity of Elk1. To demonstrate Elk1 activity, plasmid GAL4/Elk1 (307–428), which encodes the fusion protein of the GAL4/DNA–binding domain fused to the activation domain of Elk1, was cotransfected with GAL4-Luc, a chimeric construct consisting of 5 copies of the GAL4-binding sequences and the luciferase reporter, into ECs followed by cyclic strain treatment. As shown in Figure 5, the Elk1 transcriptional activities were significantly increased in the strained ECs, and those cells cotransfected with an upstream kinase MEK1 expression vector (pFC-MEK1). However, in ECs transfected with only the nonactivation Elk1 domain plasmid (pFC-dbd), there was no inducibility. These results clearly demonstrate that cyclic strain to ECs increases the transcriptional activity of Elk1. To further support this notion regarding the strain-induced ERK signaling pathway, we examined the ERK1/ERK2 kinase activity in strained ECs. As shown in Figure 6, ECs rapidly increased their ERK kinase activity within 5 minutes, which was followed by a decline but with the level still elevated 2 hours after strain treatment. In agreement with earlier results, when strained ECs were pretreated with an antioxidant, N-acetylcysteine (NAC) or catalase, this strain-induced ERK kinase activity was inhibited (Figure 6). Taken together, these results indicate that cyclic strain–induced Egr-1 expression is mainly mediated via the Ras/Raf-1/ERK pathway, and the strain-induced ROS appear to modulate this signaling pathway.

View larger version (17K): [in this window] [in a new window]   Figure 4. Ras/Raf-1/ERK signaling pathway is involved in cyclic strain–induced Egr-1 gene expression. A, Chimeric construct e698Luc was cotransfected into BAECs with either empty control PSR or plasmids encoding the dominant negative mutant RasN17, Raf301, mERK, RacN17, or JNK(K-R). Transfected ECs were then seeded onto a flexible membrane for cyclic strain treatment followed by luciferase assays. Induction was measured as the normalized luciferase activities in the experimental cells relative to those in the static controls. Results are shown as mean±SEM from at least 3 separate experiments. *P<0.05 vs empty control PSR. B, ECs were in untreated control conditions (C), subjected to cyclic strain (S), or treated with H2O2 (100 µmol/L) for 60 minutes. In some experiments, ECs were pretreated with PD98059 (20 µmol/L) for 30 minutes followed by strain or H2O2 treatment. Total RNA was analyzed for Egr-1 levels by Northern blot hybridization with 32P-labeled Egr-1 probe. 18 S indicates 10 µg of RNA applied to each lane. Data are representative of duplicate experiments.

View larger version (17K): [in this window] [in a new window]   Figure 5. Cyclic strain induces transcriptional activity of Elk1. Plasmid GAL4/Elk1 or pFC-dbd was cotransfected with GAL4-luc into ECs in a tissue culture plate. The transfected cells were then subcultured onto a flexible membrane and either subjected to cyclic strain for 12 hours or kept as static controls, followed by luciferase activity assays. Luciferase activities were normalized for transfection efficiency based on ß-galactosidase activity. Plasmid pFC-MEK1, an Elk1 upstream kinase MEK1 expression vector, and plasmid pFC-dbd, which contains the nonactivation domain of Elk1, were used as positive and negative controls, respectively. Results are presented as fold induction in luciferase activities as compared with those cells transfected with pFC-dbd only. Results are shown as mean±SEM from at least 3 separate experiments. *P<0.05 vs static control cells.

View larger version (27K): [in this window] [in a new window]   Figure 6. Cyclic strain induces ERK activities that can be attenuated by antioxidant pretreatment. ECs after strain treatment for 5 minutes (S5') or 2 hours (S2 hours) were lysed and incubated with anti-ERK. ERK was immunoprecipitated, and kinase activity was performed in the presence of MBP and [-32P]ATP. In some experiments, ECs were preincubated with catalase (CAT, 3x105 U/L) or NAC (20 mmol/L) for 1 hour followed by strain treatment. Data are representative of duplicate experiments.

ROS Are Involved in the Cyclic Strain–Induced Egr-1 Expression
We demonstrated earlier that an antioxidant could inhibit strain-induced Egr-1 promoter activity and ERK activation. To confirm that ROS are involved in strain-induced Egr-1 expression, we treated ECs with free radical scavengers and then checked their effects on Egr-1 induction. As shown in Figure 7A, ECs pretreated with either a glutathione precursor, NAC, or catalase abolished strain-induced Egr-1 gene expression. Our previous studies indicated that H₂O₂ and superoxide levels are increased in shear-treated or strain-treated human ECs.^{36 37} To demonstrate the role of ROS in the induction of Egr-1 by cyclic strain, we assessed ROS by adding exogenous H₂O₂ into cultured ECs and analyzing their Egr-1 inducibility. When ECs were exposed to 100 µmol/L H₂O₂ for various time intervals, the Egr-1 mRNA levels of the ECs increased and reached a plateau 1 hour after exposure to H₂O₂ (Figure 7B). ECs treated with PMA, as a positive control, also showed an increase in Egr-1 expression. Taken together, these results indicate that ROS induced by cyclic strain are involved in Egr-1 gene induction.

View larger version (51K): [in this window] [in a new window]   Figure 7. ROS are involved in cyclic strain–induced Egr-1 expression. A, ECs were in unstrained control conditions (C) or subjected to strain (S) for 30 and 60 minutes. In some experiments, ECs were pretreated with either 20 mmol/L NAC (NAC+S60') or 3x105 U/L catalase (CAT+S60') for 1 hour before strain treatment. B, ECs treated with H2O2 (100 µmol/L) for various time intervals. ECs treated with PMA (100 µg/L) for 1 hour. Total RNA was analyzed for Egr-1 levels by Northern blot hybridization with 32P-labeled Egr-1 probe. 18S indicates 10 µg of RNA applied to each lane. Data are representative of duplicate experiments with similar results.

Serum Response Element (SRE) Is a Common Target Sequence for Cyclic Strain and H₂O₂ in the Egr-1 Promoter Region
To elucidate the regulatory mechanisms of transcription that are responsible for cyclic strain– and H₂O₂-induced Egr-1 gene expression, deletion analysis of the Egr-1 promoter was performed to identify cis-acting elements for cyclic strain and H₂O₂. The 698-bp human Egr-1 promoter contains multiple SREs.⁴⁵ ECs treated with either cyclic strain or H₂O₂ significantly increased promoter activities of e698Luc, e231Luc, and e120Luc compared with control nontreated cells. Deletion of 17 bp in the 5' flanking region of e120Luc, which disrupts the proximal single SRE site, diminished not only basal levels but also the inducibility of cyclic strain and H₂O₂ (Figure 8). The above findings indicate that the proximal SRE site in the Egr-1 promoter region is essential for Egr-1 induction in ECs after cyclic strain or H₂O₂ treatment. This indicates that cyclic stain and H₂O₂ share a common target sequence (ie, a SRE site) in the Egr-1 promoter region that is responsible for Egr-1 induction. Our results thus confirm that cyclic strain–induced Egr-1 expression is modulated by increased ROS on the Ras/Raf-1/ERK signaling pathway and subsequently activate Elk1 followed by an increase of SRE binding activity in the Egr-1 promoter region.

View larger version (24K): [in this window] [in a new window]   Figure 8. SRE in the Egr-1 promoter region is functionally responsive to cyclic strain and H2O2. Schematic representation of Egr-1/Luc deletion constructs is shown at the top. SRE is represented with a box in the promoter region. Transfected cells were treated with cyclic strain or 100 µmol/L H2O2 for 12 hours. Relative luciferase activities represent the fold induction of reporter luciferase activities from experimental groups compared with those of untreated controls transfected with e698Luc. Results are shown as mean±SEM from at least 3 separate experiments. *P<0.05 vs respective static controls.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
It is well accepted that 2 major signaling pathways, Ras/Rac/JNK and Ras/Raf/ERK, can be rapidly activated via a phosphorylation cascade in cells exposed to various stimuli, including cytokines and environmental stress such as UV irradiation and heavy metal exposure.⁴⁹ Evidence indicates that the signals involved in cellular responses to growth factors or serum are predominantly mediated through the ERK pathway.^{46 49 50 51} In contrast, cytokines or environmental stress activates the JNK but not the ERK pathway.^{49 51 52 53 54} Our results show that strain-induced promoter activities are mainly inhibited by dominate negative mutants RasN17, Raf301, and mERK2. This Ras/Raf/ERK pathway was further confirmed by the inhibitory effect of PD98059, a specific MEK inhibitor, on strain-induced Egr-1 expression. In addition, an ERK downstream transcription factor, Elk1, is activated by cyclic strain. Our data clearly suggest that the Ras/Raf-1/ERK pathway is the predominant signaling pathway involved in cyclic strain–induced Egr-1 gene expression. Further support of the involvement of this is shown in strain-stimulated ERK kinase activities. Our results are consistent with reports of signals involved in endothelial responses to shear stress⁶ and cardiomyocytes under stretching conditions.⁵⁵ Present data indicate that similar signaling pathways are involved in ECs exposed to cyclic strain and growth factors. A previous report by Li et al⁷ indicated that shear-induced MCP-1 expression is mediated predominantly via the Ras/Rac/JNK pathway. The differential activation of MAPK pathways by shear stress and cyclic strain remain unclear. This may be due to the nature of these mechanical forces, in that shear flow produces a constant stress, whereas our strain system provided cyclic changes of pressure to ECs. Shear and strain may therefore produce different responses in terms of signaling pathways. These diverse signaling pathways may result in a substantial difference in gene expression patterns, as cyclic strain produces a sustained elevation of MCP-1² and endothelin-1,⁵⁶ whereas shear stress induces a transient increase in MCP-1⁵⁷ and downregulates endothelin-1.⁵⁸

Recent studies including ours have shown that hemodynamic force can stimulate intracellular ROS production and that these ROS are subsequently involved in the induction of oxidant-sensitive genes such as MCP-1 and ICAM-1^{36 37 38 39 59} in ECs. We have previously used human umbilical vein ECs to demonstrate the induction of ROS including superoxide in ECs under shear³⁷ or strain³⁶ treatment. The present study using BAECs has shown similar results. These findings are in agreement with previous studies indicating that ROS contribute to reperfusion-induced endothelial responses.⁶⁰ Our present study has further demonstrated that this strain-induced ROS can modulate Egr-1 expression through a transcriptional event. Several lines of evidence support our theme. First, strain-induced Egr-1 expression was found in cells treated with either H₂O₂ or phorbol ester that is known to be able to stimulate intracellular ROS levels.¹⁴ Second, strain- or H₂O₂-induced Egr-1 expression was similarly inhibited after ECs were treated with an antioxidant NAC or catalase. Third, strain-induced Egr-1 promoter activities were diminished by antioxidant pretreatment of ECs. Fourth, strain and H₂O₂ appear to act on the same cis-acting element, ie, the serum-response element (SRE), in the promoter region of the Egr-1 gene, given that deletion of this SRE abolishes strain and H₂O₂ inducibility. Fifth, strain and H₂O₂ apparently act similarly on the signaling transduction pathway, given that the dominant negative mutant Ras can abolish both strain and H₂O₂ inducibility on Egr-1 promoter activity. In addition, ECs treated with PD98059 inhibited both strain- and H₂O₂-induced Egr-1 gene expression. Finally, strain-induced MAPK kinase activity was reduced by antioxidant or catalase treatment of strained cells.

Present data indicate that hemodynamic-induced ROS are involved in the modulation of signaling pathways. Changes in the intracellular redox status are thought to trigger cellular signaling molecules, including various protein kinases, phosphatases, and growth factor receptors.^{53 61} Mechanical force may exert its effect by modifying signaling molecules via alteration of the redox status by increasing ROS levels. Under this oxidative modification, the downstream signaling pathway thus serves as a mechanical transduction. Recent data indicate that a small GTPase (Ras) and its downstream MAPK/ERK and JNK are modulated by ROS.^{30 52} The present study strongly suggests that the intracellular redox status and its effects on signaling mechanisms modulate gene expression in ECs under a hemodynamic environment.

It is well documented that intracellular ROS levels are induced when ECs are exposed to various stimuli.¹⁴ However, excess ROS levels may cause oxidative stress to ECs that is believed to contribute to the pathology of atherosclerosis¹⁹ or reperfusion-induced injuries.⁶⁰ The origin of these intracellular ROS, including superoxide, H₂O₂, and hydroxyl radicals, remains unclear. They may derive from several sources, including the mitochondrial electron transport system⁶² and NADPH oxidase.⁶³ In the present study, we used the relatively stable H₂O₂ to assess the effects of ROS on ECs. H₂O₂-induced Egr-1 gene expression was shown to be dose and time dependent. Similar Egr-1 induction was also observed in ECs treated with superoxide generated by the reaction of xanthine oxidase and hypoxanthine (data not shown). Superoxide may exert its effect by directly acting on the cell membrane or indirectly through its conversion to H₂O₂. The induction effect of H₂O₂ on Egr-1 was diminished after ECs were treated with either NAC or catalase. All of these results indicate that H₂O₂ or its related species, superoxide and hydroxyl radicals, may all be in part involved in ROS-induced Egr-1 expression. Because cyclic strain– or H₂O₂-induced Egr-1 expression was inhibited after ECs were treated with antioxidants, cyclic strain is believed to exert its effects in a manner similar to that of H₂O₂. Our previous studies demonstrated that shear stress– or strain-induced expression of genes, including MCP-1, ICAM-1, and c-fos, is attenuated after ECs are treated with antioxidants.^{36 37 38 39 64} This study indicates that Egr-1 expression is also aggravated by strain-induced ROS. Taken together, our results confirm that intracellular ROS levels are induced to modulate gene expression in ECs under a hemodynamic environment.

Induction of Egr-1 has been demonstrated in cells exposed to various stimuli, including phorbol ester, ionizing radiation, inflammation, oxidative agents, and mechanical stretch/relaxation.^{21 22 65 66 67 68} Egr-1 has recently been shown to be an important regulator for gene expression by competing with the transcriptional factor Sp-1 in binding to the GC-rich region in the promoter of several atherosclerosis-associated genes, including tissue factor, PDGF, and ICAM-1.^{8 9 10 11 12 13} Expression of these genes can also be induced by hemodynamic force either through shear stress^{1 69} or cyclic strain.¹⁸ Recently, it was demonstrated that shear-induced Egr-1 plays an important role in transcriptional regulation of the PDGF-A gene in endothelium.^{11 12 13} We used the same Egr-1 binding sequences in the PDGF-A promoter and also demonstrated a specific binding of cyclic strain–induced Egr-1 expression. Thus, cyclic strain not only increases Egr-1 mRNA, but it also increases its functional activity. The promoter region of Egr-1 contains 5 SREs with a CArG box as the core sequence responsible for these ROS effects.²⁷ Consistent with this finding, our deletion constructs and reporter gene assay of the Egr-1 promoter region demonstrated that SRE is a common responsive element for the transcriptional activation of Egr-1 induced by cyclic strain or H₂O₂. A recent finding demonstrated that the transcriptional induction of Egr-1 by an oxygen singlet generated by UV irradiation also requires SRE.²² Our present results are also consistent with our previous findings that ROS induction by shear stress is involved in flow-induced c-fos expression⁶⁴ and that SRE is responsible for c-fos changes when the cellular redox status is altered by H₂O₂.⁵¹ SRE is regulated by the binding of serum response factors and TCF, the transcriptional activities of which are enhanced by their phosphorylation.⁵⁰ Whether the induction of Egr-1 and c-fos transcription is mediated by SRE via a similar phosphorylation cascade remains to be clarified. Nevertheless, our data clearly indicate that cyclic strain–induced Egr-1 gene expression is a transcriptional event that is mediated through the activation of SRE in the Egr-1 promoter region.

In conclusion, present results clearly indicate that cyclic strain to bovine ECs induces Egr-1 gene expression predominantly via the Ras/Raf/ERK pathway and that strain-induced ROS are involved in the modulation of this signaling pathway. Because the intracellular redox status is crucial for Egr-1 expression and Egr-1 expression may trigger the induction of atherosclerosis- or inflammation-related genes, the constant surveillance of intracellular ROS levels by cellular antioxidant capability is thus essential to protect ECs from stimuli that potentially cause oxidative stress.

	Acknowledgments

 
This study was supported in part by Grant NSC 86-2314-B001-004-M26 from the National Science Council, Taiwan, ROC.

Received June 29, 1998; accepted January 20, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Davies PF, Barbee KA, Volin M, Robotewskyj A, Chen J, Joseph L, Griem ML, Wernick MN, Jacobs D, Ploacek DC, DePaola N, Barakat AI. Spatial relationships in early signaling events of flow-mediated endothelial mechanotransduction. Annu Rev Physiol. 1997;59:527–549.[Medline] [Order article via Infotrieve]

2. Wang DL, Wung BS, Shyy YJ, Lin CF, Chao YJ, Usami S, Chien S. Mechanical strain induces monocyte chemotactic protein-1 gene expression in endothelial cells: effects of mechanical strain on monocyte adhesion to endothelial cells. Circ Res. 1995;77:294–302.[Abstract/Free Full Text]

3. Schwarz G, Callewaert G, Droogmans G, Nilius B. Shear stress-induced calcium transients in endothelial cells from human umbilical cord veins. J Physiol (Lond). 1992;458:527–538.[Abstract/Free Full Text]

4. Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on prostacyclin production by cultured human endothelial cells. Science. 1985;227:1477–1479.[Abstract/Free Full Text]

5. Bhagyalakshmi A, Berthiaume F, Reich KM, Frangos JA. Fluid shear stress stimulates membrane phospholipid metabolism in cultured human endothelial cells. J Vasc Res. 1992;29:443–449.[Medline] [Order article via Infotrieve]

6. Takahashi M, Berk BC. Mitogen-activated protein kinase (ERK1/2) activation by shear stress and adhesion in endothelial cells: essential role for a herbimycin-sensitive kinase. J Clin Invest. 1996;98:2623–2631.[Medline] [Order article via Infotrieve]

7. Li YS, Shyy JYJ, Li S, Lee J, Su B, Karin M, Chien S. The Ras-JNK pathway is involved in shear-induced gene expression. Mol Cell Biol. 1996;16:5947–5954.[Abstract]

8. Dey BR, Sukhatme VP, Roberts AB, Sporn MB, Rauscher FJ, Kim SJ. Repression of transforming growth factor bA1 gene by the Wilm tumor suppressor WT1 gene product. Mol Endocrinol. 1994;8:595–620.[Abstract/Free Full Text]

9. Mackman N. Regulation of the tissue factor gene. FASEB J. 1995;9:883–889.[Abstract]

10. Maltzman JS, Carman JA, Monroe JG. Transcriptional regulation of ICAM-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor Erg-1. J Exp Med. 1996;183:1747–1759.[Abstract/Free Full Text]

11. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: a common theme in vascular injury. Science. 1996;271:1427–1431.[Abstract]

12. Khachigian LM, Anderson KR, Halnon NJ, Gimbrone MA Jr, Resnick N, Collins T. Egr-1 is activated in endothelial cells exposed to fluid shear stress and interacts with a novel shear-stress-response element in the PDGF-A chain promoter. Arterioscler Thromb Vasc Biol. 1997;17:2280–2286.[Abstract/Free Full Text]

13. Khachigian LM, Collins T. Inducible expression of Egr-1 dependent genes: a paradigm of transcriptional activation in vascular endothelium. Circ Res. 1997;81:457–461.[Free Full Text]

14. Lander HM. An essential role for free radicals and derived species in signal transduction. FASEB J. 1997;11:118–124.[Abstract]

15. Ohno M, Cooke JP, Dzau VJ, Gibbons GH. Fluid shear stress induces endothelial transforming growth factor beta-1 transcription and production. J Clin Invest. 1995;95:1363–1369.

16. Hsieh HJ, Li NQ, Frangos JA. Shear stress increases endothelial platelet-derived growth factor messenger RNA levels. Am J Physiol. 1991;260:H642–H646.[Abstract/Free Full Text]

17. Lin MC, Almus-Jacobs F, Chen HH, Parry GC, Mackman N, Shyy JY, Chien S. Shear stress induction of the tissue factor gene. J Clin Invest. 1997;99:737–744.[Medline] [Order article via Infotrieve]

18. Cheng JJ, Wung BS, Chao YJ, Wang DL. Cyclic strain enhances adhesion of monocytes to endothelial cells by increasing intercellular adhesion molecule-1 expression. Hypertension. 1996;28:386–391.[Abstract/Free Full Text]

19. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791–804.[Medline] [Order article via Infotrieve]

20. Huang RP, Ngo L, Okamura D, Tucker M, Adamson ED. V-sis induces Egr-1 expression by a pathway mediated by C-Ha-Ras. J Cell Biochem. 1994;56:469–479.[Medline] [Order article via Infotrieve]

21. Nose K, Ohba M. Functional activation of the Erg-1 (early growth response-1) gene by hydrogen peroxide. Biochem J. 1996;316:381–383.

22. Datta R, Taneja N, Sukhatme VP, Qureshi SA, Weichselbaum R, Kufe DW. Reactive oxygen intermediates target CC(A/T)6GG sequences to mediate activation of the early growth response-1 transcription factor gene by ionizing radiation. Proc Natl Acad Sci U S A. 1993;90:2419–2422.[Abstract/Free Full Text]

23. Dreher D, Junod AF. Differential effects of superoxide, hydrogen peroxide and hydroxyl radical on intracellular calcium in human endothelial cells. J Cell Physiol. 1995;162:147–153.[Medline] [Order article via Infotrieve]

24. Tan CM, Xendoyannis S, Feldman RD. Oxidant stress enhances adenylyl cyclase activation. Circ Res. 1995;77:710–717.[Abstract/Free Full Text]

25. Taheer MM, Garcia JG, Natarajan V. Hydroperoxide-induced diacylglycerol formation and protein kinase C activation in vascular endothelial cells. Arch Biochem Biophys. 1993;303:260–266.[Medline] [Order article via Infotrieve]

26. Marui N, Offermann MK, Swerlick R, Kunsch C, Rosen CA, Ahmad M, Alexander RW, Medford RM. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant sensitive mechanism in human vascular endothelial cells. J Clin Invest. 1993;92:1866–1874.

27. Ohba M, Shibanuma M, Kuroki T, Nose K. Production of hydrogen peroxide by transforming growth factor-b71 and its involvement in induction of egr-1 in mouse osteoblastic cells. J Cell Biol. 1994;126:1079–1088.[Abstract/Free Full Text]

28. Sundaresan M, Yu ZX, Ferrans VJ, Irani K, Finkel T. Requirement for generation of H₂O₂ for platelet-derived growth factor signal transduction. Science. 1995;270:296–299.[Abstract/Free Full Text]

29. Lo YYC, Cruz T. Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes. J Biol Chem. 1996;270:11727–11730.[Abstract/Free Full Text]

30. Guyton KZ, Liu Y, Gorospe M, Xu Q, Holbrook NJ. Activation of mitogen-activated protein kinase by H₂O₂. J Biol Chem. 1995;271:4138–4142.[Abstract/Free Full Text]

31. Lander HM. p21 ras as a common signaling target of reactive free radicals and cellular redox stress. J Biol Chem. 1995;270:21195–21198.[Abstract/Free Full Text]

32. Liu Y, Guyton KZ, Gorospe M, Xu Q, Lee JC, Holbrook NJ. Differential activation of ERK, JNK/SAPK and P38/CSBP/RK MAP kinase family members during the cellular response to arsenite. Free Radic Biol Med. 1996;21:771–781.[Medline] [Order article via Infotrieve]

33. Rosette C, Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science. 1996;15:1194–1197.

34. Topper JN, Cai J, Falb D, Gimbrone MA. Identification of vascular endothelial genes differentially responsive to fluid mechanical stimuli: cyclooxygenase-2, manganese superoxide dismutase and endothelial cell nitric oxide synthase are selectively up-regulated by steady laminar shear stress. Proc Natl Acad Sci U S A. 1996;93:10417–10422.[Abstract/Free Full Text]

35. Inoue N, Ramasamy S, Fukai T, Nerem RM, Harrison DG. Shear stress modulates expression of Cu/Zn superoxide dismutase in human aortic endothelial cells. Circ Res. 1996;79:32–37.[Abstract/Free Full Text]

36. Wung BS, Cheng JJ, Shyy YJ, Wang DL. Cyclic strain-induced monocyte chemotactic protein-1 gene expression involves reactive oxygen species activation of AP-1. Circ Res. 1997;81:1–7.[Abstract/Free Full Text]

37. Chiu JJ, Wung BS, Shyy YJ, Hsieh HJ, Wang DL. Reactive oxygen species are involved in the shear stress-induced intercellular adhesion molecule-1 expression in endothelial cells. Arterioscler Thromb Vasc Biol. 1997;17:3570–3577.[Abstract/Free Full Text]

38. Cheng JJ, Wung BS, Chao YJ, Wang DL. Cyclic strain-induced reactive oxygen species involved in ICAM-1 gene induction in endothelial cells. Hypertension. 1998;31:125–130.[Abstract/Free Full Text]

39. Cheng JJ, Chao YJ, Wung BS, Wang DL. Cyclic strain-induced plasminogen activator inhibitor-1 release from endothelial cells involves reactive oxygen species. Biochem Biophys Res Commun. 1996;225:100–105.[Medline] [Order article via Infotrieve]

40. Feig LA, Cooper GM. Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol Cell Biol. 1988;8:3235–3243.[Abstract/Free Full Text]

41. Kolch WG, Heidecker G, Lloyd P, Rapp UR. Raf-1 protein kinase is required for growth of induced NIH/3T3 cells. Nature.. 1991;349:426–428.[Medline] [Order article via Infotrieve]

42. Minden A, Lin A, Claret FX, Abo A, Karin M. Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell. 1995;81:1147–1157.[Medline] [Order article via Infotrieve]

43. Wang DL, Tang CC, Wung BS, Chen HH, Wang JJ. Cyclical strain increases endothelin-1 secretion and gene expression in human endothelial cells. Biochem Biophys Res Commun. 1993;195:1050–1056.[Medline] [Order article via Infotrieve]

44. Wung BS, Cheng JJ, Chao YJ, Lin J, Wang DL. Cyclical strain increases monocyte chemotatic protein-1 secretion in human endothelial cells. Am J Physiol. 1996;39:H1462–H1468.

45. Sakamoto KM, Bardeleben C, Yates KE, Raines MA, Golde DW, Gasson JC. 5' upstream sequence and genomic structure of the human primary response gene, EGR-1/TIS8. Oncogene. 1991;6:867–871.[Medline] [Order article via Infotrieve]

46. Whitmarsh AJ, Shore P, Sharrocks AD, Davis RJ. Integration of MAP kinase signal transduction pathways at the serum response element. Science. 1995;269:403–407.[Abstract/Free Full Text]

47. Cavigelli M, Dolfi F, Claret FX, Karin M. Induction of c-fos expression through JNK-mediated TCF/Elk1 phosphorylation. EMBO J. 1995;14:5957–5964.[Medline] [Order article via Infotrieve]

48. Whitmarsh AJ, Yang SH, Su MSS, Sharrocks AD, Davis RJ. Role of P38 and JNK mitogen-activated protein kinases in the activation of ternary complex factors. Mol Cell Biol. 1997;17:2360–2371.[Abstract]

49. Canman CE, Kastan MB. Signal transduction: three paths to stress relief. Nature. 1996;384:213–214.[Medline] [Order article via Infotrieve]

50. Treisman R. The serum response element. Trends Biochem Sci. 1993;17:423–426.

51. Muller JM, Cahill MA, Rupec RA, Baeuerle PA, Nordheim A. Antioxidants as well as oxidants activate c-fos via Ras-dependent activation of extracellular-signal-regulated kinase 2 and Elk1. Eur J Biochem. 1997;244:45–52.[Medline] [Order article via Infotrieve]

52. Deng T, Karin M. c-Fos transcriptional activity stimulated by H-Ras-activated protein kinase distinct from JNK and ERK. Nature. 1994;371:171–175.[Medline] [Order article via Infotrieve]

53. Cavigelli M, Li WW, Lin A, Su B, Yoshioka K, Karin M. The tumor promoter arsenite stimulates AP-1 activity by inhibiting a JNK phosphatase. EMBO J. 1996;15:6269–6279.[Medline] [Order article via Infotrieve]

54. Lo YYC, Wong JMS, Cruz T. Reactive oxygen species mediate cytokine activation of c-Jun NH₂-terminal kinases. J Biol Chem. 1996;271:15703–15701.[Abstract/Free Full Text]

55. Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima I, Mizuno T, Takano H, Hiroi Y, Ueki K, Tobe K, Kadowaki T, Nagai R, Yazaki Y. Mechanical stress activates protein kinase cascade of phosphorylation in neonatal rat cardiac myocytes. J Clin Invest. 1995;96:438–446.

56. Wang DL, Wung BS, Peng YC, Wang JJ. Mechanical strain increases endothelin-1 gene expression via protein kinase C pathway in human endothelial cells. J Cell Physiol. 1995;163:400–406.[Medline] [Order article via Infotrieve]

57. Shyy YJ, Hsieh HJ, Usami S, Chien S. Fluid shear stress induces a biphasic response of human monocyte chemotactic protein-1 gene expression in vascular endothelium. Proc Natl Acad Sci U S A. 1994;91:4678–4682.[Abstract/Free Full Text]

58. Malek AM, Greene AL, Izumo S. Regulation of endothelin-1 gene by fluid shear stress is transcriptionally mediated and independent of protein kinase C and cAMP. Proc Natl Acad Sci U S A. 1993;90:5999–6003.[Abstract/Free Full Text]

59. Howard AB, Alexander RW, Nerem RM, Griendling KK, Taylor WR. Cyclic train induces an oxidative stress in endothelial cells. Am J Physiol. 1997;272:C421–C427.[Abstract/Free Full Text]

60. Halliwell B, Gutteridge JM. Role of free radicals and catalytic metal ions in human disease: an overview. Methods Enzymol. 1990;186:1–85.[Medline] [Order article via Infotrieve]

61. Sachsenmaier C, Rasler-Pohl A, Zinck R, Nordheim A, Herrlich P, Rahmsdorf HJ. Involvement of growth factor receptors in the mammalian UVC response. Cell. 1994;78:963–972.[Medline] [Order article via Infotrieve]

62. Bovies A. Mitochondrial production of superoxide radical and hydrogen peroxide. Adv Exp Med Biol. 1977;78:67–82.[Medline] [Order article via Infotrieve]

63. Romson JL, Hook BG, Kunkel SL, Abrams GD, Schork A, Bucchesi BR. Reduction of the extent of ischemic myocardial injury by neutrophil depletion in the dog. Circ Res. 1983;67:1016–1023.

64. Hsieh HJ, Cheng CC, Wu ST, Chiu JJ, Wung BS, Wang DL. Increase of reactive oxygen species (ROS) in endothelial cells by shear flow and involvement of ROS in shear-induced c-fos expression. J Cell Physiol. 1998;175:156–162.[Medline] [Order article via Infotrieve]

65. Molnar G, Crozat A, Pardee AB. The immediate-early gene Egr-1 regulates the activity of the thymidine kinase promoter at the G₀-to-G₁ transition of the cell cycle. Mol Cell Biol. 1994;10:1931–1939.

66. Nguyen HQ, Hoffman-Lieberman B, Lieberman DA. The zinc finger transcription factor Egr-1 is essential and restricts for differentiation along the macrophage lineage. Cell. 1993;72:197–209.[Medline] [Order article via Infotrieve]

67. Komuro I., Kaida T, Shibazaki Y, Kurabayashi M, Katoh Y. Stretching cardiac myocytes stimulates protooncogene expression. J Biol Chem. 1990;265:3595–3598.[Abstract/Free Full Text]

68. McMahon SB, Monroe JG. The role of early growth response gene-1 (egr-1) in regulation of the immune response. J Leukoc Biol. 1996;60:159–166.[Abstract]

69. Gimbrone MA, Nagel T, Topper J. Biomechanical activation: an emerging paradigm in endothelial adhesion biology (Perspective Series: Cell Adhesion in Vascular Biology). J Clin Invest. 1997;99:1809–1813.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				W.-x. Liao, L. Feng, H. Zhang, J. Zheng, T. R. Moore, and D.-b. Chen Compartmentalizing VEGF-Induced ERK2/1 Signaling in Placental Artery Endothelial Cell Caveolae: A Paradoxical Role of Caveolin-1 in Placental Angiogenesis in Vitro Mol. Endocrinol., September 1, 2009; 23(9): 1428 - 1444. [Abstract] [Full Text] [PDF]

				M. Ying, C. Tu, H. Ying, Y. Hu, Q. He, and B. Yang MSFTZ, a Flavanone Derivative, Induces Human Hepatoma Cell Apoptosis via a Reactive Oxygen Species- and Caspase-Dependent Mitochondrial Pathway J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 758 - 765. [Abstract] [Full Text] [PDF]

				O. Wang, K. Cai, S. Pang, T. Wang, D. Qi, Q. Zhu, Z. Ni, and Y. Le Mechanisms of Glucose-Induced Expression of Pancreatic-Derived Factor in Pancreatic {beta}-Cells Endocrinology, February 1, 2008; 149(2): 672 - 680. [Abstract] [Full Text] [PDF]

				R. N. Hasan and A. I. Schafer Hemin Upregulates Egr-1 Expression in Vascular Smooth Muscle Cells via Reactive Oxygen Species ERK-1/2 Elk-1 and NF-{kappa}B Circ. Res., January 4, 2008; 102(1): 42 - 50. [Abstract] [Full Text] [PDF]

				J.-J. Chiu, L.-J. Chen, C.-I Lee, P.-L. Lee, D.-Y. Lee, M.-C. Tsai, C.-W. Lin, S. Usami, and S. Chien Mechanisms of induction of endothelial cell E-selectin expression by smooth muscle cells and its inhibition by shear stress Blood, July 15, 2007; 110(2): 519 - 528. [Abstract] [Full Text] [PDF]

				F. Shi, Y.-J. Chiu, Y. Cho, T. A. Bullard, M. Sokabe, and K. Fujiwara Down-regulation of ERK but not MEK phosphorylation in cultured endothelial cells by repeated changes in cyclic stretch Cardiovasc Res, March 1, 2007; 73(4): 813 - 822. [Abstract] [Full Text] [PDF]

				P. M. Cummins, N. von Offenberg Sweeney, M. T. Killeen, Y. A. Birney, E. M. Redmond, and P. A. Cahill Cyclic strain-mediated matrix metalloproteinase regulation within the vascular endothelium: a force to be reckoned with Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H28 - H42. [Abstract] [Full Text] [PDF]

				R. A. Pulver-Kaste, C. A. Barlow, J. Bond, A. Watson, P. L. Penar, B. Tranmer, and K. M. Lounsbury Ca2+ source-dependent transcription of CRE-containing genes in vascular smooth muscle Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H97 - H105. [Abstract] [Full Text] [PDF]

				R. Geracitano, A. Tozzi, N. Berretta, F. Florenzano, E. Guatteo, M. T. Viscomi, B. Chiolo, M. Molinari, G. Bernardi, and N. B Mercuri Protective role of hydrogen peroxide in oxygen-deprived dopaminergic neurones of the rat substantia nigra J. Physiol., October 1, 2005; 568(1): 97 - 110. [Abstract] [Full Text] [PDF]

				H. Cai Hydrogen peroxide regulation of endothelial function: Origins, mechanisms, and consequences Cardiovasc Res, October 1, 2005; 68(1): 26 - 36. [Abstract] [Full Text] [PDF]

				P. J. Boyd, J. Doyle, E. Gee, S. Pallan, and T. L. Haas MAPK signaling regulates endothelial cell assembly into networks and expression of MT1-MMP and MMP-2 Am J Physiol Cell Physiol, March 1, 2005; 288(3): C659 - C668. [Abstract] [Full Text] [PDF]

				Y. J. Wu, L. L. Muldoon, and E. A. Neuwelt The Chemoprotective Agent N-Acetylcysteine Blocks Cisplatin-Induced Apoptosis through Caspase Signaling Pathway J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 424 - 431. [Abstract] [Full Text] [PDF]

				C.-W. Ni, H.-J. Hsieh, Y.-J. Chao, and D. L. Wang Interleukin-6-induced JAK2/STAT3 signaling pathway in endothelial cells is suppressed by hemodynamic flow Am J Physiol Cell Physiol, September 1, 2004; 287(3): C771 - C780. [Abstract] [Full Text] [PDF]

				M. Osawa, S. Itoh, S. Ohta, Q. Huang, B. C. Berk, N.-L. Marmarosh, W. Che, B. Ding, C. Yan, and J.-i. Abe ERK1/2 Associates with the c-Met-binding Domain of Growth Factor Receptor-bound Protein 2 (Grb2)-associated Binder-1 (Gab1): ROLE IN ERK1/2 AND EARLY GROWTH RESPONSE FACTOR-1 (Egr-1) NUCLEAR ACCUMULATION J. Biol. Chem., July 9, 2004; 279(28): 29691 - 29699. [Abstract] [Full Text] [PDF]

				H. Huang, R. D. Kamm, and R. T. Lee Cell mechanics and mechanotransduction: pathways, probes, and physiology Am J Physiol Cell Physiol, July 1, 2004; 287(1): C1 - C11. [Abstract] [Full Text] [PDF]

				R. M. Day, G. Thiel, J. Lum, R. D. Chevere, Y. Yang, J. Stevens, L. Sibert, and B. L. Fanburg Hepatocyte Growth Factor Regulates Angiotensin Converting Enzyme Expression J. Biol. Chem., March 5, 2004; 279(10): 8792 - 8801. [Abstract] [Full Text] [PDF]

				T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF]

				X. Han, P. J. Boyd, S. Colgan, J. A. Madri, and T. L. Haas Transcriptional Up-regulation of Endothelial Cell Matrix Metalloproteinase-2 in Response to Extracellular Cues Involves GATA-2 J. Biol. Chem., November 28, 2003; 278(48): 47785 - 47791. [Abstract] [Full Text] [PDF]

				L. E. Nagy Recent Insights into the Role of the Innate Immune System in the Development of Alcoholic Liver Disease Experimental Biology and Medicine, September 1, 2003; 228(8): 882 - 890. [Abstract] [Full Text] [PDF]

				F. D. Ragione, V. Cucciolla, V. Criniti, S. Indaco, A. Borriello, and V. Zappia p21Cip1 Gene Expression Is Modulated by Egr1: A NOVEL REGULATORY MECHANISM INVOLVED IN THE RESVERATROL ANTIPROLIFERATIVE EFFECT J. Biol. Chem., June 20, 2003; 278(26): 23360 - 23368. [Abstract] [Full Text] [PDF]

				C.-W. Ni, H.-J. Hsieh, Y.-J. Chao, and D. L. Wang Shear Flow Attenuates Serum-induced STAT3 Activation in Endothelial Cells J. Biol. Chem., May 23, 2003; 278(22): 19702 - 19708. [Abstract] [Full Text] [PDF]

				S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells Blood, December 15, 2002; 100(13): 4454 - 4461. [Abstract] [Full Text] [PDF]

				J.-J. Cheng, Y.-J. Chao, and D. L. Wang Cyclic Strain Activates Redox-sensitive Proline-rich Tyrosine Kinase 2 (PYK2) in Endothelial Cells J. Biol. Chem., December 6, 2002; 277(50): 48152 - 48157. [Abstract] [Full Text] [PDF]

				L. Shi, R. Kishore, M. R. McMullen, and L. E. Nagy Chronic Ethanol Increases Lipopolysaccharide-stimulated Egr-1 Expression in RAW 264.7 Macrophages. CONTRIBUTION TO ENHANCED TUMOR NECROSIS FACTOR alpha PRODUCTION J. Biol. Chem., April 19, 2002; 277(17): 14777 - 14785. [Abstract] [Full Text] [PDF]

				B.S. Wung, J.J. Cheng, S.-K. Shyue, and D.L. Wang NO Modulates Monocyte Chemotactic Protein-1 Expression in Endothelial Cells Under Cyclic Strain Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1941 - 1947. [Abstract] [Full Text] [PDF]

				Z. Wei, A. B. Al-Mehdi, and A. B. Fisher Signaling pathway for nitric oxide generation with simulated ischemia in flow-adapted endothelial cells Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2226 - H2232. [Abstract] [Full Text] [PDF]

				L. Guillemot, A. Levy, M. Raymondjean, and B. Rothhut Angiotensin II-induced Transcriptional Activation of the Cyclin D1 Gene Is Mediated by Egr-1 in CHO-AT1A Cells J. Biol. Chem., October 12, 2001; 276(42): 39394 - 39403. [Abstract] [Full Text] [PDF]

				Y.-L. Chang, J.-J. Shen, B.-S. Wung, J.-J. Cheng, and D. L. Wang Chinese Herbal Remedy Wogonin Inhibits Monocyte Chemotactic Protein-1 Gene Expression in Human Endothelial Cells Mol. Pharmacol., September 1, 2001; 60(3): 507 - 513. [Abstract] [Full Text] [PDF]

				B. T. Chen, M. V. Avshalumov, and M. E. Rice H2O2 Is a Novel, Endogenous Modulator of Synaptic Dopamine Release J Neurophysiol, June 1, 2001; 85(6): 2468 - 2476. [Abstract] [Full Text] [PDF]

				M. Morimoto, N. Kume, S. Miyamoto, Y. Ueno, H. Kataoka, M. Minami, K. Hayashida, N. Hashimoto, and T. Kita Lysophosphatidylcholine Induces Early Growth Response Factor-1 Expression and Activates the Core Promoter of PDGF-A Chain in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2001; 21(5): 771 - 776. [Abstract] [Full Text] [PDF]

				H. Kito, E. L. Chen, X. Wang, M. Ikeda, N. Azuma, N. Nakajima, V. Gahtan, and B. E. Sumpio Role of mitogen-activated protein kinases in pulmonary endothelial cells exposed to cyclic strain J Appl Physiol, December 1, 2000; 89(6): 2391 - 2400. [Abstract] [Full Text] [PDF]

				V. J. Thannickal and B. L. Fanburg Reactive oxygen species in cell signaling Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1005 - L1028. [Abstract] [Full Text] [PDF]

				S. Lehoux, B. Esposito, R. Merval, L. Loufrani, and A. Tedgui Pulsatile Stretch-Induced Extracellular Signal-Regulated Kinase 1/2 Activation in Organ Culture of Rabbit Aorta Involves Reactive Oxygen Species Arterioscler Thromb Vasc Biol, November 1, 2000; 20(11): 2366 - 2372. [Abstract] [Full Text] [PDF]

				K. K. Griendling, D. Sorescu, B. Lassegue, and M. Ushio-Fukai Modulation of Protein Kinase Activity and Gene Expression by Reactive Oxygen Species and Their Role in Vascular Physiology and Pathophysiology Arterioscler Thromb Vasc Biol, October 1, 2000; 20(10): 2175 - 2183. [Abstract] [Full Text] [PDF]

				L. Liu, J. C. Tsai, and W. C. Aird Egr-1 gene is induced by the systemic administration of the vascular endothelial growth factor and the epidermal growth factor Blood, September 1, 2000; 96(5): 1772 - 1781. [Abstract] [Full Text] [PDF]

				U. Bayraktutan, L. Blayney, and A. M. Shah Molecular Characterization and Localization of the NAD(P)H Oxidase Components gp91-phox and p22-phox in Endothelial Cells Arterioscler Thromb Vasc Biol, August 1, 2000; 20(8): 1903 - 1911. [Abstract] [Full Text] [PDF]

				M. S. Wolin Interactions of Oxidants With Vascular Signaling Systems Arterioscler Thromb Vasc Biol, June 1, 2000; 20(6): 1430 - 1442. [Abstract] [Full Text] [PDF]

				J. J. Chiu, B. S. Wung, H. J. Hsieh, L. W. Lo, and D. L. Wang Nitric Oxide Regulates Shear Stress–Induced Early Growth Response-1 : Expression via the Extracellular Signal–Regulated Kinase Pathway in Endothelial Cells Circ. Res., August 6, 1999; 85(3): 238 - 246. [Abstract] [Full Text] [PDF]

				J.-J. Cheng, B.-S. Wung, Y.-J. Chao, and D. L. Wang Sequential Activation of Protein Kinase C (PKC)-alpha and PKC-epsilon Contributes to Sustained Raf/ERK1/2 Activation in Endothelial Cells under Mechanical Strain J. Biol. Chem., August 10, 2001; 276(33): 31368 - 31375. [Abstract] [Full Text] [PDF]

				L. Shi, R. Kishore, M. R. McMullen, and L. E. Nagy Lipopolysaccharide stimulation of ERK1/2 increases TNF-alpha production via Egr-1 Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1205 - C1211. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wung, B. S. Articles by Wang, D. L. Search for Related Content PubMed PubMed Citation Articles by Wung, B. S. Articles by Wang, D. L. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB HYDROGEN PEROXIDE Related Collections Cell signalling/signal transduction Gene expression Endothelium/vascular type/nitric oxide