© 1999 American Heart Association, Inc.
Original Contribution |
Mechanical Stretch Activates the JAK/STAT Pathway in Rat Cardiomyocytes
From the Cardiopulmonary Division (J.P., K.F., H.K., M. Sano, T.T., T.K., S.O.), Department of Internal Medicine, Keio University, Tokyo, and Chugai Pharmaceutical Co Ltd (M. Saito, J.M.), Shizuoka, Japan.
Correspondence to Keiichi Fukuda, Cardiopulmonary Division, Department of Internal Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. E-mail kfukuda{at}mc.med.keio.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—This study was designed to determine whether mechanical stretch activates the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway in cardiomyocytes and, if so, by what mechanism. Neonatal rat/murine cardiomyocytes were cultured on malleable silicone dishes and were stretched by 20%. Mechanical stretch induced rapid phosphorylation of JAK1, JAK2, Tyk2, STAT1, STAT3, and glycoprotein 130 as early as 2 minutes and peaked at 5 to 15 minutes. It also caused gel mobility shift of sis-inducing element, which was supershifted by preincubation with anti-STAT3 antibody. Preincubation with CV11974 (AT1 blocker) partially inhibited the phosphorylation of STAT1, but not that of STAT3. Preincubation with TAK044 (endothelin-1-type A/B-receptor blocker) did not attenuate this pathway. RX435 (anti–glycoprotein 130 blocking antibody) inhibited the phosphorylation of STAT3 and partially inhibited that of STAT1. Phosphorylation of STAT1 and STAT3 was strongly inhibited by HOE642 (Na+/H+ exchanger inhibitor) and BAPTA-AM (intracellular calcium chelator), but not by gadolinium (stretch-activated ion channel inhibitor), EGTA (extracellular Ca2+ chelator), or KN62 (Ca2+/calmodulin kinase II inhibitor). Chelerythrine (protein kinase C inhibitor) partially inhibited the phosphorylation of STAT1 and STAT3. Mechanical stretch also augmented the mRNA expression of cardiotrophin-1, interleukin-6, and leukemia inhibitory factor at 60 to 120 minutes. These results indicated that the JAK/STAT pathway was activated by mechanical stretch, and that this activation was partially dependent on autocrine/paracrine–secreted angiotensin II and was mainly dependent on the interleukin-6 family of cytokines but was independent of endothelin-1. Moreover, certain levels of intracellular Ca2+ were necessary for stretch-induced activation of this pathway, and protein kinase C was also partially involved in this activation.
Key Words: mechanical stretch • angiotensin II • cardiac hypertrophy • JAK/STAT pathway • glycoprotein 130
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cardiac hypertrophy is a compensatory response that allows the heart to cope with the pathogenic stimuli found with many cardiovascular diseases.1 Cardiac hypertrophy is induced by mechanical load and humoral factors, such as angiotensin II (Ang II),2 endothelin-1 (ET-1),3 and norepinephrine.4 Mechanical stretch is one of the most important stimuli of cardiac hypertrophy.5 6 Mechanical stretch-induced signal transduction is characterized by simultaneous activation of multiple second messenger systems. Many studies have demonstrated that mechanical stretch caused activation of multiple intracellular signal transduction pathways in cultured neonatal cardiomyocytes, such as phospholipases (C, D, and A2), tyrosine kinases, p21ras, Raf-1, mitogen-activated protein kinases, c-jun N-terminal protein kinases, and protein kinase C (PKC).7 8 9 Autocrine/paracrine–secreted growth factors such as Ang II and ET-1 play an important role in the stretch-induced hypertrophic response.10 11 Although mechanical stretch activates multiple second messenger systems, it remains unclear which molecules are directly activated by stretch and how mechanical stimuli are converted into intracellular signals to activate protein kinase cascades and stimulate the secretion of growth factors.
The Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway was initially discovered as a major signal transduction pathway of the cytokine superfamilies.12 It plays a crucial role in the growth and differentiation of a variety of cell types. Although the significance of the JAK/STAT pathway in cardiomyocytes has not been well characterized, increasing evidence suggests that this pathway might be involved in the development of myocardial hypertrophy. We and others have reported that the JAK/STAT pathway was activated by hypertrophic agonists (leukemia inhibitory factor [LIF], cardiotrophin-1 [CT-1], and Ang II) in vitro.13 14 15 16 LIF and CT-1 activated JAK1, JAK2, Tyk2, STAT1, and STAT3, and Ang II activated JAK2, Tyk2, STAT1, and STAT2 in cardiomyocytes. Kunisada et al17 reported that overexpression of constitutive active STAT3 augmented the LIF-induced increase in [3H]leucine uptake and hypertrophy marker gene expression, whereas overexpression of a dominant-negative STAT3 decreased these events. We have also demonstrated that acute pressure overload in vivo activated the JAK/STAT pathway and that Ang II was partially involved in this activation.18 These results suggested that this pathway was critically involved in the hypertrophic response.
In the present study, we investigated whether the JAK/STAT pathway was activated by mechanical stretch in cultured cardiomyocytes and, if so, how. We investigated (1) the involvement of autocrine/paracrine–secreted growth factors in stretch-induced activation of this pathway, (2) the role of ion channel and exchanger, and (3) the cross talk between the JAK/STAT pathway and other signaling pathways.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Culture and Cardiomyocyte Stretching
Primary cultures of cardiomyocytes were prepared from the ventricles of 1-day-old Wistar rats or ICR mice (Japan Clea Co Ltd) by enzymatic dissociation in 0.03% trypsin, 0.03% collagenase, and 20 µg/mL of DNase I as described previously.13 The cardiomyocytes were collected by differential adhesiveness. Cardiomyocyte-enriched suspensions were removed from the culture dishes and plated at a density of 1x105 cells/cm2 on silicone rubber dishes (241 cm) precoated with laminin (2 µg/cm2). Twelve hours after plating, bromodeoxyuridine was added to the medium at a concentration of 10-7 mol/L for 12 hours to deplete residual nonmyocytes. The experiment was performed on the second day from the primary culture, and the final density of the cells was 1.1x105–1.2x105 cells/cm2. The nonmyocyte population amounted to
5 to 10% of the total cell population as determined by
immunofluorescence staining with monoclonal
anti-sarcomeric myosin antibody (MF20). The cells were grown in
M199/DMEM medium supplemented with 10% FBS, penicillin (50 U/mL), and
streptomycin (50 µg/mL) at 37°C in humid air with 5%
CO2. The culture medium was changed 24 hours
after seeding to a medium containing 0.1% FBS. After 8 hours in the
0.1% FBS medium, the culture dishes were stretched by 20%. Stretching
of cardiomyocytes was accomplished essentially according to
the method of Komuro et al5 and Sadoshima and
Izumo.6 A 20% stretch was shown to be sufficient to
activate various signal transduction pathways and not to damage
the stretched cell.7 8 9 We carried out stretch and control
experiments simultaneously, with the same pool of cells in
each experiment.
Immunoprecipitation and Western Blot Analysis
Polyclonal antibodies to JAK1, JAK2, Tyk2, STAT1
/ß, STAT3,
and glycoprotein (gp) 130, and monoclonal antibody to
STAT1, were purchased from Santa Cruz Biotechnology.
Anti-phosphotyrosine antibody (4G10) was purchased from Upstate
Biotechnology. Polyclonal antibody to phosphospecific STAT3 was
purchased from New England Biolabs, Inc.
To prepare cell extracts, cells were washed 3 times in PBS and then extracted in lysis buffer containing (in mmol/L) Tris-HCl (pH 7.4) 20, NaCl 100, EDTA 5, NaF 50, Na3P2O7 10, Na3VO4 1, phenylmethylsulfonyl fluoride 1, and 1.0% Triton X-100, 10% glycerol, 0.1% SDS, 1.0% deoxycholic acid, 10 µg/mL aprotinin, and 10 µg/mL leupeptin. The lysates were centrifuged at 10 000g for 15 minutes. Protein concentration was determined by the Bio-Rad protein assay.
Cell lysates were incubated with 1 µg/mL of the respective antibodies overnight at 4°C. Immunocomplexes were collected by incubating with 50 µL of protein A– or G–Sepharose for 2 hours. Immunoprecipitates were washed 4 times with ice-cold lysis buffer. The pellets were resuspended in 2x sample buffer containing 50 mmol/L Tris (pH 6.8), 2% SDS, 2% ß-mercaptoethanol, 2% glycerol, and bromphenol blue. The samples were subjected to SDS-PAGE and were transferred to reinforced nitrocellulose membranes (Schleicher & Schuell). The membranes were blocked with 5% BSA in Tris-buffered saline–Tween solution (20 mmol/L Tris-HCl [pH 7.4], 150 mmol/L NaCl, and 0.05% Tween 20) for 2 hours at room temperature. Blots were immunolabeled overnight at 4°C with anti-phosphotyrosine antibody or anti-gp130 antibody. Proteins were visualized by enhanced chemiluminescence (Amersham). The blots were stripped and reprobed with the same antibodies used for their immunoprecipitation, to ensure equal loading of the proteins.
For Western blot analysis, cells were lysed in lysis buffer containing (in mmol/L) Tris (pH 7.6) 20, NaCl 250, EDTA 3, EGTA 3, and ß-glycerophosphate 3, and 0.5% NP-40 and the protease inhibitors described above. Immunoblotting was conducted with anti-phospho-STAT3, and anti-STAT3 antibodies.
Gel Mobility Shift Assay
Cardiomyocytes were rinsed with PBS at 0°C and scraped into
the same buffer. Nuclear extracts were prepared according to standard
methods described previously.13 19 Five micrograms of
nuclear extracts were incubated with 1 µg of poly(dI-dC)-poly(dI-dC)
(Pharmacia Biotech) with or without competitor
oligonucleotide in 20 µL of a solution containing
(in mmol/L) HEPES (pH 7.9) 10, NaCl 50, and EDTA 1, and 10%
glycerol, for 20 minutes at 25°C. The samples were incubated with 1
or 2 fmol of radiolabeled probes (5000 cpm) for 10 minutes at
25°C. The probes were purchased from Santa Cruz Biotechnology, and
their sequences were described (sis-inducing element [SIE]-DNA,
5'-CAGTTCCCGTCAATC-3'; mutant SIE-DNA, 5'-CAGCCACCGTCAATC). Binding
reactions were resolved on a 4% native polyacrylamide gel
containing TAE buffer containing (in mmol/L) Tris (pH 7.5)
40, sodium acetate 40, and EDTA 1 for 3 hours at 150 V at 4°C. The
gel was dried and exposed to x-ray film for 12 hours. For supershift
assays, nuclear extracts were incubated with 2 µg of antibodies to
STAT1, STAT3, or both and incubated at room temperature for 1 hour, and
the complexes were resolved by gel electrophoresis.
RNA Extraction and Reverse Transcriptase–Polymerase Chain Reaction
(RT-PCR) Analysis
Total RNA was extracted from neonatal rat
cardiomyocytes using TRIzol reagent (GIBCO). The samples
were treated with DNase I and then subjected to first-strand synthesis
using oligo(dT) primer and reverse transcriptase (Superscript II). The
PCR reaction was performed in a reaction volume of 20 µL containing
250 mmol/L of dNTP, 50 pmol of each specific primer, and 2.5 U of
Taq polymerase. The primers used were as follows: CT-1
sense, CCCTCTTCACCTCCAACAGTG, and antisense, GAGGCGAGAGCAGAAGAGAA;
interleukin (IL)-6 sense, GACTTCACAGAGGATACCACCC, and antisense,
GACTTCACAGAGGATACCACCC; LIF sense, AGTCAACTGGCTCAACTCAACG, and
antisense, CTGGGCCAACACACTTATGACT; and ciliary neurotrophic factor
(CNTF) sense, GGATGGCTTTCGCAGAGCAAAC, and antisense,
AGGACCTTCAAGCCCCATAGCT. Denaturing, annealing, and extension reactions
were performed at 95°C for 30 seconds, 58 to 60°C for 1 minute, and
72°C for 1 minute, respectively. Before the quantitative
analysis, the linear range of the PCR cycles was measured for
each cytokine, and the appropriate number of PCR cycles was
determined. -Tubulin was used as an internal control for each
sample.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mechanical Stretch Activates the JAK Family Kinases
We initially determined whether mechanical stretch would result in tyrosine phosphorylation of the JAK kinases. After stretching, cardiomyocytes were lysed and immunoprecipitated with anti-JAK1, anti-JAK2, or anti-Tyk2 antibody and immunoblotted with anti-phosphotyrosine antibody (Figure 1
). JAK1, JAK2, and Tyk2 were rapidly
phosphorylated at 2 minutes, which peaked at 5 minutes
and decreased thereafter. These findings indicated that mechanical
stretch could directly or indirectly activate the JAK kinases
in rat cardiomyocytes.
|
Mechanical Stretch Activates STAT1 and STAT3
To demonstrate that mechanical stretch would activate the
STAT families, we first analyzed the tyrosine
phosphorylation of STAT1 and STAT3 by
immunoprecipitation-Western blot analysis (Figure 2A). After mechanical stretching, STAT1
and STAT3 were phosphorylated as early as 2 minutes,
which peaked at 5 to 15 minutes and then gradually decreased, but
remained elevated at 30 minutes. The dual bands in the upper panel
indicate STAT1 and STAT1ß.
|
The DNA binding activity of STATs depends primarily on tyrosine
phosphorylation. To investigate whether mechanical
stretch induces sis-inducing factor (SIF)–like activity in
cardiomyocytes, we performed a gel mobility shift assay
using 32P-labeled SIE
oligonucleotide. As shown in Figure 2B
, left,
stimulation of cardiomyocytes by mechanical stretch
resulted in the induction of protein complexes that bound to the SIE
oligonucleotide. The specific DNA-protein complex
increased from 5 minutes, peaked at 30 minutes, and decreased at 60
minutes. No mobility shift was observed with mutant SIE probe (lane 7),
and the addition of higher concentrations of unlabeled SIE competed
with the SIF complexes (lane 6), confirming the specificity of binding
to SIE. A supershift assay revealed that incubation of the DNA-protein
complex with anti-STAT1 antibody only mildly inhibited binding of the
SIF band, but incubation with anti-STAT3 antibody or with both
anti-STAT1 and anti-STAT3 antibodies significantly inhibited the
binding of SIF complexes in stretch-stimulated
cardiomyocyte extracts (Figure 2B, right). The
antibody to STAT3 removed the SIF complexes rather than supershifting
them. The anti-STAT3 antibody used is a polyclonal antibody that
recognizes amino acids 626 to 640. This antibody does not directly
recognize the DNA binding domain but seems to have inhibited the
binding of STAT3 to DNA. These results indicated that mechanical
stretch induced homodimerization or heterodimerization of STAT1 and
STAT3 and formation of SIF complexes.
Inhibition of Phosphorylation of STATs by a JAK2
Kinase Inhibitor
Recent studies have reported that STAT1 and STAT3 can be
phosphorylated by several tyrosine kinases other than
JAK families. To determine whether the phosphorylation
of STAT1 and STAT3 induced by stretching was mediated by the JAK
kinase–dependent pathway, we investigated the effect of a specific
JAK2 kinase inhibitor, AG490, on the
phosphorylation of STATs. Cardiomyocytes were
pretreated with 4x10-5 mol/L of AG490 for 30
minutes before stretching. As shown in Figure 2C, AG490
significantly inhibited the phosphorylation of STAT1
and STAT3. We have observed that AG490 did not affect the LIF-induced
tyrosine phosphorylation of JAK1 and Tyk2, but it
inhibited LIF-induced phosphorylation of STAT3 by 88%
and slightly inhibited that of STAT1 (H.K., K.F., unpublished data,
1998). These data suggested that JAK2 kinase activity was
necessary for stretch-induced activation of STAT1 and STAT3 in
cardiomyocytes.
Autocrine/Paracrine–Secreted Ang II but Not ET-1 Is Partially
Involved in Phosphorylation of STATs
Previous studies have reported that mechanical stretch
stimulates secretion of Ang II and ET-1 in cardiomyocytes
and that both factors are involved in the development of mechanical
stretch-induced cardiac hypertrophy.10 11 We
have reported that pressure overload-induced activation of the JAK/STAT
pathway was partially dependent on Ang II, mediated via the
AT1.18 Thus, we investigated whether
these 2 factors were involved in the mechanical stretch-induced
phosphorylation of STATs. As shown in Figure 3A and 3B, CV11974
(AT1 antagonist) partially inhibited
the phosphorylation of STAT1 and STAT1ß induced by
mechanical stretch, whereas it completely inhibited that of STAT1
induced by Ang II. CV11974 did not affect the
phosphorylation of STAT3 induced by mechanical stretch.
Pretreatment with TAK044 (ET-1 type A/B receptor
antagonist) did not inhibit the
phosphorylation of STAT1 and STAT3 induced by
mechanical stretch (Figure 3C). As shown in Figure 3D, we
have observed that ET-1 stimulation did not tyrosine
phosphorylate STAT3 until 30 minutes. It induced tyrosine
phosphorylation of STAT1 at 2 to 5 minutes, although
only at a very low level. TAK044 completely inhibited the
phosphorylation of STAT1 induced by ET-1. These
findings indicated that autocrine/paracrine-secreted Ang II or ET-1 did
not seem to be involved in the activation of STAT3 induced by
mechanical stretch, and Ang II was partially involved in the activation
of STAT1, whereas ET-1 did not seem to be involved in this
activation.
|
Involvement of gp130-Related Signaling in Stretch-Induced
Activation of STATs
To demonstrate that gp130-related signaling was involved in the
stretch-induced activation of this pathway, we preincubated the cells
with anti-mouse gp130-specific blocking antibody RX435 for 30 minutes
and observed the tyrosine phosphorylation of STAT1 and
STAT3. RX435 specifically blocks the actions of LIF, IL-6, IL-11, and
oncostatin M on mouse myeloid leukemic M1 cells and inhibits the
binding of CT-1 to M1 cells.20 RX435 strongly reduced the
stretch-induced phosphorylation of STAT3 and slightly
inhibited the phosphorylation of STAT1/ß (Figure 4A and 4B). We then detected the
phosphorylation of gp130 (Figure 4C). gp130 was
rapidly phosphorylated at 2 minutes after stretching,
gradually decreased, and returned to the control level at 30 minutes.
These findings suggested that the IL-6 family of cytokines is
critically involved in the stretch-induced activation of STATs,
especially STAT3, in cardiomyocytes.
|
Expression of the IL-6 Family of Cytokines in
Stretched Cardiomyocytes
On the basis of the above results, we further tested the levels of
expression of CT-1, IL-6, LIF, and CNTF mRNA by RT-PCR in stretched
cardiomyocytes (Figure 4D). We used 23 cycles for
IL-6 and -tubulin, 28 cycles for CT-1 and CNTF, and 30 cycles for
LIF. The expression of CNTF was unaffected by stretch stimulation. In
contrast, expression of CT-1, IL-6, and LIF mRNA increased after
stretching and peaked at 60 to 120 minutes. These results were
reproducible in 3 separate experiments. These findings indicated that
mechanical stretch was involved not only in rapid secretion but also in
mRNA expression of the IL-6 family of cytokines in
cardiomyocytes.
Role of ion channels and Na+/H+ exchanger
(NHE) in Stretch-Induced Phosphorylation of
STATs
To determine whether mechanosensitive ion channels and NHE are
involved in stretch-induced activation of STATs, we pretreated the
cells with either a specific inhibitor of the
stretch-sensitive cation channel (10-5 mol/L
gadolinium) or an NHE inhibitor
(10-5 mol/L HOE642) and stretched the cells by
20% for 6 minutes. The results are shown in Figure 5. Stretch-induced
phosphorylation of STAT1 and STAT3 was not affected by
pretreatment with gadolinium. In contrast,
phosphorylation of STAT1 and STAT3 was strongly
inhibited by HOE642. These results suggested that stretch-induced
phosphorylation of STATs was partially dependent on the
activation of NHE.
|
Role of Ca2+ in Mediating Stretch-Induced
Phosphorylation of STATs
A previous study7 reported that mechanical stretch
increased intracellular Ca2+. It remains unclear
whether these pathways are involved in the activation of STATs induced
by mechanical stretching. In this study, we observed that the addition
of EGTA (4x10-3 mol/L) to the culture medium
resulted in no significant reduction of the
phosphorylation of STAT1 and STAT3. In contrast, the
stretch-induced phosphorylation of STAT1 and STAT3 was
completely attenuated by buffering the intracellular free
Ca2+ with the pretreatment of membrane-permeable
BAPTA-AM (1x10-4 mol/L). This inhibition was
dose dependent (Figure 6A and 6B). Next,
we pretreated the cells with the calmodulin kinase II
antagonist KN62 for 30 minutes and found that KN62 had no
significant effect on phosphorylation of STAT1 and
STAT3 (Figure 6A). These results suggested that certain levels
of intracellular Ca2+ play a pivotal role in
stretch-induced activation of STATs, and that
Ca2+ influx was not apparently necessary for
stretch-induced activation of this pathway.
|
Role of PKC in Mediating Stretch-Induced
Phosphorylation of STATs
Mechanical stretch activates PKC in
cardiomyocytes, and PKC is critically involved in
stretch-induced mitogen-activated protein kinase
activation.7 To investigate the role of PKC in
stretch-induced activation of STATs, we stimulated the cells with
phorbol 12-myristate 13-acetate (PMA)
(1x10-6 mol/L), a direct activator
of PKC, and blocked the PKC activity with chelerythrine
(1x10-5 mol/L) and observed the
phosphorylation of STATs. As shown in Figure 7, PMA caused significant
phosphorylation of STAT1 and STAT3. Pretreatment with
chelerythrine for 30 minutes significantly attenuated the
phosphorylation of STAT1 and STAT3. These results
suggested that PKC is partially involved in stretch-induced activation
of STATs.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the present study, we demonstrated that mechanical stretch induced rapid phosphorylation of JAK1, JAK2, Tyk2, STAT1, STAT3, and gp130 and induced formation of SIF complexes in rat cardiomyocytes. The stretch-induced activation of STAT1 and STAT3 was partially dependent on JAK2 kinase. We also found that autocrine/paracrine–secreted Ang II was partially involved in stretch-induced phosphorylation of STAT1 but that ET-1 was not involved in this activation. In contrast, the IL-6 cytokine family–related signaling pathway plays an important role in the stretch-induced activation of this pathway in cardiomyocytes. Moreover, mRNA expression of the IL-6 family of cytokines was upregulated by mechanical stretch. NHE activation was involved in the activation of STATs. In contrast, stretch-sensitive cation channels did not appear to be involved in this activation. We also demonstrated that intracellular Ca2+ was required for the stretch-induced activation of STATs and that the activation of PKC was partially involved in this activation in cardiomyocytes.
Accumulating evidence has demonstrated that mechanical stretch stimulates production or secretion of growth factors and that an autocrine/paracrine response is a common mechanism used in stretch-induced cell growth.3 10 11 Ang II and ET-1 have been shown to play an important role in mediating stretch-induced cardiac hypertrophy in cardiomyocytes. Thus, we investigated whether the autocrine/paracrine–secreted Ang II and/or ET-1 was involved in the activation of STATs. We have previously reported that Ang II phosphorylated JAK2, Tyk2, STAT1, and STAT2, but not JAK1 or STAT3, at up to 30 minutes and that CV11974 significantly inhibited the Ang II-induced phosphorylation of STAT1.16 In this study, we observed that ET-1 did not cause phosphorylation of STAT3 at least up to 30 minutes and that it slightly tyrosine phosphorylated STAT1 at 2 to 5 minutes. Moreover, we observed that the phosphorylation of STAT1 was completely inhibited by TAK044. These findings indicated that autocrine/paracrine–secreted Ang II or ET-1 might be involved in the stretch-induced phosphorylation of STAT1 but would not be involved in that of STAT3. The present study revealed that autocrine/paracrine–secreted Ang II was partially involved in the stretch-induced phosphorylation of STAT1; however, we could not confirm that ET-1 was involved in this activation. Moreover, the present findings on STAT3 indicated that factors other than Ang II and ET-1 were involved in the activation of STATs induced by mechanical stretch.
We and others have previously demonstrated that LIF causes cardiac hypertrophy and activated the JAK/STAT pathway.13 14 The other IL-6–related cytokines, including CNTF, oncostatin M, and CT-1, also activate the JAK/STAT pathway via gp130.15 21 22 gp130 functions as a common cytokine signal transducer for the IL-6 family of cytokines, and targeting of the gp130 gene leads to the failure of myocardium to mature.23 Moreover, transgenic mice expressing both IL-6 and IL-6 receptor displayed constitutive tyrosine phosphorylation of gp130 in the myocardium and led to cardiac hypertrophy.24 These findings suggested that a gp130-dependent signaling pathway might be critically involved in the hypertrophic response of cardiomyocytes. In this study, we demonstrated that the gp130-dependent pathway plays an important role in mechanical stretch-induced activation of the JAK/STAT pathway. Pretreatment with RX435 significantly reduced the phosphorylation of STAT1 and STAT3, especially that of STAT3. We also found that gp130 receptor was rapidly phosphorylated by stretching. The finding that the phosphorylation of STAT3 was almost completely inhibited by RX435 suggested that this family of cytokines plays a pivotal role in stretch-induced activation of STAT3. In contrast, given that the phosphorylation of STAT1 was partially inhibited by both RX435 and CV11974, it seems that both Ang II and the IL-6 family of cytokines might be involved in the activation of STAT1 in cardiomyocytes.
Recent studies have revealed that ion channels and ion exchangers
in the cell membrane can rapidly respond to extracellular stimuli and
play a pivotal role in fundamental cell functions.25 26
Therefore, there is the possibility that the JAK/STAT pathway is
directly activated by mechanical stretch or indirectly
activated by these upstream modulators. By using a nonselective
cation channel blocker, gadolinium,27 we demonstrated that
the stretch-sensitive cation channels nonselective for
Na+ and K+ were not
involved in stretch-induced phosphorylation of STATs.
In contrast, the NHE inhibitor HOE64228
significantly reduced the phosphorylation of STAT1 and
STAT3. Accumulating evidence has demonstrated that NHE can be
activated by mechanical stretch,29 and the
activation of NHE can increase H+ efflux and
Na+ influx. Na+ entering
the cell via NHE activation may be exchanged for
Ca2+ via an
Na+/Ca2+ exchanger, leading
to an increase in intracellular Ca2+
concentrations.30 Ca2+ has been
demonstrated to play an important role in the process of cardiac
hypertrophy.31 Dose-dependent effects of
BAPTA-AM demonstrated that certain levels of intracellular
Ca2+ were required for the stretch-induced
phosphorylation of STAT1 and STAT3. This suggests that
the NHE might be involved in the stretch-induced
phosphorylation of STATs through increasing
Ca2+ levels. To our knowledge, this is the first
report to show that intracellular calcium is required for the tyrosine
phosphorylation of STATs. The precise mechanism needs
to be clarified in the future (see proposed mechanism in Figure 8).
|
The JAK/STAT pathway was previously identified as a direct signaling pathway, linking cytokine and growth factor receptors directly to the nucleus. Recent studies have demonstrated interference between the JAK/STAT pathway and other known signaling pathways.32 33 Initially, tyrosine phosphorylation of STAT was thought to be the sole function of JAKs, but many lines of evidence have demonstrated that tyrosine phosphorylation of STAT can occur even in the absence of JAK kinase activity.34 Intrinsic receptor kinase activity of the growth factor receptors or intracellular kinases such as v-src and v-abl were demonstrated to induce phosphorylation of STAT directly or through the activation of JAK kinases.35 36 These results suggested that a cross talk existed between the JAK/STAT pathway and other different signaling pathways. In the present study, we have shown that the stretch-induced phosphorylation of STAT1 and STAT3 was partially dependent on PKC activity. A previous report showed that PKC was activated by mechanical stretch. The precise mechanism by which PKC modulates the mechanical stretch-induced phosphorylation of STATs remains unknown. There is the possibility of cross talk between the JAK/STAT pathway and PKC or the existence of other molecules upstream of the STATs. Further studies are needed to clarify this mechanism.
The mechanical stretch of cultured cardiomyocytes in vitro is not a perfect model of in vivo pressure overload and has some drawbacks when used as a surrogate for hypertrophic signaling, given that pressure overload-induced hypertrophy takes several days in animals and years in humans. We reported that acute pressure overload activated the JAK/STAT pathway via the Ang II–dependent and –independent pathway in rat heart. It should be clarified whether chronic pressure overload causes constitutive activation of this pathway in in vivo heart.
In conclusion, the JAK/STAT pathway was activated by
mechanical stretch, and this activation was partially dependent on
autocrine/paracrine–secreted Ang II and was mainly dependent on the
IL-6 family of cytokines but was independent of ET-1. Moreover,
certain levels of intracellular Ca2+ were
necessary for stretch-induced activation of this pathway, and PKC was
also partially involved in this activation (Figure 8).
|
Acknowledgments |
|---|
This study was supported by a research grant, under the auspices of the Research for the Future Program, from the Japan Society for the Promotion of Science (JSPS-RFTF97I00201) and by research grants from the Ministry of Education, Science and Culture, Japan, and the Ministry of Welfare, Japan. The authors acknowledge Rie Inaba and Yoshiko Kurokawa for technical assistance.
Received October 2, 1998; accepted March 19, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham heart study. N Engl J Med. 1990;322:1561–1566.[Abstract]
-
Baker KM, Chernin MI, Wixson SK, Aceto JF.
Renin-angiotensin system involvement in pressure-overload
cardiac hypertrophy in rat. Am J Physiol. 1990;259:H324–H332.
[Abstract/Free Full Text] -
Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima, Hiro
Y, Mizuno T, Maemura K, Kurihara H, Aikawa R, Takano H, Yazaki Y.
Endothelin-1 is involved in mechanical stress-induced
cardiomyocyte hypertrophy. J Biol
Chem. 1996;271:3221–3228.
[Abstract/Free Full Text] - Zimmer HG, Kolbeck-Ruhmkorff C, Zierhut W. Cardiac hypertrophy induced by alpha- and beta-adrenergic receptor stimulation. Cardioscience. 1995;6:47–57.[Medline] [Order article via Infotrieve]
-
Komuro I, Kaida T, Shibazaki Y, Kurabayashi M, Katoh
Y, Hoh E, Takaku F, Yazaki Y. Stretching cardiac myocytes stimulates
protooncogene expression. J Biol Chem. 1990;265:3595–3598.
[Abstract/Free Full Text] - Sadoshima J, Izumo S. Mechanical stretch rapidly activates multiple signal transduction pathways in cardiac myocytes: potential involvement of an autocrine/paracrine mechanism. EMBO J. 1993;12:1681–1692.[Medline] [Order article via Infotrieve]
- Rozich JD, Barnes MA, Schmid PG, Zile MR, McDermott PJ, Cooper G 4th. Load effects on gene expression during cardiac hypertrophy. J Mol Cell Cardiol. 1995;27:485–499.[Medline] [Order article via Infotrieve]
- Komuro I, Kudo S, Yamazaki T, Zou Y, Shiojima I, Yazaki Y. Mechanical stretch activates the stress-activated protein kinases in cardiac myocytes. FASEB J. 1996;10:631–636.[Abstract]
-
Yamazaki T, Tobe K, Hoh E, Maemura K, Kaida T, Komuro
I, Tamemoto H, Kadowaki T, Nagai R, Yazaki Y. Mechanical loading
activates mitogen-activated protein kinase and S6
peptide kinase in cultured rat cardiac myocytes. J Biol
Chem. 1993;268:12069–12076.
[Abstract/Free Full Text] - Sadoshima J, Xu Y, Slayter HS, Izumo S. Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro. Cell. 1993;75:977–984.[Medline] [Order article via Infotrieve]
- Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398–403.
- Ihle JN. Cytokine receptor signaling. Nature. 1995;377:55911–55914.
-
Kodama H, Fukuda K, Pan J, Makino S, Baba A, Hori S,
Ogawa S. Leukemia inhibitory factor, a potent cardiac
hypertrophic cytokine, activates the JAK/STAT pathway
in rat cardiomyocytes. Circ Res. 1997;81:656–663.
[Abstract/Free Full Text] -
Kunisada K, Hirota H, Fujio Y, Matsui H, Tani Y,
Yamauchi-Takihara K, Kishimoto T. Activation of JAK-STAT and MAP
kinases by leukemia inhibitory factor through gp130 in
cardiac myocytes. Circulation. 1996;94:2626–2632.
[Abstract/Free Full Text] - Pennica D, Wood WI, Chien KR. Cardiotrophin-1: a multifunctional cytokine that signals via LIF receptor-gp 130 dependent pathways. Cytokine Growth Factor Rev. 1996;7:81–91.[Medline] [Order article via Infotrieve]
-
Kodama H, Fukuda K, Pan J, Makino S, Sano M, Takahashi
T, Hori S, Ogawa S. Biphasic activation of the JAK/STAT pathway by
angiotensin II in rat cardiomyocytes.
Circ Res. 1998;82:244–250.
[Abstract/Free Full Text] -
Kunisada K, Tone E, Fujio Y, Matsui H,
Yamauchi-Takihara K, Kishimoto T. Activation of gp130 transduces
hypertrophic signals via STAT3 in cardiac myocytes.
Circulation. 1998;98:346–352.
[Abstract/Free Full Text] -
Pan J, Fukuda K, Kodama H, Makino S, Takahashi T, Sano
M, Hori S, Ogawa S. Role of angiotensin II in activation of
the JAK/STAT pathway induced by acute pressure overload in the rat
heart. Circ Res. 1997;81:611–617.
[Abstract/Free Full Text] -
Dignam JD, Lebovitz RM, Roeder RG. Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res. 1983;11:1475–1489.
[Abstract/Free Full Text] -
Pennica D, Shaw KJ, Swanson TA, Moore MW, Shelton DL,
Zioncheck KA, Rosenthal A, Taga T, Paoni NF, Wood WI. Cardiotrophin-1.
J Biol Chem. 1995;270:10915–10922.
[Abstract/Free Full Text] - Frank DA, Greenberg ME. Signal transduction pathways activated by ciliary neurotrophic factor and related cytokines. Perspect Dev Neurobiol. 1996;4:3–18.[Medline] [Order article via Infotrieve]
-
Stahl N, Boulton TG, Farruggella T, Ip NY, Davis S,
Witthuhn BA, Quelle FW, Silvennoinen O, Barbieri G, Pellegrini S, Ihle
JN, Yancopoulos GD. Association and activation of Jak-Tyk kinases
by CNTF-LIF-OSM-IL-6 beta receptor components.
Science. 1994;263:92–95.
[Abstract/Free Full Text] -
Yoshida K, Taga T, Saito M, Suematsu S, Kumanogoh A,
Tanaka T, Fujiwara H, Hirata M, Yamagami T, Nakahata T, Hirabayashi T,
Yoneda Y, Tanaka K, Wang WZ, Mori C. Targeted disruption of gp130, a
common signal transducer for the interleukin 6 family of
cytokines, leads to myocardial and hematological disorders.
Proc Natl Acad Sci U S A. 1996;93:407–411.
[Abstract/Free Full Text] -
Hirota H, Yoshida K, Kishimoto T, Taga T. Continuous
activation of gp130, a signal-transducing receptor component for
interleukin 6-related cytokines, causes myocardial
hypertrophy in mice. Proc Natl Acad Sci U S A. 1995;92:4862–4866.
[Abstract/Free Full Text] - Morris CE. Mechanosensitive ion channels. J Membr Biol. 1990;113:93–107.[Medline] [Order article via Infotrieve]
-
Yamazaki T, Komuro I, Kudoh S, Zou Y, Nagai R, Aikawa
R, Uozumi H, Yazaki Y. Role of ion channels and exchangers in
mechanical stretch-induced cardiomyocyte
hypertrophy. Circ Res. 1998;82:430–437.
[Abstract/Free Full Text] -
Yang XC, Sachs F. Block of stretch-activated
ion channels in Xenopus oocytes by gadolinium and calcium
ions. Science. 1989;243:1068–1071.
[Abstract/Free Full Text] - Scholz W, Albus U, Counillon L, Gogelein H, Lang HJ, Linz W, Weichert A, Scholkens BA. Protective effects of HOE642, a selective sodium-hydrogen exchange subtype 1 inhibitor, on cardiac ischaemia and reperfusion. Cardiovasc Res. 1995;29:260–268.[Medline] [Order article via Infotrieve]
- Takewaki S, Kuro-o M, Hiroi Y, Yamazaki T, Noguchi T, Miyagishi A, Nakahara K, Aikawa M, Manabe I, Yazaki Y, Nagai R. Activation of Na+-H+ antiporter (NHE-1) gene expression during growth, hypertrophy and proliferation of the rabbit cardiovascular system. J Mol Cell Cardiol. 1995;27:729–742.[Medline] [Order article via Infotrieve]
-
Kim D, Cragoe EJ Jr, Smith TW. Relations among sodium
pump inhibition, Na-Ca and Na-H exchange activities, and Ca-H
interaction in cultured chick heart cells. Circ Res. 1987;60:185–193.
[Abstract/Free Full Text] - Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998;93:215–228.[Medline] [Order article via Infotrieve]
-
Sengupta TK, Talbot ES, Scherle PA, Ivashkiv LB.
Rapid inhibition of interleukin-6 signaling and stat3 activation
mediated by mitogen-activated protein kinases. Proc Natl
Acad Sci U S A. 1998;95:11107–11112.
[Abstract/Free Full Text] -
Nicholson SE, Novak U, Ziegler SF, Layton JE. Distinct
regions of the granulocyte colony-stimulating factor receptor are
required for tyrosine phosphorylation of the signaling
molecules JAK2, Stat3, and p42, p44 MAPK. Blood. 1995;86:3698–3704.
[Abstract/Free Full Text] - Frank DA, Varticovski L. BCR/abl leads to the constitutive activation of STAT proteins, and shares an epitope with tyrosine phosphorylated STATs. Leukemia. 1996;10:1724–1730.[Medline] [Order article via Infotrieve]
-
Daniel NN, Pernis A, Rothman PB. Jak-STAT signaling
induced by the v-abl oncogene. Science. 1995;269:1875–1877.
[Abstract/Free Full Text] -
Yu CL, Meyer DJ, Campbell GS, Larner AC, Carter-Su C,
Schwartz J, Jove R Enhanced DNA-binding activity of a Stat3-related
protein in cells transformed by the Src oncoprotein.
Science. 1995;269:81–83.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||