Original Contribution |
From INSERM U153, Institut de Myologie (N.N., N.V., C.D., B.H., K.S., P.G.), Hôpital Pitié-Salpêtrière, Paris, France; Service de Biochimie B (P.R., L.D., B.H.), Hôpital Pitié-Salpêtrière, Paris, France; Service de Cardiologie (N.N., I.D., P.C.), Hôpital Lariboisière, Paris, France; Institute of Pediatry and Children Surgery (M.S.), Moscow, Russia; Falvaloro Foundation (R.P.), Buenos Aires, Argentina; and Service de Cardiologie (P.C.), Hôpital Louis Pradel, Lyon, France.
Correspondence to Nathalie Neyroud, INSERM U153, Institut de Myologie, Groupe Hospitalier Pitié-Salpêtrière, 47 boulevard de l'Hôpital, 75013 Paris, France. E-mail nneyroud{at}myologie.infobiogen.fr
| Abstract |
|---|
|
|
|---|
subunit of the KVLQT1
channel cause the long-QT syndrome (LQTS). The autosomal dominant form
of this cardiac disease, the Romano-Ward syndrome, is characterized by
a prolongation of the QT interval, ventricular
arrhythmias, and sudden death. The autosomal recessive form,
the Jervell and Lange-Nielsen syndrome, also includes bilateral
deafness. In the present study, we report the entire genomic
structure of KCNQ1, which consists of 19 exons spanning
400 kb on chromosome 11p15.5. We describe the sequences of exon-intron
boundaries and oligonucleotide primers that allow
polymerase chain reaction (PCR) amplification of exons from genomic
DNA. Two new (CA)n repeat microsatellites were found in
introns 10 and 14. The present study provides helpful tools for the
linkage analysis and mutation screening of the complete
KCNQ1 gene. By use of these tools, five novel mutations
were identified in LQTS patients by PCRsingle-strand
conformational polymorphism (SSCP) analysis in the
C-terminal part of KCNQ1: two missense mutations, a
20-bp and 1-bp deletions, and a 1-bp insertion. Such mutations in the
C-terminal domain of the gene may be more frequent than previously
expected, because this region has not been analyzed so far.
This could explain the low percentage of mutations found in large
LQTS cohorts.
Key Words: KCNQ1 KVLQT1 K+ channel long-QT syndrome
| Introduction |
|---|
|
|
|---|
KCNQ1 genomic organization has been partially described by Lee et al7 without reporting intronic sequences flanking the exons. Analysis of the gene demonstrated that at least 6 alternative splice variants can exist that differ depending on the use of the several exons located in the 5' part of the gene.3 4 7 15 16 Two major 5' splice variants are present in human heart. A full-length isoform, isoform 1, which contains an open reading frame encoding a 676-amino acid polypeptide and a truncated isoform, isoform 2, which encodes a 549-amino acid protein lacking the cytoplasmic N-terminus and the initial part of the first transmembrane domain S1.7 15 17 Both isoforms have been expressed by transfection in COS or HEK cells, but only isoform 1 produced the IKs current when associated with MinK.3 15 However, isoform 2 has a dominant-negative effect on the IKs current when coexpressed with isoform 1 and MinK.18 19
A better knowledge of the KCNQ1 gene structure and intronic sequences flanking the exon boundaries is essential for identifying LQTS-associated mutations and their pathophysiological consequences. In the present study, we have determined the complete genomic organization and sequence of the human KCNQ1 gene by virtual screening of public sequence databases. KCNQ1 contains 19 exons and exceeds 400 000 bp, suggesting a possibility of intragenic recombinations. We localized the (CA)n microsatellite D11S4088 in KCNQ1 and determined two new intragenic microsatellites that will be helpful for the linkage analysis. Further, we identified five novel mutations in the C-terminal part of the gene, which has not been analyzed so far from genomic DNA. The availability of tools to screen the entire KCNQ1 gene should increase the percentage of mutations found in large LQTS cohorts.
| Materials and Methods |
|---|
|
|
|---|
Characterization of Three (CA)n Repeat
Polymorphisms in KCNQ1
The BLASTN program was used to search for
(CA)n repeat polymorphisms and to localize
known microsatellites in the KCNQ1 introns. Polymerase chain
reaction (PCR) amplification and analysis of microsatellite
markers obtained were carried out as previously
described.6
Subjects
Ninety-three LQTS families (84 RW and 9 JLN families) were
enrolled in a large genetic study. LQTS mutations have previously been
identified in KCNQ1 and reported for some of the
families.6 17 21 22 In the remaining 53 families,
clinical evaluation was made and blood samples were collected after
written informed consent was obtained in accordance with the guidelines
established by the Comité Consultatif de Protection des Personnes
dans la Recherche Biomédicale du Groupe Hospitalier de la
Pitié-Salpêtrière (Paris, France). All subjects
underwent clinical and cardiovascular examinations,
including a 12-lead ECG. Subjects were considered as being affected by
the RW syndrome when they presented with (1) syncopes or
documented torsades de pointes, (2) a QTc interval (QT interval
measured in lead II and corrected for heart rate by the Bazett formula)
>460 ms, or (3) a QTc>440 ms associated with bradycardia or abnormal
T-wave pattern.21 Subjects were considered as being
affected by the JLN syndrome when they presented with a
QTc>460 ms associated with syncopes and congenital bilateral
deafness.6
In RW family 11356 (Figure 2
), the proband died suddenly at the
age of 30 years under treatment for an abscessed tonsillitis. At the
age of 66 years, his affected mother began to experience several
syncopes at rest. In RW family E-973, the proband experienced several
syncopes triggered by emotion since the age of 6 years, whereas her
affected mother was asymptomatic. In RW family 11232, the
proband experienced several stress-induced syncopes since the age of 3
years, but her affected father was asymptomatic.
|
In JLN family 12664, the JLN patient was deaf and experienced his first syncope at the age of 2 years. In JLN family 9976, the JLN patient was deaf and experienced his first syncope at 13 months, but his heterozygous father was asymptomatic.
Single-Strand Conformational Polymorphism (SSCP)
Analysis and Direct Sequencing of the PCR Products
The primers were constructed on the basis of flanking intron
sequences and were used to amplify each exon (Table 1
). The touchdown PCRs were performed
from LQTS patient genomic DNA by decreasing the annealing temperature
in the first 10 cycles according to the conditions reported in Table 1
. For SSCP, the PCR products were denatured for 5 minutes
at 96°C in a low ionic strength solution, which generates stable
single-stranded DNA,23 kept on ice for 5 minutes, loaded
onto a 10% polyacrylamide gel, and run at 8 mA, at 25°C and
7°C, in a Hoefer apparatus. The bands were
visualized after silver staining of the gels (Bio-Rad). The PCR
products were sequenced by the dideoxynucleotide chain
termination method with fluorescent
dideoxynucleotides on an ABI-Prism 377 DNA sequencer
(Perkin-Elmer/Applied Biosystems).
|
| Results |
|---|
|
|
|---|
The schematic organization of the human KCNQ1 gene and the
alignment of exons with structural domains of the protein are shown in
Figure 1
. The gene spans more than 400 kb
and contains 19 exons. We identified an additional exon in the 3' part
of KCNQ1, thus completing the partial genomic organization
published by Lee et al.7 The region previously
identified on the cDNA sequence as exon 117 corresponds,
in fact, to exons 11 and 12, which are separated by an intron of 7 kb
on genomic DNA. Moreover, we determined the full-length exon 1a. This
exon (386 bp excluding 5'-untranslated region [UTR]) comprises the
initiation codon for KVLQT1 isoform 1. Fifteen exons (1 to 15 with the
exception of exon 2a) are common to isoforms 1 and 2. The N-terminal
part of isoform 2, which has a truncated S1 transmembrane segment, is
encoded by exon 1b (5 bp excluding 5'-UTR). The exon named 1a encodes
the full-length S1 transmembrane segment preceded by the 128-amino acid
residue N-terminal domain of isoform 1. Exons 1c and 2a belong to
isoforms 3 and 4 described by Lee et al.7 The sizes of
exons and introns are summarized in Table 2
. The exon sizes, excluding the 5'- and
3'-UTRs, vary from 5 to 386 bp and intron sizes from 570 bp to
107 kb.
|
|
Three (CA)n Repeat Microsatellites in
KCNQ1
We localized the (CA)n microsatellite
D11S4088 in intron 10 of KCNQ1 using the BLASTN program. We
also report two new microsatellites in introns 10 and
14 with EMBL accession numbers AJ006724 and AJ006725. The primer sets
used for their amplification are as follows: 095L,
5'-TCACAGC-CCTCAGCCTAT-3'; 095R,
5'-GACACAAATGCCAAACAGA-3' and 1228L,
5'-TCCCTGGGGTTCTGCTC-3'; 1228R, 5'-CTTGCTGTACCACTGCCT-3', respectively.
By analyzing DNA samples from 80 unrelated Caucasians, we detected
three alleles for each microsatellite. Allele frequencies were
0.11, 0.22, and 0.67 for AJ006724 and 0.13, 0.42, and 0.45 for
AJ006725. Their heterozygosity indexes were 0.11 and 0.35,
respectively.
Identification of Mutations in KCNQ1 Associated
With LQTS
Exons 1 to 15 and corresponding exon-intron boundaries were
analyzed by PCR-SSCP according to the conditions described in
Table 1
. In 40 LQTS families, 27 different mutations have
previously been found in the transmembrane segments (References 21 and
2221 22 and data not shown) and 3 in the C-terminal domain of
KCNQ1.6 17 21 Five new mutations,
reported in the present study, were identified in the C-terminal
domain of KCNQ1 in five unrelated LQTS families (Figure 2
). Mutations are numbered from the ATG
codon of the full-length isoform 1.15 17
A 1-bp deletion was identified in exon 9 of KCNQ1. This deletion of a C at position 1343 (1343delC) was found in RW family 11356. It introduces a frameshift that leads to a premature stop codon 17 amino acids later. Two missense mutations were identified in exon 14. One is a C to T transition at position 1760 (T587M) identified in JLN family 12664 that changes a threonine at position 587 to a methionine. The second is a G to A transition at position 1772 (R591H) found in RW family E-973 that changes an arginine at position 591 to a histidine. Two frameshift mutations were found in exon 15. One is a 20-bp deletion (CCAGAGAGGGCGGGGCCCAC) at position 1892 (1892del20) identified in JLN family 9976. It introduces a frameshift leading to a premature stop codon 13 amino acids later. The second is an insertion of a C at position 1893 (1893insC) found in RW family 11232. This 1-bp insertion introduces a frameshift that leads to a premature stop codon 19 amino acids later. Both mutations 1892del20 and 1893insC are predicted to produce truncated proteins with a stop signal close to the end of the normal protein. In contrast, mutation 1343delC is predicted to produce a protein lacking 212 amino acids in its C-terminal domain. None of the SSCP patterns corresponding to each mutation has been found in 100 healthy individuals.
| Discussion |
|---|
|
|
|---|
Six alternative splice variants have been reported in KCNQ1
that differ depending on the use of the exons located in the 5' part of
the gene.3 4 7 15 16 All isoforms have in common the
coding sequence from exons 2 to 15 (Figure 1
). Isoforms 0 and 1
share the 3' part of exon 1a and the full exon 1 but are divergent in
the 5' part of exon 1a.4 15 17 The genomic sequence
analysis cannot definitely exclude that the difference in the
5' part of exon 1a in isoform 0 is due to a cryptic splice site.
Nevertheless, isoform 0 is more probably a cloning artifact, given that
the 5' part of the sequence specific to this isoform (33 bp) is
invert-homolog to another part of the gene (position 246 to 278).
However, it appears that the divergent N-terminus does not prevent
isoform 0 expression, because it has been found to be functional in
Chinese hamster ovary cells.4 Isoforms 1 and 2 comprise
exons 1a and 1b, respectively, followed by exon 1 and are the two major
KCNQ1 splice variants present in the
heart.3 7 15 Isoform 3 contains exons 1b, 1c, and 1,
and isoform 4 comprises exons 1b, 1c, 1, and 2a. These two isoforms
probably represent untranslated transcripts, because exon 1c
introduces a stop codon in the KCNQ1
sequence.7 Isoform 5 contains the 3' part of exon 1a
and exons 1c and 1.16 The first transmembrane domain of
isoform 5 is changed when compared with isoforms 0 and 1, and isoform 5
did not yield novel currents when expressed in Xenopus
oocytes. However, because there is no in-frame 5' stop codon, an
initiation site further upstream leading to a longer coding sequence of
KCNQ1 cannot be excluded. The
physiological role of isoforms 3, 4, and 5 remains
enigmatic, whereas isoforms 1 and 2 associate with MinK to form a
functional K+ channel in the heart underlying the
IKs current.18 19
KCNQ1 mutations are numbered according to isoform
011 16 24 25 or to isoform
1.6 17 21 26 27 The identification of the full-length exon
1a from genomic DNA suggests that a common nomenclature should be used
for numbering KCNQ1 mutations according to isoform 1
sequence, which has been independently determined by two
groups.15 17
The knowledge of exon-intron boundaries allowed us to identify five new mutations in the C-terminal domain of KCNQ1. At present, 40 different mutations have been identified in KCNQ1 in LQTS,5 6 11 16 17 21 22 24 25 26 27 28 29 30 31 32 33 but only three have been reported by our group in the C-terminal region of the gene.6 17 21 Indeed, most of known KCNQ1 mutations are localized in the transmembrane domains of the protein, but the C-terminal domain has not been analyzed in most of the studies. The three mutations already described in this part of the gene are a deletion-insertion (16307+8) observed in a JLN family6 and two missense mutations (R539W and R555C) identified in RW families.17 21 One of the two new C-terminal missense mutations reported in the present study affects also an arginine (R591H) in an RW family. This arginine at position 591 has been conserved throughout evolution, from Caenorhabditis elegans to Homo sapiens. KCNQ1 belongs to a family of voltage-gated K+ channel genes, which contains KCNQ2 and KCNQ3, both expressed in brain and involved in epilepsy.34 35 These three genes show high sequence homology in the S1-to-S6 transmembrane domains but a lower similarity in their C-terminal region,34 35 suggesting that this part may be related to a specific function of these channels in different tissues. Indeed, KCNQ1 showed a highly positively charged C-terminal subregion containing numerous arginines where we have already found two mutated arginines in RW patients (R539W and R555C).17 These arginines have been well conserved throughout species. The R555C mutation was clearly associated with a forme fruste of the RW syndrome.21 For the R591H and R539W mutations, we could not determine the severity of the disease because of the small size of the families. A 1-bp deletion and a 1-bp insertion were also identified in two small RW families. Only one sudden death was reported in all families, which occurred in a patient treated for an abscessed tonsillitis (family 11356, patient II-2, mutation 1343delC).
In two nonconsanguineous JLN families, we identified two mutations in the C-terminal domain of KCNQ1. One is a missense mutation (T587M) and the other is a frameshift mutation. The mutated threonine at position 587 is conserved in Squalus acanthias, Mus musculus, and H sapiens but not in C elegans. It is the second missense mutation that causes the JLN syndrome; the first has been identified in the pore.22 With the 20-bp deletion that we identified in the present study, four of the six known mutations causing the JLN syndrome induced a putative premature truncation of the subunit,6 11 32 suggesting that frameshift mutations, especially in the C-terminal domain of the KVLQT1 channel, could be responsible for most of the JLN cases. Thus, analysis of the whole KCNQ1 gene will assist in genetic diagnosis of asymptomatic mutation carriers at risk for ventricular arrhythmias.
We suggest that the five new mutations reported in the present study cause LQTS, because they affect conserved amino acids of the protein or lead to putative truncated proteins and they are not present in control subjects. However, functional studies would be required to absolutely confirm the pathogenic nature of these changes. In our series, systematic screening of exons 1 to 15 of KCNQ1 by PCR-SSCP identified 28 different mutations in KCNQ1 in 38 of 84 RW families (45%), 5 of them occurring in the C-terminal domain (18%). Seven KCNQ1 mutations including three in the C-terminal domain (43%) were identified in JLN families. One mutation in a compound heterozygous JLN patient was not identified, although linkage analysis supports the hypothesis that this second mutation is in KCNQ1, and no genetic defect in KCNE1 has been evidenced. Because exons 1a and 1b were not screened in our study, we can hypothesize that nonidentified mutations are located in this region of the gene. Nevertheless, it is well established that SSCP is not 100% effective in the detection of mutations, and we could have missed them.
Intragenic microsatellite markers are of great help for the linkage analysis. Hence, the entire genomic sequence of the human K+ channel KCNQ1 gene has been analyzed for the presence of such DNA markers. Two new intragenic microsatellites were found and the previously known marker D11S4088 was localized in intron 10. Mutations in parts of the gene other than transmembrane domains are probably more numerous than initially expected. The presence of mutations in the C-terminal domain, and even in the N-terminus, which has not been analyzed so far, may explain the low percentage of mutations identified in large LQTS cohorts.25 30 33 In conclusion, this work provides helpful tools for linkage analysis and systematic mutation screening in the KCNQ1 gene.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received July 22, 1998; accepted November 19, 1998.
| References |
|---|
|
|
|---|
2. Vetter D, Mann J, Wangemann P, Liu J, McLaughlin K, Lesage F, Marcus D, Ladzunski M, Heinemann S, Barhanin J. Inner ear defects induced by null mutation of the Isk gene. Neuron. 1996;17:12511264.[Medline] [Order article via Infotrieve]
3. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. KVLQT1 and IsK (minK) proteins associate to form the IKs cardiac potassium current. Nature. 1996;384:7880.[Medline] [Order article via Infotrieve]
4. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT. Coassembly of KVLQT1 and minK (IsK) proteins to form cardiac IKs potassium channel. Nature. 1996;384:8083.[Medline] [Order article via Infotrieve]
5. Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating M. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:1723.[Medline] [Order article via Infotrieve]
6. Neyroud N, Tesson F, Denjoy I, Leibovici M, Donger C, Barhanin J, Faure S, Gary F, Coumel P, Petit C, Schwartz K, Guicheney P. A novel mutation in the K+ channel KVLQT1 causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat Genet. 1997;15:186189.[Medline] [Order article via Infotrieve]
7. Lee MP, Hu RJ, Johnson LA, Feinberg AP. Human KVLQT1 gene shows tissue-specific imprinting and encompasses Beckwith-Wiedemann syndrome chromosomal rearrangements. Nat Genet. 1997;15:181185.[Medline] [Order article via Infotrieve]
8.
Gould TD, Pfeifer K. Imprinting of mouse Kvlqt1 is
developmentally regulated. Hum Mol Genet. 1998;7:483487.
9.
Towbin JA, Li H, Taggart RT, Lehmann MH, Schwartz PJ,
Satler CA, Ayyagari R, Robinson JL, Moss A, Hejtmancik JF. Evidence of
genetic heterogeneity in Romano-Ward long QT syndrome:
analysis of 23 families. Circulation. 1994;90:26352644.
10. Schwartz PJ, Periti M, Malliani A. The long Q-T syndrome. Am Heart J. 1975;89:378390.[Medline] [Order article via Infotrieve]
11.
Splawski I, Timothy K, Vincent GM, Atkinson D, Keating
M. Molecular basis of the long-QT syndrome associated with deafness.
N Engl J Med. 1997;336:15621567.
12. Romano C, Gemme G, Pongiglione R. Aritmie cardiache rare dell'eta pediatria. Clin Pediatr. 1963;45:656683.
13. Ward OC. A new familial cardiac syndrome in children. J Ir Med Assoc. 1964;54:103106.[Medline] [Order article via Infotrieve]
14. Jervell A, Lange-Nielsen F. Congenital deaf mutism, functional heart disease with prolongation of the QT interval and sudden death. Am Heart J. 1956;54:5968.
15.
Yang WP, Levesque PWL, Conder ML, Shalaby F, Blanar M.
KVLQT1, a voltage-gated potassium channel responsible for human cardiac
arrhythmias. Proc Natl Acad Sci U S A. 1997;94:40174021.
16.
Wollnick B, Schroeder BC, Kubish C, Esperer HD,
Wieacker P, Jentsch TJ. Pathophysiological
mechanisms of dominant and recessive KVLQT1 K+
channel mutations found in inherited cardiac arrhythmias.
Hum Mol Genet. 1997;6:19431949.
17. Chouabe C, Neyroud N, Guicheney P, Lazdunski M, Romey G, Barhanin J. Properties of KVLQT1 K+ channel mutations in Romano-Ward and Jervell and Lange-Nielsen inherited cardiac arrhythmias. EMBO J. 1997;16:54725479.[Medline] [Order article via Infotrieve]
18.
Jiang M, Tseng-Crank J, Tseng GN. Suppression of slow
delayed rectifier current by a truncated isoform of KVLQT1 cloned from
normal human heart. J Biol Chem. 1997;272:2410924112.
19.
Demolombe S, Baro I, Pereon Y, Bliek J, Mohammad-Pannah
R, Pollard H, Morid S, Mannens S, Wilde A, Barhanin J, Charpentier F,
Escande D. A dominant negative isoform of the long QT syndrome 1 gene
product. J Biol Chem. 1998;273:68376843.
20. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403410.[Medline] [Order article via Infotrieve]
21.
Donger C, Denjoy I, Berthet M, Neyroud N, Cruaud C,
Bennaceur M, Chivoret G, Schwartz K, Coumel P, Guicheney P.
KVLQT1 C-terminal missense mutation causes a forme fruste
long-QT syndrome. Circulation. 1997;96:27782781.
22. Neyroud N, Denjoy I, Donger C, Villain E, Leenhardt A, Gary F, Coumel P, Schwartz K, Guicheney P. A heterozygous mutation in the pore of the potassium channel gene KVLQT1 causes a benign phenotype in the long QT syndrome. Eur J Hum Genet. 1998;6:129133.[Medline] [Order article via Infotrieve]
23. Maruya E, Saji H, Yokoyama S. PCR-LIS-SSCP (low ionic strength single-stranded conformation polymorphism): a simple method for high resolution allele typing of HLA-DRB1, -DQB1, and -DPB1. Genome Methods. 1996;6:5157.
24. Wang Q, Chen Q, Li HL, Towbin JA. Molecular genetics of long QT syndrome from genes to patients. Curr Opin Cardiol. 1997;12:310320.[Medline] [Order article via Infotrieve]
25.
Li H, Chen Q, Moss AJ, Robinson J, Goytia V, Perry JC,
Vincent M, Priori SG, Lehmann MH, Denfield SW, Duff D, Kaine S, Shimizu
W, Schwartz PJ, Wang Q, Towbin JA. New mutations in the
KVLQT1 potassium channel that cause long-QT syndrome.
Circulation. 1998;97:12641269.
26.
Shalaby F, Levesque P, Yang W, Little W, Conder M,
Jenkins-West T, Blanar M. Dominant-negative KVLQT1 mutations
underlie the LQT1 form of long QT syndrome. Circulation. 1997;96:17331736.
27.
Priori SG, Schwartz PJ, Napolitano C, Bianchi L, Dennis
A, De Fusco M, Brown AM, Casari G. A recessive variant of the
Romano-Ward long-QT syndrome? Circulation. 1998;97:24202425.
28.
Russell MW, Dick M, Collins FS, Brody LC. KVLQT1
mutations in three families with familial or sporadic long QT syndrome.
Hum Mol Genet. 1996;5:13191324.
29.
De Jager T, Corbett CH, Badenhorst JCW, Brink PA,
Corfield VA. Evidence of a long QT founder gene with varying phenotypic
expression in South African families. J Med Genet. 1996;33:567573.
30.
Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta
K, Haneda N, Nakano O, Shibata A, Sawayama T, Kasai H, Yasaki Y,
Nakamura Y. Four novel KVLQT1 and four novel HERG mutations in familial
long-QT syndrome. Circulation. 1997;95:565567.
31. Van der Berg MH, Wilde AA, Robles de Medina EO, Meyer H, Geelen JL, Jongbloed RJ, Wellens HJ, Geraedts JP. The long QT syndrome: a novel missense mutation in the S6 region of the KVLQT1 gene. Hum Genet. 1997;100:356361.[Medline] [Order article via Infotrieve]
32.
Tyson J, Tranebjaerg L, Bellman S, Wren C, Taylor J,
Bathen J, Aslaksen B, Sorland SJ, Lund O, Malcolm S, Pembrey M,
Bhattacharya S, Bitner-Glindzicz M. IsK and KVLQT1: mutation in either
of the two subunits of the slow component of the delayed rectifier
potassium channel can cause Jervell and Lange-Nielsen syndrome.
Hum Mol Genet. 1997;6:21792185.
33. Saarinen K, Swan H, Kainulainen K, Tovonen L, Viitasalo M, Kontula K. Molecular genetics of the long QT syndrome: two novel mutations of the KVLQT1 gene and phenotypic expression of the mutant gene in a large kindred. Hum Mutat. 1998;11:118165.
34. Charlier C, Singh NA, Ryan SG, Lewis TB, Reus BE, Leach RJ, Leppert M. A pore mutation in a novel KQT-like potassium channel gene in an idiopathic epilepsy family. Nat Genet. 1998;18:5355.[Medline] [Order article via Infotrieve]
35. Singh NA, Charlier C, Stauffer D, DuPont BR, Leach RJ, Melis R, Ronen GM, Bjerre I, Quattlebaum T, Murphy JV, McHarg ML, Gagnon D, Rosales TO, Peiffer A, Anderson VE, Leppert M. A novel potassium channel gene, KCNQ2, is mutated in an inherited epilepsy of newborns. Nat Genet. 1998;18:2529.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
K. Mussig, H. Staiger, F. Machicao, K. Kirchhoff, M. Guthoff, S. A. Schafer, K. Kantartzis, G. Silbernagel, N. Stefan, J. J. Holst, et al. Association of Type 2 Diabetes Candidate Polymorphisms in KCNQ1 With Incretin and Insulin Secretion Diabetes, July 1, 2009; 58(7): 1715 - 1720. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Beckmann, A. A.M. Wilde, and S. Kaab Dual Inheritance of Sudden Death from Cardiovascular Causes N. Engl. J. Med., May 8, 2008; 358(19): 2077 - 2078. [Full Text] [PDF] |
||||
![]() |
J. Zehelein, S. Kathoefer, M. Khalil, M. Alter, D. Thomas, K. Brockmeier, H. E. Ulmer, H. A. Katus, and M. Koenen Skipping of Exon 1 in the KCNQ1 Gene Causes Jervell and Lange-Nielsen Syndrome J. Biol. Chem., November 17, 2006; 281(46): 35397 - 35403. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Anastasakis, C.-M. Kotta, S. Kyriakogonas, B. Wollnik, A. Theopistou, and C. Stefanadis Phenotype reveals genotype in a Greek long QT syndrome family. Europace, April 1, 2006; 8(4): 241 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jespersen, M. Grunnet, and S.-P. Olesen The KCNQ1 Potassium Channel: From Gene to Physiological Function Physiology, December 1, 2005; 20(6): 408 - 416. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Brink, L. Crotti, V. Corfield, A. Goosen, G. Durrheim, P. Hedley, M. Heradien, G. Geldenhuys, E. Vanoli, S. Bacchini, et al. Phenotypic Variability and Unusual Clinical Severity of Congenital Long-QT Syndrome in a Founder Population Circulation, October 25, 2005; 112(17): 2602 - 2610. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Thomas, A.-B. Wimmer, C. A. Karle, M. Licka, M. Alter, M. Khalil, H. E. Ulmer, S. Kathofer, J. Kiehn, H. A. Katus, et al. Dominant-negative IKs suppression by KCNQ1-{Delta}F339 potassium channels linked to Romano-Ward syndrome Cardiovasc Res, August 15, 2005; 67(3): 487 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Paulsen, T. Khare, C. Burgard, S. Tierling, and J. Walter Evolution of the Beckwith-Wiedemann syndrome region in vertebrates Genome Res., January 1, 2005; 15(1): 146 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jespersen, H. B. Rasmussen, M. Grunnet, H. S. Jensen, K. Angelo, D. S. Dupuis, L. K. Vogel, N. K. Jorgensen, D. A. Klaerke, and S.-P. Olesen Basolateral localisation of KCNQ1 potassium channels in MDCK cells: molecular identification of an N-terminal targeting motif J. Cell Sci., September 1, 2004; 117(19): 4517 - 4526. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kanki, S. Kupershmidt, T. Yang, S. Wells, and D. M. Roden A Structural Requirement for Processing the Cardiac K+ Channel KCNQ1 J. Biol. Chem., August 6, 2004; 279(32): 33976 - 33983. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Knollmann, M. C. Casimiro, A. N. Katchman, S. G. Sirenko, T. Schober, Q. Rong, K. Pfeifer, and S. N. Ebert Isoproterenol Exacerbates a Long QT Phenotype in Kcnq1-Deficient Neonatal Mice: Possible Roles for Human-Like Kcnq1 Isoform 1 and Slow Delayed Rectifier K+ Current J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 311 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gouas, C. Bellocq, M. Berthet, F. Potet, S. Demolombe, A. Forhan, R. Lescasse, F. Simon, B. Balkau, I. Denjoy, et al. New KCNQ1 mutations leading to haploinsufficiency in a general population: Defective trafficking of a KvLQT1 mutant Cardiovasc Res, July 1, 2004; 63(1): 60 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Paulussen, A. Raes, G. Matthijs, D. J. Snyders, N. Cohen, and J. Aerssens A Novel Mutation (T65P) in the PAS Domain of the Human Potassium Channel HERG Results in the Long QT Syndrome by Trafficking Deficiency J. Biol. Chem., December 6, 2002; 277(50): 48610 - 48616. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Syrris, A Murray, N D Carter, W M McKenna, and S Jeffery Mutation detection in long QT syndrome: a comprehensive set of primers and PCR conditions J. Med. Genet., October 1, 2001; 38(10): 705 - 710. [Full Text] [PDF] |
||||
![]() |
P. Chevalier, C. Rodriguez, L. Bontemps, M. Miquel, G. Kirkorian, R. Rousson, F. Potet, J.-J. Schott, I. Baro, and P. Touboul Non-invasive testing of acquired long QT syndrome: Evidence for multiple arrhythmogenic substrates Cardiovasc Res, May 1, 2001; 50(2): 386 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Lupoglazoff, I. Denjoy, M. Berthet, N. Neyroud, L. Demay, P. Richard, B. Hainque, G. Vaksmann, D. Klug, A. Leenhardt, et al. Notched T Waves on Holter Recordings Enhance Detection of Patients With LQT2 (HERG) Mutations Circulation, February 27, 2001; 103(8): 1095 - 1101. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Piippo, H. Swan, M. Pasternack, H. Chapman, K. Paavonen, M. Viitasalo, L. Toivonen, and K. Kontula A founder mutation of the potassium channel KCNQ1 in long QT syndrome: Implications for estimation of disease prevalence and molecular diagnostics J. Am. Coll. Cardiol., February 1, 2001; 37(2): 562 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al. Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2 Circulation, September 5, 2000; 102(10): 1178 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-E. Chiang and D. M. Roden The long QT syndromes: genetic basis and clinical implications J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chouabe, N. Neyroud, P. Richard, I. Denjoy, B. Hainque, G. Romey, M.-D. Drici, P. Guicheney, and J. Barhanin Novel mutations in KvLQT1 that affect Iks activation through interactions with Isk Cardiovasc Res, March 1, 2000; 45(4): 971 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Murray, C. Donger, C. Fenske, I. Spillman, P. Richard, Y. B. Dong, N. Neyroud, P. Chevalier, I. Denjoy, N. Carter, et al. Splicing Mutations in KCNQ1 : A Mutation Hot Spot at Codon 344 That Produces In Frame Transcripts Circulation, September 7, 1999; 100(10): 1077 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, H. Kanki, B. Drolet, T. Yang, J. Wei, P. C. Viswanathan, S. H. Hohnloser, W. Shimizu, P. J. Schwartz, M. Stanton, et al. Allelic Variants in Long-QT Disease Genes in Patients With Drug-Associated Torsades de Pointes Circulation, April 23, 2002; 105(16): 1943 - 1948. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |