Original Contribution |
B Transcription Factors
From the Department of Internal Medicine (Y.H.), Sealy Center for Molecular Cardiology (M.S.R.), and Sealy Center for Molecular Science (A.R.B.), University of Texas Medical Branch, Galveston, Tex.
Correspondence to Allan R. Brasier, Division of Endocrinology, MRB 8.138, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555-1060. E-mail arbrasie{at}utmb.edu
| Abstract |
|---|
|
|
|---|
B (NF-
B) motif. Sar1
Ang II induced cytoplasmic-to-nuclear translocation of the NF-
B
subunits Rel A and NF-
B1 with parallel changes in DNA-binding
activity in a biphasic manner, which produced an early peak at 15
minutes followed by a nadir 1 to 6 hours later and a later peak at 24
hours. The early phase of NF-
B translocation was dependent on weak
simultaneous proteolysis of the I
B
and ß
inhibitors, whereas later translocation was associated with
enhanced processing of the p105 precursor into the mature 50-kDa
NF-
B1 form. Pretreatment with a potent inhibitor of
I
B
proteolysis, TPCK, completely blocked Sar1 Ang
IIAng II-induced NF-
B activation and induction of
endogenous IL-6 gene expression, which indicated the
essential role of NF-
B in mediating IL-6 expression. We conclude
that Ang II is a pleiotropic regulator of the NF-
B transcription
factor family and may be responsible for activating the expression of
cytokine gene networks in VSMCs.
Key Words: nuclear factor-
B renin-angiotensin system angiotensin II cytokine
| Introduction |
|---|
|
|
|---|
Ang II activates genetic networks in various cell types by
influencing the activity and expression of nuclear regulatory proteins,
including immediate-early transcription factors
(activator protein 1)5 7 and
tyrosine-receptorcoupled transcription factors (signal transducers
and activators of transcription)8 in VSMCs,
early growth response-1 in cardiomyocytes,9
and activator protein 1 in adrenal glomerulsa
cells.10 In addition, we recently reported that Ang II
induces the activity of the nuclear factor-
B (NF-
B) transcription
factor in hepatocytes.11 NF-
B is a family
of cytoplasmic transcription factors composed of homodimeric and
heterodimeric complexes of the potent transactivating subunits Rel A
and c-Rel and the inert DNA-binding subunit
NF-
B1.12 13 14 Rel A and c-Rel complexes are actively
sequestered in the cytoplasm by association with the
inhibitory proteins (I
B), which inactivate
the transcriptional activator subunits by binding and
masking their nuclear translocation domains. After activation, NF-
B
translocates into the nucleus, where it binds and induces expression of
cytokine and acute-phase response genes.11 13 15
Although Ang II increases NF-
B transcriptional activity in
hepatocytes, the mechanism (and subunits affected) has not
been determined, nor has it been established whether this phenomenon
occurs in other cell types.
Interleukin-6 (IL-6) is a multifunctional cytokine that mediates B lymphocyte proliferation/induction of antibody synthesis and mediates the hepatic acute-phase response.16 17 In the vessel wall, locally secreted IL-6 also plays an important role as a VSMC growth factor through a paracrine mechanism, which involves production of PDGF.18 19 20 IL-6 is encoded by a highly inducible promoter that is a target for tissue-specific and cytokine-inducible transcription factors.16 22 Both human and rat VSMCs inducibly secrete IL-6 in response to the inflammatory cytokines IL-1 and tumor necrosis factor (TNF),17 bacterial cell wallderived lipopolysaccharide,17 platelet-derived thrombin,21 and Ang II.19 However, the mechanism for transcriptional activation of IL-6 in VSMCs has not been determined.
In this experiment, we examined the mechanisms for Ang II-induced
activation of IL-6 gene expression in cultured rat VSMCs. Treatment
with Sar1 Ang II (100 nmol/L) rapidly
activated expression of IL-6 mRNA transcripts in a
transcription-dependent manner and was completely blocked by
actinomycin D. In gene transfer studies with plasmids that contained
the IL-6 promoterdriven luciferase reporter gene, the NF-
B binding
site was essential for this effect. Site mutations of the NF-
B
binding site blocked basal and Ang II-activated IL-6 luciferase
reporter activity. Ang II induced nuclear translocation of the Rel
A · NF-
B1 isoforms in VSMCs concomitant with I
B
and ß
proteolysis. In addition, chronic Ang II stimulation induced processing
of the mature form of NF-
B1 (50-kDa subunit) from its 105-kDa
precursor, p105. These data implicate Ang II as an
activator of NF-
B translocation and cytokine
expression in VSMCs.
| Materials and Methods |
|---|
|
|
|---|
(CalBiochem) was added at a
concentration of 1.1 nmol/L. TPCK was from CalBiochem and used at a
final concentration of 50 µmol/L.
RNA Extraction and IL-6 Transcript Analysis
VSMC RNA was extracted with acid-guanidine HCl/phenol extraction
(TelTex). For Northern blots, 30 µg of total cellular RNA was
fractionated on a MOPS/formaldehyde agarose gel as
described.15 The IL-6 cDNA probe was generated by reverse
transcriptionpolymerase chain reaction (RT-PCR).22 24
The upstream primer for rat IL-6 was 5'-CAAGAGACTTCCAGCCAGTTGC-3'
(hybridizing to nucleotides [nt] 81 to 102 of the rat
mRNA) and the downstream primer was 5'-TTGCCGAGTAGACCTCATAGT-GACC-3'
(hybridizing to nt 694 to 670 of the rat mRNA). The 590-bp cDNA was
subcloned into the pCR2.1 plasmid (Invitrogen) and sequenced to confirm
authenticity. The cDNA probe was produced in the PCR with the rat IL-6
downstream primer and [
32P] dATP. After the
blots were hybridized, they were washed and exposed to a Molecular
Dynamics PhosphorImager cassette for quantification.
Plasmid Construction and Transfection
The IL-6 promoter/luciferase reporter was produced with the use
of the PCR with the IL-6 gene in the pGEM plasmid (a gift from
S. Akira, Osaka University, Japan) as a template with the
upstream primer 5'-TAATAAGGGATCCAATCAGCCCC ACCCGCTCT-3'
[hybridizing to nt -310 to -279 of the gene promoter,22
incorporating a BamH1 site (underlined)] and a downstream
primer 5'-AAGAAGCTTGCTTCGAGGGCAGAATGAG-3' [hybridizing nt
25 to -3 of the gene promoter, which incorporates a HindIII
site (underlined)]. The 328-bp BamH1/HindIII
fragment was then subcloned into the same restriction sites of the
promoterless luciferase plasmid, poLUC.25
Site-directed mutagenesis of the NF-
B site in the context of
-303/+23 IL-6 promoter was introduced with the technique of PCR
"SOEing"26 with the mutagenic primers (mutations
underlined): 
sense
5'-ATCAAATGTTGTATTTTACA-ATGAGTCTCAATA-3',
and 
antisense
5'-ATTGAGACTCT-ATGTAAAATACAACATTTTGATAAATC-3'.
The BamH1/HindIII fragment that contained the
IL-6 promoter that mutated in the NF-
B site was then subcloned into
the BamH1/HindIII-digested poLUC reporter vector.
