Original Contributions |
/ß and the IFN-
Signal-Transduction Pathways
From the Department of Pathology and the Molecular Cardiobiology Program, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, Conn.
Correspondence to David R. Johnson, 454 BCMM, Yale University School of Medicine, 295 Congress Ave, New Haven, CT 06510. E-mail johnson{at}biomed.med.yale.edu
| Abstract |
|---|
|
|
|---|
and IFN-
/ß induction of the transporter associated with antigen
processing-1 (TAP1) promoter was compared in HeLa cells and
endothelial cells (ECs). In HeLa cells, IFN-
acts
through Stat1
/Stat1
homodimers binding to the gamma activating
sequence (GAS) and IFN-
/ß acts through Stat1/Stat2/p48 binding to
the IFN-stimulated response element (ISRE). In ECs, however, IFN-
and IFN-
/ß act through both the GAS and ISRE. The basis of the IFN
signaling crossover in ECs was investigated. HeLa and ECs contain
similar ratios of Stat1
to Stat2 proteins, and IFN-
/ß also
activates the same Janus kinases (JAKs) (Jak1 and
tyrosine kinase (Tyk) 2 but not Jak2). However, IFN-
/ß
activates more Stat1
than does IFN-
in ECs, whereas the
reverse occurs in HeLa, and expression of the IFN-
/ß
receptor-associated phosphatase SHP-1 is much lower in ECs than HeLa
cells. Overexpression of SHP-1 in ECs blocks IFN-
/ß signaling
through GAS, and expression of a dominant negative SHP-1 in HeLa cells
permits IFN-
/ß signaling through GAS, demonstrating a role for
SHP-1 in regulating crossovers between the IFN-
/ß and IFN-
signaling pathways.
Key Words: endothelial cell interferon MHC class I transporter associated with antigen processing (TAP) phosphatase
| Introduction |
|---|
|
|
|---|
MHC class I molecules are expressed constitutively at low levels by
many cells, including vascular endothelial cells (ECs). Expression is
increased at sites of inflammation after a delay of a few hours.
Increased MHC class I expression increases the efficiency of peptide
presentation to CTLs.4 5 The
inflammatory cytokines interferon (IFN)-
, IFN-ß, or
IFN-
increase MHC class I expression in vivo.6
IFNs induce transcription of MHC class I molecules (called HLA-A, -B,
-C in humans) in cultured human umbilical vein ECs and in the human
epithelial carcinoma cell line HeLa.7 8
IFN-
, IFN-ß (type I IFNs), and IFN-
(type II IFNs) are
thought to activate distinct signal-transduction pathways,
leading to different cellular responses (reviewed in Reference 99 ).
IFN-
and -ß compete for receptor occupancy whereas IFN-
binds
to a unique receptor. In response to IFN-
/ß, the
receptor-associated Janus kinases (JAKs) Jak1 and Tyk2 are
activated10 followed by the STAT (signal
transducer and activator of transcription) proteins Stat1
, Stat1ß
(an alternatively spliced form of Stat1), and
Stat2.11 Stat1
or Stat1ß forms heterodimers
with Stat2, which then associate with a 48-kD protein ISGF3-
to form
Stat1/Stat2/p48 (also known as IFN-stimulated gene factor 3
[ISGF3]).12 Stat1/Stat2/p48 translocates to the
nucleus and binds to the IFN-stimulated response element (ISRE)
(AGTTTCNNTTTYCC consensus sequence).13 In
response to IFN-
, Jak1 and Jak2 are activated followed by
Stat1
.14 Activated Stat1
forms
Stat1
/Stat1
homodimers (also called GAF) that bind a GAS
(TTCNNNAA consensus sequence).15 Crossovers
between the IFN-
/ß and IFN-
signaling pathways have been
documented. For example, IFN-
modulates the IFN-
/ß pathway
indirectly by increasing the levels of p48, which is said to
"prime" the response for stronger activation of Stat1/Stat2/p48 by
IFN-
/ß.16 Also, IFN-
treated human FS2
fibroblasts contain a factor that is indistinguishable from
Stat1
/Stat1
in DNase (exo III) protection
assays.17 This factor is not detectable, however,
in electrophoretic mobility shift assays (EMSAs) of DNA-binding
proteins using as probe the gamma activating sequence (GAS) from the
guanylate-binding protein (GBP) gene
promoter.18 The molecular basis for this
activation has not been established.
Protein phosphatases regulate activation and inactivation of
intracellular second-messenger systems by cytokines (reviewed
in Reference 1919 ). IFN-
/ß signaling requires
SHP-2,20 an SH2-containing protein tyrosine
phosphatase (also called PTP1D, SHPTP2, Syp21 )
that is constitutively associated with the IFN-
/ß
receptor.20 The phosphatase SHP-1 (also called
SHPTP1 and HCP) associates with the IFN-
/ß receptor on IFN
binding22 and inhibits signaling, perhaps by
dephosphorylating Tyk2.23 SHP-2 is expressed
ubiquitously, while SHP-1 is expressed at high levels in
hematopoietic cells and at lower levels in neural
cells,24 malignant colon epithelial
cells,25 HeLa
cells,26 and ECs (see below).
Both IFN-
/ß and IFN-
induce TAP1 mRNA more rapidly than HLA
class I mRNA,27 and IFN-
increases
TAP-dependent peptide transport more rapidly than HLA class I molecule
expression.28 IFN-
activated
Stat1
/Stat1
binds to a GAS in the promoter of
TAP129 and the promoter of the transcription
factor IRF-1,30 which mediates the delayed
response of HLA class I promoter.31 The
biological significance of rapid TAP1 induction by IFNs is not known.
Elevated concentrations of TAP-supplied peptides in the endoplasmic
reticulum may help ensure efficient peptide loading, thereby also
limiting expression of "empty" HLA class I molecules that may
promote autoimmunity.32 In the present study,
the response of the TAP1 promoter to type I IFNs (IFN-
/ß) is
analyzed and compared in HeLa cells and cultured ECs, a more
physiological candidate for antigen
presentation to CTLs in vivo.33
| Materials and Methods |
|---|
|
|
|---|
-), and
U6A (Stat2-) were obtained from G.R. Stark (Cleveland Clinic Research
Foundation, Cleveland, Ohio). Recombinant IFN-
2b was purchased from
Schering. IFN-ß (expressed in Escherichia coli;
3x108 U/m) and IFN-
(expressed in E.
coli; 2.5x107 U/mg) were obtained from
Biogen Inc. IFN-
or IFN-ß was used at 1000 U/mL and IFN-
at 500
U/mL.
Reporter Gene Constructs, Transfection, and Reporter
Assays
The TAP1 promoter-driven reporter constructs TAP-growth hormone
(GH) mutant IFN consensus sequence (mICS) (previously
called mICS1), mISRE (previously called mICS12), mGAS, and mISRE/mGAS
(previously called mICS12/mGAS) have been
described.29 The following
oligonucleotides were used in EMSAs (listed 5' to 3';
complement sequence not shown): TAP1 ICS: AGGCGGCCGCTTTCGATTTCGCT; TAP1
GAS: CGATTTCGCTTTCCCCTAAATG (GAS consensus is underlined);
TAP1 ISRE: TTCGATTTCGCTTTCCCCTggATGGCTGAGCTTCT (ISRE
consensus sequence is underlined; small gg mutated from AA of the
wild-type GAS sequence). Transient transfections of human umbilical
vein ECs were performed using a DEAE-Dextran
protocol.34 Two plasmids were transfected: a TAP
promoter-reporter construct (6 µg) and SV-ß-gal (6 µg), to
normalize for transfection efficiency. For SHP-1 studies, 3 plasmids
were transfected: a reporter gene (6 µg), SV-ß-gal (3 µg) and 3
µg of the expression vector encoding wild-type SHP-1 (pCMV5-SHP1C), a
dominant negative SHP-1 mutant (pCMV5-SHP1C [Cys
Ser]) or the empty
vector (pCMV5) (described in Reference 2020 ; generously provided by Dr.
Andrew Larner, NIH). After 24 hours, transfected cells were replated on
gelatin-coated 24-well plates. Forty-eight hours after transfection,
cells were treated with IFNs as indicated. Transfections of HeLa and
2fTGH cells were performed using cationic liposomes (Lipofectamine,
GIBCO) according to the manufacturer's instructions. DNA (2 µg
reporter and 1 µg SV-ß-gal) was mixed with Lipofectamine (6 µL)
and incubated for 20 minutes at room temperature, then added to each
well, along with 2 mL of OptiMEM medium. After transfection overnight,
the cells were divided equally into 4 different cultures. For the assay
of constitutive and cytokine-induced promoter activity,
culture media were harvested after 24 hours. Samples were assayed for
hGH using a kit (Nichols Institute). Radioactivity was measured in a
gamma counter (5500B, Beckman). Cell lysates were assayed for
ß-galactosidase using a kit (Promega).
Nuclear Extracts and EMSA
Nuclear extracts were prepared following a
modification35 of the procedure of Dignam et
al.36 Briefly, cells
(5x106) were harvested by scrape-harvesting into
TBS (20 mmol/L Tris, pH 7.2, 0.15 mol/L NaCl), resuspended in
buffer A (0.2 mL; 10 mmol/L HEPES, pH 7.9, 10 mmol/L KCl,
1.5 mmol/L MgCl2, leupeptin and aprotinin
each 1 µg/mL, PMSF 0.5 mmol/L, 1 mmol/L orthovanadate,
2 mmol/L pyrophosphate), and incubated 15 minutes on ice. Then 25
µL 2.5% NP-40/buffer A was added, mixed by inversion, and the nuclei
pelleted (500g, 4 minutes, 4°C). Nuclear proteins were
extracted and analyzed as described
previously.29 The antibodies specific for
Stat1
and Stat2 were purchased from Santa Cruz Biotech.
Immunoprecipitation and Immunoblotting
Confluent cultures of ECs (three 10-cm plates) or HeLa cells
(one 10-cm plate) were treated with IFN-
, IFN-ß, or IFN-
(15
minutes). Cells were washed twice with cold PBS and lysed in 1.5 mL of
cold lysis buffer (50 mmol/L Tris-HCl, pH 7.6, 150 mmol/L
NaCl, 0.1% Triton X-100, 0.75% Brij 96, 1 mmol/L sodium
orthovanadate, 1 mmol/L NaF, 1 mmol/L sodium pyrophosphate,
10 µg/mL aprotinin, 10 µg/mL leupeptin, 2 mmol/L PMSF, 1
mmol/L EDTA) for 20 minutes on ice, then centrifuged
(13 000g, 10 minutes). For JAKs, 1 mL lysate was precleared
with 1 µL of normal rabbit serum and 50 µL of GammaBind plus
Sepharose beads (Pharmacia) with rocking at 4°C overnight. Lysates
were then incubated sequentially with JAK-specific antisera (Jak1,
Jak2, then Tyk2, 5 µL each) for 2 hours with 50 µL of GammaBind
plus Sepharose. For STATs, 200 µL lysate was incubated with 2 µL of
antiserum and 50 µL of GammaBind plus Sepharose beads for 2 hours.
Immune complexes were collected by centrifugation
(13 000g for 10 minutes) and washed 3 to 5 times with lysis
buffer. Precipitates were dissolved in SDS-sample buffer (60 µL) and
resolved (20 µL) by electrophoresis (6% PAGE for JAKs, 8% PAGE for
STATs), immunoblotted (Immobilon P, Millipore) with
anti-phosphotyrosine antibody 4G10 and detected by chemiluminescence
(ECL, Amersham). For detection of Stat1, Stat2, SHP1, dnSHP1, or SHP2,
cell lysates (10 µL) were resolved by SDS-PAGE (8%). Antibodies were
purchased from Upstate Biotechnology Inc, except for anti-SHP2
(Transduction Laboratory).
| Results |
|---|
|
|
|---|
/ß in ECs and HeLa Cells
/ß and IFN-
) induce rapid
accumulation of TAP1 mRNA in human ECs27 and HeLa
cells (Reference 2929 and D. Johnson, unpublished observation,
1997). Three IFN-responsive sequences have been identified in
the TAP1 promoter: an ICS, an ISRE, and GAS.29 37
To identify the promoter elements and binding proteins that confer IFN
responses, wild-type and mutant TAP1 promoter-reporter gene constructs
were transiently transfected into HeLa cells and ECs. Mutation of the
ICS (IRF-1 binding site, previously called
ICS129 ) does not influence the IFN-
, IFN-ß,
or IFN-
responses in either HeLa cells or ECs (mICS, Figure 1
response because mutation of this site (mGAS) abolishes
the IFN-
response (Figure 1a
response.
These findings are in agreement with our earlier study in HeLa
cells.29 In ECs, however, mutation of either the
GAS or the ISRE greatly reduces the IFN-
response and both elements
must be mutated to abolish the IFN-
response. Therefore, the ISRE
contributes to the IFN-
response of the TAP1 promoter in ECs but not
in HeLa cells.
|
The IFN-
/ß response of the TAP1 promoter also differs between
these two cell types (Figure 1a
and 1b
). In ECs, the TAP1 promoter
responds more strongly to IFN-
/ß than to IFN-
, whereas the
reverse is observed in HeLa cells. In HeLa cells, mutation of the ISRE
abolishes the IFN-
/ß response, whereas mutation of the GAS has no
effect on the IFN-
/ß response (Figure 1a
). In ECs, however, the
IFN-
/ß response is reduced by mutation of either the ISRE or the
GAS (Figure 1b
), and both elements must be mutated to abolish the
response. Therefore, the GAS contributes to the IFN-
/ß response of
the TAP1 promoter in ECs but not in HeLa cells.
Stat1
, Stat2, and p48 are Essential for the ISRE-Mediated
Induction of TAP1 by IFN-
/ß
The TAP1 ISRE was used as a probe in EMSAs to detect binding
proteins in nuclear extracts from IFN-
/ßtreated cells. However,
no specific binding proteins were detected in either ECs or HeLa cell
nuclear extracts (data not shown). In particular, no IRF-1 binding to
the ISRE was detected, although IRF-1 does bind the TAP1
ICS.29 A report that IRF-1 binds the TAP ISRE
used a probe that contained an intact ICS flanking the ISRE, and the
control oligonucleotide was mutant in both the ISRE and
the ICS, so it is unclear whether the detected factor binds to the ISRE
or the ICS.37
It has been noted that IFN-
/ßactivated transcription
factor Stat1/Stat2/p48 (ISGF3) can be detected by EMSA in the nuclear
extracts from some cells only if they have been pretreated (primed)
with IFN-
for 24 hours before IFN-
/ß
treatment.16 Increased Stat1/Stat2/p48 detected
after priming correlates with increased ISRE-mediated
transcription.16 When control or IFN-
primed
ECs (Figure 2
) or HeLa cells (not shown)
are treated with IFN-ß for 15 minutes, ISRE-protein complexes are
detected in the IFN-
primed cells but not in unprimed cells (lane 4
compared with lanes 2 and 3). Competition with excess unlabeled TAP
ISRE or the ISG15 ISRE, which binds
Stat1/Stat2/p48,13 demonstrates specific binding
(lanes 8 and 9). Furthermore, the complex contains Stat1
and Stat2,
because formation of the complex is blocked by specific antisera (lanes
5 and 6) but not by normal serum (NRS, lane 7). Similar results were
obtained using IFN-
treated ECs and HeLa cells (not shown). These
results suggest that Stat1/Stat2/p48 can bind to the ISRE of TAP1
promoter. It remained unclear, however, whether the small amount of
Stat1/Stat2/p48 formed in unprimed cells mediates transcriptional
activation by IFN-
/ß.
|
To determine whether Stat1
and Stat2 mediate the ISRE-dependent
IFN-
/ß response of the TAP1 promoter, the fibrosarcoma cell line
2fTGH and three mutant daughter lines lacking Stat1
(U3A), Stat2
(U6A), or p48 (U2A)38 were tested in transient
transfections with TAP1 promoter-reporter genes. 2fTGH cells resemble
HeLa cells in that mutation at the ISRE abolishes the IFN-
/ß
response of the TAP1 promoter (Figure 2b
). 2fTGH cells differ from HeLa
cells (and resemble ECs) in that the IFN-
response is mediated by
the ISRE as well as the GAS. In U3A mutant cells (lacking Stat1
),
both IFN-
/ß and IFN-
responses are abolished, indicating that
Stat1
is essential for signaling by both types of IFN. In U6A cells
(lacking Stat2) and U2A cells (lacking p48), the IFN-
/ß response
of TAP1 promoter is abolished (although the IFN-
response is
intact), confirming that the components of ISGF3 complex (Stat1, Stat2,
and p48) participate in the ISRE-dependent transcriptional activation
of the TAP1 gene by IFN-
/ß.
Although Stat1/Stat2/p48 can be detected by EMSA of nuclear extracts
from IFN-ßtreated HT1080 fibrosarcoma cells, the derivative 2fTGH
cell line requires IFN-
priming to form detectable levels of
IFN-ßactivated Stat1/Stat2/p48 (Reference 3939 and data not
shown). Taken together, these results are consistent with the
conclusion that Stat1/Stat2/p48 mediates ISRE-dependent IFN-
/ß
responses in ECs and HeLa cells, despite the fact that it is detected
by EMSA only in IFN-
primed cells. An alternative explanation, that
transfection somehow mimics IFN-
priming, is not true because
transfected cells do not increase their HLA class I expression and
remain IFN-ß inducible to the same extent as untreated cells (Figure 2c
). The simplest interpretation of this finding is that transfection
assays are more sensitive than EMSA.
These experiments also reveal that Stat1
but not Stat2 or p48
participates in the IFN-
response of the TAP1 ISRE, because the
response is absent in cells lacking Stat1
(U3A) but intact in cells
lines lacking p48 or Stat2 (U2A or U6A). The same conclusion was
reached using a different reporter gene (luciferase) and a different
transfection protocol (calcium phosphate coprecipitation), while
control transfections performed in parallel demonstrated that the
IFN-
/ß and IFN-
responses of the HLA class I promoter (HLA-B7)
require Stat1, Stat2, and p48 (data not shown). In contrast, it has
been shown that the ISRE-dependent IFN-
response of the ISG54
promoter requires both Stat1 and p48.40
In ECs, IFN-
/ß Activates Stat1
/Stat1
Homodimers
That Bind the TAP1 GAS
The TAP1 GAS contributes to the IFN-
/ß response in ECs but
not HeLa cells (Figure 1b
). Consistent with the transfection
results, IFN-
/ß only weakly activates GAS-binding nuclear
proteins in HeLa cells, although IFN-
does so effectively (Figure 3a
). In contrast, GAS-binding proteins
are detected in IFN-
/ß as well as IFN-
treated ECs (Figure 3b
), and binding is specifically competed (lane 5). The proteins in the
complex were identified as Stat1
(presumably in the form of a
Stat1
homodimer, GAF) by antibody EMSA (not shown), as demonstrated
previously in IFN-
treated HeLa cells.29 In
contrast, Stat1
binding to the GAS in the promoter of the GBP gene
is not detectable in IFN-
/ßtreated FS2
fibroblasts,18 perhaps because the GBP GAS is
lower affinity than the TAP1 GAS or because more Stat1
is
activated in ECs.
|
IFN-
/ß Activates the Same JAKs in ECs and HeLa
Cells
Studies in HeLa cells and other cell types have shown that IFN-
activates Jak1 and Jak2, leading to the activation of Stat1
and the formation of Stat1
/Stat1
, whereas IFN-
/ß
activates Jak1 and Tyk2, leading to activation of Stat1 and
Stat2 and the formation of Stat1/Stat2/p48
(ISGF3).41 To test whether IFN-
/ß activation
of Jak2 in ECs could account for the formation of Stat1
/Stat1
,
JAK phosphorylation was assessed by immunoprecipitation
with JAK-specific antibodies (Jak1, Jak2, or Tyk2) followed by Western
blotting with a phosphotyrosine-specific antibody (Figure 4
, upper panels). JAK-specific antibodies
confirm comparable loadings of the gel (lower panels). IFN-ß
activates Jak1 and Tyk2 but not Jak2 in both ECs and HeLa
cells. Similar results were obtained using IFN-
(not shown). IFN-
activates Jak1 and Jak2 but not Tyk2 in both ECs and HeLa cells
(Figure 4
). These data demonstrate that IFNs activate the same
JAKs in ECs and HeLa cells and suggest that IFN-
/ß activation of
Stat1
/Stat1
in ECs does not result from the activation of
Jak2.
|
IFN-
/ß Activates More Stat1
Than Stat2 in ECs But
Not in HeLa Cells
If IFN-
/ß activated more Stat1
than Stat2 in ECs,
then excess activated Stat1
might form homodimers. The
levels of Stat1
and Stat2 proteins were found by Western blotting to
be comparable in ECs and HeLa cells (Figure 5a
). When phosphorylated
Stat1
was measured, however, more Stat1
was found to be
phosphorylated in response to IFN-
/ß than IFN-
in ECs, whereas the reverse is true in HeLa cells (Figure 5b
, upper
panel). Phosphorylated Stat2 was strongly induced only
by IFN-
/ß, and the extent of phosphorylation
appeared comparable in ECs and HeLa cells (not shown). In both cell
types, similar amounts of Stat2 associate with Stat1 in response to
IFN-ß (Figure 5b
, compare middle with lower panels). These data
demonstrate that the ratio of IFN-ßactivated Stat1
to
Stat2 is much higher in ECs than in HeLa cells (compare lanes 3 and 5
of upper panel with lower panel) and support the suggestion that excess
activated Stat1
molecules in IFN-
/ßtreated ECs may
form homodimers.
|
IFN-
/ß Activates Stat1
More Transiently Than Does
IFN-
in ECs
More Stat1
/Stat1
is activated by IFN-ß than
by IFN-
at 15 minutes (Figure 6a
, compare lanes 2 and 3), but the levels are similar by 30 minutes
(Figure 3
), and Stat1
/Stat1
is not detected after 4 hours IFN-ß
treatment (Figure 6a
, lane 4), while it is still detectable after 16
hours of IFN-
treatment (lane 7). The kinetics of Stat1
phosphorylation was also examined by
immunoprecipitation and immunoblotting (Figure 6b
and 6c
). Consistent with the EMSA observations, IFN-
/ß
activates rapid but transient phosphorylation
of Stat1
(Figure 6b
, upper panel, lane 2, 15 minutes; lane 4, 4
hours). In HeLa cells, IFN-ß rapidly but only weakly
activates Stat1
, and phosphorylated Stat1
is no longer detectable by 1 hour (Figure 6c
). Stat2 is probably
associated with phosphorylated Stat1
at times after
15 minutes, but the levels of phosphorylated Stat1
drop below the detection limits for phosphotyrosine at later times (1
hour and 4 hours, lanes 3 and 4). The rapid decline of
phosphorylated Stat1
raised the possibility that the
failure to observe IFN-
/ßactivated Stat1
/Stat1
in
HeLa cells is caused by a more effective
dephosphorylation in this cell type compared with
ECs.
|
The Tyrosine Phosphatase SHP-1 Downregulates IFN-
/ßMediated
Stat1
Activation and GAS-Mediated TAP1 Promoter Activation
The SH2-containing tyrosine phosphatase-1 (SHP-1) regulates the
IFN-
/ßstimulated Jak/Stat pathway.22
Therefore, a higher level of SHP-1 in HeLa cells might account for the
lower level of IFN-
/ßactivated Stat1
/Stat1
. SHP-1
is indeed expressed at a much higher level in HeLa cells than in ECs,
as measured by immunoblotting (Figure 7a
). A structurally related phosphatase
that is required for IFN-
/ß signaling, SHP-2, is expressed at
comparable levels in ECs and HeLa cells (Figure 7a
, middle panel).
Consistent with the explanation that a tyrosine phosphatase
controls Stat1
/Stat1
formation in HeLa cells, IFN-ß can induce
significantly more GAS-binding Stat1
/Stat1
in HeLa cells
in the presence of the tyrosine phosphatase inhibitor
orthovanadate(van) (Figure 7b
).
|
To test directly the role of SHP-1 in regulating IFN-
/ß activation
of Stat1
, expression constructs encoding wild-type or mutant SHP-1
were transfected, together with TAP1 promoter-reporter constructs into
HeLa cells and ECs (Figure 8
). SHP-1 is
overexpressed in transfected ECs (Figure 8a
, lanes 1 to 3), and the
dominant negative SHP-1 mutant does not alter the high, constitutive
level of endogenous SHP-1 in HeLa cells (lanes 4 and 5).
TAP1 promoter-reporter constructs containing a mutant ISRE and a
wild-type or mutant GAS were used to test GAS-mediated transcription
without ISRE-mediated effects (Figure 8b
). Increased expression of
SHP-1 in ECs blocks IFN-ß signaling through the GAS, while expression
of the dominant negative SHP-1 (dnSHP-1) or transfection with the empty
expression vector (vector) have no effect. In contrast, increased
expression of SHP-1 in HeLa cells has no effect on the low level of
IFN-ßinduced, GAS-mediated transcription, while expression of the
dominant negative SHP-1 allows IFN-ß signaling through the GAS. These
data demonstrate that SHP-1 regulates crossover between the
IFN-
/ßISRE and IFN-
GAS signaling pathways in HeLa cells and
ECs (Figure 8c
).
|
| Discussion |
|---|
|
|
|---|
in HeLa cells is mediated by
activated Stat1
homodimers (GAF) binding to the GAS in the
TAP1 promoter.29 In contrast, rapid induction by
type I IFNs (IFN-
/ß) in HeLa cells is mediated by ISGF3, which is
a complex that includes activated Stat proteins
(Stat1
/Stat2/ISGF3
), binding to an ISRE in the TAP1 promoter
(Figure 1
drives transcription of GAS-containing genes and IFN-
/ß
drives transcription of ISRE-containing genes.9
Unexpectedly, different combinations of TAP1 promoter elements mediate
IFN responses in ECs: specifically, both the GAS and the ISRE
contribute to the full IFN-
/ß response in ECs. This is because in
ECs but not in HeLa cells, IFN-
/ß activates
Stat1
/Stat1
, which binds to the GAS on the TAP1 promoter. Similar
crossovers between the IFN-
/ß and IFN-
signal-transduction
pathways have been reported,17 but no mechanism
has been demonstrated.
The TAP1 ISRE is required for the IFN-
/ß response of the TAP1
promoter in HeLa cells and contributes to the response in ECs (Figure 1
). Although EMSA detection of ISRE-binding Stat1/Stat2/p48 in
IFN-
/ßtreated ECs and HeLa cells requires IFN-
priming
(Figure 2a
), induction of the TAP1 gene or TAP1 promoter by IFN-
/ß
does not29 (Figure 1
). EMSA detection of
Stat1/Stat2/p48 requires IFN-
priming also in 2fTGH cells (not
shown). The 2fTGH and Stat mutant daughter cell lines demonstrate,
however, that Stat1
, Stat2, and p48 are all essential for the
ISRE-mediated IFN-
/ß response in this cell type (Figure 2b
). This
analysis supports the conclusion that Stat1/Stat2/p48 mediates
IFN-
/ßinduced TAP1 expression even in unprimed cells and
suggests that the EMSA is less sensitive than transcription assays with
promoter-reporter constructs.
The ISRE contributes to the IFN-
response of the TAP1 gene in ECs
and 2fTGH but not HeLa cells (Figures 1
and 2b
). IFN-
can induce the
ISG54 promoter in 2fTGH cells by activating a complex of Stat1
and
p48 that lacks Stat2.40 However, Stat1
but not
Stat2 or p48 are involved in the IFN-
response of the TAP1 ISRE
(Figure 2b
). It is unclear how the Stat1 could bind to the ISRE without
the IRF family member p48. Differences in the TAP1 and ISG54 ISREs may
account for different dependencies on p48. IFN-
does not induce any
ISRE-binding complex detectable by EMSA, however, and the identity of
the IFN-
activated transcription factor(s) binding to this
site was not pursued in this study.
IRF1 binding to the TAP1 ICS but not the TAP1 ISRE is detected by EMSA
(not shown). The ICS does not contribute to an IFN response in either
HeLa cells or ECs (Figure 1
), however, suggesting that IRF1 does not
contribute to the IFN response in these cells. In contrast, IRF1
knockout mice express lower levels of TAP1 in their lymphocytes,
strongly supporting a role for IRF1 in TAP1
expression.37 42 Surprisingly, TAP1 is induced by
IFNs in IRF1 knockout mice (personal communication, J. Ting, University
of North Carolina, 1998). Therefore, IRF1 may promote
constitutive TAP1 transcription in some cell types but does not
contribute to the IFN response.
In ECs, IFN-
/ß induces the TAP1 gene27 and
the TAP1 promoter (Figure 1
) more strongly than does IFN-
, whereas
IFN-
is stronger than IFN-
/ß in HeLa cells (Figure 1
). The TAP1
GAS contributes to the IFN-
/ß response in ECs but not in HeLa
cells (Figure 1
) and GAS-binding Stat1
/Stat1
are
activated by IFN-
/ß in ECs but not in HeLa cells (Figure 3
). The residual response of the mutant ISRE construct in ECs (mISRE,
containing GAS alone, Figure 1b
) suggests that
IFN-
/ßactivated Stat1
/Stat1
contributes to TAP1
induction. Therefore, IFN-
/ß activation of both the
Stat1/Stat2/p48-ISRE and Stat1
/Stat1
-GAS pathways probably
accounts for the stronger induction of TAP1 in ECs, whereas in HeLa
cells the Stat1/Stat2/p48-ISRE pathway alone is activated.
Stat1
/Stat2 heterodimers bind to a GAS-like site (pIRE) in the IRF-1
promoter in response to IFN-
.43 44 This
complex was not detected, however, in IFN-
/ßtreated ECs by EMSA
with a TAP1 GAS probe (data not shown), suggesting that either the EMSA
is not sensitive enough or Stat1
/Stat2 is not involved in
GAS-mediated TAP1 induction in response to IFN-
/ß in ECs.
The molecular basis of IFN-
/ß activation of Stat1
/Stat1
in
ECs but not HeLa cells was examined. The pattern of JAK activation does
not explain the ability of IFN-
/ß to activate
Stat1
/Stat1
in ECs (Figure 4
). Instead, the data suggest that
IFN-
/ß activates a much higher ratio of Stat1
to Stat2
in ECs than in HeLa cells (Figure 5
). Thus, in addition to associating
with Stat2, activated Stat1
may form homodimers in response
to IFN-
/ß. IFN-
/ß activation of Stat1
is more transient
than IFN-
activation of Stat1
in ECs (Figure 6
). Similarly,
IFN-
activates in fibroblasts a factor called AAF
(
[IFN]-activated factor) that is identical to Stat1
homodimers (GAF) in DNA binding and reporter gene
assays.17 The activation of AAF by IFN-
is
also more transient than that of GAF by IFN-
.
Inactivation of IFN-activated transcription factors is not
fully understood.9 A nuclear tyrosine phosphatase
that acts on both IFN-
and IFN-
activated
Stat1
45 is unlikely to account for the
transience of IFN-
/ßactivated Stat1
in ECs because
the response to IFN-
is sustained. The tyrosine phosphatase SHP-1
reversibly associates with the IFN-
/ß receptor to downregulate the
activities of Jak1 and Stat1
.22 In SHP-1
mutant mice, formation of Stat1
/Stat1
is selectively
increased.46 Similarly, much lower levels of
SHP-1 in ECs than in HeLa cells correlates with more Stat1
activated by IFN-
/ß in ECs than in HeLa cells (Figure 7a
).
Consistent with this interpretation, IFN-
/ß can
activate Stat1
/Stat1
in HeLa cells treated with the
tyrosine phosphatase inhibitor orthovanadate (Figure 7b
).
The tyrosine phosphatase SHP-2 is required to initiate IFN-
/ß
signaling,20 so it is unlikely that orthovanadate
stimulates IFN-
/ß signaling in HeLa cells by inhibiting this
phosphatase. Finally, overexpression of SHP-1 in ECs blocks IFN-ß
signaling through GAS, producing a phenotype that resembles
HeLa cells (Figure 8
). Overexpression of a dominant negative SHP-1
(dnSHP1) mutant in HeLa cells allows IFN-ß signaling through GAS,
confirming the role of SHP-1 in regulating the IFN-ß response. In
contrast, overexpression of SHP-1 in HeLa cells has been recently shown
to increase IFN-
activated Stat1, while expression of a
dominant negative SHP-1 decreases IFN-
activated
Stat1.26
In conclusion, ECs differ from HeLa cells in that they use additional
pathways for STAT activation in response to IFN-
/ß and IFN-
,
involving bidirectional crossovers between the two IFN pathways (Figure 8c
). SHP-1 regulates crossover between IFN-
/ß and IFN-
signal-transduction pathways. These cell typespecific differences in
IFN signaling may explain why ECs are more responsive than other cell
types to IFN in vivo.6
| Acknowledgments |
|---|
Received January 29, 1998; accepted July 1, 1998.
| References |
|---|
|
|
|---|
2. Van Kaer L, Ashton-Rickardt P, Ploegh H, Tonegawa S. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules and CD4-CD8+T cells. Cell.. 1992;71:12051214.[Medline] [Order article via Infotrieve]
3.
de la Salle H, Hanau D, Fricker D, Urlacher A, Kelly
A, Salamero J, Powis S, Donato L, Bausinger H, Laforet M, Jeras M,
Spehner D, Bieber T, Falkenrodt A, Cazenave J-P, Trowsdale J, Tongio
M-M. Homozygous human TAP peptide transporter mutation in HLA class I
deficiency. Science.. 1994;265:237241.
4.
Cox JH, Yewdell JW, Eisenlohr LC, Johnson PR, Bennink
JR. Antigen presentation requires transport of MHC class I
molecules from the endoplasmic reticulum. Science.. 1990;247:715718.
5.
Joly E, Mucke L, Oldstone M. Viral persistence in
neurons explained by lack of major histocompatibility class I
expression. Science.. 1991;253:12831285.
6. Messadi D, Pober J, Murphy G. Effects of recombinant gamma-interferon on HLA-DR and DQ expression by skin cells in short-term organ culture. Lab Invest.. 1988;58:6167.[Medline] [Order article via Infotrieve]
7.
Friedman R, Stark G.
-Interferon-induced
transcription of HLA and metallothionein genes
containing homologous upstream sequences. Nature.. 1985;314:637639.[Medline]
[Order article via Infotrieve]
8.
Johnson D, Pober J. Tumor necrosis factor and immune
interferon synergistically increase transcription of HLA class I heavy-
and light-chain genes in vascular endothelium.
Proc Natl Acad Sci U S A.. 1990;87:51835187.
9.
Darnell J Jr. STATs and gene regulation.
Science.. 1997;277:16301635.
10. Firmbach-Kraft I, Byers M, Shows T, Dalla F, Krolewski J. Tyk2, prototype of a novel class of non-receptor tyrosine kinase genes. Oncogene.. 1990;5:13291336.[Medline] [Order article via Infotrieve]
11.
David M, Larner A. Activation of transcription factors
by interferon-alpha in a cell-free system. Science.. 1992;257:813815.
12.
Fu X-Y, Kessler D, Veals S, Levy D, Darnell JE Jr.
ISGF3, the transcriptional activator induced by interferon
, consists of multiple interacting polypeptide chains.
Proc Natl Acad Sci U S A.. 1990;87:85558559.
13.
Levy D, Kessler D, Pine R, Reich N, Darnell J Jr.
Interferon-induced nuclear factors that bind a shared promoter element
correlate with positive and negative control. Genes Dev.. 1988;2:383393.
14. Harpur A, Andres A, Ziemiecki A, Aston R, Wilks A. JAK2, a third member of the JAK family of protein tyrosine kinases. Oncogene.. 1992;7:13471353.[Medline] [Order article via Infotrieve]
15.
Decker T, Lew DJ, Mirkovitch J, Darnell JE Jr.
Cytoplasmic activation of GAF, an IFN-
-regulated DNA-binding
factor. EMBO J.. 1991;10:927932.[Medline]
[Order article via Infotrieve]
16.
Levy D, Lew D, Decker T, Kessler D, Darnell J Jr.
Synergistic interaction between interferon-
and interferon-
through induced synthesis of one subunit of the transcription factor
ISGF3. EMBO J.. 1990;9:11051111.[Medline]
[Order article via Infotrieve]
17.
Decker T, Lew D, Darnell J Jr. Two distinct
alpha-interferon-dependent signal transduction pathways may contribute
to activation of transcription of the guanylate-binding protein
gene. Mol Cell Biol.. 1991;11:51475153.
18.
Shuai K, Schindler C, Prezioso V, Darnell J Jr.
Activation of transcription by IFN-
: tyrosine
phosphorylation of a 91-kD DNA binding protein.
Science.. 1992;258:18081812.
19. Scharenberg A, Kinet J-P. The emerging field of receptor-mediated inhibitory signaling: SHP or SHIP? Cell.. 1996;87:961964.[Medline] [Order article via Infotrieve]
20.
David M, Zhou G, Pine R, Dixon J, Larner A. The SH2
domain-containing tyrosine phosphate PTP1D is required for interferon
/ß-induced gene expression. J Biol Chem.. 1996;271:1586215865.
21. Adachi M, Fischer E, Ihle J, Imai K, Jirik F, Neel B, Pawson T, Shen S-H, Thomas M, Ullrich A, Zhao Z. Mammalian SH2-containing protein tyrosine phosphatases [letter]. Cell.. 1996;85:15.[Medline] [Order article via Infotrieve]
22. David M, Chen H, Goelz S, Larner A, Neel B. Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol.. 1995;15:70507058.[Abstract]
23.
Yetter A, Uddin S, Krolewski J, Jiao H, Yi T, Platanias
L. Association of the interferon-dependent tyrosine kinase Tyk-2 with
the hematopoietic cell phosphatase. J Biol Chem.. 1995;270:1817918182.
24. Massa P, Wu C. The role of protein tyrosine phosphatase SHP-1 in the regulation of IFN-gamma signaling in neural cells. J Immunol.. 1996;157:51395144.[Abstract]
25. Beauchemin N, Kunath T, Robitaille J, Chow B, Turbide C, Daniels E, Veillette A. Association of biliary glycoprotein with protein tyrosine phosphatase SHP-1 in malignant colon epithelial cells. Oncogene.. 1997;14:783790.[Medline] [Order article via Infotrieve]
26.
You M, Zhao Z. Positive effects of SH2
domain-containing tyrosine phosphatase SHP-1 on epidermal growth
factor- and interferon-
-stimulated activation of STAT
transcription factors in HeLa cells. J Biol
Chem.. 1997;272:2337623381.
27. Epperson D, Arnold D, Spies T, Cresswell P, Pober J, Johnson D. Cytokines increase transporter in antigen processing-1 expression more rapidly than HLA class I expression in endothelial cells. J Immunol.. 1992;149:32973301.[Abstract]
28.
Ma W-L, Lehner P, Cresswell P, Pober J, Johnson D.
Interferon-
rapidly increases peptide transporter (TAP) subunit
expression and peptide transport capacity in
endothelial cells. J Biol Chem.. 1997;272:1658516590.
29.
Min W, Pober J, Johnson D. Kinetically-coordinated
induction of TAP1 and HLA class I by IFN-
: the rapid induction
of TAP1 by IFN-
is mediated by STAT1
. J Immunol.. 1996;156:31743183.[Abstract]
30.
Pine R, Canova A, Schindler C. Tyrosine
phosphorylated p91 binds to a single element in the
ISGF2/IRF-1 promoter to mediate induction by IFN
and IFN
,
and is likely to autoregulate the p91 gene. Eur Mol Biol Org
J.. 1994;13:158167.[Medline]
[Order article via Infotrieve]
31.
Johnson D, Pober J. HLA class I heavy chain gene
promoter elements mediating synergy between tumor necrosis factor and
interferons. Mol Cell Biol.. 1994;14:13221332.
32. Benjamin R, Madrigal J, Parham P. Peptide binding to empty HLA-B27 molecules of viable human cells. Nature.. 1991;351:7477.[Medline] [Order article via Infotrieve]
33. Pober J, Orosz C, Rose M, Savage C. Can graft endothelial cells initiate a host anti-graft immune response? Transplantation.. 1996;61:343349.[Medline] [Order article via Infotrieve]
34.
Ledebur H, Parks T. Transcriptional regulation of the
intercellular adhesion molecule-1 gene by inflammatory cytokine
in human endothelial cells. J Biol
Chem.. 1995;270:933943.
35.
Schreiber E, Matthias P, Müller M, Schaffner W.
Rapid detection of octamer binding proteins with `mini-extracts,'
prepared from a small number of cells. Nucleic Acids Res.. 1989;17:6419.
36. Dignam J, Martin P, Shastry B, Roeder R. Eukaryotic gene transcription with purified components. Methods Enzymol.. 1983;101:582598.[Medline] [Order article via Infotrieve]
37. White L, Wright K, Felix N, Ruffner H, Reis L, Pine R, Ting J. Regulation of LMP2 and TAP1 genes by IRF-1 explains the paucity of CD8+ T cells in IRF-1 -/- mice. Immunity.. 1996;5:365376.[Medline] [Order article via Infotrieve]
38.
John J, McKendry R, Pellegrini S, Flavell D, Kerr I,
Stark G. Isolation and characterization of a new mutant human cell line
unresponsive to alpha and beta interferons. Mol Cell Biol.. 1991;11:41894195.
39.
Improta T, Schindler C, Horvath C, Kerr I, Stark G,
Darnell J Jr. Transcription factor ISGF-3 formation requires
phosphorylated Stat91 protein, but Stat113 protein is
phosphorylated independently of Stat91 protein.
Proc Natl Acad Sci U S A.. 1994;91:47764780.
40.
Bluyssen H, Muzaffar R, Vlieststra R, van der
Made A, Leung S, Stark G, Kerr I, Trapman J, Levy D. Combinatorial
association and abundance of the components of interferon-stimulated
gene factor 3 dictate the selectivity of interferon responses.
Proc Natl Acad Sci U S A.. 1995;92:56455649.
41.
Darnell J Jr, Kerr I, Stark G. Jak-STAT pathways and
transcriptional activation in response to IFNs and other extracellular
signalling proteins. Science.. 1994;264:14151421.
42. Penninger J, Sirard C, Mittrücker H-W, Chidgey A, Kozieradzki I, Ngheim M, Hakem A, Kimura T, Timms E, Boyd R, Taniguchi T, Matsuyama T, Mak T. The interferon regulatory transcription factor IRF-1 controls the positive and negative selection of CD8+ thymocytes. Immunity.. 1997;7:243254.[Medline] [Order article via Infotrieve]
43.
Ghislain J, Fish E. Application of genomic DNA affinity
chromatography identifies multiple
interferon-
-regulated Stat2 complexes. J Biol
Chem.. 1996;21:1240812413.
44.
Li X, Leung S, Qureshi S, Darnell J Jr, Stark G.
Formation of STAT1-STAT2 heterodimers and their role in the activation
of IRF-1 gene transcription by interferon-
. J
Biol Chem.. 1996;271:57905794.
45.
David M, Grimley P, Finbloom D, Larner A. A nuclear
tyrosine phosphatase downregulates interferon-induced gene expression.
Mol Cell Biol.. 1993;13:75157521.
46.
Kozlowski M, Mlinaric R, Feng G, Shen R, Pawson T,
Siminovitch K. Expression and catalytic activity of the tyrosine
phosphatase PTP1C is severely impaired in motheaten and viable
motheaten mice. J Exp Med.. 1993;178:21572163.
This article has been cited by other articles:
![]() |
S. A. Gerber and J. S. Pober IFN-{alpha} Induces Transcription of Hypoxia-Inducible Factor-1{alpha} to Inhibit Proliferation of Human Endothelial Cells J. Immunol., July 15, 2008; 181(2): 1052 - 1062. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ungureanu, S. Vanhatupa, J. Gronholm, J. J. Palvimo, and O. Silvennoinen SUMO-1 conjugation selectively modulates STAT1-mediated gene responses Blood, July 1, 2005; 106(1): 224 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Marques, M. Brucet, J. Lloberas, and A. Celada STAT1 Regulates Lipopolysaccharide- and TNF-{alpha}-Dependent Expression of Transporter Associated with Antigen Processing 1 and Low Molecular Mass Polypeptide 2 Genes in Macrophages by Distinct Mechanisms J. Immunol., July 15, 2004; 173(2): 1103 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Sharif, I. Tassiulas, Y. Hu, I. Mecklenbrauker, A. Tarakhovsky, and L. B. Ivashkiv IFN-{alpha} Priming Results in a Gain of Proinflammatory Function by IL-10: Implications for Systemic Lupus Erythematosus Pathogenesis J. Immunol., May 15, 2004; 172(10): 6476 - 6481. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schroder, P. J. Hertzog, T. Ravasi, and D. A. Hume Interferon-{gamma}: an overview of signals, mechanisms and functions J. Leukoc. Biol., February 1, 2004; 75(2): 163 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mitola, M. Strasly, M. Prato, P. Ghia, and F. Bussolino IL-12 Regulates an Endothelial Cell-Lymphocyte Network: Effect on Metalloproteinase-9 Production J. Immunol., October 1, 2003; 171(7): 3725 - 3733. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Rendon-Mitchell, M. Ochani, J. Li, J. Han, H. Wang, H. Yang, S. Susarla, C. Czura, R. A. Mitchell, G. Chen, et al. IFN-{gamma} Induces High Mobility Group Box 1 Protein Release Partly Through a TNF-Dependent Mechanism J. Immunol., April 1, 2003; 170(7): 3890 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Johnson Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression J. Immunol., February 15, 2003; 170(4): 1894 - 1902. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Massa, S. L. Ropka, S. Saha, K. L. Fecenko, and K. L. Beuler Critical Role for Protein Tyrosine Phosphatase SHP-1 in Controlling Infection of Central Nervous System Glia and Demyelination by Theiler's Murine Encephalomyelitis Virus J. Virol., July 17, 2002; 76(16): 8335 - 8346. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mahboubi and J. S. Pober Activation of Signal Transducer and Activator of Transcription 1 (STAT1) Is Not Sufficient for the Induction of STAT1-dependent Genes in Endothelial Cells. COMPARISON OF INTERFERON-gamma AND ONCOSTATIN M J. Biol. Chem., March 1, 2002; 277(10): 8012 - 8021. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nishio, M. Tsurudome, M. Ito, M. Kawano, H. Komada, and Y. Ito High Resistance of Human Parainfluenza Type 2 Virus Protein-Expressing Cells to the Antiviral and Anti-Cell Proliferative Activities of Alpha/Beta Interferons: Cysteine-Rich V-Specific Domain Is Required for High Resistance to the Interferons J. Virol., October 1, 2001; 75(19): 9165 - 9176. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Arons, V. Kunin, C. Schechter, and R. Ehrlich Organization and Functional Analysis of the Mouse Transporter Associated with Antigen Processing 2 Promoter J. Immunol., March 15, 2001; 166(6): 3942 - 3951. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Cramer, S. L. Nelson, and M. J. Klemsz Synergistic Induction of the Tap-1 Gene by IFN-{gamma} and Lipopolysaccharide in Macrophages Is Regulated by STAT1 J. Immunol., September 15, 2000; 165(6): 3190 - 3197. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Weiden, N. Tanaka, Y. Qiao, B. Y. Zhao, Y. Honda, K. Nakata, A. Canova, D. E. Levy, W. N. Rom, and R. Pine Differentiation of Monocytes to Macrophages Switches the Mycobacterium tuberculosis Effect on HIV-1 Replication from Stimulation to Inhibition: Modulation of Interferon Response and CCAAT/Enhancer Binding Protein {beta} Expression J. Immunol., August 15, 2000; 165(4): 2028 - 2039. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |