Original Contribution |
From the Cardiovascular Division (B.S.W., J.J.C., Y.J.C., D.L.W.), Institute of Biomedical Sciences, Academia Sinica, and Department of Chemical Engineering (H.J.H.), National Taiwan University, Taipei, Taiwan, ROC.
Correspondence to Dr D.L. Wang, Cardiovascular Division, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, ROC. E-mail lingwang{at}ibms.sinica.edu.tw
| Abstract |
|---|
|
|
|---|
Key Words: endothelial cell cyclic strain Egr-1 ERK signaling pathway reactive oxygen species
| Introduction |
|---|
|
|
|---|
Early growth response-1 (Egr-1), a transcription factor and an immediate-early gene, has been suggested to be involved in the regulation of gene expression of platelet-derived growth factor (PDGF), tissue factor, and the intercellular adhesion molecule-1 (ICAM-1).8 9 10 11 12 13 These genes that are known to be involved in atherosclerosis are also sensitive to hemodynamic force.14 15 16 17 18 19 Egr-1 encodes a serum-inducible zinc finger nuclear phosphoprotein that is capable of competing with Sp-1 to bind to GC-rich sequences in the promoter region for gene induction in cells exposed to various stimuli, including growth factors and oxidative agents.11 12 13 20 21 22 Thus, Egr-1 plays an important role in the modulation of vascular physiology and function.11 13 Because Egr-1 can be induced under oxidative stress and is involved in subsequent gene expression, Egr-1 induction is very important in determining endothelial responses under hemodynamic conditions. In the present study, we have demonstrated that cyclic strain to bovine ECs induces Egr-1 expression, and this induction is mediated via the Ras/Raf-1/ERK pathway. Our study thus confirms that cyclic strain to ECs can activate signaling mechanisms that result in the change of gene expression.
Reactive oxygen species (ROS), including superoxide, H2O2, and hydroxyl radicals, are believed to be potentially cytotoxic to cells. Excess ROS will induce oxidative stress to cells possibly through the synergetic effects of calcium mobilization and activation of protein kinase C and adenyl cyclase.23 24 25 However, recent studies suggest that a modest increase of intracellular ROS may modulate signal transduction.26 27 28 29 ROS have been demonstrated to be involved in growth factorinduced or cytokine-induced gene expression.26 27 28 29 Further studies have indicated that signaling transduction pathways, including Ras and mitogen-activated protein kinase (MAPK), can be activated by ROS generated in cells after various stimuli.30 31 32 33 Recent findings indicate that shear flow can induce several redox-sensitive genes, including cyclooxygenase-2, nitric oxide synthase, manganese, and Cu/Zn superoxide dismutase in ECs.34 35 Our previous reports demonstrated that an increase of intracellular ROS levels could modulate shear- or strain-induced expression of monocyte chemotactic protein-1 (MCP-1) and ICAM-1 and the release of plasminogen activator inhibitor-1.36 37 38 39 We also illustrated that strain-induced MCP-1 expression was a result of increased activator protein-1 binding by ROS generated during strain.36 The present study further demonstrates that strain-induced ROS are involved in the modulation of cyclic strain-induced Ras/Raf-1/ERK activity and thus affect gene expression.
| Materials and Methods |
|---|
|
|
|---|
EC Cultures
Bovine aortic ECs (BAECs) were cultured in DMEM supplemented
with 10% FCS (GIBCO-BRL), 100 U of penicillin/mL, and 100 µg of
streptomycin/mL as described.36 BAECs
(2x105 cells per well) at no more than 15
passages were seeded on the flexible membrane base of a culture well
(Flex 1, Flexcell Co) and grown for 2 more days until the monolayer
became confluent. The medium of the cultured ECs was then changed with
medium that was identical except that it contained only 0.5% FCS, and
the cells were incubated 24 hours before the experiment.
In Vitro Cyclic Strain on Cultured ECs
The strain unit Flexcell FX-2000 (Flexcell), which has been
previously described,43 44 consists of a vacuum unit
linked to a valve controlled by a computer program. The flexible
membrane supporting the cultured cells was deformed by sinusoidal
negative pressure with a peak level of 20 kPa, which produces a
strain on cells ranging from minimal strain at the center of the
membrane to a peak value of 25% at the periphery (maximal strain,
25%; average strain,
12%), at a frequency of 1 Hz (60
cycles/min) for various intervals. After the strain experiment, the
total RNA from the strained cells was collected for Northern blot
analysis.
RNA Isolation and Northern Blot Analysis
Total RNA was isolated from the ECs by the guanidinium
isothiocyanate/phenol-chloroform method.43 RNA (10 µg
per lane) was separated by electrophoresis on a 1.2% agarose
formaldehyde gel and transferred onto a nylon membrane (Nytran,
Schleicher & Schuell Inc) by a vacuum blotting system (VacuGene XL,
Pharmacia). After hybridizing with the
32P-labeled cDNA probes, the membrane was washed
with 1x SSC containing 1% SDS at room temperature for 30 minutes and
then exposed to x-ray film (Kodak X-Omat-AR) at 70°C.
Autoradiographic results were scanned and analyzed
using a densitometer (Computing Densitometer 300S, Molecular
Dynamics).
Electrophoretic Mobility Shift Assay (EMSA)
To prepare nuclear protein extracts, ECs were washed with cold
PBS and then immediately removed by scraping in PBS. After
centrifugation of the cell suspension at 2000 rpm, the
cell pellets were resuspended in cold buffer A containing (in
mmol/L) KCl 10, EDTA 0.1, DTT 1, and phenylmethylsulfonyl
fluoride (PMSF) 1 for 15 minutes. The cells were lysed by
adding 10% NP-40 and then centrifuged at 6000 rpm to obtain a
pellet of nuclei. The nuclei pellets were resuspended in cold buffer B
containing (in mmol/L) HEPES 20, EDTA 1, DTT 1, and PMSF 1, as
well as 0.4 mol/L NaCl; vigorously agitated from time to time; and then
centrifuged. The supernatant containing the nuclear proteins
was used for the EMSA or stored at 70°C until used.
Double-stranded oligonucleotides (30 bp) containing the
Egr-1 binding site in the proximal region of the PDGF-A promoter was
prepared as described.11 12 13 The
oligonucleotides were end labeled with
[
-32P]ATP. Extracted nuclear proteins (10
µg) were incubated with 0.1 ng of 32P-labeled
DNA for 15 minutes at room temperature in 25 µL of binding buffer
containing 1 µg poly(dI-dC). In an antibody supershift assay,
anti-Egr-1 antibody (1 µg, Santa Cruz Biotechnology) was incubated
with the mixture for 10 minutes at room temperature before the addition
of the labeled probe. The mixtures were electrophoresed on 4%
nondenaturing polyacrylamide gels under high ionic strength.
Gels were dried and imaged by autoradiography.
Egr-1 Reporter Gene Constructs
Two oligonucleotide primers
(CAGCCGCTCCTCCCCCGCAC) and (GCTGGATCTCTCGCGACTCCC) were designed on the
basis of the human Egr-1 promoter sequence.45 Primers were
applied into a polymerase chain reaction (PCR) by using Taq polymerase
with normal human genomic DNA as template. The PCR product of 720
bp, beginning with the 698 nucleotide of the
transcription initiation site, was subcloned into the TA cloning PCR II
vector (Invitrogen). The clone was then digested with
KpnI/XhoI for an orientation check and then
subcloned into the KpnI/XhoI sites of the
luciferase reporter gene vector PGL2-basic (Promega) to construct
egr698Luc. egr231Luc was constructed by
SacI/BglII digestion of egr698Luc and subcloned
into PGL2. The deletion constructs egr120Luc and egr93Luc were made by
PCR with designed restriction sites in primers corresponding with the
egr698Luc sequence.
DNA Plasmids, Transfection, and Luciferase Assay
An Elk1 transduction pathwayreporting system obtained from
Stratagene (catalog No. 219005, Stratagene) contains plasmids
GAL4/Elk1-(307428) and GAL4-Luc. GAL4/Elk1-(307428) encodes the
fusion protein of the GAL4 DNA-binding domain fused to the activation
domain of Elk1. GAL4-Luc is a chimeric construct consisting of 5 copies
of the GAL4-binding sequences and the luciferase reporter. DNA
transfection and luciferase assay were performed as previously
described.36 Briefly, DNA plasmids were transfected into
BAECs at their 60% confluence level by using the lipofectamine method
(GIBCO-BRL). The pSV-ß-galatosidase plasmid was cotransfected to
normalize the transfection efficiency. After transfection, cells were
incubated overnight to reach confluence. The cells were seeded on
flexible membranes for cyclic strain. Luciferase activity was measured
with the cell extract by using the Biotec assay system (Promega). Each
reading was recorded as a single photon count by using a microplate
scintillation counter (Topcount, Packard Instrument Co).
ß-Galactosidase activity was assayed by adding the substrate
o-nitrophenyl-ß-D-galactopyranoside
to 20 µL of cell lysate and incubated at 37°C before
recording at 420 nm.
MAPK/ERK Assay
MAPK/ERK activity was assayed according to the method previously
described,7 with minor modification. Briefly, after
treatments, ECs were lysed with buffer containing 1% NP-40, 0.5%
sodium deoxycholate, 0.1% SDS, and a mixture of protease
inhibitors (PMSF, aprotinin, and sodium orthovanadate).
Cells were disrupted by repeated aspiration through a 21-gauge needle.
After removing cellular debris, supernatants were assayed for protein
concentration. An equal amount of protein from each sample was
incubated with anti-MAPK antibody (Santa Cruz Biotechnology) for 2
hours at 4°C with gentle shaking. The immune complex was then
incubated with protein A/G agarose for 1 hour. After
centrifugation and washing, this agarose-bound immune
complex was incubated with kinase reaction buffer containing myelin
basic protein (MBP). The kinase reaction was carried out for 20 minutes
at 30°C in buffer containing 0.3 g/L MBP, 50 µmol/L ATP, and 1
µCi [
-32P]ATP. The reaction was stopped by
adding an equal volume of sample buffer containing SDS and boiling for
3 minutes. The samples were electrophoresed on a 15%
polyacrylamide gel. After drying, the gel was exposed to x-ray
film.
Statistical Analysis
Statistical analyses were performed with the Student
t test for experiments consisting of 2 groups only and with
ANOVA for experiments consisting of more than 2 groups. Data were
presented as mean±SEM. Statistical significance was defined as
P<0.05.
| Results |
|---|
|
|
|---|
|
Cyclic StrainInduced Egr-1 Gene Expression Is a
Transcriptional Event
In an attempt to elucidate the molecular mechanisms of
strain-induced Egr-1 expression, we examined the promoter activity of
Egr-1 by using egr698Luc, which contains the nucleotide
698 to +22 of the human Egr-1 promoter. ECs were transiently
transfected with egr698Luc and then subjected to cyclic strain before
luciferase assay. Cyclic strain to ECs showed a marked increase in
luciferase activity, similar to those cells treated with oxidant agents
(ie, H2O2, phorbol
12-myristate 13-acetate [PMA], or sodium arsenite)
(Figure 2
). This strain inducibility of
Egr-1 promoter activity, however, was significantly attenuated in ECs
pretreated with catalase. This result suggests that strain-induced
Egr-1 expression is a transcriptional event and that strain-induced ROS
levels are involved in this Egr-1 gene induction.
|
Ras Mediates Cyclic StrainInduced Egr-1 Transcription
To elucidate the signaling pathways involved in cyclic
straininduced Egr-1 expression, we first sought to determine whether
Ras was involved in this Egr-1 induction. We cotransfected Egr-1
promoter/Luc reporter genes with either Ras-positive (RasL61) or
Ras-negative (RasN17) mutants into ECs. ECs cotransfected with RasL61
increased their promoter activities in a dose-dependent manner, whereas
the nonpromoter vector (PGL2) was unable to elicit this response
(Figure 3A
). In contrast, when the
ECs were cotransfected with RasL61 and RasN17, the increased promoter
activities were significantly reduced. To further confirm that Ras is
involved in the signaling pathway for cyclic straintreated cells, ECs
were transfected with negative mutant RasN17. As shown in Figure 3B
, RasN17 attenuated cyclic straininduced Egr-1 promoter
activities. Interestingly, ECs treated with
H2O2 showed a similar
induction of Egr-1 promoter activity, and this induction could be
inhibited with RasN17. These results indicate that cyclic
straininduced Egr-1 promoter activity is mediated via the signaling
molecule Ras, and H2O2
appears to exert its effect on ECs via the same or a similar signaling
molecule.