Plasmids were purified by ion exchange chromatography
(Qiagen) and sequenced to verify authenticity.
Transient transfections were performed by electroporation. Resuspended VSMCs (1 to 2x107) were incubated for 15 minutes with 60 µg of the indicated IL-6/LUC and 20 µg of internal control SV40 early region promoter/alkaline phosphastase (SV2APAP) reporter plasmids on ice in a final volume of 0.5 mL of serum-free medium per cuvette, and subjected to a 35.4- to 42.1-ms pulse of 300 V and 950 mF with a Gene Pulser transfection apparatus (Bio-RAD). The transfection mixtures were incubated for another 15 minutes at room temperature before being plated onto 60-mm culture dishes. Cells were then serum-starved for 72 hours before stimulation with 100 nmol/L Sar1 Ang II for 5 hours. In the luciferase assays, transfected cells were washed with PBS 3 times and lysed on the plate by the addition of 200 µL of lysis buffer (25 mmol/L Tris-phosphate, pH 7.8; 2 mmol/L DTT; 2 mmol/L trans-1,2-diaminocyclohexane-N,N,N',N'-tetracetic acid; 10% glycerol; 1% Triton X-100), and cytoplasmic lysates (100 µL) were assayed for luciferase and alkaline phosphatase reporter activities.27 Luciferase activity was determined by subtraction of machine background and normalization of each plate to alkaline phosphatase activity.
Western Immunoblots and Immunoprecipitation
Two to three hundred micrograms of cytoplasmic or nuclear
extracts were prepared as described28 and fractionated on
SDS-PAGE, transferred to polyvinylidene difluoride (PVDF)
membrane, and subjected to Western immunoblots. Primary
antibodies were rabbit polyclonal anti-I
B, I
Bß, Rel A, c-Rel,
and NF-
B1 antibodies. Immune complexes were detected by binding
donkey antirabbit IgG conjugated to horseradish peroxidase followed
by reaction in the enhanced chemiluminescence assay (ECL, Amersham
International). The specificity of each antibody has been documented by
the ability to identify the correct molecular weight product and
whether it is blocked after preadsorption with the appropriate
peptide.28
Gel Mobility Shift and Microaffinity Purification Assays
Nuclear extracts (25 µg) were incubated with 40 000 cpm of
32P- labeled duplex NF-
B binding site,
5'-GATCCACCACAGT-TGGGATTTCCCAACCTGACCA-3', and 2 µg of poly(dA-dT)
in a buffer that contained 8% glycerol, 100 mmol/L NaCl, 5
mmol/L MgCl2, 5 mmol/L DTT, and 0.1 mg/mL PMSF in a final volume
of 20 µL for 15 minutes at room temperature.28 The
complexes were fractionated on 6% native polyacrylamide gels
run in TBE buffer (25 mmol/L Tris, 25 mmol/L boric
acid, 0.5 mmol/L EDTA), dried, and exposed to Kodak X-AR film at
-70°C.
Microaffinity purification of NF-
B binding proteins was performed
with chemically synthesized oligonucleotides that
contained 5' biotin (Bt) on a flexible linker (Genosys). Sequences of
duplex oligonucleotides are
WT: GATCCATCAGTTGCAAATCGTGGAATTTCCTCTA GTAGTCAACGTTTAGCACCTTAAAGGAGATCTAG

B:
GATCCATCAGTTGCAAATCGTTTAATTTAATCTA
GTAGTCAACGTTTAGCAAATTAAATTAGATCTAG
N
M:
GATCCATCAGCTACGAGTCGTGGAATTTCCTCTA GTAGTCGATGCTCAGCACCTTAAAGGAGATCTAG
Forty picomoles of Bt oligonucleotide duplex
was incubated with 800 µg of nuclear extracts from VSMCs either
untreated or stimulated with Ang II for the indicated time in the
presence of 10 µg of poly(dA-dT) in a 1-mL volume of binding buffer
that contained 12.5 mmol/L HEPES (pH 7.9), 4 mmol/L
MgCl2, 60 mmol/L KCl, 1 mmol/L EDTA,
1 mmol/L DTT, 6% glycerol, and protease inhibitor
cocktail for 30 minutes at 4°C. The bound proteins were collected by
the addition of 40 µL of a 50% (vol/vol) slurry of
streptavidin-agarose beads (Pierce) and incubation for 2 more hours at
4°C. After the binding proteins were washed 4 times with binding
buffer and transferred to fresh microtubes, they were eluted in a
100-µL volume a of mixture of Laemmli buffer and 500 mmol/L KCl
and fractionated in SDS-PAGE for the Western
immunoblotting probed with anti-Rel A or
anti-NF-
B1 antibodies. For competition, a 10-fold excess of
nonbiotinylated oligonucleotides was included in the
initial binding reaction.
| Results |
|---|
|
|
|---|
|
To isolate the component of IL-6 induction that was due to changes in
IL-6 transcription, -303/+22-bp of the IL-6 promoter/luciferase
reporter (-303/+22 IL-6/LUC) gene was transfected into rat VSMCs and
subsequently stimulated for 5 hours with either vehicle,
Sar1 Ang II (100 nmol/L), or TNF-
(1.1
nmol/L). As shown in Figure 2
, normalized
luciferase activity (IL-6/luciferase to internal control alkaline
phosphatase) after Sar1 Ang II stimulation
increased 1.7±0.3-fold relative to control (mean±SD, n=3,
P<0.05, Student t test), whereas after
stimulation with TNF-
increased 2.3±0.5-fold (mean±range,
n=2). The role of NF-
B in Ang II-induced activation of -303/+22
IL-6/LUC reporter activity was assayed by introduction of a site
mutation of the NF-
B binding site into the -303/+22 IL-6/LUC
reporter (-303/+22 IL-6 
/LUC). After stimulation, the -303/+22
IL-6 
/LUC was inert to stimulation by both agents (Ang II and
TNF-
). To determine whether the NF-
B binding site is sufficient
to confer Ang II inducibility, we analyzed an NF-
B response
element in a promoter context where basal and inducible activity could
be measured. In VSMCs, the IL-8 promoter is also Ang II inducible;
deletion of the NF-
B binding site completely blocked Ang II
induction (Figure 2B
). We have previously demonstrated that the
NF-
B binding site is an Ang II-inducible enhancer that can confer
Ang II induction onto a heterologous promoter.11
Although the unlikely possibility of cryptic Ang II-inducible elements
in the IL-6 promoter cannot be completely excluded, we interpret these
data to indicate that the NF-
B binding site is necessary and
sufficient for Ang II-mediated transcription.
|
Ang II Stimulates NF-
B DNA-Binding Activity in a Biphasic
Manner
To determine whether Ang II stimulates changes in NF-
B DNA
binding activity in VSMCs, NF-
B binding was assayed in nuclear
extracts from cells stimulated for various times with
Sar1 Ang II (Figure 3A
). In unstimulated nuclei, a single
binding activity was seen (complex C2), and on longer exposures, a
faint binding of a slower migrating complex, C1, could be seen (not
shown). In contrast, within 0.25 hours after Ang II treatment, the
second complex, C1, and to a lesser extent C2 were both induced.
