Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1998;83:852-859

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mandriota, S. J.
Right arrow Articles by Pepper, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mandriota, S. J.
Right arrow Articles by Pepper, M. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
(Circulation Research. 1998;83:852-859.)
© 1998 American Heart Association, Inc.


Original Contributions

Regulation of Angiopoietin-2 mRNA Levels in Bovine Microvascular Endothelial Cells by Cytokines and Hypoxia

Stefano J. Mandriota, , Michael S. Pepper

From the Department of Morphology, University Medical Center, Geneva, Switzerland.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Angiopoietin-2 (Ang2) is a ligand for the endothelial cell tyrosine kinase receptor Tie2 and counteracts blood vessel maturation/stability mediated by angiopoietin-1 (Ang1), the other known ligand of Tie2. Using degenerate oligonucleotides and reverse transcriptase–polymerase chain reaction, we have screened bovine microvascular endothelial (BME), aortic, lymphatic, pulmonary artery, and transformed fetal aortic endothelial cells, as well as rat smooth muscle cells for Ang1 and Ang2 expression. Except for high Ang2 mRNA levels found in BME cells, none of the endothelial cell types studied expressed appreciable levels of Ang1 or Ang2 mRNAs, whereas smooth muscle cells expressed both Ang1 and Ang2. BME cell Ang2 mRNA levels were increased by vascular endothelial growth factor (1.9- to 2.9-fold), basic fibroblast growth factor (1.6- to 2-fold), both cytokines in combination (2.9- to 4-fold), and hypoxia (3.1- to 5.6-fold) and were decreased by Ang1 (31% to 70%) or transforming growth factor-ß1 (64% to 81%). Ang2 also decreased (60% to 82%) BME cell Ang2 mRNA. mRNA levels for the Tie1 or Tie2 receptors were only slightly modulated under the conditions described above. These findings suggest that the angiogenic effect of a number of regulators may be achieved in part through the regulation of an autocrine loop of Ang2 activity in microvascular endothelial cells.


Key Words: angiopoietin-2 • angiogenesis • hypoxia • cytokine • vascular remodeling


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
During angiogenesis, previously quiescent endothelial cells are induced to degrade their basement membrane and to invade the surrounding stroma as cell cords. Later, these cords form a lumen, deposit a new basement membrane, and recruit perivascular cells such as smooth muscle cells (SMCs) and pericytes, thus resulting in functional new vessels.1 This sequence of events predicts that angiogenesis is dependent on the concerted regulation of distinct cell functions. From a descriptive point of view, it is useful to attribute these functions to a phase of "activation" or to a phase of "maturation." Activation includes increased vascular permeability and extravascular fibrin deposition, induction of endothelial cell migration and proliferation, and controlled proteolysis of the extracellular matrix. Maturation includes cessation of endothelial cell migration and proliferation, reduction of extracellular proteolytic activity, new basement membrane deposition, lumen formation, junctional complex maturation, and recruitment of perivascular cells. After maturation, endothelial cell quiescence and blood vessel stability are thought to be actively maintained by a complex interaction between endothelial and SMCs or pericytes, which in turn is mediated by a balance between positive and negative regulators of angiogenesis.

Although the molecular mechanisms underlying the phase of activation have been extensively characterized, those governing the phase of maturation are only beginning to be understood. Vascular endothelial growth factor/vascular permeability factor (VEGF/VPF, referred to as VEGF in this article) and basic fibroblast growth factor (bFGF) stimulate migration, proliferation, and extracellular proteolytic activity in cultured endothelial cells and have thus been classified as key regulators of the activation phase.2 3 4 However, although a role for VEGF in the endogenous regulation of angiogenesis has been clearly demonstrated, the role of bFGF as an endogenous angiogenesis regulator requires further clarification.2 4

The recent discovery of angiopoietin-1 (Ang1) and angiopoietin-2 (Ang2) has provided novel and important insights into the molecular mechanisms of blood vessel formation.5 6 Ang1 and Ang2 share about 60% amino acid identity and bind with similar affinity to the endothelial cell tyrosine kinase receptor Tie2/Tek (referred to as Tie2 in this article).5 6 However, although Ang1 induces Tie2 autophosphorylation, Ang2 is a naturally occurring antagonist of Ang1, in that it competes with Ang1 for binding to Tie2 and blocks Ang1-induced Tie2 autophosphorylation.6 Intriguingly, Ang1 does not induce endothelial cell proliferation, despite intense autophosphorylation of Tie2.5 In vivo analysis of Ang1 function by targeted gene inactivation in the mouse has revealed lethal embryonic defects highly reminiscent of those observed in Tie2 knockout mice. These defects consist of a poorly organized subendothelial matrix, loosening of endothelial cell contacts with the basement membrane, and generalized lack of perivascular cells.7 8 9 10 Of note, endothelial cells are present in normal number in Ang1 null mice.10 These findings imply that Ang1 is not necessary for endothelial cell differentiation and proliferation and demonstrate instead that Ang1 is required for correct vascular assembly and recruitment of perivascular cells. Tie1, another endothelial cell receptor with no ligand described to date, which is closely related to Tie2, is also essential for correct vascular assembly. Tie1 null mice die of edema and hemorrhage, resulting from poor structural integrity of the vasculature.9

Several additional interesting features of Ang2 have been reported. Consistent with its role as an antagonist of Ang1, overexpression of Ang2 in endothelial cells of transgenic mice results in lethal embryonic defects reminiscent of those observed in Ang1 and Tie2 knockout mice.6 During embryogenesis and adult life, Ang2 expression occurs almost exclusively at sites of vascular remodeling and is most marked at the invading front of vascular sprouts, where its expression coincides with that of VEGF.6 However, Ang2 expression is also pronounced in atretic follicles and in aged corpora lutea, in which blood vessels regress, and VEGF mRNA is almost undetectable.6 Taken together, these findings have led to the proposal that, by virtue of its capacity to counteract Ang1-mediated blood vessel maturation/stability, the function of Ang2 may be context-dependent. When acting in the absence of angiogenic inducers such as VEGF, Ang2-mediated loosening of cell-matrix contacts may induce endothelial cell apoptosis with consequent vascular regression. When acting in concert with VEGF, Ang2 may facilitate endothelial cell migration and proliferation, thus serving as a permissive angiogenic signal.6 11 Although attractive, this hypothesis requires additional clarification. For example, virtually nothing is known about the molecular mechanisms that regulate the expression of Ang1 or Ang2 or of the endothelial cell receptors Tie1 or Tie2. In this study, we cloned partial cDNAs coding for bovine and rat Ang1 and Ang2 and used them as probes (1) to assess their expression in a variety of bovine endothelial cell lines as well as rat SMCs and C6 glioma cells and (2) to study the regulation of this expression by a variety of well-characterized angiogenic stimuli, including hypoxia. Expression of Tie1 and Tie2 was also studied in microvascular endothelial cells.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Reagents
Recombinant human Ang1 and Ang2 were kindly provided by Dr G.D. Yancopoulos (Regeneron Pharmaceuticals, Tarrytown, NY). Recombinant human bFGF was kindly provided by Dr P. Sarmientos (Farmitalia Carlo Erba, Milano, Italy). Human platelet–derived transforming growth factor-ß1 (TGF-ß1) was purchased from R&D Systems Europe (Abingdon, Oxon, UK). Recombinant human VEGF (165aa species) was purchased from PeproTech Inc (Rocky Hill, NJ). Recombinant mouse angiostatin (rmAst) was a kind gift from Dr Y. Shing (Children's Hospital, Harvard University Medical School, Cambridge, Mass), and angiostatin prepared by elastase digestion of human plasminogen (ehAst) was kindly provided by Dr B. Binder (University of Vienna, Austria).

Cell Culture
Adrenal cortex–derived BME cells,12 bovine aortic endothelial (BAE) cells,13 bovine lymphatic endothelial (BLE) cells,14 and calf pulmonary artery endothelial (CPAE) cells (American Type Culture Collection, Manassas, Va) were cultured as previously described.15 16 Transformed fetal BAE (GM7373) cells, kindly provided by Dr M. Presta (University of Brescia, Italy), were grown in DMEM (Gibco) containing 10% FCS (Gibco). Rat SMCs from normal aortic media, kindly provided by Drs M.-L. Piallat-Bochaton and G. Gabbiani (Dept of Pathology, University of Geneva Medical Center, Switzerland) were cultured in DMEM containing 4.5 g/L glucose and 10% FCS. C6 glioma cells were cultured as described.17

Molecular Cloning of Bovine and Rat Ang1 and Ang2 Partial cDNAs
Partially degenerate oligonucleotides were designed from the amino acid sequences QHLEHVM and MEGKHKE or VDFQRTW and WKGSGYS, which are conserved in the human and mouse Ang1 or Ang2 cDNAs, respectively.5 6 The primer sequences used were as follows: Ang1, forward, 5'-CAGCATCTGGA(A/G)CA(T/C)GT(A/G/T/C)ATG; reverse, 5'-TTC(T/C)TTGTGTTT(A/G/T/C)CC(T/C)TCCAT; Ang2, forward, 5'-GT(T/G)GA(T/C)TT(T/C)CAGAG(A/G/T/C)AC(A/G/T/C)TGG; reverse, 5'-CGA(A/G) TAGCC(T/G)GA(A/G/T/C)CC(T/C)TTCCA. Total cellular RNAs (2 µg) from BME, BAE, BLE, CPAE, GM7373, rat SMC, and C6 glioma cells or from adult bovine liver or 17-day rat placenta were reverse-transcribed using random exanucleotides (Boehringer Mannheim) and Moloney murine leukemia virus reverse transcriptase (Promega). One twentieth of each reverse transcriptase (RT) product was amplified with degenerate Ang1 or Ang2 oligonucleotides using PrymeZyme DNA polymerase (Biometra). Polymerase chain-reaction cycles were (for all cDNAs) as follows: 95°C, 3 minutes (1x); 95°C, 30 seconds; 55°C, 1 minute; 72°C, 45 seconds (35x); and 72°C, 5 minutes (1x). Approximately 350-bp reverse transcriptase–polymerase chain reaction (RT-PCR) products amplified with degenerate Ang1 oligonucleotides from adult bovine liver or rat placenta or {approx}450-bp RT-PCR products amplified with degenerate Ang2 oligonucleotides from BME cells or rat placenta were cloned into pGEM-T Easy (Promega) and sequenced on both strands.

Northern Blot, RNase Protection, and Semiquantitative RT-PCR
Twenty-four to 36 hours after the last medium change, bFGF (10 ng/mL), VEGF (30 ng/mL), or both cytokines together, TGF-ß1 (1 ng/mL), rmAst (500 ng/mL), ehAst (10 µg/mL), Ang1 (10 or 100 ng/mL), or Ang2 (10 or 100 ng/mL) were directly added to the culture medium of confluent monolayers of BME cells. Conditions of hypoxia (for both BME cells and SMCs) were achieved using an airtight Plexiglas container, in which O2 was replaced with a 95% N2/5% CO2 gas mixture. Under these conditions, the difference in pH values between the medium of controls and hypoxia-incubated cultures at the end of the incubation period did not exceed 0.08 units. Total cellular RNAs, purified using Trizol reagent (Gibco), were analyzed by Northern blot or RNase protection analysis as described18 19 using the 32P-labeled bovine Ang1 or Ang2 cRNAs as probes. For analysis of Tie1 or Tie2 mRNAs, a cDNA fragment corresponding to nucleotides 2076 to 2520 of the bovine Tie1 coding sequence20 or a cDNA fragment corresponding to nucleotides 2037 to 2484 of the bovine Tie2 coding sequence20 was amplified by RT-PCR, cloned, sequenced to confirm identity, and used to synthesize cRNA probes for use in Northern blot or RNase protection assays. For semiquantitative RT-PCR, 2 µg of total RNA from rat SMCs was reverse-transcribed using oligo-dT15 (Boehringer) and Superscript II (Gibco). For each RT product, one twentieth of the final reaction volume was amplified in three parallel PCR reactions using the Ang2 oligonucleotides described above, a pair of mouse VEGF primers, which efficiently amplified rat VEGF cDNAs,21 or a pair of partially degenerate primers for the acidic ribosomal phosphoprotein P0 (forward: CCGGAATTCAGGGAAGACAGGGCGACCTGG; reverse: CGCGGATCC(C/T)C(G/T)GAT(A/G)GCCTTGCGCATCAT). PCR cycles were as follows: for Ang2, 95°C, 3 minutes (1x); 95°C, 30 seconds; 55°C, 1 minute; and 72°C, 45 seconds (25x); for VEGF, 95°C, 3 minutes (1x); 95°C, 30 seconds; 60°C, 1 minute; and 72°C, 45 seconds (20x); for P0, 95°C, 3 minutes (1x); 95°C, 30 seconds; 60°C, 1 minute; and 72°C, 45 seconds (18x). Preliminary experiments were performed to assess at what stage the reactions reached saturation. After this, PCR reactions were terminated before saturation to allow semiquantitative analysis. Five microcuries of 32P-labeled dCTP was added to each reaction tube to visualize PCR products by autoradiography.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
In situ hybridization has revealed punctate Ang2 expression at the invading front of vascular sprouts, where it appears to be expressed by endothelial cells and/or pericytes.6 This raised the possibility that cultured endothelial cells might produce Ang2 and might therefore provide a model to study the regulation of Ang2 expression in vitro. To determine whether cultured bovine endothelial cells express Ang2, partially degenerate oligonucleotides were designed from the amino acid sequences VDFQRTW and WKGSGYS, which are conserved in the human and mouse Ang2 cDNAs,6 and used to screen bovine endothelial cell total cellular RNAs by RT-PCR. After 35 PCR cycles, a band of {approx}450 bp, thus corresponding in size to the RT-PCR product expected from human or mouse Ang2 mRNAs (453 bp),6 was readily detectable in BME cells (Figure 1ADown, bottom panel). The same band was observed, although to a much lesser degree, in CPAE cells (Figure 1ADown, bottom panel), absent or almost undetectable in BAE cells (Figure 1ADown, bottom panel, and data not shown), or undetectable in BLE or GM7373 cells (Figure 1ADown, bottom panel). Of note, the putative bovine Ang2 cDNA band was also undetectable when starting from total RNA from adult bovine liver (Figure 1ADown, bottom panel), which is consistent with previous observations on Ang2 mRNA expression in adult tissues.6 With the use of the same pair of oligonucleotides, a band of identical size was amplified from total RNA from 17-day rat placenta or SMCs (Figure 1BDown, bottom panel), which is consistent with the pattern of Ang2 expression in vivo6 but not from rat C6 glioma cells (Figure 1BDown, bottom panel). In all samples, the band was undetectable when RT was omitted (Figure 1ADown and 1BDown, bottom panels, and data not shown), demonstrating that when present, Ang2 was not amplified from genomic DNA.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR screening of bovine endothelial, rat SMCs, and rat C6 glioma cells with partially degenerate oligonucleotides for Ang1 or Ang2. Two micrograms of total RNA from adult bovine liver, from BME, BAE, BLE, CPAE, and GM7373 cells (A) or from 17-day rat placenta, rat SMCs, or C6 glioma cells (B) was reverse-transcribed using random exanucleotides. One twentieth of the volume of the RT products, or an equivalent volume of H2O (H2O), was subjected to 35 PCR cycles in the presence of partially degenerate oligonucleotides for Ang1 (upper panels in A and B) or Ang2 (bottom panels in A and B). Where indicated, RT was omitted.

To explore the possibility that some of the endothelial cell types studied also express Ang1, partially degenerate oligonucleotides were designed from the amino acid sequences QHLEHVM and MEGKHKE, which are conserved in the human and mouse Ang1 cDNAs.5 By RT-PCR, these primers amplified a band of {approx}350 bp, thus corresponding in size to the RT-PCR product expected from human and mouse Ang1 mRNAs (372 bp),5 from total RNA from adult bovine liver (Figure 1AUp, upper panel), which is consistent with previous results6 but not from BME, BAE, BLE, CPAE, or GM7373 cells (Figure 1AUp, upper panel). The same pair of oligonucleotides amplified a band of identical size from total RNA from 17-day rat placenta, SMCs, and C6 glioma cells (Figure 1BUp, upper panel), which is consistent with previous results.5 6 22 Taken together, these results suggested that, with the exception of Ang2 expression by BME cells, none of the bovine endothelial cell types tested express significant levels of either Ang1 or Ang2 mRNAs.

To determine whether the RT-PCR products shown in Figure 1Up actually correspond to the bovine or rat counterparts of Ang1 or Ang2 cDNAs, these products were cloned in pGEM-T Easy (Promega) and entirely sequenced on both strands (Figure 2ADown and 2BDown). A high degree of identity was found with human and mouse Ang1 or Ang2 cDNAs (TableDown), confirming that these RT-PCR products were the bovine or rat counterparts of Ang1 or Ang2 and thus could be used as probes to study Ang1 or Ang2 mRNA levels in bovine and rat cells and tissues.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Nucleotide and deduced amino acid sequences of bovine and rat Ang1 and Ang2 partial cDNAs. Approximately 350-bp RT-PCR products amplified with degenerate Ang1 primers from adult bovine liver or rat placenta (upper panels, Figure 1AUp and 1BUp) or {approx}450-bp RT-PCR products amplified with degenerate Ang2 oligonucleotides from BME cells or rat placenta (bottom panels, Figure 1AUp and 1BUp) were cloned and sequenced on both strands. Bovine and rat Ang1 (A) and Ang2 (B) were compared with human and mouse Ang1 (A) and Ang2 (B) amino acid sequences. Sequences of degenerate oligonucleotides have been omitted. (GenBank accession Nos., bAng1: AF032923, bAng2: AF032924, rAng1: AF030376, and rAng2: AF030378).


View this table:
[in this window]
[in a new window]
 
Table 1. Percent Identity Between Bovine, Rat, Human, and Mouse Ang1 or Ang2 cDNA and Amino Acid Sequences

To assess the mechanisms that might regulate angiopoietin expression, confluent monolayers of BME cells were incubated for 15 hours in the presence of a variety of well-characterized angiogenic regulators. These included bFGF (10 ng/mL), VEGF (30 ng/mL), or both cytokines in combination, TGF-ß1 (1 ng/mL), rmAst (500 ng/mL), ehAst (10 µg/mL), Ang1 or Ang2 (both at 100 ng/mL), or hypoxia (95% N2/5% CO2). At the end of the incubation, total cellular RNA was purified and analyzed by RNase protection using 32P-labeled cRNA probes synthesized from the bovine Ang1 or Ang2 partial cDNAs shown in Figure 2Up. As an internal control, an equal amount of 32P-labeled cRNA from bovine P0 partial cDNA23 was included in all samples. Consistent with RT-PCR results (Figure 1AUp), Ang2 mRNA was readily detectable in BME cells (Figure 3Down) but not in BAE cells (data not shown). BME cell expression of Ang2 was increased 2-fold by bFGF, 2.9-fold by VEGF, 4-fold by bFGF and VEGF in combination, and 5.6-fold by hypoxia (Figures 3Down and 4Down). In contrast, it was decreased by 81% by TGF-ß1, 70% by Ang1, and 82% by Ang2 (Figures 3Down and 4Down). Angiostatin had little or no effect on Ang2 expression (Figure 3Down and data not shown). The bovine Ang1 cRNA probe revealed Ang1 expression in total RNA from bovine adult skeletal muscle (Figure 3Down), which is consistent with previous results,6 but not in BME cells, either when cultured under normal growth conditions (Figure 3Down), which is consistent with RT-PCR results (Figure 1AUp), or when stimulated with the angiogenic regulators listed above (Figure 3Down). Ang2 mRNA was undetectable in rat SMCs by RNAse protection when the cells were grown under either normal or hypoxic conditions (data not shown), which may reflect the low level of Ang2 mRNA in these cells (Figure 1BUp). Semiquantitative RT-PCR analysis revealed that hypoxia had little or no effect on SMC Ang2 mRNA levels (Figure 5Down; compare the Ang2 band with the P0 band in control versus hypoxia-treated cells); hypoxia did not induce Ang2 mRNA expression in BAE or C6 glioma cells in which the Ang2 gene is however probably silent (Figure 1Up and data not shown). In contrast, hypoxia strongly increased VEGF expression or slightly decreased Ang1 expression in both SMCs and C6 glioma cells (Figure 5Down and data not shown), which is consistent with previous results.17 22



View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. RNase protection analysis for Ang1 and Ang2 mRNA in BME cells. Purified 32P-labeled bovine Ang1 and Ang2 cRNAs (probe) were hybridized to hybridization mix (probe+h.m.), yeast tRNA (tRNA), to 10 µg of total RNA from bovine adult skeletal muscle (Sk. muscle) (only for Ang1, upper panel), or to 10 µg of total RNA from BME cells incubated for 15 hours in the presence of normal growth medium (control) or in medium containing bFGF (10 ng/mL), VEGF (30 ng/mL), both cytokines in combination (F/V), TGF-ß1 (1 ng/mL), rmAst (Ast, 500 ng/mL), Ang1 or Ang2 (both at 100 ng/mL), or a gas mixture containing 95% N2/5% CO2 (hypoxia). As an internal control, an equal amount of the P0 cRNA probe was included in all samples. SP6=control template marker. One of two experiments with similar results is shown.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Quantitation of Ang2 mRNA levels in BME cells as assessed by RNase protection analysis. For each experimental condition (bFGF: 10 ng/mL, VEGF: 30 ng/mL, F/V: bFGF 10 ng/mL+VEGF 30 ng/mL, TGF-ß1: 1 ng/mL, Ang1: 100 ng/mL, and Ang2: 100 ng/mL), the graph shows values obtained by scanning densitometry (normalized with respect to the P0 signal), ±SD from two different experiments. An arbitrary value of 1 was assigned to controls.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. Ang2 and VEGF mRNA levels in SMCs incubated under hypoxic conditions. Two micrograms of total RNA from 12.5-day rat embryo+placenta (E/P12.5) or from confluent monolayers of rat SMCs incubated for 15 hours under normal growth conditions (control) or in the presence of a gas mixture containing 95% N2/5% CO2 (hypoxia) were reverse-transcribed with oligo-dT15. One twentieth of the RT products, or an equivalent volume of H2O (H2O), was subjected to 25, 20, or 18 cycles of PCR in the presence of Ang2, VEGF, or P0 oligonucleotides, respectively. Where indicated, RT was omitted. Five microcuries of 32P-dCTP were included in each sample to visualize the PCR products by autoradiography.

Because RNase protection does not distinguish between transcripts of different sizes, total BME cell RNAs from experiments similar to those shown in Figures 3Up and 4Up were analyzed by Northern blot, using the 32P-labeled bovine Ang2 cRNA as a probe. BME cells were found to express three major Ang2 transcripts of 2.3, 2.8, and 5.8 kb (Figure 6Down). An additional band of 1.6 kb was detectable in cultures incubated under hypoxic conditions (Figure 6Down). All of the Ang2 mRNA transcripts were modulated in a similar manner by the different treatments used, although the effect of hypoxia was most marked on the 2.3-kb transcript, and that of Ang1 was more marked on the 5.8-kb transcript (Figures 6Down and 7Down). With these exceptions noted, scanning densitometry gave values largely superimposable on those obtained by RNase protection (Figure 7Down). When replicate RNA blots were hybridized with bovine Tie1 or Tie2 cRNA probes, small modulations of Tie1 or Tie2 mRNA levels by the angiogenic regulators listed above were found (Figure 6Down). In particular, Tie1 mRNA was slightly increased by bFGF (1.6±0.08-fold) or by the combination bFGF/VEGF (1.8±0.15-fold), and Tie2 mRNA was slightly increased by bFGF (1.6±0.24-fold), Ang1 (100 ng/mL, 1.5±0.09-fold), or Ang2 (100 ng/mL, 1.9±0.29-fold) or decreased by hypoxia (62±4%), alone or in combination with VEGF (Figure 6Down and data not shown) (for all of these modulations, errors represent SEM with n=4 experiments). Similar results were obtained by RNase protection using the same probes (data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 6. Northern blot analysis of Ang2, Tie1, or Tie2 mRNA levels in BME cells. Confluent monolayers of BME cells were incubated for 15 hours in the presence of normal growth medium (control) or in medium containing VEGF (30 ng/mL), bFGF (10 ng/mL), both cytokines in combination (F/V), Ang1 (10 or 100 ng/mL), Ang2 (10 or 100 ng/mL), TGF-ß1 (1 ng/mL), or a gas mixture containing 95% N2/5% CO2, alone (hypoxia), or in combination with 30 ng/mL of VEGF (H/V). Replicate filters containing total cellular RNA (10 µg/lane) were hybridized with 32P-labeled bovine Ang2, Tie1, or Tie2 cRNA probes. The second panel from the top is a shorter exposure of the top panel to show the 2.3-kb and 2.8-kb Ang2 mRNAs. Methylene blue staining reveals 28S and 18S rRNAs and demonstrates uniformity of loading and RNA integrity. One of four experiments with similar results is shown.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 7. Quantitation of Ang2 mRNA levels in BME cells as assessed by Northern blot analysis. For each experimental condition (bFGF: 10 ng/mL, VEGF: 30 ng/mL, F/V: bFGF 10 ng/mL+VEGF 30 ng/mL, TGF-ß1: 1 ng/mL, Ang1: 100 ng/mL, and Ang2: 100 ng/mL), the graph shows values obtained by scanning densitometry (±SEM, n=4 experiments) for the 5.8-kb, 2.8-kb, or 2.3-kb Ang2 transcripts, respectively. An arbitrary value of 1 was assigned to controls in all cases.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The recent discovery and characterization of two ligands (Ang1 and Ang2) for the endothelial cell tyrosine kinase receptor Tie2 has increased our understanding of the molecular basis of the angiogenic process. Ang1 was the first to be described and appeared as an unusual angiogenic factor in that it was unable to stimulate endothelial cell proliferation.5 Targeted inactivation of the Ang1 gene in the mouse revealed the requirement for this factor for recruitment of perivascular cells and correct vascular assembly, rather than for endothelial cell differentiation and proliferation,10 thus providing a novel and important insight into the mechanisms that govern the late phases of angiogenesis. Because Ang1-mediated blood vessel maturation/stability is likely to interfere with the extensive vascular remodeling that takes place during angiogenesis, it has been proposed that Ang2, a natural antagonist of Ang1,6 may be an important proangiogenic factor, in that it may counteract Ang1-mediated blood vessel stability, thus maintaining the endothelium in a more plastic state and promoting the response of endothelial cells to angiogenic inducers.6 11 To assess this hypothesis, we cloned partial cDNAs coding for bovine or rat Ang1 and Ang2, with the aim of studying the mechanisms that regulate their expression in a number of cultured bovine and rat cell types. We found that Ang1 is expressed in SMCs but not in five different types of bovine endothelial cells nor in BME cells exposed to a variety of angiogenic stimuli. This is largely consistent with the pattern of Ang1 expression in vivo.5 6 Rat C6 glioma cells also expressed Ang1, as previously reported by others.22 Relatively high levels of Ang2 mRNA were found in endothelial cells of microvascular origin but not of large vessel or lymphatic origin, and lower levels were seen in SMCs. This is also consistent with the pattern of Ang2 expression in vivo, in which Ang2 mRNA was detected in SMCs, pericytes, and endothelial cells at the invading front of vascular sprouts.6 No Ang2 expression was observed in C6 glioma cells.

Of interest was the finding that microvascular endothelial cells express Ang2, for it suggested that (1) regulation of endothelial cell Ang2 levels during angiogenesis may give rise to and modulate an autocrine loop of Ang1 inactivation that would operate selectively at sites of vascular remodeling and (2) regulation of Ang2 expression in endothelial cells could be directly governed by angiogenic inducers/repressors, thus representing part of their mechanism of action. In this study, we report for the first time that three well-characterized angiogenic inducers, namely, VEGF, bFGF, and hypoxia, increase BME cell expression of Ang2. This suggests that an increase in Ang2 expression is a common pathway by which different angiogenic inducers act, and that Ang2-mediated inactivation of the stabilizing Ang1 signal is an important step in the vascular remodeling that occurs during angiogenesis, independently of the nature of the angiogenic stimulus (Figure 8Down).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 8. Dynamic interplay between Ang1 and Ang2 in the regulation of blood vessel maturation/stability.6 11 At the onset of angiogenesis, the local induction of Ang2 expression in endothelial cells by signals such as VEGF, bFGF, and/or hypoxia may inactivate the stabilizing Ang1 signal, thus promoting the loosening of endothelial-perivascular cell contacts (vessel wall disassembly) and allowing endothelial cells to respond to angiogenic inducers by the formation of sprouts. In the final phases of angiogenesis, a local diminution of Ang2 expression, possibly mediated by Ang1 itself and/or TGF-ß1, may reestablish the Ang1 signal, whose expression is, in contrast to that of Ang2, constitutive in many organs,6 thus promoting the recruitment of perivascular cells and the maturation of the newly formed vessels (vessel wall assembly). The recruitment of perivascular cells to the vessel wall has been hypothesized to be mediated by endothelial cell–derived polypeptides such as TGF-ß1 and platelet-derived growth factor (PDGF).26

The finding that Ang2 expression is increased by hypoxia was particularly striking. Tissue hypoxia is a fundamental angiogenic stimulus, characteristic of malignant tumors, healing wounds, and a number of other pathological or physiological situations associated with neovascularization. The VEGF gene has been shown to contain specific hypoxia-responsive elements and consistent with these features is upregulated in response to low oxygen tensions in a variety of experimental models.3 In the present study, we report that Ang2 mRNA is also increased by hypoxia in microvascular endothelial cells. This phenomenon was apparently specific for these cells, because Ang2 mRNA levels appeared not to be significantly altered by hypoxia in SMCs. In addition to VEGF, our findings identify Ang2 as another hypoxia-inducible angiogenic factor, point to Ang2 as a potential important component of the angiogenic switch that characterizes the passage of a tumor from the avascular to the vascular phase, and provide strong evidence for a collaboration between VEGF and Ang2 in the regulation of neovascularization in ischemic tissues.

The finding that Ang2 mRNA is rapidly and dramatically induced in tumor vasculature but not in the surrounding tumor tissue in which VEGF is upregulated (G.D. Yancopoulos, unpublished data, 1998) strengthens our conclusion that tumor-derived signals such as hypoxia and/or VEGF or bFGF may specifically induce Ang2 expression in tumor endothelium, and that this event may in turn be an important component of the angiogenic switch and/or of the subsequent phases of the formation of an endogenous tumor microcirculation.

If increased Ang2 activity is part of the mechanism of action of angiogenic inducers, one would expect those factors that are required for the maturation/stability of blood vessels to act in part by decreasing/repressing Ang2 activity (Figure 8Up). Consistent with this view, Ang1 decreased Ang2 mRNA levels in BME cells. Recent genetic studies have indicated that TGF-ß1 is an important mediator of correct vascular assembly24 ; we found that TGF-ß1 also decreased BME cell Ang2 mRNA levels. It is noteworthy that the vessels of the yolk sac of TGF-ß1 null mice25 show defects that are somewhat reminiscent of those observed in Ang1 or Tie2 knockout mice7 8 9 10 or in transgenic mice overexpressing Ang2,6 which suggests that these defects could be due in part to an inappropriate overexpression of Ang2, which in turn is due to the lack of TGF-ß1. A similar molecular basis may contribute to the phenotype of Ang1 null mice. Although these correlations are likely to be an oversimplification of what occurs in the whole organism, they are nonetheless intriguing.


*    Acknowledgments
 
This work was supported by grant No. 31-43364.95 from the Swiss National Science Foundation and by a grant-in-aid from the Fondation Carlos et Elise de Reuter.


*    Footnotes
 
Michael S. Pepper, Department of Morphology, University Medical Center, 1 rue Michel Servet, 1211 Geneva 4, Switzerland.

Received May 11, 1998; accepted August 12, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Ausprunk DH, Folkman J. Migration and proliferation of endothelial cells in preformed and newly formed blood vessels during tumor angiogenesis. Microvasc Res. 1977;14:53–65.[Medline] [Order article via Infotrieve]

2. Pepper MS, Mandriota SJ, Vassalli JD, Orci L, Montesano R. Angiogenesis regulating cytokines: activities and interactions. Curr Top Microbiol Immunol. 1996;213(Pt 2):31–67.

3. Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocr Rev. 1997;18:4–25.[Abstract/Free Full Text]

4. Christofori G. The role of fibroblast growth factors in tumour progression and angiogenesis. In: Bicknell R, Lewis CE, Ferrara N, eds. Tumour Angiogenesis. New York, NY: Oxford University Press; 1997:201–237.

5. Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, Ryan TE, Bruno J, Radziejewski C, Maisonpierre PC, Yancopoulos GD. Isolation of angiopoietin-1, a ligand for the Tie2 receptor, by secretion-trap expression cloning. Cell. 1996;87:1161–1169.[Medline] [Order article via Infotrieve]

6. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science. 1997;277:55–60.[Abstract/Free Full Text]

7. Dumont DJ, Gradwohl G, Fong GH, Puri MG, Gertsenstein M, Auerbach A, Breitman ML. Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev. 1994;8:1897–1909.[Abstract/Free Full Text]

8. Puri MC, Rossant J, Alitalo K, Bernstein A, Partanen J. The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells. EMBO J. 1995;14:5884–5891.[Medline] [Order article via Infotrieve]

9. Sato TN, Tozawa Y, Deutsch U, Wolburg-Buchholz K, Fujiwara Y, Gendron-Maguire M, Gridley T, Wolburg H, Risau W, Qin Y. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature. 1995;376:70–74.[Medline] [Order article via Infotrieve]

10. Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, Sato TN, Yancopoulos GD. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell. 1996;87:1171–1180.[Medline] [Order article via Infotrieve]

11. Hanahan D. Signaling vascular morphogenesis and maintenance. Science. 1997;277:48–50.[Free Full Text]

12. Furie MB, Cramer EB, Naprstek BL, Silverstein SC. Cultured endothelial cell monolayers that restrict the transendothelial passage of macromolecules and electrical current. J Cell Biol. 1984;98:1033–1041.[Abstract/Free Full Text]

13. Pepper MS, Montesano R, El Aoumari A, Gros D, Orci L, Meda P. Coupling and connexin-43 expression in microvascular and large vessel endothelial cells. Am J Physiol. 1992;262:C1246–C1257.[Abstract/Free Full Text]

14. Pepper MS, Wasi S, Ferrara N, Orci L, Montesano R. In vitro angiogenic and proteolytic properties of bovine lymphatic endothelial cells. Exp Cell Res. 1994;210:298–305.[Medline] [Order article via Infotrieve]

15. Mandriota SJ, Seghezzi G, Vassalli JD, Ferrara N, Wasi S, Mazzieri R, Mignatti P, Pepper MS. Vascular endothelial growth factor increases urokinase receptor expression in vascular endothelial cells. J Biol Chem. 1995;270:9709–9716.[Abstract/Free Full Text]

16. Montesano R, Orci L. Phorbol esters induce angiogenesis in vitro from large vessel endothelial cells. J Cell Physiol. 1987;130:284–291.[Medline] [Order article via Infotrieve]

17. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature. 1992;359:843–848.[Medline] [Order article via Infotrieve]

18. Pepper MS, Belin D, Montesano R, Orci L, Vassalli JD. Transforming growth factor-ß1 modulates basic fibroblast growth factor-induced proteolytic and angiogenic properties of endothelial cells in vitro. J Cell Biol. 1990;111:743–755.[Abstract/Free Full Text]

19. Pepper MS, Soriano JV, Menoud PA, Sappino AP, Orci L, Montesano R. Modulation of hepatocyte growth factor and c-met in the rat mammary gland during pregnancy, lactation and involution. Exp Cell Res. 1995;219:204–210.[Medline] [Order article via Infotrieve]

20. Sato TN, Qin Y, Kozak CA, Audus KL. Tie-1 and tie-2 define another class of putative receptor tyrosine kinase genes expressed in early embryonic vascular system. Proc Natl Acad Sci U S A.. 1993;90:9355–9358.[Abstract/Free Full Text]

21. Gorden DL, Mandriota SJ, Montesano R, Orci L, Pepper MS. Vascular endothelial growth factor is increased in devascularized rat islets of Langerhans in vitro. Transplantation. 1997;63:436–443.[Medline] [Order article via Infotrieve]

22. Enholm B, Paavonen K, Ristimaki A, Kumar V, Gunji Y, Klefstrom J, Kivinen L, Laiho M, Olofsson B, Joukov V, Eriksson U, Alitalo K. Regulation of VEGF-B and VEGF-C mRNAs by serum, growth factors and oncoproteins. Oncogene. 1997;14:2475–2483.[Medline] [Order article via Infotrieve]

23. Pepper MS, Mandriota SJ. Regulation of vascular endothelial growth factor receptor-2 (Flk-1) expression in vascular endothelial cells. Exp Cell Res. 1998;241:414–425.[Medline] [Order article via Infotrieve]

24. Pepper MS. Transforming growth factor-ß: vasculogenesis, angiogenesis, and vessel wall integrity. Cytokine Growth Factor Rev. 1997;8:21–43.[Medline] [Order article via Infotrieve]

25. Dickson MC, Martin JS, Cousins FM, Kulkarni AB, Karlsson S, Akhurst RJ. Defective hematopoiesis and vasculogenesis in transforming growth factor-ß1 knockout mice. Development. 1995;121:1845–1854.[Abstract]

26. Folkman J, D'Amore PA. Blood vessel formation: what is its molecular basis? Cell.. 1996;87:1153–1155.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
P. Kumpers, J. Hellpap, S. David, R. Horn, H. Leitolf, H. Haller, and M. Haubitz
Circulating angiopoietin-2 is a marker and potential mediator of endothelial cell detachment in ANCA-associated vasculitis with renal involvement
Nephrol. Dial. Transplant., June 1, 2009; 24(6): 1845 - 1850.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
E. M. Dioum, S. L. Clarke, K. Ding, J. J. Repa, and J. A. Garcia
HIF-2{alpha}-Haploinsufficient Mice Have Blunted Retinal Neovascularization Due to Impaired Expression of a Proangiogenic Gene Battery
Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2714 - 2720.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Mofarrahi, T. Nouh, S. Qureshi, L. Guillot, D. Mayaki, and S. N. A. Hussain
Regulation of angiopoietin expression by bacterial lipopolysaccharide
Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L955 - L963.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Szymczak, M. Murray, and N. Petrovic
Modulation of angiogenesis by {omega}-3 polyunsaturated fatty acids is mediated by cyclooxygenases
Blood, April 1, 2008; 111(7): 3514 - 3521.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
L. Kugathasan, A. E. Dutly, Y. D. Zhao, Y. Deng, M. J. Robb, S. Keshavjee, and D. J. Stewart
Role of Angiopoietin-1 in Experimental and Human Pulmonary Arterial Hypertension
Chest, December 1, 2005; 128(6_suppl): 633S - 642S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. E. Nisato, G. Hosseini, C. Sirrenberg, G. S. Butler, T. Crabbe, A. J.P. Docherty, M. Wiesner, G. Murphy, C. M. Overall, S. L. Goodman, et al.
Dissecting the Role of Matrix Metalloproteinases (MMP) and Integrin {alpha}v{beta}3 in Angiogenesis In vitro: Absence of Hemopexin C Domain Bioactivity, but Membrane-Type 1-MMP and {alpha}v{beta}3 Are Critical
Cancer Res., October 15, 2005; 65(20): 9377 - 9387.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
J S Mohan, P L Lip, A D Blann, D Bareford, and G Y H Lip
The angiopoietin/Tie-2 system in proliferative sickle retinopathy: relation to vascular endothelial growth factor, its soluble receptor Flt-1 and von Willebrand factor, and to the effects of laser treatment
Br J Ophthalmol, July 1, 2005; 89(7): 815 - 819.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
J I Patel, P G Hykin, Z J Gregor, M Boulton, and I A Cree
Angiopoietin concentrations in diabetic retinopathy
Br J Ophthalmol, April 1, 2005; 89(4): 480 - 483.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Hegen, S. Koidl, K. Weindel, D. Marme, H. G. Augustin, and U. Fiedler
Expression of Angiopoietin-2 in Endothelial Cells Is Controlled by Positive and Negative Regulatory Promoter Elements
Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1803 - 1809.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Sandhu, K. Teichert-Kuliszewska, S. Nag, G. Proteau, M. J. Robb, A. I.M. Campbell, M. A. Kuliszewski, M. J.B. Kutryk, and D. J. Stewart
Reciprocal regulation of angiopoietin-1 and angiopoietin-2 following myocardial infarction in the rat
Cardiovasc Res, October 1, 2004; 64(1): 115 - 124.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. E. Nisato, J. A. Harrison, R. Buser, L. Orci, C. Rinsch, R. Montesano, P. Dupraz, and M. S. Pepper
Generation and Characterization of Telomerase-Transfected Human Lymphatic Endothelial Cells with an Extended Life Span
Am. J. Pathol., July 1, 2004; 165(1): 11 - 24.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
U. Fiedler, M. Scharpfenecker, S. Koidl, A. Hegen, V. Grunow, J. M. Schmidt, W. Kriz, G. Thurston, and H. G. Augustin
The Tie-2 ligand Angiopoietin-2 is stored in and rapidly released upon stimulation from endothelial cell Weibel-Palade bodies
Blood, June 1, 2004; 103(11): 4150 - 4156.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Tsutsumi, Y. Yonemitsu, Y. Shikada, M. Onimaru, M. Tanii, S. Okano, K. Kaneko, M. Hasegawa, M. Hashizume, Y. Maehara, et al.
Essential Role of PDGFR{alpha}-p70S6K Signaling in Mesenchymal Cells During Therapeutic and Tumor Angiogenesis In Vivo: Role of PDGFR{alpha} During Angiogenesis
Circ. Res., May 14, 2004; 94(9): 1186 - 1194.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H.-P. Hammes, J. Lin, P. Wagner, Y. Feng, F. vom Hagen, T. Krzizok, O. Renner, G. Breier, M. Brownlee, and U. Deutsch
Angiopoietin-2 Causes Pericyte Dropout in the Normal Retina: Evidence for Involvement in Diabetic Retinopathy
Diabetes, April 1, 2004; 53(4): 1104 - 1110.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Pichiule, J. C. Chavez, and J. C. LaManna
Hypoxic Regulation of Angiopoietin-2 Expression in Endothelial Cells
J. Biol. Chem., March 26, 2004; 279(13): 12171 - 12180.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
G. J. Hausman and R. L. Richardson
Adipose tissue angiogenesis
J Anim Sci, March 1, 2004; 82(3): 925 - 934.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. Y. Chong, G. J. Caine, B. Freestone, A. D. Blann, and G. Y. H. Lip
Plasma angiopoietin-1, angiopoietin-2, and angiopoietin receptor tie-2 levels in congestive heart failure
J. Am. Coll. Cardiol., February 4, 2004; 43(3): 423 - 428.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
T. VEIKKOLA, M. LOHELA, K. IKENBERG, T. MAKINEN, T. KORFF, A. SAARISTO, T. PETROVA, M. JELTSCH, H. G. AUGUSTIN, and K. ALITALO
Intrinsic versus microenvironmental regulation of lymphatic endothelial cell phenotype and function
FASEB J, November 1, 2003; 17(14): 2006 - 2013.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Yamakawa, L. X. Liu, T. Date, A. J. Belanger, K. A. Vincent, G. Y. Akita, T. Kuriyama, S. H. Cheng, R. J. Gregory, and C. Jiang
Hypoxia-Inducible Factor-1 Mediates Activation of Cultured Vascular Endothelial Cells by Inducing Multiple Angiogenic Factors
Circ. Res., October 3, 2003; 93(7): 664 - 673.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. Feraud, C. Mallet, and I. Vilgrain
Expressional Regulation of the Angiopoietin-1 and -2 and the Endothelial-Specific Receptor Tyrosine Kinase Tie2 in Adrenal Atrophy: A Study of Adrenocorticotropin-Induced Repair
Endocrinology, October 1, 2003; 144(10): 4607 - 4615.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Zhang, N. Yang, J.-W. Park, D. Katsaros, S. Fracchioli, G. Cao, A. O'Brien-Jenkins, T. C. Randall, S. C. Rubin, and G. Coukos
Tumor-derived Vascular Endothelial Growth Factor Up-Regulates Angiopoietin-2 in Host Endothelium and Destabilizes Host Vasculature, Supporting Angiogenesis in Ovarian Cancer
Cancer Res., June 15, 2003; 63(12): 3403 - 3412.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. D. Zhao, A. I.M. Campbell, M. Robb, D. Ng, and D. J. Stewart
Protective Role of Angiopoietin-1 in Experimental Pulmonary Hypertension
Circ. Res., May 16, 2003; 92(9): 984 - 991.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Le Jan, C. Amy, A. Cazes, C. Monnot, N. Lamande, J. Favier, J. Philippe, M. Sibony, J.-M. Gasc, P. Corvol, et al.
Angiopoietin-Like 4 Is a Proangiogenic Factor Produced during Ischemia and in Conventional Renal Cell Carcinoma
Am. J. Pathol., May 1, 2003; 162(5): 1521 - 1528.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
H. Takagi, S. Koyama, H. Seike, H. Oh, A. Otani, M. Matsumura, and Y. Honda
Potential Role of the Angiopoietin/Tie2 System in Ischemia-Induced Retinal Neovascularization
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 393 - 402.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
A. Zakrzewicz, T. W. Secomb, and A. R. Pries
Angioadaptation: Keeping the Vascular System in Shape
Physiology, October 1, 2002; 17(5): 197 - 201.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Favier, P.-F. Plouin, P. Corvol, and J.-M. Gasc
Angiogenesis and Vascular Architecture in Pheochromocytomas : Distinctive Traits in Malignant Tumors
Am. J. Pathol., October 1, 2002; 161(4): 1235 - 1246.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Geva, D. G. Ginzinger, C. J. Zaloudek, D. H. Moore, A. Byrne, and R. B. Jaffe
Human Placental Vascular Development: Vasculogenic and Angiogenic (Branching and Nonbranching) Transformation Is Regulated by Vascular Endothelial Growth Factor-A, Angiopoietin-1, and Angiopoietin-2
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4213 - 4224.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
G.C. Weston, I. Haviv, and P.A.W. Rogers
Microarray analysis of VEGF-responsive genes in myometrial endothelial cells
Mol. Hum. Reprod., September 1, 2002; 8(9): 855 - 863.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Hewett, S. Nijjar, M. Shams, S. Morgan, J. Gupta, and A. Ahmed
Down-Regulation of Angiopoietin-1 Expression in Menorrhagia
Am. J. Pathol., March 1, 2002; 160(3): 773 - 780.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Li, N. W. Shworak, and M. Simons
Increased responsiveness of hypoxic endothelial cells to FGF2 is mediated by HIF-1{alpha}-dependent regulation of enzymes involved in synthesis of heparan sulfate FGF2-binding sites
J. Cell Sci., January 5, 2002; 115(9): 1951 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
T. MAKINEN and K. ALITALO
Molecular Mechanisms of Lymphangiogenesis
Cold Spring Harb Symp Quant Biol, January 1, 2002; 67(0): 189 - 196.
[Abstract] [PDF]


Home page
Am. J. Pathol.Home page
Y. Yu, J. Varughese, L. F. Brown, J. B. Mulliken, and J. Bischoff
Increased Tie2 Expression, Enhanced Response to Angiopoietin-1, and Dysregulated Angiopoietin-2 Expression in Hemangioma-Derived Endothelial Cells
Am. J. Pathol., December 1, 2001; 159(6): 2271 - 2280.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Abdulmalek, F. Ashur, N. Ezer, F. Ye, S. Magder, and S. N. A. Hussain
Differential expression of Tie-2 receptors and angiopoietins in response to in vivo hypoxia in rats
Am J Physiol Lung Cell Mol Physiol, September 1, 2001; 281(3): L582 - L590.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Koga, T. Todaka, M. Morioka, J.-i. Hamada, Y. Kai, S. Yano, A. Okamura, N. Takakura, T. Suda, and Y. Ushio
Expression of Angiopoietin-2 in Human Glioma Cells and Its Role for Angiogenesis
Cancer Res., August 1, 2001; 61(16): 6248 - 6254.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. D. Ramsden, H. C. Cocks, M. Shams, S. Nijjar, J. C. Watkinson, M. C. Sheppard, A. Ahmed, and M. C. Eggo
Tie-2 Is Expressed on Thyroid Follicular Cells, Is Increased in Goiter, and Is Regulated by Thyrotropin through Cyclic Adenosine 3',5'-Monophosphate
J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2709 - 2716.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. Audero, I. Cascone, I. Zanon, S. C. Previtali, R. Piva, D. Schiffer, and F. Bussolino
Expression of Angiopoietin-1 in Human Glioblastomas Regulates Tumor-Induced Angiogenesis : In Vivo and In Vitro Studies
Arterioscler Thromb Vasc Biol, April 1, 2001; 21(4): 536 - 541.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. Otani, H. Takagi, H. Oh, S. Koyama, and Y. Honda
Angiotensin II Induces Expression of the Tie2 Receptor Ligand, Angiopoietin-2, in Bovine Retinal Endothelial Cells
Diabetes, April 1, 2001; 50(4): 867 - 875.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
T. Etoh, H. Inoue, S. Tanaka, G. F. Barnard, S. Kitano, and M. Mori
Angiopoietin-2 Is Related to Tumor Angiogenesis in Gastric Carcinoma: Possible in Vivo Regulation via Induction of Proteases
Cancer Res., March 1, 2001; 61(5): 2145 - 2153.
[Abstract] [Full Text]


Home page
Cardiovasc ResHome page
I. Kim, S.-O. Moon, C.-Y. Han, Y. K. Pak, S. K. Moon, J. J. Kim, and G. Y. Koh
The angiopoietin-tie2 system in coronary artery endothelium prevents oxidized low-density lipoprotein-induced apoptosis
Cardiovasc Res, March 1, 2001; 49(4): 872 - 881.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Teichert-Kuliszewska, P. C. Maisonpierre, N. Jones, A. I.M. Campbell, Z. Master, M. P. Bendeck, K. Alitalo, D. J. Dumont, G. D. Yancopoulos, and D. J. Stewart
Biological action of angiopoietin-2 in a fibrin matrix model of angiogenesis is associated with activation of Tie2
Cardiovasc Res, February 16, 2001; 49(3): 659 - 670.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. C. Denko and A. J. Giaccia
Tumor Hypoxia, the Physiological Link between Trousseau's Syndrome (Carcinoma-induced Coagulopathy) and Metastasis
Cancer Res., February 1, 2001; 61(3): 795 - 798.
[Full Text]


Home page
FASEB J.Home page
T. KORFF, S. KIMMINA, G. MARTINY-BARON, and H. G. AUGUSTIN
Blood vessel maturation in a 3-dimensional spheroidal coculture model: direct contact with smooth muscle cells regulates endothelial cell quiescence and abrogates VEGF responsiveness
FASEB J, February 1, 2001; 15(2): 447 - 457.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Fujiyama, H. Matsubara, Y. Nozawa, K. Maruyama, Y. Mori, Y. Tsutsumi, H. Masaki, Y. Uchiyama, Y. Koyama, A. Nose, et al.
Angiotensin AT1 and AT2 Receptors Differentially Regulate Angiopoietin-2 and Vascular Endothelial Growth Factor Expression and Angiogenesis by Modulating Heparin Binding-Epidermal Growth Factor (EGF)-Mediated EGF Receptor Transactivation
Circ. Res., January 19, 2001; 88(1): 22 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. E. Bell, A. Mavila, R. Salazar, K. J. Bayless, S. Kanagala, S. A. Maxwell, and G. E. Davis
Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling
J. Cell Sci., January 8, 2001; 114(15): 2755 - 2773.
[Abstract] [Full Text] [PDF]


Home page
Neuro Oncol DukeHome page
H. Ding, L. Roncari, X. Wu, N. Lau, P. Shannon, A. Nagy, and A. Guha
Expression and hypoxic regulation of angiopoietins in human astrocytomas
Neuro-oncol, January 1, 2001; 3(1): 1 - 10.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
T.M. Hazzard, L.K. Christenson, and R.L. Stouffer
Changes in expression of vascular endothelial growth factor and angiopoietin-1 and -2 in the macaque corpus luteum during the menstrual cycle
Mol. Hum. Reprod., November 1, 2000; 6(11): 993 - 998.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Beck, T. Acker, C. Wiessner, P. R. Allegrini, and K. H. Plate
Expression of Angiopoietin-1, Angiopoietin-2, and Tie Receptors after Middle Cerebral Artery Occlusion in the Rat
Am. J. Pathol., November 1, 2000; 157(5): 1473 - 1483.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. Willam, P. Koehne, J. S. Jurgensen, M. Grafe, K. D. Wagner, S. Bachmann, U. Frei, and K.-U. Eckardt
Tie2 Receptor Expression Is Stimulated by Hypoxia and Proinflammatory Cytokines in Human Endothelial Cells
Circ. Res., September 1, 2000; 87(5): 370 - 377.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Bongrazio, C. Baumann, A. Zakrzewicz, A. R Pries, and P. Gaehtgens
Evidence for modulation of genes involved in vascular adaptation by prolonged exposure of endothelial cells to shear stress
Cardiovasc Res, August 1, 2000; 47(2): 384 - 393.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. J. Mandriota, C. Pyke, C. Di Sanza, P. Quinodoz, B. Pittet, and M. S. Pepper
Hypoxia-Inducible Angiopoietin-2 Expression Is Mimicked by Iodonium Compounds and Occurs in the Rat Brain and Skin in Response to Systemic Hypoxia and Tissue Ischemia
Am. J. Pathol., June 1, 2000; 156(6): 2077 - 2089.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Veikkola, M. Karkkainen, L. Claesson-Welsh, and K. Alitalo
Regulation of Angiogenesis via Vascular Endothelial Growth Factor Receptors
Cancer Res., January 1, 2000; 60(2): 203 - 212.
[Full Text]


Home page
Am. J. Pathol.Home page
J. Lauren, Y. Gunji, and K. Alitalo
Is Angiopoietin-2 Necessary for the Initiation of Tumor Angiogenesis?
Am. J. Pathol., November 1, 1998; 153(5): 1333 - 1339.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Cohen, D. Barkan, Y. Levy, I. Goldberg, E. Fridman, J. Kopolovic, and M. Rubinstein
Leptin Induces Angiopoietin-2 Expression in Adipose Tissues
J. Biol. Chem., March 9, 2001; 276(11): 7697 - 7700.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Xu and Q. Yu
Angiopoietin-1, Unlike Angiopoietin-2, Is Incorporated into the Extracellular Matrix via Its Linker Peptide Region
J. Biol. Chem., September 7, 2001; 276(37): 34990 - 34998.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Kim, J.-H. Kim, Y. S. Ryu, S. H. Jung, J. J. Nah, and G. Y. Koh
Characterization and Expression of a Novel Alternatively Spliced Human Angiopoietin-2
J. Biol. Chem., June 9, 2000; 275(24): 18550 - 18556.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mandriota, S. J.
Right arrow Articles by Pepper, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mandriota, S. J.
Right arrow Articles by Pepper, M. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH