This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pan, J. Articles by Ogawa, S. Search for Related Content PubMed PubMed Citation Articles by Pan, J. Articles by Ogawa, S. Related Collections ACE/Angiotension receptors Cell signalling/signal transduction Growth factors/cytokines Heart failure - basic studies

(Circulation Research. 1999;84:1127-1136.)
© 1999 American Heart Association, Inc.

Original Contribution

Mechanical Stretch Activates the JAK/STAT Pathway in Rat Cardiomyocytes

Jing Pan, Keiichi Fukuda, Mikiyoshi Saito, Junichi Matsuzaki, Hiroaki Kodama, Motoaki Sano, Toshiyuki Takahashi, Takahiro Kato, Satoshi Ogawa

From the Cardiopulmonary Division (J.P., K.F., H.K., M. Sano, T.T., T.K., S.O.), Department of Internal Medicine, Keio University, Tokyo, and Chugai Pharmaceutical Co Ltd (M. Saito, J.M.), Shizuoka, Japan.

Correspondence to Keiichi Fukuda, Cardiopulmonary Division, Department of Internal Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. E-mail kfukuda{at}mc.med.keio.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—This study was designed to determine whether mechanical stretch activates the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway in cardiomyocytes and, if so, by what mechanism. Neonatal rat/murine cardiomyocytes were cultured on malleable silicone dishes and were stretched by 20%. Mechanical stretch induced rapid phosphorylation of JAK1, JAK2, Tyk2, STAT1, STAT3, and glycoprotein 130 as early as 2 minutes and peaked at 5 to 15 minutes. It also caused gel mobility shift of sis-inducing element, which was supershifted by preincubation with anti-STAT3 antibody. Preincubation with CV11974 (AT₁ blocker) partially inhibited the phosphorylation of STAT1, but not that of STAT3. Preincubation with TAK044 (endothelin-1-type A/B-receptor blocker) did not attenuate this pathway. RX435 (anti–glycoprotein 130 blocking antibody) inhibited the phosphorylation of STAT3 and partially inhibited that of STAT1. Phosphorylation of STAT1 and STAT3 was strongly inhibited by HOE642 (Na⁺/H⁺ exchanger inhibitor) and BAPTA-AM (intracellular calcium chelator), but not by gadolinium (stretch-activated ion channel inhibitor), EGTA (extracellular Ca²⁺ chelator), or KN62 (Ca²⁺/calmodulin kinase II inhibitor). Chelerythrine (protein kinase C inhibitor) partially inhibited the phosphorylation of STAT1 and STAT3. Mechanical stretch also augmented the mRNA expression of cardiotrophin-1, interleukin-6, and leukemia inhibitory factor at 60 to 120 minutes. These results indicated that the JAK/STAT pathway was activated by mechanical stretch, and that this activation was partially dependent on autocrine/paracrine–secreted angiotensin II and was mainly dependent on the interleukin-6 family of cytokines but was independent of endothelin-1. Moreover, certain levels of intracellular Ca²⁺ were necessary for stretch-induced activation of this pathway, and protein kinase C was also partially involved in this activation.

Key Words: mechanical stretch • angiotensin II • cardiac hypertrophy • JAK/STAT pathway • glycoprotein 130

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cardiac hypertrophy is a compensatory response that allows the heart to cope with the pathogenic stimuli found with many cardiovascular diseases.¹ Cardiac hypertrophy is induced by mechanical load and humoral factors, such as angiotensin II (Ang II),² endothelin-1 (ET-1),³ and norepinephrine.⁴ Mechanical stretch is one of the most important stimuli of cardiac hypertrophy.^{5 6} Mechanical stretch-induced signal transduction is characterized by simultaneous activation of multiple second messenger systems. Many studies have demonstrated that mechanical stretch caused activation of multiple intracellular signal transduction pathways in cultured neonatal cardiomyocytes, such as phospholipases (C, D, and A₂), tyrosine kinases, p21^ras, Raf-1, mitogen-activated protein kinases, c-jun N-terminal protein kinases, and protein kinase C (PKC).^{7 8 9} Autocrine/paracrine–secreted growth factors such as Ang II and ET-1 play an important role in the stretch-induced hypertrophic response.^{10 11} Although mechanical stretch activates multiple second messenger systems, it remains unclear which molecules are directly activated by stretch and how mechanical stimuli are converted into intracellular signals to activate protein kinase cascades and stimulate the secretion of growth factors.

The Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway was initially discovered as a major signal transduction pathway of the cytokine superfamilies.¹² It plays a crucial role in the growth and differentiation of a variety of cell types. Although the significance of the JAK/STAT pathway in cardiomyocytes has not been well characterized, increasing evidence suggests that this pathway might be involved in the development of myocardial hypertrophy. We and others have reported that the JAK/STAT pathway was activated by hypertrophic agonists (leukemia inhibitory factor [LIF], cardiotrophin-1 [CT-1], and Ang II) in vitro.^{13 14 15 16} LIF and CT-1 activated JAK1, JAK2, Tyk2, STAT1, and STAT3, and Ang II activated JAK2, Tyk2, STAT1, and STAT2 in cardiomyocytes. Kunisada et al¹⁷ reported that overexpression of constitutive active STAT3 augmented the LIF-induced increase in [³H]leucine uptake and hypertrophy marker gene expression, whereas overexpression of a dominant-negative STAT3 decreased these events. We have also demonstrated that acute pressure overload in vivo activated the JAK/STAT pathway and that Ang II was partially involved in this activation.¹⁸ These results suggested that this pathway was critically involved in the hypertrophic response.

In the present study, we investigated whether the JAK/STAT pathway was activated by mechanical stretch in cultured cardiomyocytes and, if so, how. We investigated (1) the involvement of autocrine/paracrine–secreted growth factors in stretch-induced activation of this pathway, (2) the role of ion channel and exchanger, and (3) the cross talk between the JAK/STAT pathway and other signaling pathways.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell Culture and Cardiomyocyte Stretching
Primary cultures of cardiomyocytes were prepared from the ventricles of 1-day-old Wistar rats or ICR mice (Japan Clea Co Ltd) by enzymatic dissociation in 0.03% trypsin, 0.03% collagenase, and 20 µg/mL of DNase I as described previously.¹³ The cardiomyocytes were collected by differential adhesiveness. Cardiomyocyte-enriched suspensions were removed from the culture dishes and plated at a density of 1x10⁵ cells/cm² on silicone rubber dishes (241 cm) precoated with laminin (2 µg/cm²). Twelve hours after plating, bromodeoxyuridine was added to the medium at a concentration of 10^-7 mol/L for 12 hours to deplete residual nonmyocytes. The experiment was performed on the second day from the primary culture, and the final density of the cells was 1.1x10⁵–1.2x10⁵ cells/cm². The nonmyocyte population amounted to 5 to 10% of the total cell population as determined by immunofluorescence staining with monoclonal anti-sarcomeric myosin antibody (MF20). The cells were grown in M199/DMEM medium supplemented with 10% FBS, penicillin (50 U/mL), and streptomycin (50 µg/mL) at 37°C in humid air with 5% CO₂. The culture medium was changed 24 hours after seeding to a medium containing 0.1% FBS. After 8 hours in the 0.1% FBS medium, the culture dishes were stretched by 20%. Stretching of cardiomyocytes was accomplished essentially according to the method of Komuro et al⁵ and Sadoshima and Izumo.⁶ A 20% stretch was shown to be sufficient to activate various signal transduction pathways and not to damage the stretched cell.^{7 8 9} We carried out stretch and control experiments simultaneously, with the same pool of cells in each experiment.

Immunoprecipitation and Western Blot Analysis
Polyclonal antibodies to JAK1, JAK2, Tyk2, STAT1/ß, STAT3, and glycoprotein (gp) 130, and monoclonal antibody to STAT1, were purchased from Santa Cruz Biotechnology. Anti-phosphotyrosine antibody (4G10) was purchased from Upstate Biotechnology. Polyclonal antibody to phosphospecific STAT3 was purchased from New England Biolabs, Inc.

To prepare cell extracts, cells were washed 3 times in PBS and then extracted in lysis buffer containing (in mmol/L) Tris-HCl (pH 7.4) 20, NaCl 100, EDTA 5, NaF 50, Na₃P₂O₇ 10, Na₃VO₄ 1, phenylmethylsulfonyl fluoride 1, and 1.0% Triton X-100, 10% glycerol, 0.1% SDS, 1.0% deoxycholic acid, 10 µg/mL aprotinin, and 10 µg/mL leupeptin. The lysates were centrifuged at 10 000g for 15 minutes. Protein concentration was determined by the Bio-Rad protein assay.

Cell lysates were incubated with 1 µg/mL of the respective antibodies overnight at 4°C. Immunocomplexes were collected by incubating with 50 µL of protein A– or G–Sepharose for 2 hours. Immunoprecipitates were washed 4 times with ice-cold lysis buffer. The pellets were resuspended in 2x sample buffer containing 50 mmol/L Tris (pH 6.8), 2% SDS, 2% ß-mercaptoethanol, 2% glycerol, and bromphenol blue. The samples were subjected to SDS-PAGE and were transferred to reinforced nitrocellulose membranes (Schleicher & Schuell). The membranes were blocked with 5% BSA in Tris-buffered saline–Tween solution (20 mmol/L Tris-HCl [pH 7.4], 150 mmol/L NaCl, and 0.05% Tween 20) for 2 hours at room temperature. Blots were immunolabeled overnight at 4°C with anti-phosphotyrosine antibody or anti-gp130 antibody. Proteins were visualized by enhanced chemiluminescence (Amersham). The blots were stripped and reprobed with the same antibodies used for their immunoprecipitation, to ensure equal loading of the proteins.

For Western blot analysis, cells were lysed in lysis buffer containing (in mmol/L) Tris (pH 7.6) 20, NaCl 250, EDTA 3, EGTA 3, and ß-glycerophosphate 3, and 0.5% NP-40 and the protease inhibitors described above. Immunoblotting was conducted with anti-phospho-STAT3, and anti-STAT3 antibodies.

Gel Mobility Shift Assay
Cardiomyocytes were rinsed with PBS at 0°C and scraped into the same buffer. Nuclear extracts were prepared according to standard methods described previously.^{13 19} Five micrograms of nuclear extracts were incubated with 1 µg of poly(dI-dC)-poly(dI-dC) (Pharmacia Biotech) with or without competitor oligonucleotide in 20 µL of a solution containing (in mmol/L) HEPES (pH 7.9) 10, NaCl 50, and EDTA 1, and 10% glycerol, for 20 minutes at 25°C. The samples were incubated with 1 or 2 fmol of radiolabeled probes (5000 cpm) for 10 minutes at 25°C. The probes were purchased from Santa Cruz Biotechnology, and their sequences were described (sis-inducing element [SIE]-DNA, 5'-CAGTTCCCGTCAATC-3'; mutant SIE-DNA, 5'-CAGCCACCGTCAATC). Binding reactions were resolved on a 4% native polyacrylamide gel containing TAE buffer containing (in mmol/L) Tris (pH 7.5) 40, sodium acetate 40, and EDTA 1 for 3 hours at 150 V at 4°C. The gel was dried and exposed to x-ray film for 12 hours. For supershift assays, nuclear extracts were incubated with 2 µg of antibodies to STAT1, STAT3, or both and incubated at room temperature for 1 hour, and the complexes were resolved by gel electrophoresis.

RNA Extraction and Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA was extracted from neonatal rat cardiomyocytes using TRIzol reagent (GIBCO). The samples were treated with DNase I and then subjected to first-strand synthesis using oligo(dT) primer and reverse transcriptase (Superscript II). The PCR reaction was performed in a reaction volume of 20 µL containing 250 mmol/L of dNTP, 50 pmol of each specific primer, and 2.5 U of Taq polymerase. The primers used were as follows: CT-1 sense, CCCTCTTCACCTCCAACAGTG, and antisense, GAGGCGAGAGCAGAAGAGAA; interleukin (IL)-6 sense, GACTTCACAGAGGATACCACCC, and antisense, GACTTCACAGAGGATACCACCC; LIF sense, AGTCAACTGGCTCAACTCAACG, and antisense, CTGGGCCAACACACTTATGACT; and ciliary neurotrophic factor (CNTF) sense, GGATGGCTTTCGCAGAGCAAAC, and antisense, AGGACCTTCAAGCCCCATAGCT. Denaturing, annealing, and extension reactions were performed at 95°C for 30 seconds, 58 to 60°C for 1 minute, and 72°C for 1 minute, respectively. Before the quantitative analysis, the linear range of the PCR cycles was measured for each cytokine, and the appropriate number of PCR cycles was determined. -Tubulin was used as an internal control for each sample.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mechanical Stretch Activates the JAK Family Kinases
We initially determined whether mechanical stretch would result in tyrosine phosphorylation of the JAK kinases. After stretching, cardiomyocytes were lysed and immunoprecipitated with anti-JAK1, anti-JAK2, or anti-Tyk2 antibody and immunoblotted with anti-phosphotyrosine antibody (Figure 1). JAK1, JAK2, and Tyk2 were rapidly phosphorylated at 2 minutes, which peaked at 5 minutes and decreased thereafter. These findings indicated that mechanical stretch could directly or indirectly activate the JAK kinases in rat cardiomyocytes.

View larger version (54K): [in this window] [in a new window]   Figure 1. Effect of mechanical stretch on phosphorylation of JAK kinases. Cell lysates were immunoprecipitated with antibodies to JAK1, JAK2, and Tyk2 and immunoblotted with anti-phosphotyrosine antibody. Mechanical stretch induced rapid tyrosine phosphorylation of JAK1, JAK2, and Tyk2. Membranes were stripped and reprobed with anti-JAK1, -JAK2, and -Tyk2 antibodies. All experiments were performed at least 4 times.

Mechanical Stretch Activates STAT1 and STAT3
To demonstrate that mechanical stretch would activate the STAT families, we first analyzed the tyrosine phosphorylation of STAT1 and STAT3 by immunoprecipitation-Western blot analysis (Figure 2A). After mechanical stretching, STAT1 and STAT3 were phosphorylated as early as 2 minutes, which peaked at 5 to 15 minutes and then gradually decreased, but remained elevated at 30 minutes. The dual bands in the upper panel indicate STAT1 and STAT1ß.

View larger version (77K): [in this window] [in a new window]   Figure 2. Effect of mechanical stretch on activation of STATs. A, Effect of stretch on phosphorylation of STATs. After cells were stretched for the indicated times, cell lysates were immunoprecipitated with antibodies to STAT1 or STAT3 and immunoblotted with anti-phosphotyrosine antibody. Membranes were stripped and reprobed with anti-STAT1/ß or STAT3 antibodies. Four separate experiments showed similar results. B, Effect of stretch on SIF formation. Left, Gel mobility shift assay was performed using nuclear extracts from stretch-treated cardiomyocytes. Nuclear extracts (5 µg) were incubated with the 32P-labeled SIE (containing a STAT binding site) oligonucleotide for 20 minutes at 25°C and resolved by native 4% TAE polyacrylamide gel electrophoresis. Competition experiments (comp. SIE) were performed with a 100-fold excess of unlabeled SIE oligonucleotide (lane 6), and a mutant labeled SIE oligonucleotide was used as a negative control (lane 7). Right, Nuclear extracts from stretch-stimulated cells were preincubated with anti-STAT1 (S1), anti-STAT3 antibody (S3), or both antibodies, and the complexes were resolved on a 4% native polyacrylamide gel. Note that anti-STAT3 antibody significantly removed the SIF complex rather than supershifting it. C, Effect of JAK2 kinase inhibitor on phosphorylation of STATs. Cardiomyocytes were pretreated with AG490 (4x10-5 mol/L) for 30 minutes and stretched by 20% for 6 minutes. The phosphorylation of STATs was detected. The blot presented is representative of 3 independent experiments. IP indicates immunoprecipitation; pTyr, phosphotyrosine; +, incubation or stimulation (+); and -, incubation or stimulation (-).

The DNA binding activity of STATs depends primarily on tyrosine phosphorylation. To investigate whether mechanical stretch induces sis-inducing factor (SIF)–like activity in cardiomyocytes, we performed a gel mobility shift assay using ³²P-labeled SIE oligonucleotide. As shown in Figure 2B, left, stimulation of cardiomyocytes by mechanical stretch resulted in the induction of protein complexes that bound to the SIE oligonucleotide. The specific DNA-protein complex increased from 5 minutes, peaked at 30 minutes, and decreased at 60 minutes. No mobility shift was observed with mutant SIE probe (lane 7), and the addition of higher concentrations of unlabeled SIE competed with the SIF complexes (lane 6), confirming the specificity of binding to SIE. A supershift assay revealed that incubation of the DNA-protein complex with anti-STAT1 antibody only mildly inhibited binding of the SIF band, but incubation with anti-STAT3 antibody or with both anti-STAT1 and anti-STAT3 antibodies significantly inhibited the binding of SIF complexes in stretch-stimulated cardiomyocyte extracts (Figure 2B, right). The antibody to STAT3 removed the SIF complexes rather than supershifting them. The anti-STAT3 antibody used is a polyclonal antibody that recognizes amino acids 626 to 640. This antibody does not directly recognize the DNA binding domain but seems to have inhibited the binding of STAT3 to DNA. These results indicated that mechanical stretch induced homodimerization or heterodimerization of STAT1 and STAT3 and formation of SIF complexes.

Inhibition of Phosphorylation of STATs by a JAK2 Kinase Inhibitor
Recent studies have reported that STAT1 and STAT3 can be phosphorylated by several tyrosine kinases other than JAK families. To determine whether the phosphorylation of STAT1 and STAT3 induced by stretching was mediated by the JAK kinase–dependent pathway, we investigated the effect of a specific JAK2 kinase inhibitor, AG490, on the phosphorylation of STATs. Cardiomyocytes were pretreated with 4x10^-5 mol/L of AG490 for 30 minutes before stretching. As shown in Figure 2C, AG490 significantly inhibited the phosphorylation of STAT1 and STAT3. We have observed that AG490 did not affect the LIF-induced tyrosine phosphorylation of JAK1 and Tyk2, but it inhibited LIF-induced phosphorylation of STAT3 by 88% and slightly inhibited that of STAT1 (H.K., K.F., unpublished data, 1998). These data suggested that JAK2 kinase activity was necessary for stretch-induced activation of STAT1 and STAT3 in cardiomyocytes.

Autocrine/Paracrine–Secreted Ang II but Not ET-1 Is Partially Involved in Phosphorylation of STATs
Previous studies have reported that mechanical stretch stimulates secretion of Ang II and ET-1 in cardiomyocytes and that both factors are involved in the development of mechanical stretch-induced cardiac hypertrophy.^{10 11} We have reported that pressure overload-induced activation of the JAK/STAT pathway was partially dependent on Ang II, mediated via the AT₁.¹⁸ Thus, we investigated whether these 2 factors were involved in the mechanical stretch-induced phosphorylation of STATs. As shown in Figure 3A and 3B, CV11974 (AT₁ antagonist) partially inhibited the phosphorylation of STAT1 and STAT1ß induced by mechanical stretch, whereas it completely inhibited that of STAT1 induced by Ang II. CV11974 did not affect the phosphorylation of STAT3 induced by mechanical stretch. Pretreatment with TAK044 (ET-1 type A/B receptor antagonist) did not inhibit the phosphorylation of STAT1 and STAT3 induced by mechanical stretch (Figure 3C). As shown in Figure 3D, we have observed that ET-1 stimulation did not tyrosine phosphorylate STAT3 until 30 minutes. It induced tyrosine phosphorylation of STAT1 at 2 to 5 minutes, although only at a very low level. TAK044 completely inhibited the phosphorylation of STAT1 induced by ET-1. These findings indicated that autocrine/paracrine-secreted Ang II or ET-1 did not seem to be involved in the activation of STAT3 induced by mechanical stretch, and Ang II was partially involved in the activation of STAT1, whereas ET-1 did not seem to be involved in this activation.

View larger version (27K): [in this window] [in a new window]   Figure 3. Effect of autocrine/paracrine factors on stretch-induced tyrosine phosphorylation of STATs. A, Effect of CV11974 on phosphorylation of STATs induced by mechanical stretch. Cardiomyocytes were pretreated with AT1 blocker CV11974 (10-6 mol/L) for 1 hour and stretched by 20% for 6 minutes. Note that the phosphorylation of STAT1 was partially inhibited by CV11974, whereas that of STAT3 was unaffected. B, Effect of CV11974 on phosphorylation of STAT1 induced by Ang II. CV11974 (10-6 mol/L) completely inhibited the phosphorylation of STAT1 induced by Ang II. C, Effect of TAK044 on phosphorylation of STATs induced by mechanical stretch. Cardiomyocytes were pretreated with ET-1 blocker TAK044 (10-6 mol/L) for 1 hour and stretched by 20% for 6 minutes. Phosphorylation of STAT1 and STAT3 was unaffected by TAK044. D, Effect of TAK044 on phosphorylation of STATs induced by ET-1. ET-1 induced phosphorylation of STAT1 but did not affect that of STAT3. TAK044 (10-6 mol/L) completely inhibited the phosphorylation of STAT1 induced by ET-1. Abbreviations as in Figure 2.

Involvement of gp130-Related Signaling in Stretch-Induced Activation of STATs
To demonstrate that gp130-related signaling was involved in the stretch-induced activation of this pathway, we preincubated the cells with anti-mouse gp130-specific blocking antibody RX435 for 30 minutes and observed the tyrosine phosphorylation of STAT1 and STAT3. RX435 specifically blocks the actions of LIF, IL-6, IL-11, and oncostatin M on mouse myeloid leukemic M1 cells and inhibits the binding of CT-1 to M1 cells.²⁰ RX435 strongly reduced the stretch-induced phosphorylation of STAT3 and slightly inhibited the phosphorylation of STAT1/ß (Figure 4A and 4B). We then detected the phosphorylation of gp130 (Figure 4C). gp130 was rapidly phosphorylated at 2 minutes after stretching, gradually decreased, and returned to the control level at 30 minutes. These findings suggested that the IL-6 family of cytokines is critically involved in the stretch-induced activation of STATs, especially STAT3, in cardiomyocytes.

View larger version (31K): [in this window] [in a new window]   Figure 4. Involvement of gp130-mediated signaling in stretch-induced tyrosine phosphorylation of STATs. A, Effect of RX435 on tyrosine phosphorylation of STAT3. Mouse cardiomyocytes were stretched by 20% for 6 minutes with or without pretreatment with RX435 (10 µg/mL), anti-gp130 blocking antibody, for 30 minutes. Cell lysates were electrophoresed and blotted with anti-phospho-STAT3 antibody, and the membrane was reprobed with anti-STAT3 antibody. Cells were stimulated with LIF (1000 U/mL, lanes 5 and 6) for 6 minutes as a positive control. Note that RX435 inhibited the LIF-induced phosphorylation of STAT3 (lane 6). Stretch-induced phosphorylation of STAT3 was inhibited by RX435. B, Cell lysates were immunoprecipitated with anti-phosphotyrosine antibody and immunoblotted with antibodies to STAT1/ß or STAT3. Stretch-induced tyrosine phosphorylation of STAT3 was strongly inhibited by RX435, whereas that of STAT1 was only partially inhibited. C, Mechanical stretch-induced phosphorylation of gp130. Rat cardiomyocytes were stretched for the indicated times. Cell lysates were immunoprecipitated with anti-phosphotyrosine antibody and immunoblotted with anti-gp130 antibody. The data presented are representative of 3 independent experiments. D, Mechanical stretch induces CT-1, IL-6, and LIF mRNA expression. RT-PCR revealed that mechanical stretch induced mRNA expression of IL-6 family of cytokines in cardiomyocytes. Abbreviations as in Figure 2.

Expression of the IL-6 Family of Cytokines in Stretched Cardiomyocytes
On the basis of the above results, we further tested the levels of expression of CT-1, IL-6, LIF, and CNTF mRNA by RT-PCR in stretched cardiomyocytes (Figure 4D). We used 23 cycles for IL-6 and -tubulin, 28 cycles for CT-1 and CNTF, and 30 cycles for LIF. The expression of CNTF was unaffected by stretch stimulation. In contrast, expression of CT-1, IL-6, and LIF mRNA increased after stretching and peaked at 60 to 120 minutes. These results were reproducible in 3 separate experiments. These findings indicated that mechanical stretch was involved not only in rapid secretion but also in mRNA expression of the IL-6 family of cytokines in cardiomyocytes.

Role of ion channels and Na⁺/H⁺ exchanger (NHE) in Stretch-Induced Phosphorylation of STATs
To determine whether mechanosensitive ion channels and NHE are involved in stretch-induced activation of STATs, we pretreated the cells with either a specific inhibitor of the stretch-sensitive cation channel (10^-5 mol/L gadolinium) or an NHE inhibitor (10^-5 mol/L HOE642) and stretched the cells by 20% for 6 minutes. The results are shown in Figure 5. Stretch-induced phosphorylation of STAT1 and STAT3 was not affected by pretreatment with gadolinium. In contrast, phosphorylation of STAT1 and STAT3 was strongly inhibited by HOE642. These results suggested that stretch-induced phosphorylation of STATs was partially dependent on the activation of NHE.

View larger version (57K): [in this window] [in a new window]   Figure 5. Role of ion channel and NHE in stretch-induced activation of STATs. After pretreatment with gadolinium (1x10-5 mol/L) for 60 minutes or the NHE inhibitor HOE642 (1x10-5 mol/L) for 30 minutes, cardiomyocytes were stretched by 20% for 6 minutes. The phosphorylation of STAT1 and STAT3 was detected as described in Figure 2. Abbreviations as in Figure 2.

Role of Ca²⁺ in Mediating Stretch-Induced Phosphorylation of STATs
A previous study⁷ reported that mechanical stretch increased intracellular Ca²⁺. It remains unclear whether these pathways are involved in the activation of STATs induced by mechanical stretching. In this study, we observed that the addition of EGTA (4x10^-3 mol/L) to the culture medium resulted in no significant reduction of the phosphorylation of STAT1 and STAT3. In contrast, the stretch-induced phosphorylation of STAT1 and STAT3 was completely attenuated by buffering the intracellular free Ca²⁺ with the pretreatment of membrane-permeable BAPTA-AM (1x10^-4 mol/L). This inhibition was dose dependent (Figure 6A and 6B). Next, we pretreated the cells with the calmodulin kinase II antagonist KN62 for 30 minutes and found that KN62 had no significant effect on phosphorylation of STAT1 and STAT3 (Figure 6A). These results suggested that certain levels of intracellular Ca²⁺ play a pivotal role in stretch-induced activation of STATs, and that Ca²⁺ influx was not apparently necessary for stretch-induced activation of this pathway.

View larger version (38K): [in this window] [in a new window]   Figure 6. Role of Ca2+ in stretch-induced activation of STATs. A, Cardiomyocytes were stretched by 20% for 6 minutes with or without pretreatment with EGTA (4x10-3 mol/L) for 30 minutes, KN62 (1x10-5 mol/L) for 30 minutes, and BAPTA-AM (10-4 mol/L) for 60 minutes. B, Cardiomyocytes were stretched for 6 minutes with or without pretreatment of the indicated concentrations of BAPTA-AM for 60 minutes. Abbreviations as in Figure 2.

Role of PKC in Mediating Stretch-Induced Phosphorylation of STATs
Mechanical stretch activates PKC in cardiomyocytes, and PKC is critically involved in stretch-induced mitogen-activated protein kinase activation.⁷ To investigate the role of PKC in stretch-induced activation of STATs, we stimulated the cells with phorbol 12-myristate 13-acetate (PMA) (1x10^-6 mol/L), a direct activator of PKC, and blocked the PKC activity with chelerythrine (1x10^-5 mol/L) and observed the phosphorylation of STATs. As shown in Figure 7, PMA caused significant phosphorylation of STAT1 and STAT3. Pretreatment with chelerythrine for 30 minutes significantly attenuated the phosphorylation of STAT1 and STAT3. These results suggested that PKC is partially involved in stretch-induced activation of STATs.

View larger version (51K): [in this window] [in a new window]   Figure 7. Role of PKC in stretch-induced activation of STATs. Cardiomyocytes were stretched by 20% for 6 minutes with or without pretreatment with chelerythrine (10-5 mol/L) for 30 minutes. Cells were also stimulated with PMA (10-6 mol/L) for 120 minutes (right lanes). Phosphorylation of STAT1 and STAT3 was partially inhibited by chelerythrine. Abbreviations as in Figure 2.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we demonstrated that mechanical stretch induced rapid phosphorylation of JAK1, JAK2, Tyk2, STAT1, STAT3, and gp130 and induced formation of SIF complexes in rat cardiomyocytes. The stretch-induced activation of STAT1 and STAT3 was partially dependent on JAK2 kinase. We also found that autocrine/paracrine–secreted Ang II was partially involved in stretch-induced phosphorylation of STAT1 but that ET-1 was not involved in this activation. In contrast, the IL-6 cytokine family–related signaling pathway plays an important role in the stretch-induced activation of this pathway in cardiomyocytes. Moreover, mRNA expression of the IL-6 family of cytokines was upregulated by mechanical stretch. NHE activation was involved in the activation of STATs. In contrast, stretch-sensitive cation channels did not appear to be involved in this activation. We also demonstrated that intracellular Ca²⁺ was required for the stretch-induced activation of STATs and that the activation of PKC was partially involved in this activation in cardiomyocytes.

Accumulating evidence has demonstrated that mechanical stretch stimulates production or secretion of growth factors and that an autocrine/paracrine response is a common mechanism used in stretch-induced cell growth.^{3 10 11} Ang II and ET-1 have been shown to play an important role in mediating stretch-induced cardiac hypertrophy in cardiomyocytes. Thus, we investigated whether the autocrine/paracrine–secreted Ang II and/or ET-1 was involved in the activation of STATs. We have previously reported that Ang II phosphorylated JAK2, Tyk2, STAT1, and STAT2, but not JAK1 or STAT3, at up to 30 minutes and that CV11974 significantly inhibited the Ang II-induced phosphorylation of STAT1.¹⁶ In this study, we observed that ET-1 did not cause phosphorylation of STAT3 at least up to 30 minutes and that it slightly tyrosine phosphorylated STAT1 at 2 to 5 minutes. Moreover, we observed that the phosphorylation of STAT1 was completely inhibited by TAK044. These findings indicated that autocrine/paracrine–secreted Ang II or ET-1 might be involved in the stretch-induced phosphorylation of STAT1 but would not be involved in that of STAT3. The present study revealed that autocrine/paracrine–secreted Ang II was partially involved in the stretch-induced phosphorylation of STAT1; however, we could not confirm that ET-1 was involved in this activation. Moreover, the present findings on STAT3 indicated that factors other than Ang II and ET-1 were involved in the activation of STATs induced by mechanical stretch.

We and others have previously demonstrated that LIF causes cardiac hypertrophy and activated the JAK/STAT pathway.^{13 14} The other IL-6–related cytokines, including CNTF, oncostatin M, and CT-1, also activate the JAK/STAT pathway via gp130.^{15 21 22} gp130 functions as a common cytokine signal transducer for the IL-6 family of cytokines, and targeting of the gp130 gene leads to the failure of myocardium to mature.²³ Moreover, transgenic mice expressing both IL-6 and IL-6 receptor displayed constitutive tyrosine phosphorylation of gp130 in the myocardium and led to cardiac hypertrophy.²⁴ These findings suggested that a gp130-dependent signaling pathway might be critically involved in the hypertrophic response of cardiomyocytes. In this study, we demonstrated that the gp130-dependent pathway plays an important role in mechanical stretch-induced activation of the JAK/STAT pathway. Pretreatment with RX435 significantly reduced the phosphorylation of STAT1 and STAT3, especially that of STAT3. We also found that gp130 receptor was rapidly phosphorylated by stretching. The finding that the phosphorylation of STAT3 was almost completely inhibited by RX435 suggested that this family of cytokines plays a pivotal role in stretch-induced activation of STAT3. In contrast, given that the phosphorylation of STAT1 was partially inhibited by both RX435 and CV11974, it seems that both Ang II and the IL-6 family of cytokines might be involved in the activation of STAT1 in cardiomyocytes.

Recent studies have revealed that ion channels and ion exchangers in the cell membrane can rapidly respond to extracellular stimuli and play a pivotal role in fundamental cell functions.^{25 26} Therefore, there is the possibility that the JAK/STAT pathway is directly activated by mechanical stretch or indirectly activated by these upstream modulators. By using a nonselective cation channel blocker, gadolinium,²⁷ we demonstrated that the stretch-sensitive cation channels nonselective for Na⁺ and K⁺ were not involved in stretch-induced phosphorylation of STATs. In contrast, the NHE inhibitor HOE642²⁸ significantly reduced the phosphorylation of STAT1 and STAT3. Accumulating evidence has demonstrated that NHE can be activated by mechanical stretch,²⁹ and the activation of NHE can increase H⁺ efflux and Na⁺ influx. Na⁺ entering the cell via NHE activation may be exchanged for Ca²⁺ via an Na⁺/Ca²⁺ exchanger, leading to an increase in intracellular Ca²⁺ concentrations.³⁰ Ca²⁺ has been demonstrated to play an important role in the process of cardiac hypertrophy.³¹ Dose-dependent effects of BAPTA-AM demonstrated that certain levels of intracellular Ca²⁺ were required for the stretch-induced phosphorylation of STAT1 and STAT3. This suggests that the NHE might be involved in the stretch-induced phosphorylation of STATs through increasing Ca²⁺ levels. To our knowledge, this is the first report to show that intracellular calcium is required for the tyrosine phosphorylation of STATs. The precise mechanism needs to be clarified in the future (see proposed mechanism in Figure 8).

View larger version (21K): [in this window] [in a new window]   Figure 8. Proposed mechanism of stretch-induced activation of the JAK/STAT pathway in cardiomyocytes. IP3 indicates inositol triphosphate.

The JAK/STAT pathway was previously identified as a direct signaling pathway, linking cytokine and growth factor receptors directly to the nucleus. Recent studies have demonstrated interference between the JAK/STAT pathway and other known signaling pathways.^{32 33} Initially, tyrosine phosphorylation of STAT was thought to be the sole function of JAKs, but many lines of evidence have demonstrated that tyrosine phosphorylation of STAT can occur even in the absence of JAK kinase activity.³⁴ Intrinsic receptor kinase activity of the growth factor receptors or intracellular kinases such as v-src and v-abl were demonstrated to induce phosphorylation of STAT directly or through the activation of JAK kinases.^{35 36} These results suggested that a cross talk existed between the JAK/STAT pathway and other different signaling pathways. In the present study, we have shown that the stretch-induced phosphorylation of STAT1 and STAT3 was partially dependent on PKC activity. A previous report showed that PKC was activated by mechanical stretch. The precise mechanism by which PKC modulates the mechanical stretch-induced phosphorylation of STATs remains unknown. There is the possibility of cross talk between the JAK/STAT pathway and PKC or the existence of other molecules upstream of the STATs. Further studies are needed to clarify this mechanism.

The mechanical stretch of cultured cardiomyocytes in vitro is not a perfect model of in vivo pressure overload and has some drawbacks when used as a surrogate for hypertrophic signaling, given that pressure overload-induced hypertrophy takes several days in animals and years in humans. We reported that acute pressure overload activated the JAK/STAT pathway via the Ang II–dependent and –independent pathway in rat heart. It should be clarified whether chronic pressure overload causes constitutive activation of this pathway in in vivo heart.

In conclusion, the JAK/STAT pathway was activated by mechanical stretch, and this activation was partially dependent on autocrine/paracrine–secreted Ang II and was mainly dependent on the IL-6 family of cytokines but was independent of ET-1. Moreover, certain levels of intracellular Ca²⁺ were necessary for stretch-induced activation of this pathway, and PKC was also partially involved in this activation (Figure 8).

	Acknowledgments

 
This study was supported by a research grant, under the auspices of the Research for the Future Program, from the Japan Society for the Promotion of Science (JSPS-RFTF97I00201) and by research grants from the Ministry of Education, Science and Culture, Japan, and the Ministry of Welfare, Japan. The authors acknowledge Rie Inaba and Yoshiko Kurokawa for technical assistance.

Received October 2, 1998; accepted March 19, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham heart study. N Engl J Med. 1990;322:1561–1566.[Abstract]

2. Baker KM, Chernin MI, Wixson SK, Aceto JF. Renin-angiotensin system involvement in pressure-overload cardiac hypertrophy in rat. Am J Physiol. 1990;259:H324–H332.[Abstract/Free Full Text]

3. Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima, Hiro Y, Mizuno T, Maemura K, Kurihara H, Aikawa R, Takano H, Yazaki Y. Endothelin-1 is involved in mechanical stress-induced cardiomyocyte hypertrophy. J Biol Chem. 1996;271:3221–3228.[Abstract/Free Full Text]

4. Zimmer HG, Kolbeck-Ruhmkorff C, Zierhut W. Cardiac hypertrophy induced by alpha- and beta-adrenergic receptor stimulation. Cardioscience. 1995;6:47–57.[Medline] [Order article via Infotrieve]

5. Komuro I, Kaida T, Shibazaki Y, Kurabayashi M, Katoh Y, Hoh E, Takaku F, Yazaki Y. Stretching cardiac myocytes stimulates protooncogene expression. J Biol Chem. 1990;265:3595–3598.[Abstract/Free Full Text]

6. Sadoshima J, Izumo S. Mechanical stretch rapidly activates multiple signal transduction pathways in cardiac myocytes: potential involvement of an autocrine/paracrine mechanism. EMBO J. 1993;12:1681–1692.[Medline] [Order article via Infotrieve]

7. Rozich JD, Barnes MA, Schmid PG, Zile MR, McDermott PJ, Cooper G 4th. Load effects on gene expression during cardiac hypertrophy. J Mol Cell Cardiol. 1995;27:485–499.[Medline] [Order article via Infotrieve]

8. Komuro I, Kudo S, Yamazaki T, Zou Y, Shiojima I, Yazaki Y. Mechanical stretch activates the stress-activated protein kinases in cardiac myocytes. FASEB J. 1996;10:631–636.[Abstract]

9. Yamazaki T, Tobe K, Hoh E, Maemura K, Kaida T, Komuro I, Tamemoto H, Kadowaki T, Nagai R, Yazaki Y. Mechanical loading activates mitogen-activated protein kinase and S6 peptide kinase in cultured rat cardiac myocytes. J Biol Chem. 1993;268:12069–12076.[Abstract/Free Full Text]

10. Sadoshima J, Xu Y, Slayter HS, Izumo S. Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro. Cell. 1993;75:977–984.[Medline] [Order article via Infotrieve]

11. Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398–403.

12. Ihle JN. Cytokine receptor signaling. Nature. 1995;377:55911–55914.

13. Kodama H, Fukuda K, Pan J, Makino S, Baba A, Hori S, Ogawa S. Leukemia inhibitory factor, a potent cardiac hypertrophic cytokine, activates the JAK/STAT pathway in rat cardiomyocytes. Circ Res. 1997;81:656–663.[Abstract/Free Full Text]

14. Kunisada K, Hirota H, Fujio Y, Matsui H, Tani Y, Yamauchi-Takihara K, Kishimoto T. Activation of JAK-STAT and MAP kinases by leukemia inhibitory factor through gp130 in cardiac myocytes. Circulation. 1996;94:2626–2632.[Abstract/Free Full Text]

15. Pennica D, Wood WI, Chien KR. Cardiotrophin-1: a multifunctional cytokine that signals via LIF receptor-gp 130 dependent pathways. Cytokine Growth Factor Rev. 1996;7:81–91.[Medline] [Order article via Infotrieve]

16. Kodama H, Fukuda K, Pan J, Makino S, Sano M, Takahashi T, Hori S, Ogawa S. Biphasic activation of the JAK/STAT pathway by angiotensin II in rat cardiomyocytes. Circ Res. 1998;82:244–250.[Abstract/Free Full Text]

17. Kunisada K, Tone E, Fujio Y, Matsui H, Yamauchi-Takihara K, Kishimoto T. Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation. 1998;98:346–352.[Abstract/Free Full Text]

18. Pan J, Fukuda K, Kodama H, Makino S, Takahashi T, Sano M, Hori S, Ogawa S. Role of angiotensin II in activation of the JAK/STAT pathway induced by acute pressure overload in the rat heart. Circ Res. 1997;81:611–617.[Abstract/Free Full Text]

19. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11:1475–1489.[Abstract/Free Full Text]

20. Pennica D, Shaw KJ, Swanson TA, Moore MW, Shelton DL, Zioncheck KA, Rosenthal A, Taga T, Paoni NF, Wood WI. Cardiotrophin-1. J Biol Chem. 1995;270:10915–10922.[Abstract/Free Full Text]

21. Frank DA, Greenberg ME. Signal transduction pathways activated by ciliary neurotrophic factor and related cytokines. Perspect Dev Neurobiol. 1996;4:3–18.[Medline] [Order article via Infotrieve]

22. Stahl N, Boulton TG, Farruggella T, Ip NY, Davis S, Witthuhn BA, Quelle FW, Silvennoinen O, Barbieri G, Pellegrini S, Ihle JN, Yancopoulos GD. Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components. Science. 1994;263:92–95.[Abstract/Free Full Text]

23. Yoshida K, Taga T, Saito M, Suematsu S, Kumanogoh A, Tanaka T, Fujiwara H, Hirata M, Yamagami T, Nakahata T, Hirabayashi T, Yoneda Y, Tanaka K, Wang WZ, Mori C. Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders. Proc Natl Acad Sci U S A. 1996;93:407–411.[Abstract/Free Full Text]

24. Hirota H, Yoshida K, Kishimoto T, Taga T. Continuous activation of gp130, a signal-transducing receptor component for interleukin 6-related cytokines, causes myocardial hypertrophy in mice. Proc Natl Acad Sci U S A. 1995;92:4862–4866.[Abstract/Free Full Text]

25. Morris CE. Mechanosensitive ion channels. J Membr Biol. 1990;113:93–107.[Medline] [Order article via Infotrieve]

26. Yamazaki T, Komuro I, Kudoh S, Zou Y, Nagai R, Aikawa R, Uozumi H, Yazaki Y. Role of ion channels and exchangers in mechanical stretch-induced cardiomyocyte hypertrophy. Circ Res. 1998;82:430–437.[Abstract/Free Full Text]

27. Yang XC, Sachs F. Block of stretch-activated ion channels in Xenopus oocytes by gadolinium and calcium ions. Science. 1989;243:1068–1071.[Abstract/Free Full Text]

28. Scholz W, Albus U, Counillon L, Gogelein H, Lang HJ, Linz W, Weichert A, Scholkens BA. Protective effects of HOE642, a selective sodium-hydrogen exchange subtype 1 inhibitor, on cardiac ischaemia and reperfusion. Cardiovasc Res. 1995;29:260–268.[Medline] [Order article via Infotrieve]

29. Takewaki S, Kuro-o M, Hiroi Y, Yamazaki T, Noguchi T, Miyagishi A, Nakahara K, Aikawa M, Manabe I, Yazaki Y, Nagai R. Activation of Na⁺-H⁺ antiporter (NHE-1) gene expression during growth, hypertrophy and proliferation of the rabbit cardiovascular system. J Mol Cell Cardiol. 1995;27:729–742.[Medline] [Order article via Infotrieve]

30. Kim D, Cragoe EJ Jr, Smith TW. Relations among sodium pump inhibition, Na-Ca and Na-H exchange activities, and Ca-H interaction in cultured chick heart cells. Circ Res. 1987;60:185–193.[Abstract/Free Full Text]

31. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998;93:215–228.[Medline] [Order article via Infotrieve]

32. Sengupta TK, Talbot ES, Scherle PA, Ivashkiv LB. Rapid inhibition of interleukin-6 signaling and stat3 activation mediated by mitogen-activated protein kinases. Proc Natl Acad Sci U S A. 1998;95:11107–11112.[Abstract/Free Full Text]

33. Nicholson SE, Novak U, Ziegler SF, Layton JE. Distinct regions of the granulocyte colony-stimulating factor receptor are required for tyrosine phosphorylation of the signaling molecules JAK2, Stat3, and p42, p44 MAPK. Blood. 1995;86:3698–3704.[Abstract/Free Full Text]

34. Frank DA, Varticovski L. BCR/abl leads to the constitutive activation of STAT proteins, and shares an epitope with tyrosine phosphorylated STATs. Leukemia. 1996;10:1724–1730.[Medline] [Order article via Infotrieve]

35. Daniel NN, Pernis A, Rothman PB. Jak-STAT signaling induced by the v-abl oncogene. Science. 1995;269:1875–1877.[Abstract/Free Full Text]

36. Yu CL, Meyer DJ, Campbell GS, Larner AC, Carter-Su C, Schwartz J, Jove R Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. Science. 1995;269:81–83.[Abstract/Free Full Text]

This article has been cited by other articles:

				D. J. Hausenloy and D. M. Yellon Cardioprotective growth factors Cardiovasc Res, July 15, 2009; 83(2): 179 - 194. [Abstract] [Full Text] [PDF]

				A. Kusch, S. Tkachuk, N. Tkachuk, M. Patecki, J.-K. Park, R. Dietz, H. Haller, and I. Dumler The tight junction protein ZO-2 mediates proliferation of vascular smooth muscle cells via regulation of Stat1 Cardiovasc Res, July 1, 2009; 83(1): 115 - 122. [Abstract] [Full Text] [PDF]

				V. G. Barauna, F. C. Magalhaes, J. E. Krieger, and E. M. Oliveira AT1 receptor participates in the cardiac hypertrophy induced by resistance training in rats Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R381 - R387. [Abstract] [Full Text] [PDF]

				T. Ichiki, M. Jougasaki, M. Setoguchi, J. Imamura, H. Nakashima, T. Matsuoka, M. Sonoda, K. Nakamura, S. Minagoe, and C. Tei Cardiotrophin-1 stimulates intercellular adhesion molecule-1 and monocyte chemoattractant protein-1 in human aortic endothelial cells Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H750 - H763. [Abstract] [Full Text] [PDF]

				C. Natal, M. A. Fortuno, P. Restituto, A. Bazan, I. Colina, J. Diez, and N. Varo Cardiotrophin-1 is expressed in adipose tissue and upregulated in the metabolic syndrome Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E52 - E60. [Abstract] [Full Text] [PDF]

				C. E. Kendal-Wright Stretching, Mechanotransduction, and Proinflammatory Cytokines in the Fetal Membranes Reproductive Sciences, December 1, 2007; 14(8_suppl): 35 - 41. [Abstract] [PDF]

				N. Lopez, N. Varo, J. Diez, and M. A. Fortuno Loss of myocardial LIF receptor in experimental heart failure reduces cardiotrophin-1 cytoprotection. A role for neurohumoral agonists? Cardiovasc Res, August 1, 2007; 75(3): 536 - 545. [Abstract] [Full Text] [PDF]

				J. Espinoza-Derout, M. Wagner, K. Shahmiri, E. Mascareno, B. Chaqour, and M.A.Q. Siddiqui Pivotal role of cardiac lineage protein-1 (CLP-1) in transcriptional elongation factor P-TEFb complex formation in cardiac hypertrophy Cardiovasc Res, July 1, 2007; 75(1): 129 - 138. [Abstract] [Full Text] [PDF]

				K. Lemmens, V. F.M. Segers, M. Demolder, M. Michiels, P. Van Cauwelaert, and G. W. De Keulenaer Endogenous inhibitors of hypertrophy in concentric versus eccentric hypertrophy Eur J Heart Fail, April 1, 2007; 9(4): 352 - 356. [Abstract] [Full Text] [PDF]

				M. Petropavlovskaia, J. Makhlin, J. Sampalis, and L. Rosenberg Development of an in vitro pancreatic tissue model to study regulation of islet neogenesis associated protein expression. J. Endocrinol., October 1, 2006; 191(1): 65 - 81. [Abstract] [Full Text] [PDF]

				D. Srivastava and S. Yu Stretching to meet needs: integrin-linked kinase and the cardiac pump Genes & Dev., September 1, 2006; 20(17): 2327 - 2331. [Full Text] [PDF]

				G. Bendig, M. Grimmler, I. G. Huttner, G. Wessels, T. Dahme, S. Just, N. Trano, H. A. Katus, M. C. Fishman, and W. Rottbauer Integrin-linked kinase, a novel component of the cardiac mechanical stretch sensor, controls contractility in the zebrafish heart Genes & Dev., September 1, 2006; 20(17): 2361 - 2372. [Abstract] [Full Text] [PDF]

				K. L. Butler, L. C. Huffman, S. E. Koch, H. S. Hahn, and J. K. Gwathmey STAT-3 activation is necessary for ischemic preconditioning in hypertrophied myocardium Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H797 - H803. [Abstract] [Full Text] [PDF]

				M. F. Berry, A. J. Engler, Y. J. Woo, T. J. Pirolli, L. T. Bish, V. Jayasankar, K. J. Morine, T. J. Gardner, D. E. Discher, and H. L. Sweeney Mesenchymal stem cell injection after myocardial infarction improves myocardial compliance Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2196 - H2203. [Abstract] [Full Text] [PDF]

				T. Mohri, Y. Fujio, M. Maeda, T. Ito, T. Iwakura, Y. Oshima, Y. Uozumi, M. Segawa, H. Yamamoto, T. Kishimoto, et al. Leukemia Inhibitory Factor Induces Endothelial Differentiation in Cardiac Stem Cells J. Biol. Chem., March 10, 2006; 281(10): 6442 - 6447. [Abstract] [Full Text] [PDF]

				A. M. Samarel Costameres, focal adhesions, and cardiomyocyte mechanotransduction Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2291 - H2301. [Abstract] [Full Text] [PDF]

				C. J. Pemberton, S. D. Raudsepp, T. G. Yandle, V. A. Cameron, and A. M. Richards Plasma cardiotrophin-1 is elevated in human hypertension and stimulated by ventricular stretch Cardiovasc Res, October 1, 2005; 68(1): 109 - 117. [Abstract] [Full Text] [PDF]

				D. H. Freed, R. H. Cunnington, A. L. Dangerfield, J. S. Sutton, and I. M.C. Dixon Emerging evidence for the role of cardiotrophin-1 in cardiac repair in the infarcted heart Cardiovasc Res, March 1, 2005; 65(4): 782 - 792. [Abstract] [Full Text] [PDF]

				Y. Oshima, Y. Fujio, T. Nakanishi, N. Itoh, Y. Yamamoto, S. Negoro, K. Tanaka, T. Kishimoto, I. Kawase, and J. Azuma STAT3 mediates cardioprotection against ischemia/reperfusion injury through metallothionein induction in the heart Cardiovasc Res, February 1, 2005; 65(2): 428 - 435. [Abstract] [Full Text] [PDF]

				A. Palm-Leis, U. S. Singh, B. S. Herbelin, G. D. Olsovsky, K. M. Baker, and J. Pan Mitogen-activated Protein Kinases and Mitogen-activated Protein Kinase Phosphatases Mediate the Inhibitory Effects of All-trans Retinoic Acid on the Hypertrophic Growth of Cardiomyocytes J. Biol. Chem., December 24, 2004; 279(52): 54905 - 54917. [Abstract] [Full Text] [PDF]

				S. Sarkar, E. Vellaichamy, D. Young, and S. Sen Influence of cytokines and growth factors in ANG II-mediated collagen upregulation by fibroblasts in rats: role of myocytes Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H107 - H117. [Abstract] [Full Text] [PDF]

				M. Galvani, D. Ferrini, and F. Ottani Natriuretic peptides for risk stratification of patients with acute coronary syndromes Eur J Heart Fail, March 15, 2004; 6(3): 327 - 333. [Abstract] [Full Text] [PDF]

				A. Khan, G. W. Moe, N. Nili, E. Rezaei, M. Eskandarian, J. Butany, and B. H. Strauss The cardiac atria are chambers of active remodeling and dynamic collagen turnover during evolving heart failure J. Am. Coll. Cardiol., January 7, 2004; 43(1): 68 - 76. [Abstract] [Full Text] [PDF]

				M. M. Mascarenhas, R. M. Day, C. D. Ochoa, W.-I. Choi, L. Yu, B. Ouyang, H. G. Garg, C. A. Hales, and D. A. Quinn Low Molecular Weight Hyaluronan from Stretched Lung Enhances Interleukin-8 Expression Am. J. Respir. Cell Mol. Biol., January 1, 2004; 30(1): 51 - 60. [Abstract] [Full Text] [PDF]

				T. W Weiss, W. S Speidl, C. Kaun, G. Rega, C. Springer, K. Macfelda, U. M Losert, S. L Grant, M. L Marro, A. D Rhodes, et al. Glycoprotein 130 ligand oncostatin-M induces expression of vascular endothelial growth factor in human adult cardiac myocytes Cardiovasc Res, September 1, 2003; 59(3): 628 - 638. [Abstract] [Full Text] [PDF]

				Y. Wang Fill a Gab(1) in Cardiac Hypertrophy Signaling: Search a Missing Link Between gp130 and ERK5 in Hypertrophic Remodeling in Heart Circ. Res., August 8, 2003; 93(3): 186 - 188. [Full Text] [PDF]

				S. Chatterjee, L. T. Bish, V. Jayasankar, A. S. Stewart, Y. J. Woo, M. T. Crow, T. J. Gardner, and H. L. Sweeney Blocking the development of postischemic cardiomyopathy with viral gene transfer of the apoptosis repressor with caspase recruitment domain J. Thorac. Cardiovasc. Surg., June 1, 2003; 125(6): 1461 - 1469. [Abstract] [Full Text] [PDF]

				F. Yin, P. Li, M. Zheng, L. Chen, Q. Xu, K. Chen, Y.-y. Wang, Y.-y. Zhang, and C. Han Interleukin-6 Family of Cytokines Mediates Isoproterenol-induced Delayed STAT3 Activation in Mouse Heart J. Biol. Chem., May 30, 2003; 278(23): 21070 - 21075. [Abstract] [Full Text] [PDF]

				M. Jougasaki, H. Leskinen, A. M. Larsen, A. Cataliotti, H. H. Chen, and J. C. Burnett Jr. Leukemia inhibitory factor is augmented in the heart in experimental heart failure Eur J Heart Fail, March 1, 2003; 5(2): 137 - 145. [Abstract] [Full Text] [PDF]

				H. El-Adawi, L. Deng, A. Tramontano, S. Smith, E. Mascareno, K. Ganguly, R. Castillo, and N. El-Sherif The functional role of the JAK-STAT pathway in post-infarction remodeling Cardiovasc Res, January 1, 2003; 57(1): 129 - 138. [Abstract] [Full Text] [PDF]

				L. Zhao, J. J. Melenhorst, and L. Hennighausen Loss of Interleukin 6 Results in Delayed Mammary Gland Involution: A Possible Role for Mitogen-Activated Protein Kinase and Not Signal Transducer and Activator of Transcription 3 Mol. Endocrinol., December 1, 2002; 16(12): 2902 - 2912. [Abstract] [Full Text] [PDF]

				M. A. Sussman, A. McCulloch, and T. K. Borg Dance Band on the Titanic: Biomechanical Signaling in Cardiac Hypertrophy Circ. Res., November 15, 2002; 91(10): 888 - 898. [Abstract] [Full Text] [PDF]

				A. D. Oldenhof, O. P. Shynlova, M. Liu, B. L. Langille, and S. J. Lye Mitogen-activated protein kinases mediate stretch-induced c-fos mRNA expression in myometrial smooth muscle cells Am J Physiol Cell Physiol, November 1, 2002; 283(5): C1530 - C1539. [Abstract] [Full Text] [PDF]

				S. Curtis Hewitt, E. H. Goulding, E.M. Eddy, and K. S. Korach Studies Using the Estrogen Receptor {alpha} Knockout Uterus Demonstrate That Implantation but Not Decidualization-Associated Signaling Is Estrogen Dependent Biol Reprod, October 1, 2002; 67(4): 1268 - 1277. [Abstract] [Full Text] [PDF]

				M. R. Bristow and C. S. Long Cardiotrophin-1 in Heart Failure Circulation, September 17, 2002; 106(12): 1430 - 1432. [Full Text] [PDF]

				T. Osugi, Y. Oshima, Y. Fujio, M. Funamoto, A. Yamashita, S. Negoro, K. Kunisada, M. Izumi, Y. Nakaoka, H. Hirota, et al. Cardiac-specific Activation of Signal Transducer and Activator of Transcription 3 Promotes Vascular Formation in the Heart J. Biol. Chem., February 15, 2002; 277(8): 6676 - 6681. [Abstract] [Full Text] [PDF]

				B. Fisslthaler, R. Popp, U. R. Michaelis, L. Kiss, I. Fleming, and R. Busse Cyclic Stretch Enhances the Expression and Activity of Coronary Endothelium-Derived Hyperpolarizing Factor Synthase Hypertension, December 1, 2001; 38(6): 1427 - 1432. [Abstract] [Full Text] [PDF]

				W. F. Konertz, J. E. Shapland, H. Hotz, S. Dushe, J. P. Braun, K. Stantke, and F. X. Kleber Passive Containment and Reverse Remodeling by a Novel Textile Cardiac Support Device Circulation, September 18, 2001; 104 (2009): I-270 - I-275. [Abstract] [Full Text] [PDF]

				M. C. Oz Passive ventricular constraint for the treatment of congestive heart failure Ann. Thorac. Surg., March 1, 2001; 71 (2007): S185 - S187. [Full Text] [PDF]

				S. Talwar, P. F. Downie, I. B. Squire, J. E. Davies, D. B. Barnett, and L. L. Ng Plasma N-terminal pro BNP and cardiotrophin-1 are elevated in aortic stenosis Eur J Heart Fail, January 1, 2001; 3(1): 15 - 19. [Abstract] [Full Text] [PDF]

				S Talwar, I B Squire, P F Downie, J E Davies, L L Ng;, and G F BAXTER Plasma N terminal pro-brain natriuretic peptide and cardiotrophin 1 are raised in unstable angina Heart, October 1, 2000; 84(4): 421 - 424. [Abstract] [Full Text]

				G. E. Morley and J. Jalife Cardiac Gap Junction Remodeling by Stretch : Is It a Good Thing? Circ. Res., August 18, 2000; 87(4): 272 - 274. [Full Text] [PDF]

				C. Ruwhof and A. van der Laarse Mechanical stress-induced cardiac hypertrophy: mechanisms and signal transduction pathways Cardiovasc Res, July 1, 2000; 47(1): 23 - 37. [Abstract] [Full Text] [PDF]

				J. Fukuzawa, G. W. Booz, R. A. Hunt, N. Shimizu, V. Karoor, K. M. Baker, and D. E. Dostal Cardiotrophin-1 Increases Angiotensinogen mRNA in Rat Cardiac Myocytes Through STAT3 : An Autocrine Loop for Hypertrophy Hypertension, June 1, 2000; 35(6): 1191 - 1196. [Abstract] [Full Text] [PDF]

				M. Funamoto, Y. Fujio, K. Kunisada, S. Negoro, E. Tone, T. Osugi, H. Hirota, M. Izumi, K. Yoshizaki, K. Walsh, et al. Signal Transducer and Activator of Transcription 3 Is Required for Glycoprotein 130-mediated Induction of Vascular Endothelial Growth Factor in Cardiac Myocytes J. Biol. Chem., March 31, 2000; 275(14): 10561 - 10566. [Abstract] [Full Text] [PDF]

				M. A. Bogoyevitch Signalling via stress-activated mitogen-activated protein kinases in the cardiovascular system Cardiovasc Res, March 1, 2000; 45(4): 826 - 842. [Abstract] [Full Text] [PDF]

				D. E. Dostal and K. M. Baker The Cardiac Renin-Angiotensin System : Conceptual, or a Regulator of Cardiac Function? Circ. Res., October 1, 1999; 85(7): 643 - 650. [Abstract] [Full Text] [PDF]

				E. A. Palmieri, G. Benincasa, F. Di Rella, C. Casaburi, M. G. Monti, G. De Simone, L. Chiariotti, L. Palombini, C. B. Bruni, L. Sacca, et al. Differential expression of TNF-alpha , IL-6, and IGF-1 by graded mechanical stress in normal rat myocardium Am J Physiol Heart Circ Physiol, March 1, 2002; 282(3): H926 - H934. [Abstract] [Full Text] [PDF]

				M. Sano, K. Fukuda, T. Sato, H. Kawaguchi, M. Suematsu, S. Matsuda, S. Koyasu, H. Matsui, K. Yamauchi-Takihara, M. Harada, et al. ERK and p38 MAPK, but not NF-{kappa}B, Are Critically Involved in Reactive Oxygen Species-Mediated Induction of IL-6 by Angiotensin II in Cardiac Fibroblasts Circ. Res., October 12, 2001; 89(8): 661 - 669. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pan, J. Articles by Ogawa, S. Search for Related Content PubMed PubMed Citation Articles by Pan, J. Articles by Ogawa, S. Related Collections ACE/Angiotension receptors Cell signalling/signal transduction Growth factors/cytokines Heart failure - basic studies