Although C1 binding was detectable at all times after Ang II treatment
(0.25 to 24 hours), its abundance was maximal at 0.25 hours, fell at 1
hour, and reaccumulated at 24 hours. Compared with control, aggregate
(C1+C2) NF-
B binding activity was increased 3.2±1.8-fold at 0.25
hours and 2.8±1.4-fold at 24 hours (mean±SD, n=3, P<0.05
for each time point, Student t test). To exclude potential
nonspecific effects for the NF-
B induction at 24 hours, control
experiments were performed. Cells starved for 72 hours were harvested,
and NF-
B binding was compared with cells starved an additional 24
hours in the absence or presence of Sar1 Ang II
(Figure 3B
). As a positive control, cells maintained in
serum-free medium for 24 hours were subsequently stimulated with
TNF-
. A strong induction of NF-
B binding was observed only in the
24-hour Ang II- and 15-minute TNF-
treated plates, which indicates
NF-
B binding requires the presence of hormone.
|
Binding specificity for the NF-
B complexes was demonstrated with
competition in gel shift assay in which unlabeled
oligonucleotides that represented the
wild-type NF-
B site (WT) and 2 unrelated mutations-(
B1,

B2), neither of which bind to NF-
B,15 were
included at a molar excess to labeled probe in the binding reaction
(Figure 3C
). Only the WT NF-
B competed successfully for the
binding of the C1 and C2 complexes. These data indicated that both
complexes bind with NF-
B specificity.
To specifically demonstrate the changes in DNA-binding activity of the
Ang II-inducible NF-
B subunits, we used a 2-step microaffinity
isolation/Western immunoblot DNA-binding
assay.15 In this assay, nuclear proteins from control or
Sar1 Ang IIstimulated VSMCs are incubated in
the presence of Bt duplex NF-
B binding site (Methods),
captured by the addition of streptavidin-agarose beads, and bound
proteins are detected with Western blot. This assay allows the precise
detection and quantification of NF-
B proteins whose epitopes may be
masked within the NF-
B · DNA complex.15 As shown
in Figure 4A
, both the 65-kDa Rel A and
50-kDa NF-
B1 subunits were present and constitutively bound in
unstimulated nuclei. However, the binding activity of both proteins was
inducible by Ang II. Moreover, the abundance of both Rel A and NF-
B1
was biphasic and was rapidly increased in Ang II-stimulated nuclei at
0.25 hours, decreased at 1 hour, and gradually reaccumulated over the
next 24 hours. We note that the relative changes in Rel A and NF-
B1
binding exactly paralleled the relative changes in inducible C1
complex binding in the gel shift assay (Figure 3A
).
|
Sequence specificity of Rel A and NF-
B1 binding activities was
determined in the experiment shown in Figure 4B
. In this
competition assay, the Bt-duplex NF-
B binding step was done in the
presence of 10-fold excess of nonbiotinylated duplex WT, NF-
B
(
B), or a nonNF-
B mutation (N
M). Both Rel A and NF-
B1
binding were competed for by the addition of the WT or the N
M
mutations but not the NF-
B (
B), which indicates NF-
B
binding specificity.
Ang II Increases Nuclear Translocation of the 65-kDa Rel A
Isoform
To confirm that the nuclear abundance of Rel A is influenced by
Ang II treatment, which accounts in part for its changes in DNA-binding
activity, Western immunoblots to measure Rel A abundance in
cytoplasmic and sucrose cushionpurified nuclei were performed (Figure 5
, top panel). Sixty-five kilodaltons of
Rel A was predominately cytoplasmic in unstimulated cells, although a
small fraction was nuclear. After Ang II treatment, cytoplasmic Rel A
did not change significantly. However, nuclear Rel A rapidly increased
within 0.25 hours; compared with control levels, Rel A abundance
increased 3.0±1-fold (MEAN±SD, n=3, P<0.05).
This indicated that although a statistically significant change in
nuclear Rel A was detected, the fraction of Rel A translocated into the
nucleus was only a minor fraction of the total cytoplasmic
reservoir.12 28 More importantly, the relative
steady-state changes in Rel A observed in the nuclear compartment after
Ang II stimulation exactly paralleled the changes in NF-
B
binding (Figures 3A
and 4A
).
|
Ang II Increases Cytoplasmic Proteolysis of the c-Rel
Isoform
In epithelial and liver cells,15 c-Rel is a
78-kDa cytoplasmic protein that is regulated by a nuclear
translocation mechanism in parallel with Rel A28 and
inducibly binds with high affinity to NF-
B regulatory
elements.15 28 Western immunoblots of
cytoplasmic and nuclear fractions of Ang II-stimulated VSMCs were also
analyzed for changes in c-Rel abundance (Figure 5
). We
were surprised to observe that c-Rel disappears rapidly from both the
cytoplasmic and nuclear compartments. These data indicate that Ang II
induces a paradoxical disappearance of c-Rel in VSMCs.
Ang II-Induced Transient Proteolysis of the I
B
and ß
Isoforms
The I
B isoforms
and ß are the predominant
inhibitors responsible for Rel A inactivation expressed in
VSMCs.12 To determine whether Ang II stimulation
influences steady-state abundance of I
B
and/or ß, Western
immunoblots were performed on Sar1
Ang IIstimulated cytoplasmic extracts. Thirty-seven kilodaltons of
I
B
and 46-kDa of I
Bß were detected in control cytosolic
extracts (Figure 6A
). For I
B
, 0.25
hours after Ang II treatment, proteolysis was consistently but
weakly discernible. In 3 separate experiments, I
B
abundance was
60±25% of control values at this time point (P<0.05, n=3,
Student t test). I
Bß was also proteolyzed at 0.25 hours
to 70% (range 50% to 90%, n=2) but not thereafter.
|
Compared with our experience of the effect of TNF-
on NF-
B
translocation and I
B proteolysis in other cell systems, the effects
of Sar1 Ang II were small. To determine whether
there are intrinsic differences between NF-
B inducibility and that
of the hormone, the effects of both hormones were analyzed
(Figure 6B
). At maximal doses of each ligand, TNF-
produced a
greater degree of NF-
B binding, Rel A translocation, and I
B
proteolysis than produced by Sar1 Ang II. These
data indicate that TNF-
is a more potent activator of
NF-
B (and I
B
proteolysis) than Sar1 Ang
II.
Late-Phase NF-
B Induction: Ang II Increases 50-kDa NF-
B1
Translocation and Processing From the p105 Precursor
NF-
B1 p50 is the primary DNA binding subunit of NF-
B and is
a processed form of the cytoplasmic 105-kDa precursor.30
In Figure 7A
, immunoblots of
cytoplasmic and sucrose cushionpurified nuclear fractions from
Sar1 Ang IIstimulated VSMCs were incubated with
NH2-terminal antiNF-
B1 antibody to detect
the precursor and mature forms. In control cells, the majority of
NF-
B1 was cytoplasmic, which includes discrete 105-kDa, 84-kDa, and
the mature 50-kDa forms. Similar to Rel A and c-Rel, the majority of
the protein was cytoplasmic, with little of the 50-kDa form being
nuclear. After Ang II treatment, the abundance of 50-kDa NF-
B1
increased monotonically over 24 hours. In addition, we note that the
NF-
B1 p105 and p84 precursors also accumulated in the nucleus.
|
The later increase in nuclear NF-
B1 p50 may be the result of
enhanced processing from the p105 precursor as suggested by the
cytoplasmic accumulation of 60-kDa intermediate NF-
B1 isoforms
(large arrow, Figure 7A
). To help establish the latter
phenomenon, immunoblots of whole-cell lysates from the same
Ang II treatment times were prepared and stained with NF-
B1 antibody
(Figure 7B
). The whole-cell abundance of NF-
B1 p50 increased
from 1 to 24 hours in parallel with the latter phase of nuclear
NF-
B1. These data indicate Ang II perhaps has a biphasic effect on
NF-
B1, initially by promoting its translocation and secondarily by
increasing its processing from the p105 precursor.
Protease Inhibitors That Block NF-
B Activation Also
Block Ang II-Induced Endogenous IL-6 Gene
Expression
Taken together, our data indicated that proteolysis of I
B is
required for the initial phase of Rel A NF-
B1 translocation after
Ang II stimulation in VSMCs. To provide additional information for this
mechanism and determine the relationship of Rel A · NF-
B1
translocation to endogenous IL-6 gene expression, we
pretreated VSMCs with the I
B proteolysis inhibitor
TPCK31 before Ang II stimulation. A gel mobility shift
assay of control and Ang II-stimulated VSMCs in the absence or presence
of the protease inhibitor TPCK (50 µmol/L) and PMSF
as a control is shown in Figure 8A
.
Pretreatment with TPCK but not PMSF completely blocked the appearance
of inducible NF-
B binding. Parallel-treated plates of VSMCs were
subjected to RT-PCR to detect changes in endogenous IL-6
gene transcription (Figure 8B
). IL-6 mRNA was induced in the Ang
II-treated cells but not in Ang II-treated cells pretreated with TPCK.
These data indicate that Rel A · NF-
B1 translocation is
required for endogenous IL-6 gene expression after Ang II
stimulation.
|
| Discussion |
|---|
|
|
|---|
B
activators such as IL-1, TNF, and unidentified serum
components,12 33 we report in this study for the first
time that Ang II is also a pleiotropic activator of the
NF-
B transcription factor family in VSMCs, one of whose function is
to induce the secretion of the acute-phase mediator and vascular growth
factor IL-6. The relationship of NF-
B activation to IL-6 is based on
the observations that (1) Ang II induces NF-
B binding in parallel
with IL-6 gene transcription, (2) site mutations of the NF-
B binding
site block both basal and inducible IL-6 expression, (3) inhibition of
NF-
B translocation by the proteasome inhibitor blocks
endogenous IL-6 expression, and (4) NF-
B is an Ang
II-inducible cis regulatory element (Figure 2
NF-
B in both human and rat VSMCs is an inducible complex composed of
Rel A · NF-
B1 (p50) heterodimers whose increased nuclear
binding is mediated through a process that involves cytoplasmic-nuclear
translocation (this study and 12). After Ang II treatment of
VSMCs, we observe a biphasic pattern of activation of Rel A
· NF-
B1 heterodimers, with a rapid early activation (0.25 hours),
followed by a variable nadir (1 to 2 hours), and a late activation
(6 to 24 hours). The early activation is simultaneous with
a weak degree of I
B
and ß proteolysis in the cytoplasm. The
late activation phase primarily occurs as a result of enhanced
processing of the NF-
B1 p105 precursor into the mature 50-kDa
nuclear DNA-binding subunit. Both I
B proteolysis and p105 processing
are mediated by the ubiquitin-proteasome pathway31 ;
together these observations indicate that Ang II induces intracellular
proteolysis of various NF-
B isoforms through the 26S proteasome.
Taken together, these data implicate a pleiotropic effect of Ang II on
members of the NF-
BI
B family. The early phase of Rel A ·
NF-
B1 translocation is associated with IL-6 gene expression
(measured by Northern blot) and transcriptional activity (measured by
transfection assay). However, after 24 hours, IL-6 mRNA is no longer
expressed even though NF-
B binding activity is detectable. Together,
these data probably indicate that the IL-6 gene may be actively
repressed (after its activation) in a manner dominant to NF-
B
binding.
Other investigators have shown that in VSMCs, the effect of
NF-
Binducing hormones on steady-state levels of the I
B
inhibitors is not equivalent. For example, the
cytokine IL-1ß induces a pattern of sequential I
B
proteolysis, with a rapid I
B
proteolysis (at 30 minutes) followed
by a later I
Bß proteolysis (2 hours), which results in a sustained
profile of nuclear Rel A · NF-
B1 binding.12 The
IL-1like cytokine TNF-
only induces I
B
but not
I
Bß proteolysis and only a transient pattern of NF-
B
binding.12 In this study we observe that at maximal
agonist doses, Sar1 Ang II and TNF-
induce
I
B
proteolysis to a different extent, with Ang II inducing a
combined (weak, but statistically significant) I
B
and I
Bß
proteolysis. These data indicate that the I
B molecules are subject
to differential hormonal regulation by Ang II and cytokines in
VSMCs.
Our data also implicate a delayed effect of Ang II on NF-
B1
processing in VSMCs. NF-
B1 p50 is the
NH2-terminal DNA-binding product of p105
precursor processing.30 The proteolyzed COOH terminal
region of p105 contains repeated domains homologous to erythrocyte
ankyrin and functions as an I
B-like molecule retaining Rel A and/or
c-Rel in the cytoplasm.34 In various cell types, p105 is
inducibly phosphorylated and proteolyzed through a
mid-molecule glycine-rich region.31 After p105 processing,
sequestered Rel A and NF-
B1 DNA-binding subunits are released for
subsequent translocation into the cell nucleus. Our data indicate that
NF-
B1p105 is not only inducibly processed but also undergoes nuclear
translocation 6 hours after Ang II stimulation. We do not believe that
this is due to cytoplasmic contamination of our nuclear preparations
because our highly purified nuclei (prepared by sucrose cushion
centrifugation) are devoid of cytoplasmic
markers.28 Cytoplasmic-nuclear translocation of p105 has
not been described in VSMCs. However, in Epstein barr
virusinfected B lymphocytes, NF-
B1 p105 was observed to be
nuclear and processed within the nucleus.39 One
well-described activator of NF-
B processing is the
potent protein kinase C agonist phorbol 12-myristate
13-acetate.35 It is noteworthy that Ang II is a potent
activator of protein kinase C; we speculate that this may
be a common pathway used in Ang II induction of NF-
B1
processing.
c-Rel is a transactivating protein found in cytokine-inducible
NF-
B complexes in epithelial cells15 whose
nuclear-cytoplasmic translocation is also controlled by complex with
I
B
and I
Bß.36 37 38 A surprising observation in
this study is that cytoplasmic c-Rel is proteolyzed after Ang II
treatment and not translocated into the nucleus. c-Rel has been
implicated in growth arrest at the G1/S-phase boundary39 ;
we speculate its proteolysis may be required for Ang II-induced
activation of quiescent VSMCs.3
Within the context of the atheromatous
arterial wall, a variety of NF-
B activators
have been identified, including cytokines, IL-1, TNF-
,
thrombin, and oxidized LDL,12 32 40 that act on
endothelial, macrophage, T-lymphocyte, and
smooth muscle cells to express genes important in the
fibroproliferative response, including vascular cell adhesion
molecule-1 tissue factor, colony stimulating factors, and chemotactic
cytokines. These factors function in a paracrine way on
resident cells to facilitate intercellular interactions and amplify the
inflammatory response. We propose that Ang II, the central effector
molecule of the activated RAS, also participates in the
phenotypic switch of VSMCs into cells with endocrine functions, thereby
producing IL-6 and perhaps other NF-
Bregulated genes. Within the
vessel wall, IL-6 is likely to play several important roles. Although
IL-6 is an activator of acute-phase reactant expression in
liver cells and antibody production in B lymphocytes, IL-6
functions as an autocrine growth factor in VSMCs through its ability to
influence PDGF expression.20 Additionally, IL-6 may also
play an important chemotactic role in stimulating progenitor cells that
have transmigrated through the activated
endothelium.16
In summary, Ang II the octapeptide effector of the activated
RAS, mediates IL-6 expression in VSMCs through pleiotropic effects on
the NF-
B family of transcriptional regulators. These observations
further underscore the link between the activated RAS and
inflammatory cytokine expression or activation in the vascular
wall.
| Acknowledgments |
|---|
Received June 29, 1998; accepted January 14, 1999.
| References |
|---|
|
|
|---|
2.
Griendling KK, Ushio-Fukai M, Lassegue B, Alexander
RW. Angiotensin II signaling in vascular smooth muscle.
Hypertension. 1997;29:366373.
3.
Hershey JC, Hautman M, Thompson MM, Rothblum LI,
Haystead TAJ, Owens GK. Angiotensin II-induced
hypertrophy of rat vascular smooth muscle is associated
with increased 18S rRNA synthesis and phosphorylation
of the rRNA transcription factor, upstream binding factor. J
Biol Chem. 1995;270:2509625101.
4. Kato H, Suzuki H, Tajima S. Angiotensin II stimulates collagen synthesis in cultured vascular smooth muscle cells. J Hypertens. 1991;9:1722.[Medline] [Order article via Infotrieve]
5. Naftilan AJ, Pratt RE, Dzau VJ. Induction of platelet-derived growth factor A-chain and c-myc gene expressions by angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:14191424.
6.
Taubman MB, Berk BC, Izumo S, Tsuda T, Alexander RW,
Nadal-Ginard B. Angiotensin II induces c-fos
mRNA in aortic smooth muscle: role of Ca2+
mobilization and protein kinase C activation. J Biol
Chem. 1989;264:526530.
7.
Naftilan A, Pratt RE, Eldridge CS, Lin HL, Dzau V.
Angiotensin II induces c-fos expression in
smooth muscle via transcriptional control. Hypertension. 1989;13:706711.
8. Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontaine P, Bernstein KE. Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor. Nature. 1995;375:247250.[Medline] [Order article via Infotrieve]
9. Neyses L, Nouskas J, Luyken J, Fronhoffs S, Oberdorf S, Pfeifer U, Williams RS, Sukhatme VP, Vetter H. Induction of immediate-early genes by angiotensin II and endothelin-1 in adult rat cardiomyocytes. J Hypertens. 1993;11:927934.[Medline] [Order article via Infotrieve]
10.
Clark AJ, Balla T, Jones MR, Catt KJ. Stimulation of
early gene expression by angiotensin II in bovine adrenal
glomerulosa cells: roles of calcium and protein kinase C. Mol
Endocrinol. 1992;6:18891898.
11.
Li J, Brasier AR. Angiotensinogen gene
activation by AII is mediated by the Rel A (NF-
B p65)
transcription factor: one mechanism for the renin
angiotensin system (RAS) positive feedback loop in
hepatocytes. Mol Endocrinol. 1996;10:252264.
12.
Bourcier T, Sukhova G, Libby P. The nuclear
factor-
B signaling pathway participates in dysregulation of
vascular smooth muscle cells in vitro and in human
atherosclerosis. J Biol Chem. 1997;272:1581715824.
13.
Siebenlist U, Franzoso G, Brown K. Structure,
regulation and function of NF-
B. Annu Rev Cell Biol. 1994;10:405455.
14.
Brasier AR, Li J. Mechanisms for inducible control of
angiotensinogen gene transcription.
Hypertension. 1996;27:465475.
15.
Brasier AR, Jamaluddin M, Casola A, Duan W, Shen Q,
Garofalo R. A promoter recruitment mechanism for TNF
-induced
IL-8 transcription in type II pulmonary epithelial cells:
dependence on nuclear abundance of Rel A, NF-
B1 and c-Rel
transcription factors. J Biol Chem. 1998;273:35513561.
16. Akira S, Kishimoto T. IL-6 and NF-IL6 in acute-phase response and viral infection. Immunol Rev. 1992;127:2550.[Medline] [Order article via Infotrieve]
17. Loppnow H, Libby P. Proliferating or interleukin-1 activated human vascular smooth muscle cells secrete copious IL-6. J Clin Invest. 1990;85:731738.
18. Gaumond F, Fortin D, Stankova J, Rola-Pleszczynski M. Differential signaling pathways in platelet-activating factor-induced proliferation and interleukin-6 production by rat vascular smooth muscle cells. J Cardiovasc Pharmacol. 1997;30:169175.[Medline] [Order article via Infotrieve]
19. Beasley D. Phorbol ester and interleukin-1 induce interleukin-6 gene expression in vascular smooth muscle cells via independent pathways. J Cardiovasc Pharmacol. 1997;29:323330.[Medline] [Order article via Infotrieve]
20.
Ikeda U, Ikeda M, Oohara T, Oguchi A, Kamitani T,
Tsuruya Y, Kano S. Interleukin-6 stimulates growth of vascular smooth
muscle cells in a PDGF-dependent manner. Am J Physiol. 1991;260:H1713H1717.
21.
Loppnow H, Bil R, Hirt S, Schonbeck W, Herzberg M,
Werdan K, Rietschel ET, Brandt E, Flad HD. Platelet derived IL-1
induces cytokine production, but not proliferation of
human vascular smooth muscle cells. Blood. 1998;91:134141.
22. Yasukawa K, Hirano T, Watanabe Y, Muratani K, Matsuda T, Nakai S, Kishimoto T. Structure and expression of human B-cell stimulatory factor-2 (BSF-2/IL-6) gene. EMBO J. 1987;6:29392945.[Medline] [Order article via Infotrieve]
23.
Gunther S, Alexander RW, Atkinson WJ, Gimbrone M Jr.
Functional angiotensin II receptors in cultured vascular
smooth muscle. J Cell Biol. 1982;92:289298.
24.
Azuma H. Blockade of T-cell costimulation prevents
development of experimental chronic renal allograft rejection.
Proc Natl Acad Sci U S A. 1996;93:1243912444.
25. Brasier AR, Tate JE, Habener JF. Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques. 1989;7:11161122.[Medline] [Order article via Infotrieve]
26. Garofalo R, Sabry M, Jamaluddin M, Yu RK, Casola A, Ogra PL, Brasier AR. Transcriptional activation of the interleukin-8 gene by RSV infection in alveolar epithelial cells: nuclear translocation of the Rel A transcription factor as a mechanism producing airway mucosal inflammation. J Virol. 1996;70:87738781.[Abstract]
27.
Brasier AR, Li J, Wimbish KA. Tumor necrosis factor
activates angiotensinogen gene expression by the
Rel A transactivator. Hypertension. 1996;27:10091017.
28.
Han Y, Brasier AR. Mechanism for biphasic Rel A:
NF-
B1 nuclear translocation in tumor necrosis factor
-stimulated hepatocytes. J Biol Chem. 1997;272:98239830.
29.
Grumont RJ, Fecondo J, Gerondakis S. Alternate RNA
splicing of murine nfkb1 generates a nuclear isoform of the
p50 precursor NF-
B1 that can function as a
transactivator of NF-
B-regulated transcription.
Mol Cell Biol. 1994;14:84608470.
30.
Kieran M, Blank V, Logeat F, Vandekerckhove J,
Lottspeich F, Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A.
The DNA binding subunit of NF-
B is identical to factor KBF1 and
homologous to the rel oncogene product. Cell. 1990;62:10071018.[Medline]
[Order article via Infotrieve]
31.
Palombella VJ, Rando OJ, Goldberg AL, Maniatis T. The
ubiquitin-proteasome pathway is required for processing the
NF-
B1 precursor protein and the activation of NF-kB.
Cell. 1994;78:773785.[Medline]
[Order article via Infotrieve]
32. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801809.[Medline] [Order article via Infotrieve]
33.
Obata H, Biro S, Armia N, Kaieda H, Kihara T, Eto Hi,
Miyata M, Tanaka H. NF-
B is induced in the nuclei of cultured
rat aortic smooth muscle cells by stimulation of various growth
factors. Biochem Biophys Res Comm. 1996;224:2732.[Medline]
[Order article via Infotrieve]
34.
Mercurio F, DiDonato JA, Rosette C, Karin M. p105 and
p98 precursor proteins play an active role in NF-
B-mediated
signal transduction. Genes Dev. 1993;7:705718.
35. Baldassarre F, Mallardo M, Mezza E, Scala G, Quinto I. Regulation of NF-kB through the nuclear processing of p105 (NF-kB1) in Epstein-Barr Virus-immortalized B cell lines. Mol Cell Biol. 1995;270:3124431248.
36.
Thompson JE, Phillips RJ, Erdjument-Bromage H, Tempst
P, Ghosh S. I
B-ß regulates the persistent response in a
biphasic activation of NF-
B. Cell. 1995;80:573582.[Medline]
[Order article via Infotrieve]
37.
Rice NR, Ernst MK. In vivo control of NF-
B
activation by I
B alpha. EMBO J. 1993;12:46854695.[Medline]
[Order article via Infotrieve]
38.
Ernst MK, Dunn LL, Rice NR. The PEST-like sequence of
I
B is responsible for inhibition of DNA binding but not for
cytoplasmic retention of c-Rel or Rel A homodimers. Mol Cell
Biol. 1995;15:872882.[Abstract]
39. Bash J, Zong WX, Gelinas C. c-Rel arrests the proliferation of HeLa cells and affects critical regulations of the G1/S-phase transition. Mol Cell Biol. 1997;17:65266536.[Abstract]
40.
Brand K, Page S, Rogler G, Bartsch A, Brandl R,
Kneuchel R, Page M, Kaltschmidt C, Baeuerle PA, Neumeier D.
Activated transcription factor nuclear factor-
B is
present in the atherosclerotic lesion. J Clin
Invest. 1996;97:17151722.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
D. Bunout, G. Barrera, M. P. de la Maza, L. Leiva, C. Backhouse, and S. Hirsch Effects of enalapril or nifedipine on muscle strength or functional capacity in elderly subjects. A double blind trial Journal of Renin-Angiotensin-Aldosterone System, June 1, 2009; 10(2): 77 - 84. [Abstract] [PDF] |
||||
![]() |
J.-Y. Huang, J.-W. Liao, Y.-C. Liu, S.-Y. Lu, C.-P. Chou, W.-H. Chan, S.-U. Chen, and T.-H. Ueng Motorcycle Exhaust Induces Reproductive Toxicity and Testicular Interleukin-6 in Male Rats Toxicol. Sci., May 1, 2008; 103(1): 137 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wei, K. Chen, A. T. Whaley-Connell, C. S. Stump, J. A. Ibdah, and J. R. Sowers Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R673 - R680. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. I. Schrader, D. A. Kinzenbaw, A. W. Johnson, F. M. Faraci, and S. P. Didion IL-6 Deficiency Protects Against Angiotensin II Induced Endothelial Dysfunction and Hypertrophy Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2576 - 2581. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ni, Y. Zhan, H. He, E. Maynard, J. A. Balschi, and P. Oettgen Ets-1 Is a Critical Transcriptional Regulator of Reactive Oxygen Species and p47phox Gene Expression in Response to Angiotensin II Circ. Res., November 9, 2007; 101(10): 985 - 994. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, Y. Doerffel, B. Hocher, and T. Unger Inflammation in the genesis of hypertension and its complications the role of angiotensin II Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3107 - 3109. [Full Text] [PDF] |
||||
![]() |
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Choudhary, M. Lu, R. Cui, and A. R. Brasier Involvement of a Novel Rac/RhoA Guanosine Triphosphatase-Nuclear Factor-{kappa}B Inducing Kinase Signaling Pathway Mediating Angiotensin II-Induced RelA Transactivation Mol. Endocrinol., September 1, 2007; 21(9): 2203 - 2217. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Pagano and D. D. Gutterman The adventitia: The outs and ins of vascular disease Cardiovasc Res, September 1, 2007; 75(4): 636 - 639. [Full Text] [PDF] |
||||
![]() |
M. J. Haurani and P. J. Pagano Adventitial fibroblast reactive oxygen species as autacrine and paracrine mediators of remodeling: Bellwether for vascular disease? Cardiovasc Res, September 1, 2007; 75(4): 679 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wei, A. T. Whaley-Connell, K. Chen, J. Habibi, G. M.-E. Uptergrove, S. E. Clark, C. S. Stump, C. M. Ferrario, and J. R. Sowers NADPH Oxidase Contributes to Vascular Inflammation, Insulin Resistance, and Remodeling in the Transgenic (mRen2) Rat Hypertension, August 1, 2007; 50(2): 384 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sahar, M. A. Reddy, C. Wong, L. Meng, M. Wang, and R. Natarajan Cooperation of SRC-1 and p300 With NF-{kappa}B and CREB in Angiotensin II-Induced IL-6 Expression in Vascular Smooth Muscle Cells Arterioscler Thromb Vasc Biol, July 1, 2007; 27(7): 1528 - 1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Marik and J. Varon Hypertensive Crises: Challenges and Management Chest, June 1, 2007; 131(6): 1949 - 1962. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Adamzik, U. Frey, S. Sixt, L. Knemeyer, M. Beiderlinden, J. Peters, and W. Siffert ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS Eur. Respir. J., March 1, 2007; 29(3): 482 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ruef, M. Browatzki, C. A. Pfeiffer, J. Schmidt, and R. Kranzhofer Angiotensin II promotes the inflammatory response to CD40 ligation via TRAF-2 Vascular Medicine, February 1, 2007; 12(1): 23 - 27. [Abstract] [PDF] |
||||
![]() |
T. Kurihara, Y. Ozawa, K. Shinoda, N. Nagai, M. Inoue, Y. Oike, K. Tsubota, S. Ishida, and H. Okano Neuroprotective Effects of Angiotensin II Type 1 Receptor (AT1R) Blocker, Telmisartan, via Modulating AT1R and AT2R Signaling in Retinal Inflammation Invest. Ophthalmol. Vis. Sci., December 1, 2006; 47(12): 5545 - 5552. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gadonski, B. B. D. LaMarca, E. Sullivan, W. Bennett, D. Chandler, and J. P. Granger Hypertension Produced by Reductions in Uterine Perfusion in the Pregnant Rat: Role of Interleukin 6 Hypertension, October 1, 2006; 48(4): 711 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Cui, B. Tieu, A. Recinos, R. G. Tilton, and A. R. Brasier RhoA Mediates Angiotensin II-Induced Phospho-Ser536 Nuclear Factor {kappa}B/RelA Subunit Exchange on the Interleukin-6 Promoter in VSMCs Circ. Res., September 29, 2006; 99(7): 723 - 730. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Zschenker, T. Illies, and D. Ameis Overexpression of lysosomal Acid lipase and other proteins in atherosclerosis. J. Biochem., July 1, 2006; 140(1): 23 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
V Teplitsky, Y Shoenfeld, and A Tanay The renin-angiotensin system in lupus: physiology, genes and practice, in animals and humans Lupus, June 1, 2006; 15(6): 319 - 325. [Abstract] [PDF] |
||||
![]() |
A. Douillette, A. Bibeau-Poirier, S.-P. Gravel, J.-F. Clement, V. Chenard, P. Moreau, and M. J. Servant The Proinflammatory Actions of Angiotensin II Are Dependent on p65 Phosphorylation by the I{kappa}B Kinase Complex J. Biol. Chem., May 12, 2006; 281(19): 13275 - 13284. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, Y. Liu, H. Liu, P. L. Hermonat, and J. L. Mehta Molecular Dissection of Angiotensin II-Activated Human LOX-1 Promoter Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 1163 - 1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tedgui and Z. Mallat Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways Physiol Rev, April 1, 2006; 86(2): 515 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Granger An emerging role for inflammatory cytokines in hypertension Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H923 - H924. [Full Text] [PDF] |
||||
![]() |
D. L. Lee, L. C. Sturgis, H. Labazi, J. B. Osborne Jr., C. Fleming, J. S. Pollock, M. Manhiani, J. D. Imig, and M. W. Brands Angiotensin II hypertension is attenuated in interleukin-6 knockout mice Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H935 - H940. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, J. Cheng, Y. Ma, W. Thomas, J. Zhang, and J. Du Dual Pathways for Nuclear Factor {kappa}B Activation by Angiotensin II in Vascular Smooth Muscle: Phosphorylation of p65 by I{kappa}B Kinase and Ribosomal Kinase Circ. Res., November 11, 2005; 97(10): 975 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Carter, G. Onder, S. B. Kritchevsky, and M. Pahor Angiotensin-Converting Enzyme Inhibition Intervention in Elderly Persons: Effects on Body Composition and Physical Performance J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2005; 60(11): 1437 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Z. Shi and S. K. Sarna Transcriptional regulation of inflammatory mediators secreted by human colonic circular smooth muscle cells Am J Physiol Gastrointest Liver Physiol, August 1, 2005; 289(2): G274 - G284. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Amar, J.-B. Ruidavets, J.-C. Peyrieux, J.-M. Mallion, J. Ferrieres, M. E. Safar, and B. Chamontin C-Reactive Protein Elevation Predicts Pulse Pressure Reduction in Hypertensive Subjects Hypertension, July 1, 2005; 46(1): 151 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, Y. Ma, J. Zhang, J. Cheng, and J. Du A New Cellular Signaling Mechanism for Angiotensin II Activation of NF-{kappa}B: An I{kappa}B-Independent, RSK-Mediated Phosphorylation of p65 Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1148 - 1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling J. Biol. Chem., April 29, 2005; 280(17): 17435 - 17448. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Chung, Y.-H. Chen, and M. A. Perrella Role of Ets-2 in the Regulation of Heme Oxygenase-1 by Endotoxin J. Biol. Chem., February 11, 2005; 280(6): 4578 - 4584. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Weisberg, F. Albornoz, J. P. Griffin, D. L. Crandall, H. Elokdah, A. B. Fogo, D. E. Vaughan, and N. J. Brown Pharmacological Inhibition and Genetic Deficiency of Plasminogen Activator Inhibitor-1 Attenuates Angiotensin II/Salt-Induced Aortic Remodeling Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 365 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J.E. Sattler, J. E. Woodrum, O. Galili, M. Olson, S. Samee, F. B. Meyer, X.-Y. Zhu, L. O. Lerman, and A. Lerman Concurrent Treatment With Renin-Angiotensin System Blockers and Acetylsalicylic Acid Reduces Nuclear Factor {kappa}B Activation and C-Reactive Protein Expression in Human Carotid Artery Plaques Stroke, January 1, 2005; 36(1): 14 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sanz-Rosa, M. P. Oubina, E. Cediel, N. de las Heras, O. Vegazo, J. Jimenez, V. Lahera, and V. Cachofeiro Effect of AT1 receptor antagonism on vascular and circulating inflammatory mediators in SHR: role of NF-{kappa}B/I{kappa}B system Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H111 - H115. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, A.-P. Arrigo, and R. W. Currie Heat shock treatment suppresses angiotensin II-induced activation of NF-{kappa}B pathway and heart inflammation: a role for IKK depletion by heat shock? Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1104 - H1114. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Skurk, V. van Harmelen, and H. Hauner Angiotensin II Stimulates the Release of Interleukin-6 and Interleukin-8 From Cultured Human Adipocytes by Activation of NF-{kappa}B Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1199 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wassmann, M. Stumpf, K. Strehlow, A. Schmid, B. Schieffer, M. Bohm, and G. Nickenig Interleukin-6 Induces Oxidative Stress and Endothelial Dysfunction by Overexpression of the Angiotensin II Type 1 Receptor Circ. Res., March 5, 2004; 94(4): 534 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Monaco and E. Paleolog Nuclear factor {kappa}B: a potential therapeutic target in atherosclerosis and thrombosis Cardiovasc Res, March 1, 2004; 61(4): 671 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Taniyama and K. K. Griendling Reactive Oxygen Species in the Vasculature: Molecular and Cellular Mechanisms Hypertension, December 1, 2003; 42(6): 1075 - 1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. R. Kanakiriya, A. J. Croatt, J. J. Haggard, J. R. Ingelfinger, S.-S. Tang, J. Alam, and K. A. Nath Heme: a novel inducer of MCP-1 through HO-dependent and HO-independent mechanisms Am J Physiol Renal Physiol, March 1, 2003; 284(3): F546 - F554. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pelletier, F. Duhamel, P. Coulombe, M. R. Popoff, and S. Meloche Rho Family GTPases Are Required for Activation of Jak/STAT Signaling by G Protein-Coupled Receptors Mol. Cell. Biol., February 15, 2003; 23(4): 1316 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yan, D. Kim, T. Aizawa, and B. C. Berk Functional Interplay Between Angiotensin II and Nitric Oxide: Cyclic GMP as a Key Mediator Arterioscler Thromb Vasc Biol, January 1, 2003; 23(1): 26 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. De Caterina and C. Manes Inflammation in early atherogenesis: impact of ACE inhibition Eur. Heart J. Suppl., January 1, 2003; 5(suppl_A): A15 - A24. [Abstract] [PDF] |
||||
![]() |
B. Schieffer Interaction of interleukin-6 and angiotensin II in atherosclerosis: culprit for inflammation? Eur. Heart J. Suppl., January 1, 2003; 5(suppl_A): A25 - A30. [Abstract] [PDF] |
||||
![]() |
D. M. Tham, B. Martin-McNulty, Y.-x. Wang, D. W. Wilson, R. Vergona, M. E. Sullivan, W. Dole, and J. C. Rutledge Angiotensin II is associated with activation of NF-{kappa}B-mediated genes and downregulation of PPARs Physiol Genomics, October 2, 2002; 11(1): 21 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Brasier, A. Recinos III, and M. S. Eledrisi Vascular Inflammation and the Renin-Angiotensin System Arterioscler Thromb Vasc Biol, August 1, 2002; 22(8): 1257 - 1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tian, Y. Zhang, B. A. Luxon, R. P. Garofalo, A. Casola, M. Sinha, and A. R. Brasier Identification of NF-{kappa}B-Dependent Gene Networks in Respiratory Syncytial Virus-Infected Cells J. Virol., June 5, 2002; 76(13): 6800 - 6814. [Abstract] [Full Text] [PDF] |
||||
![]() |
D J Brull, J Sanders, A Rumley, G D Lowe, S E Humphries, and H E Montgomery Impact of angiotensin converting enzyme inhibition on post-coronary artery bypass interleukin 6 release Heart, March 1, 2002; 87(3): 252 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hattori, M. Suzuki, S. Hattori, and K. Kasai Vascular Smooth Muscle Cell Activation by Glycated Albumin (Amadori Adducts) Hypertension, January 1, 2002; 39(1): 22 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ruiz-Ortega, O. Lorenzo, M. Ruperez, V. Esteban, Y. Suzuki, S. Mezzano, J.J. Plaza, and J. Egido Role of the Renin-Angiotensin System in Vascular Diseases: Expanding the Field Hypertension, December 1, 2001; 38(6): 1382 - 1387. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Keidar, R. Heinrich, M. Kaplan, T. Hayek, and M. Aviram Angiotensin II Administration to Atherosclerotic Mice Increases Macrophage Uptake of Oxidized LDL: A Possible Role for Interleukin-6 Arterioscler Thromb Vasc Biol, September 1, 2001; 21(9): 1464 - 1469. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Libby Current Concepts of the Pathogenesis of the Acute Coronary Syndromes Circulation, July 17, 2001; 104(3): 365 - 372. [Full Text] [PDF] |
||||
![]() |
B. C. Berk Vascular Smooth Muscle Growth: Autocrine Growth Mechanisms Physiol Rev, July 1, 2001; 81(3): 999 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ruiz-Ortega, O. Lorenzo, M. Ruperez, J. Blanco, and J. Egido Systemic Infusion of Angiotensin II into Normal Rats Activates Nuclear Factor-{{kappa}}B and AP-1 in the Kidney : Role of AT1 and AT2 Receptors Am. J. Pathol., May 1, 2001; 158(5): 1743 - 1756. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Dzau Tissue Angiotensin and Pathobiology of Vascular Disease : A Unifying Hypothesis Hypertension, April 1, 2001; 37(4): 1047 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Luft Workshop: Mechanisms and Cardiovascular Damage in Hypertension Hypertension, February 1, 2001; 37(2): 594 - 598. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schieffer, M. Luchtefeld, S. Braun, A. Hilfiker, D. Hilfiker-Kleiner, and H. Drexler Role of NAD(P)H Oxidase in Angiotensin II-Induced JAK/STAT Signaling and Cytokine Induction Circ. Res., December 8, 2000; 87(12): 1195 - 1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Abbott, J. R. Loss II, A. M. Robida, and T. J. Murphy Evidence That Galpha q-Coupled Receptor-Induced Interleukin-6 mRNA in Vascular Smooth Muscle Cells Involves the Nuclear Factor of Activated T Cells Mol. Pharmacol., November 1, 2000; 58(5): 946 - 953. [Abstract] [Full Text] |
||||
![]() |
M. Ruiz-Ortega, O. Lorenzo, M. Ruperez, S. Konig, B. Wittig, and J. Egido Angiotensin II Activates Nuclear Transcription Factor {kappa}B Through AT1 and AT2 in Vascular Smooth Muscle Cells : Molecular Mechanisms Circ. Res., June 23, 2000; 86(12): 1266 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsutamoto, A. Wada, K. Maeda, N. Mabuchi, M. Hayashi, T. Tsutsui, M. Ohnishi, M. Sawaki, M. Fujii, T. Matsumoto, et al. Angiotensin II type 1 receptor antagonist decreases plasma levels of tumor necrosis factor alpha, interleukin-6 and soluble adhesion molecules in patients with chronic heart failure J. Am. Coll. Cardiol., March 1, 2000; 35(3): 714 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuhara, R. L. Geary, D. I. Diz, P. E. Gallagher, J. A. Wilson, S. S. Glazier, R. H Dean, and C. M. Ferrario Angiotensin-Converting Enzyme Expression in Human Carotid Artery Atherosclerosis Hypertension, January 1, 2000; 35(1): 353 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mervaala, D. N. Muller, J.-K. Park, R. Dechend, F. Schmidt, A. Fiebeler, M. Bieringer, V. Breu, D. Ganten, H. Haller, et al. Cyclosporin A Protects Against Angiotensin II-Induced End-Organ Damage in Double Transgenic Rats Harboring Human Renin and Angiotensinogen Genes Hypertension, January 1, 2000; 35(1): 360 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kanke, S. R. Macfarlane, M. J. Seatter, E. Davenport, A. Paul, R. C. McKenzie, and R. Plevin Proteinase-activated Receptor-2-mediated Activation of Stress-activated Protein Kinases and Inhibitory kappa B Kinases in NCTC 2544 Keratinocytes J. Biol. Chem., August 17, 2001; 276(34): 31657 - 31666. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fu, X. Zhu, Q. Wang, J. Zhang, Q. Song, H. Zheng, W. Ogawa, J. Du, and Y. E. Chen Platelet-Derived Growth Factor Promotes the Expression of Peroxisome Proliferator-Activated Receptor {gamma} in Vascular Smooth Muscle Cells by a Phosphatidylinositol 3-Kinase/Akt Signaling Pathway Circ. Res., November 23, 2001; 89(11): 1058 - 1064. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |