© 1999 American Heart Association, Inc.
Original Contribution |
Effect of Recombinant Soluble P-Selectin Glycoprotein Ligand-1 on Leukocyte-Endothelium Interaction In Vivo
Role in Rat Traumatic Shock
From the Department of Physiology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pa.
Correspondence to Allan M. Lefer, PhD, Department of Physiology, Jefferson Medical College, Thomas Jefferson University, 1020 Locust St, Philadelphia, PA 19107-6799. E-mail allan.m.lefer{at}mail.tju.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Traumatic shock induces profound pathophysiological alterations and initiates inflammatory reactions in many tissues, thus resulting in acute multiple organ damage (eg, intestine, pancreas, and liver). In the rat, Noble-Collip drum trauma increases P-selectin expression on the vascular endothelium as a result of loss of endothelium-derived NO. Here we postulated that blockade of the earliest steps in leukocyte adhesion (ie, leukocyte rolling) via administration of a recombinant soluble form of P-selectin glycoprotein ligand-1 (PSGL-1; the recombinant soluble form is rsPSGL.Ig) would attenuate selectin-mediated events observed in the rat during traumatic shock. Using intravital microscopy of the rat mesenteric microvasculature, we found that intravenous infusion of rsPSGL.Ig significantly inhibited leukocyte-endothelium interaction (ie, leukocyte rolling, adherence, and transmigration) induced by traumatic shock as well as by activation of the microvascular endothelium with 50 µmol/L NG-nitro-L-arginine methyl ester. Immunohistochemical detection of P-selectin on the mesenteric venular endothelial surface demonstrated that rsPSGL.Ig functionally neutralizes effects of P-selectin on the endothelial cell surface rather than attenuating P-selectin expression. Systemic administration of rsPSGL.Ig to traumatized rats prolonged survival time and survival rate, significantly attenuating ileal myeloperoxidase activity and significantly preserving mesenteric endothelial function. Furthermore, PSGL-1 mRNA levels were significantly increased in the blood of traumatized rats and were reduced after systemic administration of rsPSGL.Ig. Thus, soluble recombinant forms of PSGL-1 are able to ameliorate acute shock states by suppressing selectin-mediated leukocyte-endothelium interaction at both the functional and molecular levels.
Key Words: endothelial dysfunction • myeloperoxidase activity • mRNA • P-selectin • intravital microscopy
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The recruitment of leukocytes into inflamed tissues plays a pivotal role in the pathogenesis of several organ injuries, including posttraumatic syndromes. With the use of biochemical techniques, we have previously demonstrated massive infiltration of leukocytes into the visceral tissues of rats subjected to Noble-Collip drum shock, a severe form of traumatic shock characterized by marked hypotension and a high mortality rate.1 2 3 Consistent with the concept that leukocytes initially interact with the vascular endothelium before activation,4 we have also demonstrated that this posttraumatic inflammatory response is triggered by early endothelial dysfunction.5 Under these conditions, loss of endothelium-derived NO occurs within 15 minutes following traumatic shock and is associated with increased endothelial expression of the cell adhesion molecule P-selectin.6 P-selectin is able to initiate the cascade of events that increases cell adherence and leukocyte infiltration into injured tissues by first promoting leukocyte rolling along the vascular endothelium.7 This contributes to leukocyte-mediated alterations leading to circulatory shock. Therefore, it appears that successful blockade of the earliest steps in leukocyte adhesion (ie, rolling) is effective in diminishing traumatic injury.
In 1992, Moore et al8 first described a new selectin ligand, P-selectin glycoprotein ligand-1 (PSGL-1), which is located on the microvilli of leukocytes, where it is positioned to interact favorably with its counterligands under flow conditions.9 10 11 Since then, other investigators have cloned soluble forms of PSGL-112 and have demonstrated that in vivo administration of these forms of soluble PSGL-1 results in amelioration of ischemia/reperfusion injury.13 Nonetheless, we are unaware of any report describing effects of in vivo administration of soluble recombinant forms of PSGL-1 (rsPSGL.Ig) on leukocyte-endothelium interaction under physiological and pathophysiological conditions in vivo. Furthermore, rsPSGL.Ig has not been studied in more complex cardiovascular disease states, such as shock or trauma, in which multiple organ dysfunction occurs.
Therefore, we hypothesized that administration of rsPSGL.Ig would attenuate the selectin-mediated endothelial dysfunction, tissue injury, and hemodynamic alterations typically associated with a severe form of traumatic shock. Thus, the purposes of this study were to investigate the cellular and molecular mechanisms of leukocyte-endothelium interactions in the rat mesentery following administration of rsPSGL.Ig and to determine the overall effects of rsPSGL.Ig in a well-established model of murine traumatic shock.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study was performed in accordance with the National Institutes of Health guidelines for the use of experimental animals, and all animal protocols have been approved by the Institutional Animal Care and Use Committee of Thomas Jefferson University.
cDNA Construction of rsPSGL.Ig
rsPSGL0.47 mutFc (Genetics Institute, Inc) is derived from
pED0.47.Fc, a recombinant soluble form of PSGL-1 fused to human
IgG1.14 Polymerase chain reaction (PCR) was performed on
the Fc portion of this plasmid using the 5' primer
TAAATAGCGGCCGCACACATGCCCACCGTGCCCAGCACCTGAAGCCCTGGGGGCACCGTCAGTCTTCCTC
and the 3' primer GCATGTGCACCGAGGCCCCAGATCA. The PCR product
was digested with the restriction enzymes NotI and
KpnI and ligated to the large fragment of pED0.47.Fc
restricted with the same digest. The resulting vector, pED0.47 mutFc,
was confirmed by DNA sequencing and then stably transfected and
amplified in a dihydrofolate reductase–negative Chinese hamster
ovary cell line that was previously stably transfected with vector
pMT4neo expressing both a cDNA encoding an
-(1,3/1,4)-fucosyltransferase15 and a cDNA
encoding core
2-1,6-N-acetylyglucosaminyltransferase.16
Analysis of several resulting clonal cell lines revealed a cell
line having readily detectable core 2, fucosyltransferase activities,
and SLex-modified 47mutFc ("high-affinity
rsPSGL") and another cell line lacking detectable fucosyltransferase
activity and SLex-modified glycans on 47mutFc
("low-affinity rsPSGL"). Each type of these secreted rsPSGL.47mutFc
molecules was separately purified from serum-free Chinese hamster ovary
cell–conditioned medium essentially as described.13 The
final purified material was formulated into 10 mmol/L histidine,
1% (wt/vol) sucrose, 260 mmol/L glycine, and 0.005% Tween 80, pH
6.6 at room temperature at a concentration of at least 3 mg/mL.
Endotoxin was measured to be <10 EU/mg. Selectin binding activity was
assessed via in vitro binding assays as described.14
Demonstration of rsPSGL.Ig Binding to Rat Blood Cells by Flow
Cytometry
Flow cytometric analysis of rsPSGL.Ig binding to freshly
isolated rat platelets and neutrophils was performed according to
standard procedures.17 Platelet-rich plasma was
obtained by centrifuging rat blood, anticoagulated with sodium citrate
phosphate buffer (Sigma Chemical Co), at 300g for 20
minutes. The platelet-rich plasma was then centrifuged at
2000g for 10 minutes to form a platelet-rich pellet.
This pellet was washed twice in calcium-free Tyrode's solution
containing 0.2% BSA. The final cell pellet was resuspended in RPMI
1630 (Gibco) containing 0.1% sodium azide, 0.1% BSA, and 1
mmol/L Ca2+. Similarly, rat neutrophils were
freshly isolated from rat whole blood according to the method of
Williams et al.18 Isolated neutrophils were washed
twice in calcium-free Tyrode's solution containing 0.2% BSA and
suspended in RPMI 1630. Platelet or neutrophils
(5x105 cells per tube) were incubated with
either rsPSGL.Ig (20 µg/mL) or a low-activity mutant rsPSGL.Ig (20
µg/mL) and maintained at 4°C for 30 minutes. Excess of primary
antibody was then removed by washing the platelets or neutrophils
in RPMI 1630. A goat anti-human IgG F(ab')2, FITC
conjugate, was used as the secondary antibody at a 1:100
dilution (4°C for 30 minutes). The stained platelets or
neutrophils were washed twice with RPMI 1630, finally fixed in 1%
paraformaldehyde, and then analyzed by flow
cytometry (FACScan, Becton-Dickinson).
Intravital Microscopy
Male Sprague-Dawley rats, weighing 250 to 275 g, were
anesthetized with sodium pentobarbital (60 mg/kg) injected
intraperitoneally. A tracheotomy was performed to
maintain a patent airway throughout the experiment. A polyethylene
catheter was inserted in the left carotid artery to monitor mean
arterial blood pressure (MABP) as previously
described.19 The jugular vein was cannulated for infusion
of anesthetic and injection of either low-affinity mutant rsPSGL.Ig or
high-affinity mutant rsPSGL.Ig. The abdominal cavity was opened
via a midline laparotomy, as described earlier.19 A loop
of ileal mesentery was exteriorized through the midline incision,
placed in a temperature-controlled fluid-filled Plexiglas chamber, and
transilluminated for observation of the mesenteric microcirculation via
intravital microscopy. The ileum and mesentery were superfused
throughout the experiment with a modified Krebs-Henseleit (K-H)
solution (containing the following in mmol/L: 118 NaCl, 4.74 KCl,
2.45 CaCl2, 1.19
KH2PO4, 1.19
MgSO4, and 12.5 NaHCO3),
warmed to 37°C, and bubbled with 95% N2 and
5% CO2. A Microphot microscope and a 40x water
immersion lens (Nikon Corp, Tokyo, Japan) were used to visualize the
mesenteric microcirculation and the mesenteric tissue. The image was
projected by a high-resolution color video camera (DC-330,
DAGE-MTI, Inc) onto a color Sony high-resolution video monitor
(Multiscan 200-sf), and the image was recorded with a videocassette
recorder. All images were then analyzed using computerized
imaging software (Phase 3 Image System, Media Cybernetics) on a
Pentium-based IBM-compatible computer (Micron Millenia Mxe, Micron
Electronics Inc). Red blood cell velocity was determined on-line using
an optical Doppler velocimeter20
obtained from the Microcirculation Research Institute (College Station,
Tex). This method gives an average red blood cell velocity, which is
digitally displayed on a meter, and allows for the calculation of shear
rates.21
After a 20- to 30-minute stabilization period, a 30 to 50–µm diameter postcapillary venule was chosen for observation. Rats were randomly divided into 1 of the following 5 groups: (1) control rats superfused with K-H solution (n=6), (2) K-H solution–superfused rats receiving 0.5 mg/kg IV bolus rsPSGL.Ig (n=6), (3) 50 µmol/L NG-nitro-L-arginine methyl ester (L-NAME)–superfused rats, (4) 50 µmol/L L-NAME–superfused rats receiving 0.5 mg/kg IV bolus low-affinity mutant rsPSGL.Ig (n=6), and (5) 50 µmol/L L-NAME–superfused rats receiving 0.5 mg/kg IV bolus rsPSGL.Ig (n=6). To ascertain whether the degree of leukocyte-endothelium interaction induced by L-NAME was comparable to that produced by traumatic shock, an additional series of intravital microscopy observations was extended to traumatized control rats (n=5) and traumatized rats receiving rsPSGL.Ig (n=5). Both the low-affinity mutant rsPSGL.Ig and the high-affinity mutant rsPSGL.Ig were administered to the rats as an intravenous bolus immediately before recording leukocyte-endothelium interaction. A baseline recording was made to establish basal values for leukocyte rolling, adherence, and transmigration (time 0). Immediately thereafter, L-NAME superfusion of the mesentery was started. Video recordings were made at 30, 60, 90, and 120 minutes after initiation of superfusion for quantification of leukocyte rolling, adherence, and transmigration. The number of rolling, adhered, and transmigrated leukocytes was determined off-line by playback analysis of the videotape. Leukocytes were considered to be rolling if they were moving at a velocity significantly slower than that of red blood cells. Leukocyte rolling is expressed as the number of cells moving past a designated point per minute (ie, leukocyte flux). A leukocyte was judged to be adherent if it remained stationary for >30 s. Adherence is expressed as the number of leukocytes adhering to the endothelium per 100 µm of vessel length. Transmigrated leukocytes were determined in an area covering a distance of 20 µm in either direction from the vessel wall. The number of extravasated leukocytes was counted and normalized with respect to area (20x100 µm).
Immunohistochemistry
Immunohistochemical localization of P-selectin was determined in
ileal samples after intravital microscopy was completed according to
previously described methods.19
Quantification of P-selectin was accomplished using the avidin-biotin immunoperoxidase technique (Vectastain ABC Reagent, Vector Laboratories) as previously described by Weyrich et al.22 Fifty venules were analyzed per tissue section, 20 sections were examined per group, and the percentage of positive-staining venules was tallied.
Traumatic Shock Protocol
Following anesthesia with 60 mg/kg IP sodium
pentobarbital, male Sprague-Dawley rats (175 to 225 g body weight)
were subjected to traumatic shock using a Noble-Collip drum
apparatus.1 Traumatized rats were subjected to
a total of 500 revolutions at 60 rpm. Immediately following the
induction of trauma, the trachea was cannulated with PE-240
polyethylene tubing to maintain a patent airway. Polyethylene catheters
(PE-50) filled with heparinized 0.9% NaCl solution were inserted into
the right common carotid artery for recording MABP and into the
left external jugular vein for administration of either rsPSGL.Ig or
low-affinity mutant rsPSGL.Ig. The total time required to complete all
surgical procedures was <10 minutes. The MABP was continuously
recorded and tabulated every 30 minutes over the entire 5-hour
observation period using a Grass model 7 oscillographic recorder
(Grass Instruments) and Statham P23 pressure transducers. Rats were
randomly assigned to 1 of 5 experimental groups: (1)
sham-traumatized rats receiving K-H solution (n=5), (2)
sham-traumatized rats receiving 0.5 mg/kg IV bolus rsPSGL.Ig (n=6), (3)
traumatized rats receiving K-H solution (n=10), (4) traumatized rats
receiving 0.5 mg/kg IV bolus low-affinity mutant rsPSGL.Ig (n=6), and
(5) traumatized rats receiving 0.5 mg/kg IV bolus rsPSGL.Ig (n=6).
Low-affinity mutant rsPSGL.Ig or rsPSGL.Ig were administered 10 minutes after trauma as a 0.25-mL IV bolus. Sham-traumatized rats were anesthetized and subjected to all of the same surgical procedures as the traumatized rats, except that they did not undergo drum trauma. Additional pentobarbital was given intraperitoneally throughout the observation period to maintain a surgical plane of anesthesia.
Five hours after trauma, or when MABP fell below 45 mm Hg, the experiments were terminated. Samples of rat small intestine were also obtained for measurement of myeloperoxidase (MPO) activity. Survival time was defined as that interval between removal from the drum to the end of the experiment (ie, MABP <45 mm Hg). All rats were autopsied to confirm the presence of gross evidence of traumatic injury to the splanchnic viscera (ie, bowel ischemia, serosanguinous ascites, and splanchnic vascular engorgement). Rats were excluded from the study if these findings were not observed to a significant degree or if the rat died sooner than 30 minutes after trauma. Fewer than 10% of rats (ie, 1 of 13 rats) did not meet these criteria.
Determination of Tissue MPO
Small intestinal activity of MPO, an enzyme occurring virtually
exclusively in polymorphonuclear leukocytes (PMN), was determined
using the method of Bradley et al23 as modified by Mullane
et al.24 One unit of MPO is defined as that quantity of
enzyme hydrolyzing 1 mmol of peroxide per minute at 25°C.
Isolated Mesenteric Artery Ring Studies
At the end of the experiment, the superior mesenteric artery
(SMA) was rapidly removed from rats and placed in chambers containing
K-H solution, and vasorelaxation responses were studied to an
endothelium-dependent and
endothelium-independent vasodilator according to
previously described studies.6 Once a stable contraction
to 100 nmol/L 9,11-epoxymethano-prostaglandin H2 was
obtained, acetylcholine (ACh), an endothelium-dependent
vasodilator, was added to the bath in cumulative concentrations of 0.1,
1, 10, and 100 nmol/L. After the cumulative response stabilized, the
rings were washed and allowed to equilibrate to baseline once more. The
procedure was repeated with an endothelium-independent
vasodilator, acidified NaNO2 (0.1, 1, 10, and
100 µmol/L). NaNO2 was prepared by
dissolving the compound in 0.1N HCl and titrating it to pH 2.0. Equal
volumes of pH 2.0 solution had no vasoactive effect on rat SMA rings.
We defined 100% relaxation as the return to precontraction force
following U-46619–induced contraction.
Determination of PSGL-1 Gene Expression by Ribonuclease
Protection Assays
Total RNA was extracted from the lungs using the acid
guanidinium-phenol-chloroform extraction method described by
Chomczynski and Sacchi25 and previously modified for
tissue in traumatic shock rats.26
Mouse PSGL-1 cDNA was synthesized by reverse transcriptase–PCR using mouse lung total RNA and oligo(dT) and amplified using forward primer (5'-CCTGGGAATTCACCTGCCCC-3') and reverse primer (5'-GAGAGTGGAGCTAGCAAAGG-3'). These oligonucleotides correspond to amino acid sequences 267 to 273 and 394 to 388 of mouse PSGL-1, respectively.27 A 384-bp PCR fragment was cloned using the PCR 2.1-TOPO Cloning Kit (a gift from Invitrogen Corp). The SstI–XbaI fragment of this plasmid was recloned in pTRIPLEscript vector (pTRI-amp-18, Ambion). This plasmid was digested with XbaI to make with T7 polymerase a 570-base radiolabeled antisense probe containing a 384-base protected fragment. CD45 probes were used to evaluate total RNA used for PSGL-1 gene expression analysis. Rat leukocyte-common antigen CD45 cDNA was synthesized by reverse transcriptase–PCR using rat blood RNA and oligo(dT) and amplified using forward primer (5'-ctagagcTCTTTGTCACAGGGCAAG-3') and reverse primer (5'-cattcTAGATGTAACGCACAGTAAC-3'). An EcoRI–EcoRV fragment of CD45 cDNA (GenBank accession No. M25823) was cloned in pBluescript II KS+ (Stratagene). These constructs were verified by sequencing the insert in the plasmid. For the ribonuclease protection assay, we used 20 and 40 µg of total RNA for detection of CD45 and PSGL-1 mRNA, respectively. Water solutions of total RNA were dried under vacuum and dissolved in 25 µL of 80% formamide hybridization buffer containing 1.5x106 cpm of labeled PSGL-1 probe and 1x106 cpm of labeled CD45 probe. Samples were preincubated for 5 minutes at 85°C and then incubated for 16 hours at 45°C as described previously.26 The extracted, protected probe fragments were run on a 6% polyacrylamide sequencing gel in 1x Tris-borate-EDTA buffer for 2 hours at 50 mA. The gel was then dried and exposed to x-ray film (Hyperfilm MP, Amersham) at –70°C. Expression of mRNA was quantified using storage phosphor technology (Molecular Dynamics). Intensity of each PSGL-1 mRNA band was normalized for CD45 mRNA level.
Statistical Analyses
All values for data listed in the text and figures are
presented as mean±SEM of n independent experiments.
Data were compared by ANOVA using post hoc analysis with
Fisher's correct t test. Survival times were compared using
Gehan's generalized Wilcoxon test as described by Knapp and
Wise.28 The survival rates were assessed by
2 analysis. Probabilities of 0.05 or
less were considered significant in all cases.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Verification of rsPSGL.Ig Binding to Rat Platelets and Rat Neutrophils
To confirm that rsPSGL.Ig was able to bind to its high-affinity ligand in the rat, we performed flow cytometry on freshly isolated rat platelets and neutrophils. Rat platelets stained 82±12% positive for rsPSGL.Ig in comparison with only 15±3% positive staining for the low-affinity mutant (P<0.01) and 7±1.8% for the control lacking the primary antibody. Additionally, the mean channel fluorescence was 99±22 and 28±7 for rsPSGL.Ig and the rsPSGL.Ig low-affinity mutant, respectively, and only 5±0.5 for the control samples. Similarly, rat neutrophils stained 67±8% positive for rsPSGL.Ig in comparison with only 7±2.5% positive staining for the low-affinity mutant (P<0.01) and 5±0.9% for the control lacking the primary antibody. This clearly demonstrates that rsPSGL.Ig selectively binds to rat blood cells.
Effect of rsPSGL.Ig on Leukocyte Rolling, Leukocyte Adherence, and
Leukocyte Transmigration in the Mesenteric Vasculature
In rats superfused with K-H solution, a low number of rolling and
adherent leukocytes was observed in the mesenteric microvasculature
(Figures 1
and 2). Superfusion of the rat mesentery with
L-NAME for 120 minutes resulted in significant increases in leukocyte
rolling (Figure 1) and adherence (Figure 2), starting 30
minutes after L-NAME superfusion and progressively increasing over the
120-minute observation period when it plateaued. Similarly, the number
of transmigrated leukocytes increased from 1.5±0.3 to 15±3
cells/100x20-µm area. Likewise, traumatic shock caused a sustained
increase in leukocyte rolling and leukocyte adherence (Figure 3), which was comparable to that observed
following superfusion of the rat mesentery with L-NAME. Interestingly,
leukocyte rolling maximally increased immediately after trauma (Figure 3). Subsequently, the number of rolling leukocytes progressively
decreased, whereas the number of leukocytes undergoing firm adherence
continued to increase (Figure 3). This clearly demonstrates that
leukocyte rolling represents an early and crucial event in
traumatic shock, which leads to severe
pathophysiological alterations.
|
|
|
) and leukocyte adherence (
) observed in
mesenteric venules of traumatized rats given K-H buffer (top) and
traumatized rats treated with 0.5 mg/kg IV bolus high-affinity
rsPSGL.I.g (bottom). Each time point represents a value that is
mean±SEM. **P<0.01 from traumatized rats given K-H
buffer.
Intravenous infusion of 0.5 mg/kg IV bolus rsPSGL.Ig
significantly attenuated L-NAME–induced leukocyte rolling (Figure 1
) and leukocyte adherence (Figure 2) in the absence of
any significant change in the number of circulating leukocytes or
platelets (Table). In particular, at
120 minutes, leukocyte rolling was significantly (P<0.01)
reduced 
80% in rats given rsPSGL.Ig (Figure 1). Similarly,
rsPSGL.Ig significantly attenuated leukocyte adherence and leukocyte
transmigration to the microvascular endothelium.
Following a 120-minute L-NAME (50 µmol/L) superfusion, 17±3
cells/100 µm were adherent to the microvasculature and 15±2
cells/100x20-µm area had emigrated into the mesenteric tissue. In
contrast, intravenous infusion of rsPSGL.Ig
resulted in only 5±1.5 adherent cells/100 µm (Figure 2)
and 4±1 extravasated cells/100x20-µm area (P<0.01).
Moreover, infusion of low-affinity rsPSGL.Ig did not result in any
significant attenuation of leukocyte rolling (Figure 1),
adherence (Figure 2), or transmigration in L-NAME–superfused
rats. In addition, systemic administration of rsPSGL.Ig to traumatized
rats significantly attenuated the number of rolling and adherent
leukocytes (Figure 3). Thus, rsPSGL.Ig, but not its low-affinity
mutant, markedly curtails leukocyte-endothelium
interaction in the mesenteric microvasculature.
|
Mean values for MABP ranged from 120 to 135 mm Hg for all 5 groups of rats studied, over the entire experimental time (data not shown). In addition, the venular shear rates were calculated in the 5 experimental groups. Initial shear rate values were 679±33, 706±55, 701±47, 695±50, and 709±54 seconds for the 5 experimental groups. These values are not significantly different from each other and did not change significantly over the 120-minute observation period for any group. These findings indicate that the adhesive interactions observed between leukocytes and endothelial cells were not due to changes in physical hydrodynamic forces or to spontaneous hemodynamic alterations brought about by the infusion of rsPSGL.Ig.
Effect of rsPSGL.Ig on P-Selectin Expression
Immunolocalization of P-selectin was studied in the venular
endothelium of the rat ileum immediately after
intravital microscopy was completed. The percentage of venules staining
positively for P-selectin in ileal sections from control rats
superfused with K-H and given rsPSGL.Ig was consistently low
(13±2% positive venules). In contrast, superfusion with 50
µmol/L L-NAME for 120 minutes resulted in a significant increase in
P-selectin expression as quantified by the percentage of venules
staining positively for P-selectin (67±4% positive venules;
P<0.01 versus control). Intravenous infusion of
rsPSGL.Ig (0.5 mg/kg IV bolus) did not attenuate the number of venules
staining positively for P-selectin (64±4% positive venules; NS versus
L-NAME superfused mesentery). This clearly suggests that inhibition of
leukocyte-endothelium interaction induced by rsPSGL.Ig
is due to functional neutralization of P-selectin on the
endothelial cell surface rather than to significant
attenuation of P-selectin expressed on the microvascular
endothelium.
Effect of rsPSGL.Ig on MABP of Rats Subjected to Noble-Collip
Drum Trauma
Administration of rsPSGL.Ig (0.5 mg/kg IV bolus) did not
significantly influence MABP over the entire observation period in
sham-operated control rats (Figure 4).
Thus, the MABP in the sham trauma group remained at a relatively
constant value between 120 and 125 mm Hg over the entire
observation period. However, Noble-Collip drum trauma initially led to
a sustained hypotension, with MABP falling to 75 mm Hg in all
trauma groups. These initial MABP values were not significantly
different among the 3 trauma groups, suggesting a comparable degree of
trauma experienced by all trauma groups. Moreover, treatment with
rsPSGL.Ig resulted in a gradual and sustained recovery of MABP, which
became significant 150 minutes after trauma when compared with the
low-affinity mutant rsPSGL.Ig-treated group (Figure 4). Thus,
rsPSGL.Ig exerted a salutary effect on hemodynamics in
rats subjected to trauma.
|
Effect of rsPSGL.Ig on Survival Time and Survival Rate Following
Traumatic Shock
Survival times for each experimental group are presented
in Figure 5A. All 6 sham-traumatized rats
survived the entire 300-minute observation period. In contrast,
traumatized rats receiving the low-affinity mutant rsPSGL.Ig
demonstrated a survival time of only 120±24 minutes, a value
significantly (P<0.001) lower than that of sham-traumatized
rats. A significant prolongation of survival time was observed in
traumatized rats receiving 0.5 mg/kg IV bolus rsPSGL.Ig
(P<0.001), with survival time doubling (Figure 5A).
Survival rate was also significantly (P<0.01) increased in
traumatized rats treated with rsPSGL.Ig compared with traumatized rats
treated with the low-affinity mutant rsPSGL.Ig (Figure 5B).
These results suggest that systemic administration of
rsPSGL.Ig significantly increases both survival time and
survival rate in this model of traumatic shock.
|
Effect of rsPSGL.Ig on Ileal MPO Activity of Traumatized
Rats
The accumulation of neutrophils in intestinal tissue was
determined by measuring ileal MPO activity. The MPO enzyme activity
(Figure 6) was low in sham-operated
control rats (1.3±0.4 U/mg wet tissue). However, Noble-Collip drum
trauma led to a significant 4-fold increase in the intestinal
accumulation of neutrophils in the low-affinity mutant
rsPSGL.Ig-treated rats (Figure 6). In contrast, the MPO activity
of traumatized rats given rsPSGL.Ig was significantly attenuated to
2±0.5 U/mg wet tissue (P<0.05), a value not significantly
different from that of sham-operated controls (Figure 6). Thus,
these data provide evidence that rsPSGL.Ig treatment significantly
retarded the accumulation of neutrophils in intestinal tissue following
traumatic shock.
|
Effect of rsPSGL.Ig on SMA Endothelial Function of
Traumatized Rats
Endothelial function was measured by comparing
vasoactivity of isolated SMA rings in response to the
endothelium-dependent vasodilator ACh and
endothelium-independent vasodilator
NaNO2 (Figure 7).
Isolated SMA rings from sham-traumatized rats, receiving the
low-affinity mutant rsPSGL.Ig, exhibited full (>90%) relaxation to
both vasodilators. In contrast, the
endothelium-dependent vasorelaxant responses to ACh in
SMA rings obtained from traumatized rats given the low-affinity mutant
rsPSGL.Ig were significantly reduced (Figure 7). Nevertheless,
these rings relaxed fully in response to NaNO2
(>95%). However, the degree of relaxation to ACh in rings isolated
from traumatized rats treated with rsPSGL.Ig was significantly
preserved (P<0.05), thus indicating that rsPSGL.Ig
significantly protected against endothelial dysfunction
occurring during traumatic shock (Figure 7).
|
Effect of rsPSGL.Ig on Endogenous PSGL-1 mRNA
Expression in Traumatized Rats
Rat blood cell levels of mRNA codifying for endogenous
PSGL-1 were assessed by ribonuclease protection assay. As shown in
Figure 8, the intensity of each PSGL-1
mRNA band was normalized to that of CD45. No significant change in the
level of PSGL-1 mRNA was found in control rat blood cells or in blood
cells obtained from control rats given rsPSGL.Ig (Figure 8). In
contrast, the PSGL-1 transcript was significantly (P<0.05)
increased in the blood of rats subjected to Noble-Collip drum trauma
and given the low-affinity mutant rsPSGL.Ig (Figure 8). Systemic
administration of rsPSGL.Ig to the rat significantly
(P<0.05) attenuated this increase in mRNA following
traumatic shock (Figure 8). Therefore, in vivo administration of
rsPSGL.Ig in rats results in attenuation of de novo synthesis of
counterligands for adhesion molecules during inflammatory disease
states such as trauma.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study was undertaken to determine the molecular and cellular mechanisms involved in the inhibition of leukocyte-endothelium interaction observed following in vivo administration of a soluble recombinant form of PSGL, rsPSGL.Ig. We also evaluated the effects of rsPSGL.Ig on the inflammatory response and subsequent end-organ injury produced by a severe form of traumatic shock. Our data clearly indicate that rsPSGL.Ig is a potent inhibitor of leukocyte-endothelium interaction in vivo and that rsPSGL.Ig exerts significant protective effects in a murine model of traumatic shock. Specifically, intravenous administration of rsPSGL.Ig resulted in a significant prolongation of survival time and an attenuation of leukocyte infiltration as measured by lower intestinal MPO activity. rsPSGL.Ig also preserved endothelial function as evidenced by the maintained relaxation responses of SMA rings to the endothelium-dependent vasodilator ACh. These findings are consistent with recent work demonstrating that rsPSGL.Ig plays a significant role in limiting organ injury following ischemia/reperfusion of the kidney or the liver.13 29
Acute endothelial dysfunction associated with enhanced leukocyte-endothelium interaction is a common and critical early pathophysiological event resulting from either inhibition of NO synthesis in the rat mesentery30 or traumatic shock.6 31 In this regard, we have previously established a functional relationship between loss of endothelium-derived NO and the upregulation of P-selectin on the venular endothelium of the rat mesenteric microcirculation in shock-like states.31 32 Thus, blocking NO synthesis via L-NAME results in increased leukocyte adherence in the mesenteric microvasculature,33 coincident with increases in microvascular permeability.34 Accordingly, organic nitrites, which release NO and act as NO donors, can also protect the mesenteric microcirculation during acute inflammatory states.35 In this regard, a progressive reduction in endothelial NO release in the rat mesenteric microvasculature has been observed in traumatic shock.6 Moreover, we have shown that endothelial dysfunction occurs 15 to 20 minutes after trauma and that the resulting loss of functional release of NO is associated with an increased PMN adherence to the mesenteric endothelium 30 minutes after trauma.6 In the present model of trauma, total P-selectin mRNA increased in several vital organs of traumatized rats, including the intestine.26 Therefore an early, critical event common to all acute models of inflammation is the increased expression of adhesion molecules subsequent to impaired release of endothelium-derived NO.
The recruitment of leukocytes from the circulation to sites of tissue injury is mediated by cell adhesion molecules, which orchestrate the initial contact between leukocytes and the endothelium, followed by the firm adherence of leukocytes to the endothelium and the subsequent extravasation of leukocytes into the affected tissue.4 In particular, 3 groups of cell adhesion molecules are implicated in the recruitment of leukocytes into inflamed tissue, and they are the selectin family (ie, P-, L-, and E-selectin), the ß2-integrin family (ie, CD11/CD18), and the immunoglobulin superfamily (ie, intercellular adhesion molecule-1 and platelet endothelial cell adhesion molecule-1). Leukocyte rolling is the first step and is a prerequisite for firm adherence, since integrin-mediated adherence is relatively ineffective at physiological shear rates.36 In this regard, several investigators have demonstrated that inhibition of the rolling phase of leukocytes plays a key role in attenuating the inflammatory response.11 30 Consistent with such findings, we now demonstrate that the administration of a soluble form of PSGL-1, which has selectin binding properties, significantly attenuates extravasation of leukocytes in the rat mesenteric microvasculature following inhibition of NO synthesis in vivo. This inhibitory effect on leukocyte-endothelium interaction exerted by rsPSGL.Ig results in normalization of these pathophysiological events in traumatic shock. Inhibition of leukocyte extravasation exerts a key role during inflammation, because activated neutrophils, which have adhered to the endothelium, release cytotoxic mediators including proteases, eicosanoids, cytokines, and oxygen-derived free radicals,37 38 each of which can promote tissue injury and exacerbate endothelial dysfunction. Therefore, our data strongly suggest that the beneficial effects exerted by systemic administration of rsPSGL.Ig are due significantly to an inhibition of leukocyte–endothelial cell interaction. This reduced leukocyte-endothelium interaction may also explain the mechanism by which systemic administration of rsPSGL.Ig preserves endothelium-dependent vasodilation in our traumatic shock model.
PSGL-1 is a highly extended homodimer of 2 disulfide-linked subunits,
each of which displays N-linked glycans and sialylated
O-linked glycans that present
SLex.14 However, expression of
PSGL-1 protein is not sufficient to allow binding to its primary
high-affinity ligand, P-selectin. Under
physiological conditions, functional binding of
PSGL-1 to P-selectin requires a number of posttranslational
modifications by (1,3/1,4)-fucosyltransferase, which include
sialylation, sulfation, and fucosylation of the primary protein
structure.9 14 All 3 selectins demonstrate a high affinity
for sialylated, fucosylated saccharide structures such as
SLex, and although there are several
leukocyte-bound structures that present SLex,
it appears as though P-selectin must bind with PSGL-1 in order for
leukocytes to efficiently roll along the endothelium
under physiological flow
conditions.10 39 40 Consistent with this concept,
we found that in vivo administration of rsPSGL.Ig inhibits
L-NAME-induced leukocyte rolling in the rat mesenteric
microcirculation, thus also blocking firm adherence and subsequent
transmigration of leukocytes. Since intravenous infusion of
rsPSGL.Ig did not attenuate endothelial cell surface
expression of P-selectin, this activity of rsPSGL.Ig is likely due to
functional neutralization of P-selectin on the
endothelial cell surface rather than to quantitative
attenuation of P-selectin expression on the
endothelium.
Interestingly, in this study, rsPSGL.Ig was also found to inhibit de novo synthesis of PSGL-1, as confirmed by quantification of PSGL-1 mRNA levels in the blood of traumatized rats treated with rsPSGL.Ig. This result suggests that the mode of action of rsPSGL.Ig may be extended not only to inhibition of leukocyte-endothelium interaction, but also to attenuation of leukocyte-leukocyte and leukocyte-platelet interactions. Therefore, the observed reduced PSGL-1 mRNA blood levels may contribute to inhibition of the widespread increase in cell-to-cell interaction during acute inflammatory conditions such as ischemia-reperfusion and traumatic shock. In this regard, previous observations have demonstrated binding of PSGL-1 to both L- and E-selectin.41 42 However, inhibition of E-selectin–mediated leukocyte–endothelial cell interaction by rsPSGL.Ig in our 120-minute study using intravital microscopy is highly unlikely. E-selectin expression requires de novo protein synthesis having a lag time of 4 to 6 hours for protein expression on the endothelial surface. This suggests that, during the early stage of inflammatory responses, the protective effect of rsPSGL.Ig is primarily mediated via P-selectin–dependent mechanisms. Furthermore, functional inhibition of P-selectin can result in protective effects in longer experimental models of inflammation than our 2-hour intravital microscopy model.31 In this regard, Skurk et al31 have previously demonstrated that administration of a monoclonal antibody against P-selectin exerts a beneficial effect in traumatic shock and that the degree of this protection is comparable to that observed following systemic administration of a sialyl Lewisx-oligosaccharide, a specific ligand for P-, L-, and E-selectin. Therefore, most of the protection of sialyl Lewisx-oligosaccharide is via blockade of P-selectin. Interestingly, other authors have reported that inhibition of P-selectin by soluble PSGL-1 partially blocks the induction of E-selectin mRNA in the ischemic-reperfused kidney.13 One possible result of this finding is that by inhibiting the initial P-selectin–mediated tethering of leukocytes to endothelium, rsPSGL.Ig diminishes the localized production of proinflammatory cytokines, which induce later E-selectin expression. In contrast to E-selectin, L-selectin–mediated cell-to-cell interactions have been shown to be important in the development of tissue injury during the acute phase of inflammatory disease states.43 L-selectin is not only capable of mediating leukocyte-endothelium interaction but also of contributing to leukocyte-leukocyte interaction. Although PSGL-1 has been shown to bind with lower affinity to L-selectin than to P-selectin,42 the interaction of L-selectin and PSGL-1 could initiate leukocyte-leukocyte interactions that represent the first step in leukocyte aggregation during inflammatory states.41 Unstimulated leukocytes have been shown to roll on immobilized PSGL-1 under flow conditions, and treatment of the immobilized PSGL-1 with an L-selectin monoclonal antibody inhibits not only leukocyte rolling on immobilized PSGL-1 but also leukocyte rolling on adherent leukocytes.44 Even though activated PMNs shed their L-selectin, PSGL-1 remains intact. Thus, adherent activated PMNs that have shed L-selectin are capable of interacting with flowing PMNs if the adherent PMNs are expressing PSGL-1 and activated integrins, while flowing PMNs express L-selectin and the integrin counterreceptor.41 Therefore, reduced synthesis of PSGL-1 by circulating white blood cells represents a further mechanism by which rsPSGL.Ig attenuates tissue injury during acute inflammatory diseases and shock states.
In conclusion, we have demonstrated significant in vivo beneficial
effects of a recombinant soluble human form of PSGL-1 in a severe model
of traumatic shock. These effects are consistent with reduced
leukocyte-endothelial interaction induced by rsPSGL.Ig
in the rat mesenteric microvasculature. These impressive effects are
probably due to the fact that PSGL-1 has 4 orders of magnitude
greater avidity for binding to P-selectin than previously identified
selectin ligands.45 These data demonstrate the significant
role that PSGL-1 plays in the development and progression of
inflammation in disease states such as traumatic shock.
|
Acknowledgments |
|---|
This work was supported in part by research grant GM-45434 from the National Institutes of General Medical Sciences, NIH. We gratefully acknowledge the gift of rsPSGL.Ig from Dr Gray Shaw (Genetics Institute, Cambridge, Mass). We also thank Robert Craig, Barry Campbell, and Irina Opentanova for their expert technical assistance in the biochemical measurements used in this study.
Received August 11, 1998; accepted October 5, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Noble RL, Collip JB. A quantitative method of production of experimental trauma without hemorrhage in unanesthetized animals. Q J Exp Physiol. 1942;31:187–202.
2. Christopher TA, Ma XL, Lefer AM. Beneficial actions of S-nitroso-N-acetylpenicillamine, a nitric oxide donor, in murine traumatic shock. Shock. 1994;1:19–24.[Medline] [Order article via Infotrieve]
3. Terashita Z, Stahl GL, Lefer AM. Protective effects of a platelet activating factor (PAF) antagonist and its combined treatment with prostaglandin (PG) E1 in traumatic shock. J Cardiovasc Pharmacol. 1988;12:505–511.[Medline] [Order article via Infotrieve]
4. McEver RP. Leukocyte-endothelial cell interactions. Curr Opin Cell Biol. 1992;4:840–849.[Medline] [Order article via Infotrieve]
5. Lefer AM, Lefer DJ. Pharmacology of the endothelium in ischemia-reperfusion and circulatory shock. Annu Rev Pharmacol Toxicol. 1993;33:71–90.[Medline] [Order article via Infotrieve]
6. Scalia R, Pearlman S, Campbell B, Lefer AM. Time course of endothelial dysfunction and neutrophil adherence and infiltration during murine traumatic shock. Shock. 1996;6:177–182.[Medline] [Order article via Infotrieve]
7. Lorant DE, Topham MK, Whatley RE, McEver RP, McIntyre TM, Prescott SM, Zimmerman GA. Inflammatory roles of P-selectin. J Clin Invest. 1993;92:559–570.
8.
Moore KL, Stults NL, Diaz S, Smith DF, Cummings RD,
Varki A, McEver RP. Identification of a specific
glycoprotein ligand for P-selectin (CD62) on myeloid cells.
J Cell Biol. 1992;118:445–456.
9.
Moore KL, Eaton SF, Lyons DE, Lichenstein HS, Cummings
RD, McEver RP. The P-selectin glycoprotein ligand from
human neutrophils displays sialylated, fucosylated, O-linked
poly-N-acetyllactosamine. J Biol Chem. 1994;269:23318–23327.
10.
Moore KL, Patel KD, Bruehl RE, Li F, Johnson DA,
Lichenstein HS, Cummings RD, Bainton DF, McEver RP. P-selectin
glycoprotein ligand-1 mediates rolling of human neutrophils
on P-selectin. J Cell Biol. 1995;128:661–671.
11. vonAndrian UH, Hasslen SR, Nelson RD, Erlandsen SL, Butcher EC. A central role for microvillous receptor presentation in leukocyte adhesion under flow. Cell. 1995;82:989–999.[Medline] [Order article via Infotrieve]
12. Sako D, Chang X-J, Barone KM, Vachino G, White HM, Shaw G, Veldelman G M, Bean KM, Ahern TJ, Furie B, Cumming DA, Larsen RG. Expression cloning of a functional glycoprotein ligand for P-selectin. Cell. 1993;75:1179–1186.[Medline] [Order article via Infotrieve]
13. Takada M, Nadeau KC, Shaw GD, Marquette KA, Tilney NL. The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat kidney. J Clin Invest. 1997;99:2682–2690.[Medline] [Order article via Infotrieve]
14. Sako D, Comess KM, Camphausen RT, Cumming DA, Shaw GD. A sulfated peptide segment at the amino terminus of PSGL-1 is critical for P-selectin binding. Cell. 1995;83:323–331.[Medline] [Order article via Infotrieve]
15.
Natsuka S, Gersten KM, Zenita K, Kannagi R, Lowe JB.
Molecular cloning of a cDNA encoding a novel human leukocyte
-1,3-fucosyltransferase capable of synthesizing the sialyl
Lewisx determinant. J Biol Chem. 1994;269:16794–16799.
16.
Bierhuizen MF, Fukuda M. Expression and cloning of a
cDNA encoding UDP-GlcNAc:Gal ß1–3-GalNAc-R(GlcNAc to
GalNAc)ß1–6GlcNAc transferase by gene transfer into CHO cell
expressing polyoma large tumor antigen. Proc Natl Acad Sci
U S A. 1992;89:9326–9330.
17.
Murohara T, Scalia R, Lefer AM. Lysophosphatidylcholine
promotes P-selectin expression in platelets and
endothelial cells: possible involvement of protein
kinase C activation and its inhibition by nitric oxide donors.
Circ Res. 1996;78:780–789.
18. Williams JH, Moser KM, Ulich T, Cairo MS. Harvesting the noncirculating pool of polymorphonuclear leukocytes in rats by hetastarch exchange transfusion (HET): yield and functional assessment. J Leukocyte Biol. 1987;42:455–462.[Abstract]
19.
Scalia R, Gefen J, Petasis NA, Serhan CN, Lefer AM.
Lipoxin A4 stable analogs inhibit leukocyte rolling and adherence in
the rat mesenteric microvasculature: role of P-selectin. Proc
Natl Acad Sci U S A. 1997;94:9967–9972.
20. Borders JL, Granger HJ. An optical Doppler intravital velocimeter. Microvasc Res. 1984;27:117–125.[Medline] [Order article via Infotrieve]
21.
Granger DN, Benoit JN, Suzuki M, Grisham MB. Leukocyte
adherence to venular endothelium during
ischemia-reperfusion. Am J Physiol. 1989;257:G683–G688.
22. Weyrich AS, Burke M, Albertine KH, Lefer AM. Time course of coronary vascular endothelial adhesion molecules during reperfusion of the ischemic feline myocardium. J Leukocyte Biol. 1995;75:54–55.
23. Bradley PP, Priebat DA, Christensen RD, Rothstein G. Measurement of cutaneous inflammation: estimation of neutrophil content with an enzyme marker. J Invest Dermatol. 1982;78:206–209.[Medline] [Order article via Infotrieve]
24. Mullane KM, Kraemer R, Smith B. Myeloperoxidase activity as a quantitative assessment of neutrophil infiltration into ischemic myocardium. J Pharmacol Methods. 1985;14:157–167.[Medline] [Order article via Infotrieve]
25. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
26. Armstead VE, Minchenko AG, Campbell B, Lefer AM. P-selectin is up-regulated in vital organs during murine traumatic shock. FASEB J. 1997;11:1271–1279.[Abstract]
27.
Yang J, Galipeau J, Kozak CA, Furie BC, Furie B. Mouse
P-selectin glycoprotein ligand-1: molecular cloning,
chromosomal localization, and expression of a functional P-selectin
receptor. Blood. 1996;87:4176–4186.
28. Knapp RG, Wise WC. A more appropriate statistical method for analyzing mortality data in shock research. Circ Shock. 1985;16:375–381.[Medline] [Order article via Infotrieve]
29. Dulkanchainun TS, Goss JA, Imagawa DK, Shaw GD, Anselmo DM, Kaldas F, Wang T, Zhao D, Busuttil AA, Kato H, Murray NGB, Kupiec-Weglinski JW, Busuttil RD. Reduction of hepatic ischemia/reperfusion injury by a soluble P-selectin glycoprotein ligand-1. Ann Surg. 1988;227:832–840.
30. Davenpeck KL, Gauthier TW, Lefer AM. Inhibition of endothelial-derived nitric oxide promotes P-selectin expression and actions in the rat microcirculation. Gastroenterology. 1994;107:1050–1058.[Medline] [Order article via Infotrieve]
31.
Skurk C, Buerke M, Guo JP, Paulson J, Lefer AM. Sialyl
Lewisx-containing oligosaccharide exerts
beneficial effects in murine traumatic shock. Am J
Physiol. 1994;267:H2124–H2131.
32.
Gauthier TW, Davenpeck KL, Lefer AM. Nitric oxide
attenuates leukocyte-endothelial interaction via
P-selectin in splanchnic ischemia-reperfusion. Am J
Physiol. 1994;267:G562–G568.
33.
Kubes P, Suzuki M, Granger DN. Nitric oxide: an
endogenous modulator of leukocyte adhesion. Proc Natl
Acad Sci U S A. 1991;88:4651–4655.
34. Kubes P. Nitric oxide affects microvascular permeability in the intact and inflamed vasculature. Microcirculation. 1995;2:235–244.[Medline] [Order article via Infotrieve]
35. Carey C, Siegfried MR, Ma X-L, Weyrich AS, Lefer AM. Antishock and endothelial protective actions of a NO donor in mesenteric ischemia and reperfusion. Circ Shock. 1992;38:209–216.[Medline] [Order article via Infotrieve]
36. Lawrence MB, Springer TA. Leukocytes roll on a selectin at physiologic flow rats: distinction from and prerequisite for adhesion through integrins. Cell. 1991;65:859–873.[Medline] [Order article via Infotrieve]
37.
Suzuki M, Inawen W, Kvietys PR, Grisham MB, Meininger
C, Schelling ME, Granger HJ, Granger DN. Superoxide mediates
reperfusion-induced leukocyte-endothelial cell
interactions. Am J Physiol. 1989;257:H1740–H1745.
38. Weiss SJ. Tissue destruction by neutrophils. N Engl J Med. 1989;320:365–376.[Medline] [Order article via Infotrieve]
39.
Norman KE, Moore KL, McEver RP, Ley K. Leukocyte
rolling in vivo is mediated by P-selectin glycoprotein
ligand-1. Blood. 1995;86:4417–4421.
40. Patel KD, Moore KL, Nollert MU, McEver RP. Neutrophils use both shared and distinct mechanisms to adhere to selectins under static and flow conditions. J Clin Invest. 1995;96:1887–1896.
41.
Guyer DA, Moore KL, Lynam EB, Schammel CG, Rogelj S,
McEver RP, Sklar LA. P-selectin glycoprotein ligand-1
(PSGL-1) is a ligand for L-selectin in neutrophil aggregation.
Blood. 1996;88:2415–2421.
42. Tu LL, Chen AJ, Delahunty MD, Moore KL, Watson SR, McEver RP, Tedder TF. L-selectin binds to P-selectin glycoprotein ligand-1 on leukocytes: interactions between the lectin, epidermal growth factor, and consensus repeat domains of the selectins determine ligand binding specificity. J Immunol. 1996;157:3995–4004.[Abstract]
43.
Ma, X-L, Weyrich AS, Lefer DJ, Buerke M, Albertine KH,
Kishimoto TK, Lefer AM. Monoclonal antibody to L-selectin attenuates
neutrophil accumulation and protects ischemic reperfused cat
myocardium. Circulation. 1993;88:649–658.
44. Walcheck B, Moore KL, McEver RP, Kishimoto TK. Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1: a mechanism that amplifies initial leukocyte accumulation on P-selectin in vitro. J Clin Invest. 1996;98:1081–1087.[Medline] [Order article via Infotrieve]
45.
McEver RP, Moore KL, Cummings RD. Leukocyte trafficking
mediated by selectin-carbohydrate interactions. J Biol
Chem. 1995;270:11025–11028.
This article has been cited by other articles:
 |
|
 |
|
  T. Hirata, Y. Furukawa, B.-G. Yang, K. Hieshima, M. Fukuda, R. Kannagi, O. Yoshie, and M. Miyasaka Human P-selectin Glycoprotein Ligand-1 (PSGL-1) Interacts with the Skin-associated Chemokine CCL27 via Sulfated Tyrosines at the PSGL-1 Amino Terminus J. Biol. Chem., December 10, 2004; 279(50): 51775 - 51782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. R. Hicks, S. L. Nolan, V. C. Ridger, P. G. Hellewell, and K. E. Norman Recombinant P-selectin glycoprotein ligand-1 directly inhibits leukocyte rolling by all 3 selectins in vivo: complete inhibition of rolling is not required for anti-inflammatory effect Blood, April 15, 2003; 101(8): 3249 - 3256. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Wang, Z. Zhou, X. Zhou, K. Tarakji, E. J. Topol, and A. M. Lincoff Prevention of intimal hyperplasia with recombinant soluble P-selectin glycoprotein ligand-immunoglobulin in the porcine coronary artery balloon injury model J. Am. Coll. Cardiol., August 1, 2001; 38(2): 577 - 582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. P. Khor, K. McCarthy, M. DuPont, K. Murray, and G. Timony Pharmacokinetics, Pharmacodynamics, Allometry, and Dose Selection of rPSGL-Ig for Phase I Trial J. Pharmacol. Exp. Ther., May 1, 2000; 293(2): 618 - 624. [Abstract] [Full Text]
|
|
|
|
|
|
A. Leppanen, P. Mehta, Y.-B. Ouyang, T. Ju, J. Helin, K. L. Moore, I. van Die, W. M. Canfield, R. P. McEver, and R. D. Cummings A Novel Glycosulfopeptide Binds to P-selectin and Inhibits Leukocyte Adhesion to P-selectin J. Biol. Chem., August 27, 1999; 274(35): 24838 - 24848. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||