|
Cyclic StrainInduced Egr-1 Expression Is Mediated via the
Ras/Raf-1/ERKDependent Signaling Pathway
We further investigated the downstream of Ras-dependent signaling
pathways attributed to strain-induced Egr-1 expression. When cells are
exposed to various stimuli, Ras/Raf-1/ERK, Ras/Rac/JNK, or both
signaling pathways are activated,46 47 48 leading to
the activation of downstream transcriptional factors, including
activator protein-1 and ternary complex factors
(TCF). To determine the signaling pathways triggered by cyclic
strain, we cotransfected the ECs with various dominant negative mutants
(ie, Ras [RasN17], Raf [Raf301], or ERK2 [mERK2]) that are
associated with the Ras/Raf/ERK pathway to check their effects on
strain-induced Egr-1 promoter activity. As shown in Figure 4A
, in contrast to the noninhibition in
ECs cotransfected with empty vector control PSR
, the cells
transfected with RasN17, Raf301, or mERK2 had significant inhibition on
Egr-1 promoter activity. Furthermore, when ECs were cotransfected with
the dominant negative mutant of Rac (RacN17) or the catalytically
inactive mutant JNK (JNK[K-R]) that corresponds to the Ras/Rac/JNK
pathway, the strain inducibility of RacN17- and JNK(K-R)-transfected
cells was either not effected or only minimally effected. To further
confirm that the Ras/Raf/ERK pathway is involved in strain-induced
Egr-1 expression, we pretreated ECs with an inhibitor to
MAPK kinase (MEK) (ie, PD98059), followed by strain or
H2O2 treatment. As shown in
Figure 4B
, those ECs pretreated with PD98059 were significantly
inhibited in their strain- or
H2O2-induced Egr-1
expression. Since ERK1/ERK2 increases the transcriptional activity of
Elk1 by phosphorylation,46 we investigated
whether cyclic strain can elicit the transcriptional activity of Elk1.
To demonstrate Elk1 activity, plasmid GAL4/Elk1 (307428), which
encodes the fusion protein of the GAL4/DNAbinding domain fused to the
activation domain of Elk1, was cotransfected with GAL4-Luc, a chimeric
construct consisting of 5 copies of the GAL4-binding sequences and the
luciferase reporter, into ECs followed by cyclic strain treatment. As
shown in Figure 5
, the Elk1
transcriptional activities were significantly increased in the strained
ECs, and those cells cotransfected with an upstream kinase MEK1
expression vector (pFC-MEK1). However, in ECs transfected with only the
nonactivation Elk1 domain plasmid (pFC-dbd), there was no inducibility.
These results clearly demonstrate that cyclic strain to ECs increases
the transcriptional activity of Elk1. To further support this notion
regarding the strain-induced ERK signaling pathway, we examined the
ERK1/ERK2 kinase activity in strained ECs. As shown in Figure 6
, ECs rapidly increased their ERK kinase
activity within 5 minutes, which was followed by a decline but with the
level still elevated 2 hours after strain treatment. In agreement with
earlier results, when strained ECs were pretreated with an antioxidant,
N-acetylcysteine (NAC) or catalase, this strain-induced ERK
kinase activity was inhibited (Figure 6
). Taken together, these
results indicate that cyclic straininduced Egr-1 expression is mainly
mediated via the Ras/Raf-1/ERK pathway, and the strain-induced ROS
appear to modulate this signaling pathway.
|
|
|
ROS Are Involved in the Cyclic StrainInduced Egr-1
Expression
We demonstrated earlier that an antioxidant could inhibit
strain-induced Egr-1 promoter activity and ERK activation. To confirm
that ROS are involved in strain-induced Egr-1 expression, we treated
ECs with free radical scavengers and then checked their effects on
Egr-1 induction. As shown in Figure 7A
, ECs pretreated with either a glutathione precursor, NAC, or catalase
abolished strain-induced Egr-1 gene expression. Our previous studies
indicated that H2O2 and
superoxide levels are increased in shear-treated or strain-treated
human ECs.36 37 To demonstrate the role of ROS in the
induction of Egr-1 by cyclic strain, we assessed ROS by adding
exogenous H2O2 into
cultured ECs and analyzing their Egr-1 inducibility. When ECs were
exposed to 100 µmol/L
H2O2 for various time
intervals, the Egr-1 mRNA levels of the ECs increased and reached a
plateau 1 hour after exposure to
H2O2 (Figure 7B
).
ECs treated with PMA, as a positive control, also showed an increase in
Egr-1 expression. Taken together, these results indicate that ROS
induced by cyclic strain are involved in Egr-1 gene induction.
|
Serum Response Element (SRE) Is a Common Target Sequence for Cyclic
Strain and H2O2 in the Egr-1 Promoter
Region
To elucidate the regulatory mechanisms of transcription that are
responsible for cyclic strain and
H2O2-induced Egr-1 gene
expression, deletion analysis of the Egr-1 promoter was
performed to identify cis-acting elements for cyclic strain
and H2O2. The 698-bp human
Egr-1 promoter contains multiple SREs.45 ECs treated
with either cyclic strain or
H2O2 significantly
increased promoter activities of e698Luc, e231Luc, and e120Luc compared
with control nontreated cells. Deletion of 17 bp in the 5' flanking
region of e120Luc, which disrupts the proximal single SRE site,
diminished not only basal levels but also the inducibility of cyclic
strain and H2O2 (Figure 8
). The above findings indicate that the
proximal SRE site in the Egr-1 promoter region is essential for Egr-1
induction in ECs after cyclic strain or
H2O2 treatment. This
indicates that cyclic stain and
H2O2 share a common target
sequence (ie, a SRE site) in the Egr-1 promoter region that is
responsible for Egr-1 induction. Our results thus confirm that cyclic
straininduced Egr-1 expression is modulated by increased ROS on the
Ras/Raf-1/ERK signaling pathway and subsequently activate Elk1
followed by an increase of SRE binding activity in the Egr-1 promoter
region.
|
| Discussion |
|---|
|
|
|---|
Recent studies including ours have shown that hemodynamic force can stimulate intracellular ROS production and that these ROS are subsequently involved in the induction of oxidant-sensitive genes such as MCP-1 and ICAM-136 37 38 39 59 in ECs. We have previously used human umbilical vein ECs to demonstrate the induction of ROS including superoxide in ECs under shear37 or strain36 treatment. The present study using BAECs has shown similar results. These findings are in agreement with previous studies indicating that ROS contribute to reperfusion-induced endothelial responses.60 Our present study has further demonstrated that this strain-induced ROS can modulate Egr-1 expression through a transcriptional event. Several lines of evidence support our theme. First, strain-induced Egr-1 expression was found in cells treated with either H2O2 or phorbol ester that is known to be able to stimulate intracellular ROS levels.14 Second, strain- or H2O2-induced Egr-1 expression was similarly inhibited after ECs were treated with an antioxidant NAC or catalase. Third, strain-induced Egr-1 promoter activities were diminished by antioxidant pretreatment of ECs. Fourth, strain and H2O2 appear to act on the same cis-acting element, ie, the serum-response element (SRE), in the promoter region of the Egr-1 gene, given that deletion of this SRE abolishes strain and H2O2 inducibility. Fifth, strain and H2O2 apparently act similarly on the signaling transduction pathway, given that the dominant negative mutant Ras can abolish both strain and H2O2 inducibility on Egr-1 promoter activity. In addition, ECs treated with PD98059 inhibited both strain- and H2O2-induced Egr-1 gene expression. Finally, strain-induced MAPK kinase activity was reduced by antioxidant or catalase treatment of strained cells.
Present data indicate that hemodynamic-induced ROS are involved in the modulation of signaling pathways. Changes in the intracellular redox status are thought to trigger cellular signaling molecules, including various protein kinases, phosphatases, and growth factor receptors.53 61 Mechanical force may exert its effect by modifying signaling molecules via alteration of the redox status by increasing ROS levels. Under this oxidative modification, the downstream signaling pathway thus serves as a mechanical transduction. Recent data indicate that a small GTPase (Ras) and its downstream MAPK/ERK and JNK are modulated by ROS.30 52 The present study strongly suggests that the intracellular redox status and its effects on signaling mechanisms modulate gene expression in ECs under a hemodynamic environment.
It is well documented that intracellular ROS levels are induced when ECs are exposed to various stimuli.14 However, excess ROS levels may cause oxidative stress to ECs that is believed to contribute to the pathology of atherosclerosis19 or reperfusion-induced injuries.60 The origin of these intracellular ROS, including superoxide, H2O2, and hydroxyl radicals, remains unclear. They may derive from several sources, including the mitochondrial electron transport system62 and NADPH oxidase.63 In the present study, we used the relatively stable H2O2 to assess the effects of ROS on ECs. H2O2-induced Egr-1 gene expression was shown to be dose and time dependent. Similar Egr-1 induction was also observed in ECs treated with superoxide generated by the reaction of xanthine oxidase and hypoxanthine (data not shown). Superoxide may exert its effect by directly acting on the cell membrane or indirectly through its conversion to H2O2. The induction effect of H2O2 on Egr-1 was diminished after ECs were treated with either NAC or catalase. All of these results indicate that H2O2 or its related species, superoxide and hydroxyl radicals, may all be in part involved in ROS-induced Egr-1 expression. Because cyclic strain or H2O2-induced Egr-1 expression was inhibited after ECs were treated with antioxidants, cyclic strain is believed to exert its effects in a manner similar to that of H2O2. Our previous studies demonstrated that shear stress or strain-induced expression of genes, including MCP-1, ICAM-1, and c-fos, is attenuated after ECs are treated with antioxidants.36 37 38 39 64 This study indicates that Egr-1 expression is also aggravated by strain-induced ROS. Taken together, our results confirm that intracellular ROS levels are induced to modulate gene expression in ECs under a hemodynamic environment.
Induction of Egr-1 has been demonstrated in cells exposed to various stimuli, including phorbol ester, ionizing radiation, inflammation, oxidative agents, and mechanical stretch/relaxation.21 22 65 66 67 68 Egr-1 has recently been shown to be an important regulator for gene expression by competing with the transcriptional factor Sp-1 in binding to the GC-rich region in the promoter of several atherosclerosis-associated genes, including tissue factor, PDGF, and ICAM-1.8 9 10 11 12 13 Expression of these genes can also be induced by hemodynamic force either through shear stress1 69 or cyclic strain.18 Recently, it was demonstrated that shear-induced Egr-1 plays an important role in transcriptional regulation of the PDGF-A gene in endothelium.11 12 13 We used the same Egr-1 binding sequences in the PDGF-A promoter and also demonstrated a specific binding of cyclic straininduced Egr-1 expression. Thus, cyclic strain not only increases Egr-1 mRNA, but it also increases its functional activity. The promoter region of Egr-1 contains 5 SREs with a CArG box as the core sequence responsible for these ROS effects.27 Consistent with this finding, our deletion constructs and reporter gene assay of the Egr-1 promoter region demonstrated that SRE is a common responsive element for the transcriptional activation of Egr-1 induced by cyclic strain or H2O2. A recent finding demonstrated that the transcriptional induction of Egr-1 by an oxygen singlet generated by UV irradiation also requires SRE.22 Our present results are also consistent with our previous findings that ROS induction by shear stress is involved in flow-induced c-fos expression64 and that SRE is responsible for c-fos changes when the cellular redox status is altered by H2O2.51 SRE is regulated by the binding of serum response factors and TCF, the transcriptional activities of which are enhanced by their phosphorylation.50 Whether the induction of Egr-1 and c-fos transcription is mediated by SRE via a similar phosphorylation cascade remains to be clarified. Nevertheless, our data clearly indicate that cyclic straininduced Egr-1 gene expression is a transcriptional event that is mediated through the activation of SRE in the Egr-1 promoter region.
In conclusion, present results clearly indicate that cyclic strain to bovine ECs induces Egr-1 gene expression predominantly via the Ras/Raf/ERK pathway and that strain-induced ROS are involved in the modulation of this signaling pathway. Because the intracellular redox status is crucial for Egr-1 expression and Egr-1 expression may trigger the induction of atherosclerosis- or inflammation-related genes, the constant surveillance of intracellular ROS levels by cellular antioxidant capability is thus essential to protect ECs from stimuli that potentially cause oxidative stress.
| Acknowledgments |
|---|
Received June 29, 1998; accepted January 20, 1999.
| References |
|---|
|
|
|---|
2.
Wang DL, Wung BS, Shyy YJ, Lin CF, Chao YJ, Usami S,
Chien S. Mechanical strain induces monocyte chemotactic protein-1 gene
expression in endothelial cells: effects of mechanical
strain on monocyte adhesion to endothelial cells.
Circ Res. 1995;77:294302.
3.
Schwarz G, Callewaert G, Droogmans G, Nilius B. Shear
stress-induced calcium transients in endothelial cells
from human umbilical cord veins. J Physiol (Lond). 1992;458:527538.
4.
Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow
effects on prostacyclin production by cultured human
endothelial cells. Science. 1985;227:14771479.
5. Bhagyalakshmi A, Berthiaume F, Reich KM, Frangos JA. Fluid shear stress stimulates membrane phospholipid metabolism in cultured human endothelial cells. J Vasc Res. 1992;29:443449.[Medline] [Order article via Infotrieve]
6. Takahashi M, Berk BC. Mitogen-activated protein kinase (ERK1/2) activation by shear stress and adhesion in endothelial cells: essential role for a herbimycin-sensitive kinase. J Clin Invest. 1996;98:26232631.[Medline] [Order article via Infotrieve]
7. Li YS, Shyy JYJ, Li S, Lee J, Su B, Karin M, Chien S. The Ras-JNK pathway is involved in shear-induced gene expression. Mol Cell Biol. 1996;16:59475954.[Abstract]
8.
Dey BR, Sukhatme VP, Roberts AB, Sporn MB, Rauscher
FJ, Kim SJ. Repression of transforming growth factor bA1 gene by the
Wilm tumor suppressor WT1 gene product. Mol Endocrinol. 1994;8:595620.
9. Mackman N. Regulation of the tissue factor gene. FASEB J. 1995;9:883889.[Abstract]
10.
Maltzman JS, Carman JA, Monroe JG. Transcriptional
regulation of ICAM-1 gene in antigen receptor- and phorbol
ester-stimulated B lymphocytes: role for transcription factor Erg-1.
J Exp Med. 1996;183:17471759.
11. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: a common theme in vascular injury. Science. 1996;271:14271431.[Abstract]
12.
Khachigian LM, Anderson KR, Halnon NJ, Gimbrone MA Jr,
Resnick N, Collins T. Egr-1 is activated in
endothelial cells exposed to fluid shear stress and
interacts with a novel shear-stress-response element in the PDGF-A
chain promoter. Arterioscler Thromb Vasc Biol. 1997;17:22802286.
13.
Khachigian LM, Collins T. Inducible expression of Egr-1
dependent genes: a paradigm of transcriptional activation in vascular
endothelium. Circ Res. 1997;81:457461.
14. Lander HM. An essential role for free radicals and derived species in signal transduction. FASEB J. 1997;11:118124.[Abstract]
15. Ohno M, Cooke JP, Dzau VJ, Gibbons GH. Fluid shear stress induces endothelial transforming growth factor beta-1 transcription and production. J Clin Invest. 1995;95:13631369.
16.
Hsieh HJ, Li NQ, Frangos JA. Shear stress increases
endothelial platelet-derived growth factor
messenger RNA levels. Am J Physiol. 1991;260:H642H646.
17. Lin MC, Almus-Jacobs F, Chen HH, Parry GC, Mackman N, Shyy JY, Chien S. Shear stress induction of the tissue factor gene. J Clin Invest. 1997;99:737744.[Medline] [Order article via Infotrieve]
18.
Cheng JJ, Wung BS, Chao YJ, Wang DL. Cyclic strain
enhances adhesion of monocytes to endothelial cells by
increasing intercellular adhesion molecule-1 expression.
Hypertension. 1996;28:386391.
19. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791804.[Medline] [Order article via Infotrieve]
20. Huang RP, Ngo L, Okamura D, Tucker M, Adamson ED. V-sis induces Egr-1 expression by a pathway mediated by C-Ha-Ras. J Cell Biochem. 1994;56:469479.[Medline] [Order article via Infotrieve]
21. Nose K, Ohba M. Functional activation of the Erg-1 (early growth response-1) gene by hydrogen peroxide. Biochem J. 1996;316:381383.
22.
Datta R, Taneja N, Sukhatme VP, Qureshi SA,
Weichselbaum R, Kufe DW. Reactive oxygen intermediates target
CC(A/T)6GG sequences to mediate activation of the early growth
response-1 transcription factor gene by ionizing radiation. Proc
Natl Acad Sci U S A. 1993;90:24192422.
23. Dreher D, Junod AF. Differential effects of superoxide, hydrogen peroxide and hydroxyl radical on intracellular calcium in human endothelial cells. J Cell Physiol. 1995;162:147153.[Medline] [Order article via Infotrieve]
24.
Tan CM, Xendoyannis S, Feldman RD. Oxidant stress
enhances adenylyl cyclase activation. Circ Res. 1995;77:710717.
25. Taheer MM, Garcia JG, Natarajan V. Hydroperoxide-induced diacylglycerol formation and protein kinase C activation in vascular endothelial cells. Arch Biochem Biophys. 1993;303:260266.[Medline] [Order article via Infotrieve]
26. Marui N, Offermann MK, Swerlick R, Kunsch C, Rosen CA, Ahmad M, Alexander RW, Medford RM. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant sensitive mechanism in human vascular endothelial cells. J Clin Invest. 1993;92:18661874.
27.
Ohba M, Shibanuma M, Kuroki T, Nose K.
Production of hydrogen peroxide by transforming growth
factor-b71 and its involvement in induction of egr-1 in mouse
osteoblastic cells. J Cell Biol. 1994;126:10791088.
28.
Sundaresan M, Yu ZX, Ferrans VJ, Irani K, Finkel T.
Requirement for generation of
H2O2 for
platelet-derived growth factor signal transduction.
Science. 1995;270:296299.
29.
Lo YYC, Cruz T. Involvement of reactive oxygen species
in cytokine and growth factor induction of c-fos
expression in chondrocytes. J Biol Chem. 1996;270:1172711730.
30.
Guyton KZ, Liu Y, Gorospe M, Xu Q, Holbrook NJ.
Activation of mitogen-activated protein kinase by
H2O2. J Biol
Chem. 1995;271:41384142.
31.
Lander HM. p21 ras as a common signaling target of
reactive free radicals and cellular redox stress. J Biol
Chem. 1995;270:2119521198.
32. Liu Y, Guyton KZ, Gorospe M, Xu Q, Lee JC, Holbrook NJ. Differential activation of ERK, JNK/SAPK and P38/CSBP/RK MAP kinase family members during the cellular response to arsenite. Free Radic Biol Med. 1996;21:771781.[Medline] [Order article via Infotrieve]
33. Rosette C, Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science. 1996;15:11941197.
34.
Topper JN, Cai J, Falb D, Gimbrone MA. Identification
of vascular endothelial genes differentially responsive
to fluid mechanical stimuli: cyclooxygenase-2,
manganese superoxide dismutase and endothelial cell
nitric oxide synthase are selectively up-regulated by steady laminar
shear stress. Proc Natl Acad Sci U S A. 1996;93:1041710422.
35.
Inoue N, Ramasamy S, Fukai T, Nerem RM, Harrison DG.
Shear stress modulates expression of Cu/Zn superoxide dismutase in
human aortic endothelial cells. Circ Res. 1996;79:3237.
36.
Wung BS, Cheng JJ, Shyy YJ, Wang DL. Cyclic
strain-induced monocyte chemotactic protein-1 gene expression involves
reactive oxygen species activation of AP-1. Circ Res. 1997;81:17.
37.
Chiu JJ, Wung BS, Shyy YJ, Hsieh HJ, Wang DL. Reactive
oxygen species are involved in the shear stress-induced intercellular
adhesion molecule-1 expression in endothelial cells.
Arterioscler Thromb Vasc Biol. 1997;17:35703577.
38.
Cheng JJ, Wung BS, Chao YJ, Wang DL. Cyclic
strain-induced reactive oxygen species involved in ICAM-1 gene
induction in endothelial cells.
Hypertension. 1998;31:125130.
39. Cheng JJ, Chao YJ, Wung BS, Wang DL. Cyclic strain-induced plasminogen activator inhibitor-1 release from endothelial cells involves reactive oxygen species. Biochem Biophys Res Commun. 1996;225:100105.[Medline] [Order article via Infotrieve]
40.
Feig LA, Cooper GM. Inhibition of NIH 3T3 cell
proliferation by a mutant ras protein with preferential affinity for
GDP. Mol Cell Biol. 1988;8:32353243.
41. Kolch WG, Heidecker G, Lloyd P, Rapp UR. Raf-1 protein kinase is required for growth of induced NIH/3T3 cells. Nature.. 1991;349:426428.[Medline] [Order article via Infotrieve]
42. Minden A, Lin A, Claret FX, Abo A, Karin M. Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell. 1995;81:11471157.[Medline] [Order article via Infotrieve]
43. Wang DL, Tang CC, Wung BS, Chen HH, Wang JJ. Cyclical strain increases endothelin-1 secretion and gene expression in human endothelial cells. Biochem Biophys Res Commun. 1993;195:10501056.[Medline] [Order article via Infotrieve]
44. Wung BS, Cheng JJ, Chao YJ, Lin J, Wang DL. Cyclical strain increases monocyte chemotatic protein-1 secretion in human endothelial cells. Am J Physiol. 1996;39:H1462H1468.
45. Sakamoto KM, Bardeleben C, Yates KE, Raines MA, Golde DW, Gasson JC. 5' upstream sequence and genomic structure of the human primary response gene, EGR-1/TIS8. Oncogene. 1991;6:867871.[Medline] [Order article via Infotrieve]
46.
Whitmarsh AJ, Shore P, Sharrocks AD, Davis RJ.
Integration of MAP kinase signal transduction pathways at the serum
response element. Science. 1995;269:403407.
47. Cavigelli M, Dolfi F, Claret FX, Karin M. Induction of c-fos expression through JNK-mediated TCF/Elk1 phosphorylation. EMBO J. 1995;14:59575964.[Medline] [Order article via Infotrieve]
48. Whitmarsh AJ, Yang SH, Su MSS, Sharrocks AD, Davis RJ. Role of P38 and JNK mitogen-activated protein kinases in the activation of ternary complex factors. Mol Cell Biol. 1997;17:23602371.[Abstract]
49. Canman CE, Kastan MB. Signal transduction: three paths to stress relief. Nature. 1996;384:213214.[Medline] [Order article via Infotrieve]
50. Treisman R. The serum response element. Trends Biochem Sci. 1993;17:423426.
51. Muller JM, Cahill MA, Rupec RA, Baeuerle PA, Nordheim A. Antioxidants as well as oxidants activate c-fos via Ras-dependent activation of extracellular-signal-regulated kinase 2 and Elk1. Eur J Biochem. 1997;244:4552.[Medline] [Order article via Infotrieve]
52. Deng T, Karin M. c-Fos transcriptional activity stimulated by H-Ras-activated protein kinase distinct from JNK and ERK. Nature. 1994;371:171175.[Medline] [Order article via Infotrieve]
53. Cavigelli M, Li WW, Lin A, Su B, Yoshioka K, Karin M. The tumor promoter arsenite stimulates AP-1 activity by inhibiting a JNK phosphatase. EMBO J. 1996;15:62696279.[Medline] [Order article via Infotrieve]
54.
Lo YYC, Wong JMS, Cruz T. Reactive oxygen species
mediate cytokine activation of c-Jun
NH2-terminal kinases. J Biol
Chem. 1996;271:1570315701.
55. Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima I, Mizuno T, Takano H, Hiroi Y, Ueki K, Tobe K, Kadowaki T, Nagai R, Yazaki Y. Mechanical stress activates protein kinase cascade of phosphorylation in neonatal rat cardiac myocytes. J Clin Invest. 1995;96:438446.
56. Wang DL, Wung BS, Peng YC, Wang JJ. Mechanical strain increases endothelin-1 gene expression via protein kinase C pathway in human endothelial cells. J Cell Physiol. 1995;163:400406.[Medline] [Order article via Infotrieve]
57.
Shyy YJ, Hsieh HJ, Usami S, Chien S. Fluid shear stress
induces a biphasic response of human monocyte chemotactic protein-1
gene expression in vascular endothelium. Proc
Natl Acad Sci U S A. 1994;91:46784682.
58.
Malek AM, Greene AL, Izumo S. Regulation of
endothelin-1 gene by fluid shear stress is transcriptionally mediated
and independent of protein kinase C and cAMP. Proc Natl Acad Sci
U S A. 1993;90:59996003.
59.
Howard AB, Alexander RW, Nerem RM, Griendling KK,
Taylor WR. Cyclic train induces an oxidative stress in
endothelial cells. Am J Physiol. 1997;272:C421C427.
60. Halliwell B, Gutteridge JM. Role of free radicals and catalytic metal ions in human disease: an overview. Methods Enzymol. 1990;186:185.[Medline] [Order article via Infotrieve]
61. Sachsenmaier C, Rasler-Pohl A, Zinck R, Nordheim A, Herrlich P, Rahmsdorf HJ. Involvement of growth factor receptors in the mammalian UVC response. Cell. 1994;78:963972.[Medline] [Order article via Infotrieve]
62. Bovies A. Mitochondrial production of superoxide radical and hydrogen peroxide. Adv Exp Med Biol. 1977;78:6782.[Medline] [Order article via Infotrieve]
63. Romson JL, Hook BG, Kunkel SL, Abrams GD, Schork A, Bucchesi BR. Reduction of the extent of ischemic myocardial injury by neutrophil depletion in the dog. Circ Res. 1983;67:10161023.
64. Hsieh HJ, Cheng CC, Wu ST, Chiu JJ, Wung BS, Wang DL. Increase of reactive oxygen species (ROS) in endothelial cells by shear flow and involvement of ROS in shear-induced c-fos expression. J Cell Physiol. 1998;175:156162.[Medline] [Order article via Infotrieve]
65. Molnar G, Crozat A, Pardee AB. The immediate-early gene Egr-1 regulates the activity of the thymidine kinase promoter at the G0-to-G1 transition of the cell cycle. Mol Cell Biol. 1994;10:19311939.
66. Nguyen HQ, Hoffman-Lieberman B, Lieberman DA. The zinc finger transcription factor Egr-1 is essential and restricts for differentiation along the macrophage lineage. Cell. 1993;72:197209.[Medline] [Order article via Infotrieve]
67.
Komuro I., Kaida T, Shibazaki Y, Kurabayashi M, Katoh
Y. Stretching cardiac myocytes stimulates protooncogene expression.
J Biol Chem. 1990;265:35953598.
68. McMahon SB, Monroe JG. The role of early growth response gene-1 (egr-1) in regulation of the immune response. J Leukoc Biol. 1996;60:159166.[Abstract]
69. Gimbrone MA, Nagel T, Topper J. Biomechanical activation: an emerging paradigm in endothelial adhesion biology (Perspective Series: Cell Adhesion in Vascular Biology). J Clin Invest. 1997;99:18091813.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
W.-x. Liao, L. Feng, H. Zhang, J. Zheng, T. R. Moore, and D.-b. Chen Compartmentalizing VEGF-Induced ERK2/1 Signaling in Placental Artery Endothelial Cell Caveolae: A Paradoxical Role of Caveolin-1 in Placental Angiogenesis in Vitro Mol. Endocrinol., September 1, 2009; 23(9): 1428 - 1444. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ying, C. Tu, H. Ying, Y. Hu, Q. He, and B. Yang MSFTZ, a Flavanone Derivative, Induces Human Hepatoma Cell Apoptosis via a Reactive Oxygen Species- and Caspase-Dependent Mitochondrial Pathway J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 758 - 765. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Wang, K. Cai, S. Pang, T. Wang, D. Qi, Q. Zhu, Z. Ni, and Y. Le Mechanisms of Glucose-Induced Expression of Pancreatic-Derived Factor in Pancreatic {beta}-Cells Endocrinology, February 1, 2008; 149(2): 672 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Hasan and A. I. Schafer Hemin Upregulates Egr-1 Expression in Vascular Smooth Muscle Cells via Reactive Oxygen Species ERK-1/2 Elk-1 and NF-{kappa}B Circ. Res., January 4, 2008; 102(1): 42 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Chiu, L.-J. Chen, C.-I Lee, P.-L. Lee, D.-Y. Lee, M.-C. Tsai, C.-W. Lin, S. Usami, and S. Chien Mechanisms of induction of endothelial cell E-selectin expression by smooth muscle cells and its inhibition by shear stress Blood, July 15, 2007; 110(2): 519 - 528. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Shi, Y.-J. Chiu, Y. Cho, T. A. Bullard, M. Sokabe, and K. Fujiwara Down-regulation of ERK but not MEK phosphorylation in cultured endothelial cells by repeated changes in cyclic stretch Cardiovasc Res, March 1, 2007; 73(4): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Cummins, N. von Offenberg Sweeney, M. T. Killeen, Y. A. Birney, E. M. Redmond, and P. A. Cahill Cyclic strain-mediated matrix metalloproteinase regulation within the vascular endothelium: a force to be reckoned with Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H28 - H42. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Pulver-Kaste, C. A. Barlow, J. Bond, A. Watson, P. L. Penar, B. Tranmer, and K. M. Lounsbury Ca2+ source-dependent transcription of CRE-containing genes in vascular smooth muscle Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H97 - H105. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Geracitano, A. Tozzi, N. Berretta, F. Florenzano, E. Guatteo, M. T. Viscomi, B. Chiolo, M. Molinari, G. Bernardi, and N. B Mercuri Protective role of hydrogen peroxide in oxygen-deprived dopaminergic neurones of the rat substantia nigra J. Physiol., October 1, 2005; 568(1): 97 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cai Hydrogen peroxide regulation of endothelial function: Origins, mechanisms, and consequences Cardiovasc Res, October 1, 2005; 68(1): 26 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Boyd, J. Doyle, E. Gee, S. Pallan, and T. L. Haas MAPK signaling regulates endothelial cell assembly into networks and expression of MT1-MMP and MMP-2 Am J Physiol Cell Physiol, March 1, 2005; 288(3): C659 - C668. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. J. Wu, L. L. Muldoon, and E. A. Neuwelt The Chemoprotective Agent N-Acetylcysteine Blocks Cisplatin-Induced Apoptosis through Caspase Signaling Pathway J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 424 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Ni, H.-J. Hsieh, Y.-J. Chao, and D. L. Wang Interleukin-6-induced JAK2/STAT3 signaling pathway in endothelial cells is suppressed by hemodynamic flow Am J Physiol Cell Physiol, September 1, 2004; 287(3): C771 - C780. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osawa, S. Itoh, S. Ohta, Q. Huang, B. C. Berk, N.-L. Marmarosh, W. Che, B. Ding, C. Yan, and J.-i. Abe ERK1/2 Associates with the c-Met-binding Domain of Growth Factor Receptor-bound Protein 2 (Grb2)-associated Binder-1 (Gab1): ROLE IN ERK1/2 AND EARLY GROWTH RESPONSE FACTOR-1 (Egr-1) NUCLEAR ACCUMULATION J. Biol. Chem., July 9, 2004; 279(28): 29691 - 29699. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, R. D. Kamm, and R. T. Lee Cell mechanics and mechanotransduction: pathways, probes, and physiology Am J Physiol Cell Physiol, July 1, 2004; 287(1): C1 - C11. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Day, G. Thiel, J. Lum, R. D. Chevere, Y. Yang, J. Stevens, L. Sibert, and B. L. Fanburg Hepatocyte Growth Factor Regulates Angiotensin Converting Enzyme Expression J. Biol. Chem., March 5, 2004; 279(10): 8792 - 8801. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Han, P. J. Boyd, S. Colgan, J. A. Madri, and T. L. Haas Transcriptional Up-regulation of Endothelial Cell Matrix Metalloproteinase-2 in Response to Extracellular Cues Involves GATA-2 J. Biol. Chem., November 28, 2003; 278(48): 47785 - 47791. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Nagy Recent Insights into the Role of the Innate Immune System in the Development of Alcoholic Liver Disease Experimental Biology and Medicine, September 1, 2003; 228(8): 882 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. D. Ragione, V. Cucciolla, V. Criniti, S. Indaco, A. Borriello, and V. Zappia p21Cip1 Gene Expression Is Modulated by Egr1: A NOVEL REGULATORY MECHANISM INVOLVED IN THE RESVERATROL ANTIPROLIFERATIVE EFFECT J. Biol. Chem., June 20, 2003; 278(26): 23360 - 23368. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Ni, H.-J. Hsieh, Y.-J. Chao, and D. L. Wang Shear Flow Attenuates Serum-induced STAT3 Activation in Endothelial Cells J. Biol. Chem., May 23, 2003; 278(22): 19702 - 19708. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells Blood, December 15, 2002; 100(13): 4454 - 4461. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Cheng, Y.-J. Chao, and D. L. Wang Cyclic Strain Activates Redox-sensitive Proline-rich Tyrosine Kinase 2 (PYK2) in Endothelial Cells J. Biol. Chem., December 6, 2002; 277(50): 48152 - 48157. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shi, R. Kishore, M. R. McMullen, and L. E. Nagy Chronic Ethanol Increases Lipopolysaccharide-stimulated Egr-1 Expression in RAW 264.7 Macrophages. CONTRIBUTION TO ENHANCED TUMOR NECROSIS FACTOR alpha PRODUCTION J. Biol. Chem., April 19, 2002; 277(17): 14777 - 14785. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.S. Wung, J.J. Cheng, S.-K. Shyue, and D.L. Wang NO Modulates Monocyte Chemotactic Protein-1 Expression in Endothelial Cells Under Cyclic Strain Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1941 - 1947. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wei, A. B. Al-Mehdi, and A. B. Fisher Signaling pathway for nitric oxide generation with simulated ischemia in flow-adapted endothelial cells Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2226 - H2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guillemot, A. Levy, M. Raymondjean, and B. Rothhut Angiotensin II-induced Transcriptional Activation of the Cyclin D1 Gene Is Mediated by Egr-1 in CHO-AT1A Cells J. Biol. Chem., October 12, 2001; 276(42): 39394 - 39403. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Chang, J.-J. Shen, B.-S. Wung, J.-J. Cheng, and D. L. Wang Chinese Herbal Remedy Wogonin Inhibits Monocyte Chemotactic Protein-1 Gene Expression in Human Endothelial Cells Mol. Pharmacol., September 1, 2001; 60(3): 507 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Chen, M. V. Avshalumov, and M. E. Rice H2O2 Is a Novel, Endogenous Modulator of Synaptic Dopamine Release J Neurophysiol, June 1, 2001; 85(6): 2468 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Morimoto, N. Kume, S. Miyamoto, Y. Ueno, H. Kataoka, M. Minami, K. Hayashida, N. Hashimoto, and T. Kita Lysophosphatidylcholine Induces Early Growth Response Factor-1 Expression and Activates the Core Promoter of PDGF-A Chain in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2001; 21(5): 771 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kito, E. L. Chen, X. Wang, M. Ikeda, N. Azuma, N. Nakajima, V. Gahtan, and B. E. Sumpio Role of mitogen-activated protein kinases in pulmonary endothelial cells exposed to cyclic strain J Appl Physiol, December 1, 2000; 89(6): 2391 - 2400. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Thannickal and B. L. Fanburg Reactive oxygen species in cell signaling Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1005 - L1028. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lehoux, B. Esposito, R. Merval, L. Loufrani, and A. Tedgui Pulsatile Stretch-Induced Extracellular Signal-Regulated Kinase 1/2 Activation in Organ Culture of Rabbit Aorta Involves Reactive Oxygen Species Arterioscler Thromb Vasc Biol, November 1, 2000; 20(11): 2366 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Griendling, D. Sorescu, B. Lassegue, and M. Ushio-Fukai Modulation of Protein Kinase Activity and Gene Expression by Reactive Oxygen Species and Their Role in Vascular Physiology and Pathophysiology Arterioscler Thromb Vasc Biol, October 1, 2000; 20(10): 2175 - 2183. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liu, J. C. Tsai, and W. C. Aird Egr-1 gene is induced by the systemic administration of the vascular endothelial growth factor and the epidermal growth factor Blood, September 1, 2000; 96(5): 1772 - 1781. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Bayraktutan, L. Blayney, and A. M. Shah Molecular Characterization and Localization of the NAD(P)H Oxidase Components gp91-phox and p22-phox in Endothelial Cells Arterioscler Thromb Vasc Biol, August 1, 2000; 20(8): 1903 - 1911. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Wolin Interactions of Oxidants With Vascular Signaling Systems Arterioscler Thromb Vasc Biol, June 1, 2000; 20(6): 1430 - 1442. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Chiu, B. S. Wung, H. J. Hsieh, L. W. Lo, and D. L. Wang Nitric Oxide Regulates Shear Stress–Induced Early Growth Response-1 : Expression via the Extracellular Signal–Regulated Kinase Pathway in Endothelial Cells Circ. Res., August 6, 1999; 85(3): 238 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Cheng, B.-S. Wung, Y.-J. Chao, and D. L. Wang Sequential Activation of Protein Kinase C (PKC)-alpha and PKC-epsilon Contributes to Sustained Raf/ERK1/2 Activation in Endothelial Cells under Mechanical Strain J. Biol. Chem., August 10, 2001; 276(33): 31368 - 31375. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shi, R. Kishore, M. R. McMullen, and L. E. Nagy Lipopolysaccharide stimulation of ERK1/2 increases TNF-alpha production via Egr-1 Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1205 - C1211. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |