Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1998;83:668-678

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Babij, P.
Right arrow Articles by Colatsky, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Babij, P.
Right arrow Articles by Colatsky, T. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
(Circulation Research. 1998;83:668-678.)
© 1998 American Heart Association, Inc.


Rapid Communications

Inhibition of Cardiac Delayed Rectifier K+ Current by Overexpression of the Long-QT Syndrome HERG G628S Mutation in Transgenic Mice

Philip Babij, G. Roger Askew, Bart Nieuwenhuijsen, Chien-Min Su, Terry R. Bridal, Brian Jow, Thomas M. Argentieri, John Kulik, Louis J. DeGennaro, Walter Spinelli, , Thomas J. Colatsky

From the Divisions of Molecular Genetics (P.B., G.R.A., B.N., J.K., L.J.D.G.) and Cardiovascular and Metabolic Diseases (C.-M.S., T.R.B., B.J., T.M.A., W.S., T.J.C.), Wyeth-Ayerst Research, Princeton, NJ.

Correspondence to Dr Thomas J. Colatsky, Wyeth-Ayerst Research, PO Box 42528, Philadelphia, PA 19101-2528. E-mail colatst{at}war.wyeth.com


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Mutations in the HERG gene are linked to the LQT2 form of the inherited long-QT syndrome. Transgenic mice were generated expressing high myocardial levels of a particularly severe form of LQT2-associated HERG mutation (G628S). Hearts from G628S mice appeared normal except for a modest enlargement seen only in females. Ventricular myocytes isolated from adult wild-type hearts consistently exhibited an inwardly rectifying E-4031–sensitive K+ current resembling the rapidly activating cardiac delayed rectifier K+ current (Ikr) in its time and voltage dependence; this current was not found in cells isolated from G628S mice. Action potential duration was significantly prolonged in single myocytes from G628S ventricle (cycle length=1 second, 26°C) but not in recordings from intact ventricular strips studied at more physiological rates and temperature (200 to 400 bpm, 37°C). ECG intervals, including QT duration, were unchanged, although minor aberrancies were noted in 20% (16/80) of the G628S mice studied, primarily involving the QRS complex and, more rarely, T-wave morphology. The aberrations were more commonly observed in females than males but could not be correlated with sex-based differences in action potential duration. These results establish the presence of IKr in the adult mouse ventricle and demonstrate the ability of the G628S mutation to exert a dominant negative effect on endogenous IKr in vivo, leading to the expected LQT2 phenotype of prolonged repolarization at the single cell level but not QT prolongation in the intact animal. The model may be useful in dissecting repolarization currents in the mouse heart and as a means of examining the mechanism(s) by which the G628S mutation exerts its dominant negative effect on native cardiac cells in vivo.


Key Words: long-QT syndrome • mice, transgenic • HERG • potassium channels • electrocardiography


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The inherited long-QT syndrome (LQTS) is an autosomal dominant disease associated with syncope and sudden death due to repolarization abnormalities and the onset of a rare but life-threatening polymorphic ventricular tachycardia known as torsade de pointes.1 Five human genetic loci linked to LQTS have been identified so far, and 4 of these encode specific ion channel subunits in the heart.2 3 4 5 6 7 8 9 The form of LQTS linked to chromosome 7 (LQT2) involves multiple mutations in the HERG gene encoding the rapidly activating cardiac delayed rectifier K+ current (IKr) channel.10 11 12 13 When studied in vitro, these mutations result in a spectrum of HERG channel dysfunction, including loss of function and dominant negative suppression of the HERG-associated current. The G628S mutation appears to have the most severe effect on IKr when coexpressed with wild-type (WT) HERG in Xenopus oocytes, with the presence of a single G628S subunit in a tetrameric channel rendering the entire channel nonfunctional.14 The HERG mutations and the resulting defect in repolarizing current are of particular interest, because an acquired form of LQTS can be induced by drugs that specifically block IKr.1 Both congenital and acquired forms of LQTS show a female preponderance15 16 17 18 that would not be expected in an autosomal dominant disease, suggesting the presence of modifying factors that can precipitate or prevent the appearance of QT prolongation and related arrhythmia. These factors have not been defined as yet.

Electrophysiological studies have demonstrated that IKr plays a dominant role in repolarizing the embryonic and neonatal mouse heart,19 20 21 but this current appears to be developmentally regulated and difficult to detect in the adult.22 However, mouse ERG (MERG) transcript is abundantly expressed in adult mouse atrium and ventricle, existing as 3 alternately processed isoforms that differ only in their NH2-terminal domains and share significant sequence homology with HERG.23 24 MERG1b (MERGB) is selectively expressed in the heart, whereas MERG1a (MERGA) has a wider tissue distribution. Human homologues of these isoforms have also been identified (HERGA, HERGB),24 and it has been suggested that native cardiac IKr current may be formed by the coassembly of the 2 subunits.23 All known mutations associated with LQT2 occur in regions common to both isoforms,3 11 14 although a preliminary report of mutations in nonconserved regions has recently been published.25

The mouse has become an important species for modeling cardiovascular disease.26 To determine whether the mouse heart might provide a useful model of human LQTS, we created transgenic mice expressing the HERG G628S mutation in the myocardium using a cardiac-specific promoter. These studies establish, for the first time, both the existence of an endogenous IKr in the adult mouse ventricle and the ability of the G628S mutation to exert a dominant negative effect on IKr in vivo. However, abolition of IKr did not lead to QT prolongation in intact animals but did increase action potential duration in single myocytes studied at slow rates and room temperature. Minor ECG abnormalities primarily involving the QRS complex were observed in some transgenic animals and appeared to distribute in a sex-specific manner.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Creation of Transgenic Mice
The full-length WT HERG sequence in pGH19 (a gift from Dr Gail Robertson, University of Wisconsin, Madison) was modified by using recombinant polymerase chain reaction (PCR) primer pairs to produce the G628S mutation containing a silent BstBI restriction site. An auxiliary 198-bp SV40 polyadenylation sequence tag was subcloned immediately 3' to the 427-bp HERG 3' UTR. The modified HERG cDNA was subcloned into pGEM11Z and completely sequenced in both directions. The DNA construct for microinjection into mouse embryos was created by subcloning the modified HERG coding sequence into pBluescript II, downstream of the 5.5-kb murine {alpha}-cardiac myosin heavy chain gene promoter (a gift from Dr Jeffrey Robbins, University of Cincinnati), which contains introns and the first 2 noncoding exons. The plasmid was altered to accommodate an extra polylinker sequence (SalI, ClaI, HindIII, NotI, SfiI, EagI, KpnI) inserted into the SalI-KpnI sites for subcloning of HERG. The {approx}9.6-kb transgene fragment was isolated by NotI digestion, gel-purified, further purified by cesium chloride density gradient centrifugation and dialyzed extensively against 5 mmol/L Tris (pH 7.4) and 0.1 mmol/L EDTA. The transgene was microinjected into the male pronucleus of fertilized FVB/N mouse embryos. Founder transgenic mice were identified by PCR and Southern blot analysis of genomic DNA isolated from tail clips. Founders were backcrossed to WT FVB/Ns to produce heterozygous F1 offspring that were used between 3 and 9 months of age for all studies. Nontransgenic littermates were used for isolated cell studies and pathology and WT FVB/N mice were used as controls for ECG recordings.

RNA and Protein Analysis
A 356-bp XmaI-NdeI fragment from the HERG 3'UTR was subcloned into pGEM5Z for riboprobe synthesis. Total RNA was isolated from WT and transgenic mouse hearts using Trizol (Gibco BRL), and 20 µg was taken for RNase protection analysis using 20 units of RNase T2. To study the effect of HERG on endogenous MERG expression, the 3' RACE technique was used to isolate MERG cDNA clones. Mouse heart poly A+ RNA (Clontech) was used as the starting material for 3' RACE (Gibco BRL protocol) with these HERG gene-specific primers: GCATCGACATGAACGCGGTGCT (outer) and CAGGCTGACATCTGCCT (inner). PCR products were cloned using the TA Cloning system (Invitrogen), and multiple cDNAs were sequenced in both directions. A 505-bp SacI-SalI fragment from the MERG cDNA containing part of the 3' coding and the entire 3' UTR was subcloned into pGEM3Z for riboprobe synthesis. Because this region is common to all known isoforms, we discuss these results in terms of changes in MERG expression, without differentiating between isoforms. Based on the DNA sequence identity between MERG and HERG in the 3' UTR, it was predicted that the 505-bp MERG probe would also protect a 164-bp HERG fragment. Hearts from 18-day fetal and 1- to 3-day neonatal mice were pooled from each group for RNA analysis.

To determine HERG protein expression in transgenic mouse hearts, we used a HERG polyclonal antibody (a gift from Dr Jeanne Nerbonne, Washington University, St. Louis, Mo) raised in rabbits against the carboxyl terminus peptide sequence between residues 1145 to 1159 (LTSQPLHRHGSDPGS). This peptide sequence is identical in humans and mice, and it is present in both MERG isoforms. The HERG antibody was used for immunohistochemical analysis on frozen heart sections using HRP- and FITC-conjugated secondary antibodies (Sigma). Expression of the K+ channel Kv2.1 was also analyzed using an anti-peptide antibody raised against the rat protein between residues 837 to 853.27 This antibody cross-reacts with the identical mouse epitope.

Pathology
WT (n=40) and transgenic (n=27) hearts were analyzed for morphological abnormalities using gross and microscopic end points. Body and heart wet weights were obtained, and the heart was dissected using a stereomicroscope. Wet weights were acquired for the right and left atria, the right ventricular free wall, and the combined left ventricle and septum. Tissues were immersed in neutral buffered 10% formalin, embedded in paraffin, sectioned at 6 µm, and stained for histological examination. Sections were evaluated independently by 2 pathologists.

Single Cell Studies
Single ventricular myocytes were isolated from adult mice of either sex. Animals were anaesthetized with Avertin (Aldrich Chemicals) 16 µL/g body weight diluted to 2.5% in sterile irrigation saline. After thoracotomy, hearts were rapidly excised and immersed in calcium-free Krebs-Henseleit buffer (KHB) at 4°C for aortic cannulation. Ventricular myocytes were enzymatically isolated using a modification of the Langendorff coronary perfusion procedure.28 Briefly, the cannulated heart was rinsed at 37°C with KHB for 5 minutes, followed by perfusion for 5 to 10 minutes with KHB containing 0.7 mg/mL collagenase (type I, Worthington), 60 to 80 µg/mL protease (type XIV, Sigma), and 0.1% BSA. Ventricles were dissected from the heart, cut longitudinally into 1- to 2-mm-thick strips and slowly agitated for 5 to 10 minutes at 37°C in 3 changes of KHB with concentrations of enzymes identical to those used in perfusion but with the addition of 1% BSA. After each incubation period, the supernatant fraction was drawn off and passed through a 200-µm-pore nylon mesh. The filtrate was briefly centrifuged and cell pellets resuspended in KHB with 100 µmol/L CaCl2, 0.5% BSA, and 10 mmol/L HEPES. Myocytes were used within 5 to 6 hours after isolation.

Current recordings were made using the whole-cell patch configuration at room temperature (25°C to 26°C). Myocytes were superfused with HEPES-buffered Tyrode's solution containing (mmol/L) NaCl 138, KCl 4, MgCl2 0.5, NaH2PO4 1.6, NaHCO3 5, CaCl2 2, dextrose 5.5, and HEPES 10. Recording electrodes were made of 1.0-or 1.5-mm OD borosilicate capillary glass and filled with the following internal solution (mmol/L): K-aspartate 110, KCl 20, HEPES 5, EGTA 5, MgCl2 · 6H2O 2, K2-ATP 5, phosphocreatine-Na2 5, and CaCl2 1; the solution was adjusted to pH 7.3 with 1 N KOH. Electrodes had resistances between 2 and 3.5 M{Omega}, as measured in bath solution. The zero reference potential was adjusted in the bath before forming seals. Recordings were performed with an Axon Instruments 200B amplifier interfaced to a DigiData 1200 data acquisition system (Axon Instruments). Signals were typically sampled at 1 kHz and corrected for stray capacitance but not series resistance, because the magnitude of the current being recorded was considered too small (<0.2 pA/pF) to introduce significant errors. Data acquisition and analysis were performed using pClamp v6.02 software (Axon Instruments). Currents were recorded in the presence of 1 µmol/L nisoldipine to block L-type Ca2+ current, and a holding potential of -40 mV was used to inactivate the rapid Na+ current. In some studies, currents were recorded in the presence of 2 mmol/L 4-AP and 4 mmol/L TEA-Cl to isolate delayed rectifier currents from other components of outward current. Membrane currents were elicited by applying 500- or 1000-ms depolarizations in 10-mV increments at 10-second intervals, up to +60 mV. All measurements were made at 100 ms after the step to reduce possible contamination from 4-AP–sensitive tail components. Action potentials were elicited by injection of brief current pulses at a cycle length of 1 second. Cells from which action potentials were recorded were quiescent at rest and yielded stable recordings for at least 15 minutes.

Intact Tissue Studies
Mice of either sex weighing between 20 and 30 grams were killed by CO2 inhalation and exsanguination. Their hearts were quickly removed and placed into cold (4°C) physiological salt solution of the following composition (mmol/L): NaCl 118.4, KCl 4.7, CaCl2 2.5, MgSO4 1.2, KH2PO4 1.2, NaHCO3 24.9, and D-glucose 11.1, gassed with 95% O2/5% CO2 to achieve a pH of 7.4. The atria were removed and the ventricle was opened by cutting along the left anterior descending artery tract. The ventricular preparation was pinned to the bottom of a silicone elastomer-lined (Sylgard 184, Dow Corning Corp) recording chamber exposing the left ventricular septum and free wall. Impalements were restricted to the area between the ventricular apex and the base of the posterior papillary muscle. The chamber was maintained at 37°C and continually superfused with physiological salt solution gassed with 95% CO2/5% O2. Tissues were paced with a 2- to 5-ms square pulse delivered by a bipolar silver electrode (1 Hz) at 2 times diastolic threshold. Preparations were allowed to equilibrate for 1 hour. Action potentials were recorded using glass microelectrodes that had tip resistances between 20 and 30 M{Omega} when filled with 3 mol/L KCl. Signals were amplified using an Axoclamp 2A amplifier in current clamp mode and monitored on a Tektronix 5111A oscilloscope. Action potentials were digitized (12-bit ADC, 0.1-ms sampling resolution) and analyzed on-line using a 486-based personal computer and custom software. Action potential was measured at 50%, 75%, and 90% of repolarization (APD50, APD75, and APD95, respectively, expressed in milliseconds).

Electrocardiography
Mice were anesthetized with ketamine (100 mg/kg) and xylazine (8 mg/kg) intraperitoneally and placed under a heating lamp to prevent loss of body heat. Body temperature was monitored continuously by a rectal probe, and the position of the heating lamp was adjusted to maintain a constant temperature (37°C). The body was placed in a recumbent position, and subcutaneous needle electrodes were inserted in the limbs for 6-lead ECG recording. The leads were connected to a Gould ECG amplifier, and serial ECGs from leads I, II, III, aVR, aVL, and aVF were recorded using a Gould 2400S chart recorder at a paper speed of 100 mm/s. All reported measurements were obtained from lead I. The remaining leads were used as a reference to validate the presence of abnormal ECG patterns observed on the lead I records. The QT interval was measured from the beginning of the QRS complex to the end of the T wave, defined as the point of return to the isoelectric baseline, similar to the convention used by Berul et al.29 To validate our recording conditions, animals were allowed to recover for 2 days, and the ECG recording was repeated. The results were consistent during the 2 days of study. Analysis was performed by 2 investigators unaware whether the records were obtained from WT or transgenic animals.

Drugs
E-4031 was synthesized as a free base and dissolved in DMSO (in vitro studies) or in 1 N HCl (in vivo studies). TEA-Cl and 4-AP were dissolved in water. Nisoldipine was a gift from Miles, Inc, and was dissolved in 70% ethanol. Stock solutions of these agents (10 mmol/L) were diluted in Tyrode's buffer to achieve the desired final bath concentration.

Statistical Analysis
Comparisons of heart weights and ECG parameters between WT and transgenic mice were performed using the unpaired Student t test. Action potential parameters from tissue and cell studies were analyzed by ANOVA using a nested factorial design. The factors considered were experimental intervention (transgene versus WT), sex, and animal, with the animal being the nested factor. The logarithmic transformation was used to stabilize the variance of the action potential data. Frequency data were analyzed using the {chi}2 test. Significance was set at P<0.05. Values are expressed as mean±SEM. In cases for which nonparametric tests were used, both median and mean population values are presented to facilitate comparisons with the published literature.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Expression of HERG mRNA and Protein
Six lines expressing HERG G628S mRNA were identified by RNase protection analysis on RNA isolated from transgenic mouse hearts. The level of expression between lines was variable and showed no correlation with transgene copy number. A representative blot is shown in Figure 1Down. Further mRNA analysis on multiple different tissues confirmed the heart-restricted activity of the {alpha}-cardiac myosin heavy chain promoter. Some expression was also detected in lung tissue and probably represents the pulmonary myocardium, where the promoter is also known to be active.30 The level of HERG expression determined by densitometric scanning of blots was estimated to be 1- to 10-fold greater than the level of expression of endogenous MERG. Overexpression of the HERG transgene in adult mouse heart did not appear to alter the level of endogenous MERG, as evidenced by a constant MERG/ß-actin ratio, which differed by less than 25% in hearts sampled at different stages of development. HERG G628S lines 18 and 48 (the former showing {approx}2- to 3-fold higher expression), expressed {approx}8- and 4-fold, respectively, more HERG than MERG mRNA and were selected for detailed study. Transmission of the transgene was not sex linked.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Coexpression of endogenous MERG and the HERG G628S transgene in transgenic mouse hearts. The MERG probe protects a 505-bp MERG fragment and also a 164-bp HERG fragment (HERG and MERG 3'UTR sequences possess a region of identity at the 3' end). MERG expression is shown in hearts from 18-day fetal (F), 1-day neonatal (N), 3-day neonatal (N), 5 adult WT, and 5 HERG G628S transgenic lines.

HERG antibody strongly reacted with HERG protein in transgenic mouse hearts from line 18 (Figure 2ADown). Similar results were obtained in hearts from transgenic line 48 (data not shown). Weaker staining was observed in WT heart sections, including vascular structures, and probably represents cross-reactivity of the HERG antibody with endogenous MERG. The pattern of staining, which includes intercalated disk structures, suggests that MERG is expressed uniformly across all regions of the mouse myocardium. Detailed analysis of the data suggests 2 patterns of HERG G628S protein expression: (1) a uniform distribution across ventricles and atria well beyond the endogenous level represented by reactivity to MERG and (2) the presence of small intense clusters of HERG G628S expression from apex to atria throughout the heart (Figure 2BDown). Expression of the HERG G628S protein was particularly prominent around nuclei (Figure 2CDown). Additional analysis showed that the HERG G628S protein did not colocalize with synaptophysin, ryanodine receptor, or tropomyosin antibodies (data not shown). The punctate pattern of HERG protein expression also differed significantly from that of the endogenous Kv2.1 K+ channel, which showed uniform membrane expression in ventricles and atria (Figure 2ADown).



View larger version (125K):
[in this window]
[in a new window]
 
Figure 2. HERG G628S protein expression in transgenic mouse hearts. A, Immunohistochemical analysis of HERG in frozen heart sections (x200 magnification) from WT (a, b, and c) and HERG G628S line 18 transgenic mice (d, e, and f). Sections show control without primary antibody (a and d), HERG antibody (b and e), and Kv2.1 antibody (c and f). Staining with HERG antibody shows cross-reactivity with endogenous MERG, which is expressed in heart, blood vessels, and other tissues (data not shown). B, HERG immunofluorescence shown in transgenic heart cross sections at different locations (x100 magnification). Control (a), apex (b), ventricular (c, d, and e), and atrial (f). Note areas of punctate staining. C, Prominent perinuclear HERG immunoreactivity in transgenic hearts (x400 and x1000 magnifications). Sections from WT (a and b) and transgenic (c, d, e, and f) mouse hearts. Panel f shows DAPI counterstain for nuclei. Note that perinuclear staining is absent in WT heart and is not associated with all nuclei in transgenic heart.

Pathology
Both gross and histopathological examination of transgenic mouse hearts indicated no overt structural abnormalities compared with WT controls. No significant inflammatory changes were noted within the heart, and there was no evidence of increased interstitial fibrosis. Body weights were similar in both WT and transgenic mice. However, the ratio of heart weight to body weight was significantly increased in female transgenic mice (6.2±0.2, n=10, line 18 G628S females; 6.1±0.4, n=5, line 48 G628S females) compared with WT females (4.7±0.2, n=15), with no differences observed between WT (5.7±0.2, n=25) and transgenic (5.4±0.1, n=12) males. The cell capacitance of isolated ventricular myocytes in both groups was unchanged, averaging 184±8 and 186±5 pF in WT males (n=72) and females (n=102), respectively, and 205±9 and 190±6 pF in transgenic males (n=39) and females (n=61), respectively.

ECG Measurements
Basic ECG intervals in G628S and WT mice were generally consistent with those reported in C57BL/6J mice.29 Data were pooled from lines 18 and 48, because a separate analysis did not show any significant difference in the results obtained in these 2 lines. For adult WT mice, the QT interval was 98.9±2.5 ms (n=23). The average sinus cycle length corresponded to a heart rate of 191 bpm (R-R interval=315±14 ms). Compared with age-matched WT controls, expression of the HERG G628S mutation produced no significant change in any ECG interval including the QT (89.5±3.5 ms) and R-R (286±16 ms) intervals (n=21). However, {approx}20% of the transgenic mice screened from lines 18 (10/54, 18.5%) and 48 (6/26, 23.1%) showed some form of irregularity, most frequently involving alterations in the QRS complex. The most common aberrations were accentuated negative Q or S waves and, less frequently, changes in the configuration of the T wave (ie, a negative deflection of the initial peak). No abnormality was observed in any of the 25 WT mice under similar study conditions. When the animals with ECG irregularities were analyzed according to sex, the abnormalities distributed preferentially to transgenic females (13/37, 35%), with relatively few seen in transgenic males (3/43, 7%) (P<0.01). Preliminary studies attempting to induce cardiac arrhythmias in G628S mice using programmed electrical stimulation yielded only infrequent and nonspecific responses, suggesting an absence of any proarrhythmic potential associated with overexpression of the HERG mutation (data not shown).

IKr Is Present in Adult WT Mice
In ventricular myocytes isolated from WT adult mice, a small delayed rectifier current was consistently observed that displayed gating properties similar to IKr in other species, including inward rectification at positive potentials and sensitivity to E-4031 (Figure 3ADown through 3C). Activation curves constructed using E-4031–sensitive tail currents were well fitted by a simple Boltzmann distribution with V1/2=4.2±0.7 mV and k=10.5±0.7 mV (n=27) (Figure 4ADown). Kinetic analysis of the difference tail currents revealed 2 components of deactivation with time constants of 127±8 and 1686±330 ms (n=17). E-4031 was a potent blocker of the current, with an IC50=59±6 nmol/L. However, block of the tail currents by E-4031 was incomplete, with a small outward component, representing {approx}25% of the total tail current amplitude, remaining even after exposure to the highest concentrations of E-4031 (10 µmol/L) and the presence of both TEA (4 mmol/L) and 4-AP (2 mmol/L) (Figure 4BDown). This residual component of outward tail current was blocked by 30 µmol/L azimilide (data not shown), suggesting it represents the slowly activating delayed rectifier K+ current, IKs. In a total of 90 cells from 13 WT hearts studied under control conditions, total tail current amplitudes averaged 45.6±2.1 pA and were normally distributed around the mean (Figure 5Down, open bars). Tail currents measuring >=30 pA were present in 87% of the preparations tested. Together with the immunofluorescence results, these data suggest a relatively uniform distribution of IKr and its corresponding channel protein within the murine ventricle.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Presence of IKr in WT adult mouse ventricular myocytes. Typical membrane current traces recorded in single ventricular myocytes obtained from WT adult mice before (A) and after (B) exposure to 1 µmol/L E-4031. The E-4031 difference currents were obtained by digitally subtracting the records obtained under each condition (C). Panels on the left show total membrane currents recorded at sufficient gain to capture peak outward current during the test depolarizations. Panels on the right are amplified to reveal the outward tail currents recorded on return to the holding potential. Abscissa values are expressed in milliseconds; ordinate values in pA.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Gating and pharmacology of E-4031–sensitive tail currents in adult WT mice. A, Voltage dependence of activation of IKr as measured by tail current amplitude in the presence of both 2 mmol/L 4-AP and 4 mmol/L TEA. Data points are calculated as the peak amplitude of the difference tail currents before and after exposure to 1 or 5 µmol/L E-4031 and fitted as a Boltzmann distribution. B, Concentration-response relationship for block of endogenous IKr by E-4031. These data were obtained in the presence of 4-AP and TEA to minimize the contribution of other outward currents to the tail current measurement. Block of the tail current is incomplete even at high concentrations, indicating the existence of additional TEA-, 4-AP-, and E-4031–insensitive components, such as IKs. The number in parenthesis above each symbol indicates the number of cells included in the mean at that concentration of drug. The residual tail currents recorded after exposure to 1 and 10 µm E-4301 were 11.3±2.0 (n=9) and 11.0±2.1 pA (n=3), respectively.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Frequency distribution of IKr tail current amplitudes on WT and G628S mice. Frequency at which each measured value occurred is plotted as a function of tail current amplitude. Open bars represent data from WT cells (n=90); solid bars represent observations from G628S transgenic myocytes (n=46). The smooth curve describing the WT data represents the normal distribution around the WT; the transgenic data are fitted by an exponential decay from the frequency value at zero tail current amplitude.

Role of IKr in Normal Ventricular Repolarization
Action potentials recorded from single WT ventricular myocytes showed considerable variability in both duration and waveform. Whereas most action potentials were spike-like and lacked a well-defined plateau phase, some cells exhibited a mildly prolonged low-voltage plateau or "bump" that slowly decayed toward the resting potential (Figure 6ADown). Measured values for action potential duration ranged widely regardless of the level of repolarization used for analysis. The amount of outward current recorded during the test depolarization also varied markedly from cell to cell (Figure 6ADown, insets).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Action potential waveforms in single ventricular myocytes isolated from WT and G628S mouse hearts. The traces illustrate the wide range of action potential durations and the amounts of outward current (insets) present in myocytes from WT (A) and G628S transgenic mice (B). Cells used in these studies had a regular shape and morphology, were quiescent, and tolerated current injection without developing automaticity. Recordings were generally stable for 15 to 20 minutes. Outward currents were elicited by 500-ms step depolarizations to various test potentials from a holding potential of -40 mV. Calibration bars (inset): 1 second, 2000 pA.

Histograms summarizing all measurements of APD50, APD75, and APD95 in WT mice are presented in Figure 7ADown. In contrast to the normal distribution found for IKr tail current amplitude, the distribution of action potential durations was positively skewed. It is not clear whether this result represents the inclusion of different cell types in the analysis (eg, Purkinje fibers or M cells) or a natural heterogeneity in repolarizing currents within the ventricular myocardium. Median action potential durations for the WT ventricle were 1.5, 3.6, and 30.9 (n=96) at APD50, APD75, and APD95, respectively, which can be compared with means of 2.1±0.2, 5.2±0.4, and 33.1±1.7 ms, respectively, calculated for the same population of cells assuming an underlying normal distribution. There was no significant difference in action potential duration between male and female WT mice at any level of repolarization.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 7. Frequency distribution of action potential durations recorded in WT and G628S mice. Frequency at which action potential durations measured at 50%, 75%, and 95% of total repolarization were observed in WT (A) and G628S mice (B). Distributions were not normally distributed but tended to show a positive skew. Data were separated into an equal number of bins (20) at each level of repolarization. In some instances, there appears to be more than one peak in the data, suggesting the possible presence of multiple cell populations. For WT cells, the mean (median) values for APD50, APD75, and APD95 were 2.1±0.2 (1.5), 5.2±0.4 (3.6), and 33.1±1.7 (33.9) ms, respectively. For G628S cells, the mean (median) values for APD50, APD75, and APD95 were 2.9±0.2 (2.3), 8.1±0.8 (5.8), and 49.4±3.0 (44.3) ms, respectively.

The addition of 5 µmol/L E-4031 to single WT ventricular cells produced relatively modest changes in action potential waveform. Action potential duration was prolonged by E-4031 at one or more levels of repolarization in 25 of 30 cells (83%) but was unchanged in the remainder. Overall, E-4031 increased median APD50, APD75, and APD95 values by 11.3%, 12.2%, and 9.5%, respectively (P>0.05 versus predrug, n=30). These data suggest that IKr plays a limited role in determining the repolarization time course in the adult murine ventricle. It should be noted, however, that the subpopulation of WT cells exposed to E-4031 differed somewhat from the total distribution of cells studied, tending to be shorter in duration at each level of repolarization. Specifically, 90% of the cells used in the E-4031 study had APD50, APD75, and APD95 values <2.5, 8, and 48 ms, respectively, whereas the corresponding 90% cutoff values for APD50, APD75, and APD95 in the more general WT population were 4, 12, and 58 ms, respectively. Correspondingly, the amount of E-4031–sensitive tail current in this group of cells (22.6.±2.6 pA, n=28) was much smaller than expected from other experimental analyses of maximal IKr amplitude in the present study, eg, the concentration-response curve (36.3 pA) and the determination of the activation curve (36.0 pA). Given that maximal tail current amplitude before E-4031 exposure (47.0±3.2 pA, n=30) was comparable to that measured in the more general WT myocyte population (45.6±2.1 pA, n=90), these results suggest that IKr constituted a smaller fraction of total repolarizing current in the subgroup of WT cells used in the action potential experiment. The relatively modest effects of E-4031 on repolarization time course in this subgroup therefore does not necessarily preclude the possibility of a greater contribution of IKr to repolarization time course in different myocardial cell types and/or regions of the ventricle.

IKr Is Abolished in Adult Transgenic Mouse Ventricular Myocytes
Tail currents in ventricular myocytes from HERG G628S transgenic mice were typically much smaller than those observed in cells from WT animals under similar conditions. A representative tracing is shown in Figure 8Down. Overall, mean tail current amplitude in G628S myocytes (13.9±3.3 pA, n=46) was only 30% of that recorded in WT controls, which is similar to the amount of E-4031–insensitive current seen in WT cells (Figure 4Up). Tail currents measuring >=30 pA were present in only 11% of the preparations tested. The small tail currents recorded in G628S cells were insensitive to E-4031, 4-AP, and TEA, suggesting that they represented deactivation of IKs. The difference in the average tail current amplitude between WT and G628S myocytes (31.7 pA) is comparable to the amount of E-4031–sensitive tail current in WT cells in other experiments ({approx}36 pA), consistent with the conclusion that overexpression of the HERG G628S mutation effectively abolishes endogenous IKr in the mouse ventricle, presumably through a dominant negative action on the native channel protein.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 8. Functional block of IKr in isolated ventricular myocytes from HERG G628S transgenic mouse hearts. Representative traces from a patch-clamp experiment in a single ventricular myocyte isolated from a G628S mouse heart. The left panel shows total membrane current recorded at sufficient gain to capture the peak outward current during the test depolarization. The traces in the right panel are amplified to show more clearly the outward tail currents recorded on return to the holding potential. These results should be compared with the traces in Figure 3Up.

No data were obtained indicating that compensatory changes in other outward currents had occurred. However, exposure to TEA and 4-AP did not significantly alter tail current amplitude in G628S cells (13.9±3.3 pA, n=46 versus 17.8±2.3 pA, n=22), despite producing a significant 21.9% reduction in WT myocytes (45.6±2.1 pA, n=90 versus 35.6±1.6 pA, n=65). This result may suggest a possible decrease in 4-AP/TEA–sensitive outward current in G628S ventricular cells.

Prolongation of Action Potential Duration in G628S Mice
In single ventricular myocytes isolated from G628S mice of either sex (n=73), median action potential duration was significantly prolonged by 50%, 61%, and 43% at APD50, APD75, and APD95, respectively, when compared with WT controls (n=96). No within-group sex-based differences were noted in action potential duration between WT or transgenic males and females. Representative traces of action potentials from G628S mice are shown in Figure 6BUp. As in the case of the WT animals, there was considerable variability in the amount of outward current during the test pulse (Figure 6BUp, insets). The distribution of measured action potential durations was positively skewed and perhaps somewhat broader than in the WT population (Figure 7BUp).

Action potentials recorded using sharp microelectrodes in intact ventricular tissue from G628S and WT mice did not differ significantly in any of the parameters measured. No sex-based differences in action potential duration, maximal upstroke velocity, or maximum diastolic potential were observed in either WT or transgenic populations at any cycle length tested. These data are summarized in the TableDown.


View this table:
[in this window]
[in a new window]
 
Table 1. Action Potential Parameters in Intact Adult Mouse Ventricle


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
These studies clearly establish the presence of an E-4031–sensitive delayed rectifier current in adult mouse ventricular myocytes. They also demonstrate for the first time that expression of the HERG G628S mutation in transgenic mouse hearts can result in the dominant negative suppression of IKr in vivo. However, overexpression of the G628S HERG mutation did not generate either the arrhythmias or ECG abnormalities typically found in LQT2, although single cell action potential duration was prolonged.

The recording of IKr in adult mouse cardiac myocytes contrasts with previous reports that this current is developmentally regulated and present only in fetal and neonatal murine preparations.21 22 IKr-like currents were identified in nearly all cells studied, consistent with our finding that MERG protein is uniformly expressed across the murine ventricle. The gating properties and pharmacology of mouse IKr are similar to those in other species. The current is extremely sensitive to E-4031 (IC50=59 nmol/L) and is half maximally activated at +4 mV. The voltage dependence of activation is similar to that previously reported for IKr in AT-1 cells,31 HERG/minK current expressed in oocytes,32 and ventricular myocytes from cat,33 rabbit,34 and neonatal mouse21 but more positive than the IKr activation curves found in guinea pig ventricle,35 fetal mouse ventricular cells,19 human cardiomyocytes,36 37 or MERGB current.24 Because the analysis in the present study was performed using E-4031–sensitive difference currents, the more positive location of the IKr activation curve cannot be explained by contamination with overlapping currents such as IKs, which is also present in this preparation, but rather may reflect real species and/or developmental differences in the subunit composition of the native channel. The decay of the E-4031–sensitive tail current was biexponential, with time constants on the order of 80 to 200 ms and 600 to 2500 ms at a holding potential of -40 mV. This is in the same range as reported for the IKr tails in fetal mouse ventricle19 and AT-1 cells.31 It has been demonstrated23 that MERG1b, either alone or coassembled with MERG1a, can produce tail currents in oocytes that deactivate with kinetics similar to AT-1 cells.

IKr current density in WT mouse ventricle ({approx}0.25 pA/pF) is similar to that measured in adult ventricular cells of other species, including cat (0.7 pA/pF),33 dog (0.2 pA/pF),38 guinea pig (0.7 pA/pF),35 and human (0.4 pA/pF)37 but considerably smaller than the current densities reported in fetal mouse ventricle and AT-1 cells (>=2.5 pA/pF).22 31 The apparent reduction in IKr density from fetal to adult mouse is not consistent with a dramatic downregulation of channel protein when differences in cell size are taken into account, because absolute current magnitude shows at most a 2-fold increase whereas membrane capacitance increases more than 6-fold.21 This suggests that nearly the same amount of channel protein is generated in both fetal and adult tissue but is incorporated into a larger amount of cell membrane in the adult. This conclusion is also supported by our observation that the amount of MERG message remains fairly constant relative to the molecular marker ß-actin in 18-day fetal and 1- to 3-day neonatal and adult myocytes. Davies et al20 similarly concluded that the expression levels of IKr remain the same in the mouse heart from early (11 to 13 days postcoitum) to late (17 to 20 days postcoitum) embryonic development and that apparent differences in E-403–sensitive current magnitude disappeared when normalized to cell capacitance. In the adult, a 6-fold increase in total amount of membrane containing even a relatively constant number of channels would be expected to confound 3H-dofetilide binding studies, given the high degree of nonspecific binding ({approx}50%) present in this assay.22

There were 2 apparent discrepancies in the results obtained in the present study. First, action potential duration was significantly and markedly prolonged in single G628S myocytes but unchanged in intact ventricular strips, and no QT prolongation was seen in vivo. Second, we found that exposure of single myocytes to high concentrations of E-0431 prolonged action potential duration much less than would be expected given the data in G628S cells. The loss of an effect on ventricular repolarization in intact tissue and in vivo might be explained by a minimal role of IKr relative to other repolarization currents at more rapid heart rates, resembling the so-called reverse use-dependent effect of specific IKr blockers, compounded by the effects of temperature on channel gating. We did not test this hypothesis by recording action potentials in single cells at higher temperatures and faster rates, because the nonphysiological conditions used (25°C, 1-Hz pacing) were considered necessary for cell stability. The syncytial nature of the ventricular wall may further attenuate the prolongation that was seen at the single cell level.

It is more difficult to explain the relative lack of an E-4031 effect in WT cells. In principle, blocking IKr using E-4031 should be equivalent in its effects on the action potential to the dominant negative suppression of MERG channel assembly by the G628S mutation. However, the WT myocytes used in the E-4031 study may not have been a completely representative sample, because they appeared to have shorter action potentials at baseline and relatively less IKr as a fraction of their total tail current than the more general population studied. It is also possible that the pharmacological effects of E-4031 were reduced under the conditions of the study, with block either occurring too slowly during the brief action potential or recovering too completely during the intervening diastolic interval to alter the repolarization time course. However, we view this explanation as unlikely given the reported use- and state-dependent properties of E-4031 and other class III antiarrhythmics. Alternatively, the overexpression of the G628S mutation may have somehow resulted in the loss of other repolarizing currents, leading to a greater prolongation of action potential duration. Possible compensatory changes in other ion channel proteins were not rigorously followed, except for MERG and Kv2.1, which did not appear to change. There was also no dramatic change in the magnitude of the TEA/4AP-insensitive (ie, azimilide-sensitive) tail current. We did, however, find little or no TEA/4AP-sensitive tail current in the G628S cells, but this result is difficult to interpret, because the data were obtained using protocols that minimized the contribution of currents other than IKr. Given the natural and wide-ranging variability observed in both the duration of the repolarization phase and the amount of outward current present in each cell, it is difficult to exclude the possibility that some cell types or regions of the heart are more sensitive to this type of genetic perturbation or that compensatory changes in TEA- and/or 4AP-sensitive currents did in fact occur. The possibility of coordinate changes merits additional detailed study.

The in vivo suppression of endogenous IKr by the cardiac-specific expression of the HERG G628S mutation supports the view that the human mutation functions in a dominant negative manner. Recently, the mechanism of action of a {Delta}1261 HERG mutation was shown to occur via a subunit interaction domain of 135 amino acids located at the N-terminal region of the protein.39 This region appears to be important for tetramer formation. The significance of the apparent clustering of HERG G628S protein expression in the transgenic mouse heart is unclear, but it may reflect an accumulation of mutant protein assemblies in subcellular organelles during processing, as recently reported for the trapping of heteromultimeric complexes involving a truncated Kv1.1 polypeptide.40

Clinical Relevance
The cardiac-specific overexpression of the G628S mutation failed to produce a murine model of LQTS. These results differ from the phenotype obtained in transgenic mice generated by the expression of a truncated Kv1.1 polypeptide in the heart,41 which affects the assembly of the large, slowly inactivating 4-AP–sensitive outward current and results in more severe electrophysiological consequences than seen with the selective inhibition of IKr, including the generation of spontaneous arrhythmias. In the mouse and rat, repolarization is dominated by a large inactivating outward current that typically plays a more limited role in higher species. Because the balance of ionic currents underlying the murine ventricular action potential differs so dramatically from that in human ventricle, the mouse is likely to have only limited utility as an electrophysiological model of human cardiac disease. However, it may hold considerable value for dissecting repolarization currents in the mouse heart and as a means of examining the mechanism(s) by which the G628S mutation exerts its dominant negative effect on native cardiac cells in vivo.

The ECG changes seen predominantly in female transgenic mice, although minor, are suggestive of an abnormal pattern of ventricular conduction and unexpected, on the basis of our current understanding of the LQTS and the role of IKr in ventricular electrogenesis. To date, there have been no reports of aberrant QRS complexes in any form of LQTS, including LQT3, which derives from a series of specific mutations in the SCN5a gene underlying the excitatory cardiac Na+ channel.11 Similarly, as a class, drugs that specifically block IKr, eg, dofetilide and E-4031, have no effect on intracardiac conduction or QRS morphology.42 There is one isolated anecdotal report of aberrant conduction in a patient with atrial fibrillation treated with dofetilide in whom right atrial pacing induced critical retrograde conduction delays that were associated with a large difference in refractoriness between the right bundle branch and right ventricular myocardium,43 44 but this appears to be a unique incident. Autopsies of patients with LQTS suggest the occurrence of subendocardial fibrosis and possible derangements in the His-Purkinje system.45 46 47 However, there was no evidence of such histopathological changes in the present study; hearts appeared to be completely normal, apart from a statistically significant and sex-specific increase in heart weight in female transgenic animals. At the present time, minor alterations in the pathway for ventricular excitation secondary to an increase in heart weight appears to be the most likely explanation for the observed ECG aberrancies.

Limitations of the Study
The primary focus of the current set of experiments was to characterize the effects of overexpressing the human G628S mutation on endogenous IKr in the mouse ventricle and to determine whether this resulted in a model of LQT2. Although some attempt was made to determine whether compensatory changes in electrophysiology or cardiac structure might have occurred, a rigorous analysis of these effects was beyond the scope of the initial experiments.

The reason for the increased heart weight in transgenic females remains unclear and may have little or no physiological relevance. Although expression of the myosin heavy chain is known to be regulated at the transcriptional level by thyroid30 and steroid48 49 hormones, no sex-specific increases in heart weight have been noted in other transgenic models that used the {alpha}-myosin heavy chain promoter to achieve cardiac-specific protein expression (J. Robbins, PhD, oral communication, April 1998). There are no data suggesting that overexpression of the HERG G628S mutation would induce cardiac hypertrophy or hyperplasia nor has cardiac enlargement been reported in any of the clinical manifestations of LQTS. It will be important to confirm the current findings and to identify a possible molecular basis for the changes.


*    Acknowledgments
 
We thank Dr Gail Robertson for the HERG cDNA, Dr Jeffrey Robbins for the cardiac myosin heavy chain cDNA, Dr Jeanne Nerbonne for HERG antibodies, and Dr Brad Bolon for assistance with pathology.

Received May 20, 1998; accepted August 3, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Roden DM, Lazzara R, Rosen M, Schwartz PJ, Towbin J, Vincent GM. Multiple mechanisms in the long QT syndrome. Circulation. 1996;94:1996–2012.[Abstract/Free Full Text]

2. Jiang C, Atkinson D, Towbin JA, Splawski I, Lehmann MH, Li H, Timothy K, Taggart RT, Schwartz PJ, Vincent GM, Moss AJ, Keating MT. Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity. Nat Genet. 1994;8:141–147.[Medline] [Order article via Infotrieve]

3. Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell. 1995;80:795–803.[Medline] [Order article via Infotrieve]

4. Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson JL, Moss AJ, Towbin JA, Keating MT. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell. 1995;80:805–811.[Medline] [Order article via Infotrieve]

5. Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:17–23.[Medline] [Order article via Infotrieve]

6. Benson DW, MacRae CA, Vesely MR, Walsh EP, Seidman JG, Seidman CE, Satler CA. Missense mutation in the pore region of HERG causes familial long QT syndrome. Circulation. 1996;93:1791–1795.[Abstract/Free Full Text]

7. Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta K, Haneda N, Nakano O, Shibata A, Sawayama T, Kasai H, Yazaki Y, Nakamura Y. Four novel KVLQT1 and four novel HERG mutations in familial long QT syndrome. Circulation. 1997;95:565–567.[Abstract/Free Full Text]

8. Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet. 1997;17:338–340.[Medline] [Order article via Infotrieve]

9. Duggal P, Vesely MR, Wattanasirichaigoon D, Villafane J, Kaushik V, Beggs AH. Mutation of the gene for IsK associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long QT syndrome. Circulation. 1998;97:142–146.[Abstract/Free Full Text]

10. Warmke JW, Ganetzky B. A family of potassium channel genes related to eag in Drosophila and mammals. Proc Natl Acad Sci U S A. 1994;91:3438–3442.[Abstract/Free Full Text]

11. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell. 1995;81:299–307.[Medline] [Order article via Infotrieve]

12. Trudeau MC, Warmke JW, Ganetsky B, Robertson GA. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science. 1995;269:92–95.[Abstract/Free Full Text]

13. Smith PL, Baukrowitz T, Yellen G. The inward rectification mechanism of the HERG cardiac potassium channel. Nature. 1996;379:833–836.[Medline] [Order article via Infotrieve]

14. Sanguinetti MC, Curran ME, Spector PS, Keating MT. Spectrum of HERG K+-channel dysfunction in an inherited cardiac arrhythmia. Proc Natl Acad Sci U S A.. 1996;93:2208–2212.[Abstract/Free Full Text]

15. Makkar RR, Fromm BS, Steinman RT, Meissner MD, Lehmann MH. Female gender as a risk factor for torsades de pointes associated with cardiovascular drugs. JAMA. 1993;270:2590–2597.[Abstract/Free Full Text]

16. Lehmann MH, Timothy KW, Frankovich D, Fromm BS, Keating M, Locati EH, Taggart RT, Towbin JA, Moss AJ, Schwartz PJ, Vincent GM. Age-gender influence on the rate-corrected QT interval and the QT-heart rate relation in families with genotypically characterized long QT syndrome. J Am Coll Cardiol. 1997;29:93–99.[Abstract]

17. Lehmann MH, Hardy S, Archibald D, Quart B, MacNeil DJ. Sex difference in risk of torsade de pointes with d,l-sotalol. Circulation. 1996;94:2535–2541.[Abstract/Free Full Text]

18. Locati EH, Zareba W, Moss AJ, Schwartz PJ, Vincent GM, Lehmann MH, Towbin JA, Priori SG, Napolitano C, Robinson JL, Andrews M, Timothy K, Hall WJ. Age- and sex-related differences in clinical manifestations in patients with congenital long-QT syndrome: findings from the International LQTS Registry. Circulation. 1998;97:2237–2244.[Abstract/Free Full Text]

19. Wang L, Duff HJ. Identification and characteristics of delayed rectifier K+ current in fetal mouse ventricular myocytes. Am J Physiol. 1996;270:H2088–H2093.[Abstract/Free Full Text]

20. Davies MP, An RH, Doevendans P, Kubalak S, Chien KR, Kass RS. Developmental changes in ionic channel activity in the embryonic murine heart. Circ Res. 1996;78:15–25.[Abstract/Free Full Text]

21. Nuss HB, Marban E. Electrophysiological properties of neonatal mouse cardiac myocytes in primary culture. J Physiol (Lond). 1994;479:265–279.[Abstract/Free Full Text]

22. Wang L, Feng Z-P, Kondo CS, Sheldon RS, Duff HJ. Developmental changes in the delayed rectifier K+ channels in mouse heart. Circ Res. 1996;79:79–85.[Abstract/Free Full Text]

23. London B, Trudeau MC, Newton KP, Beyer AK, Copeland NG, Gilbert DJ, Jenkins NA, Satler CA, Robertson GA. Two isoforms of the mouse ether-a-go-go-related gene coassemble to form channels with properties similar to the rapidly activating component of the cardiac delayed rectifier K+ current. Circ Res. 1997;81:870–878.[Abstract/Free Full Text]

24. Lees-Miller JP, Kondo C, Wang L, Duff HJ. Electrophysiological characterization of an alternatively processed ERG K+ channel in mouse and human hearts. Circ Res. 1997;81:719–726.[Abstract/Free Full Text]

25. Vesely MR, Duggal P, London B, Wattanasirichaigoon D, Beggs AH. Complete analysis of the HERG gene for mutations in long QT syndrome [abstract]. Circulation. 1997;96:I-56.

26. James JF, Hewett TE, Robbins J. Cardiac physiology in transgenic mice. Circ Res. 1998;82:407–415.[Abstract/Free Full Text]

27. Trimmer JS. Immunological identification and characterization of a delayed rectifier K+ channel polypeptide in rat brain. Proc Natl Acad Sci U S A.. 1991;88:10764–10768.[Abstract/Free Full Text]

28. Powell T. Methods for the preparation and characterization of cardiac myocytes. In: Dhalla NS, ed. Methods in Studying Cardiac Membranes. Vol 1. Boca Raton, Fla: CRC Press; 1984:41–62.

29. Berul CI, Aronovitz MJ, Wang PJ, Medelsohn ME. In vivo cardiac electrophysiology studies in the mouse. Circulation. 1996;94:2641–2648.[Abstract/Free Full Text]

30. Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J, Robbins J. Tissue-specific regulation of the {alpha}-myosin heavy chain gene promoter in transgenic mice. J Biol Chem. 1991;266:24613–24620.[Abstract/Free Full Text]

31. Yang T, Wathen MS, Felipe A, Tamkun MM, Snyders DJ, Roden DM. K+ currents and K+ channel mRNA in cultured atrial cardiac myocytes (AT-1 cells). Circ Res. 1994;75:870–878.[Abstract/Free Full Text]

32. McDonald TV, Yu Z, Ming Z, Palma E, Meyers MB, Wang K-W, Goldstein SAN, Fishman GI. A minK-HERG complex regulates the cardiac potassium current IKr. Nature. 1997;388:289–292.[Medline] [Order article via Infotrieve]

33. Follmer CH, Cullinan CA, Colatsky TJ. Differential block of cardiac delayed rectifier current by class Ic antiarrhythmic drugs: evidence for open channel block and unblock. Cardiovasc Res. 1992;26:1121–1130.[Abstract/Free Full Text]

34. Clay JR, Ogbaghebriel A, Paquette T, Sasyniuk BI, Shrier A. A quantitative description of the E-4031-sensitive repolarization current in rabbit ventricular myocytes. Biophys J. 1995;69:1830–1837.[Medline] [Order article via Infotrieve]

35. Sanguinetti MC, Jurkiewicz NK. Two components of cardiac delayed rectifier K+ current. J Gen Physiol. 1990;96:195–215.[Abstract/Free Full Text]

36. Veldkamp MW, van Ginneken ACG, Opthof T, Bouman LN. Delayed rectifier channels in human ventricular myocytes. Circulation. 1995;92:3497–3504.[Abstract/Free Full Text]

37. Li G-R, Feng J, Yue L, Carrier M, Nattel S. Evidence for two components of delayed rectifier K+ current in human ventricular myocytes. Circ Res. 1996;78:689–696.[Abstract/Free Full Text]

38. Gintant GA. Two components of delayed rectifier current in canine atrium and ventricle. Does IKs play a role in the reverse rate of dependence of class III agents? Circ Res. 1996;78:26–37.[Abstract/Free Full Text]

39. Li X, Xu J, Li M. The human {Delta}1261 mutation of the HERG potassium channel results in a truncated protein that contains a subunit interaction domain and decreases the channel expression. J Biol Chem. 1997;272:705–708.[Abstract/Free Full Text]

40. Folco E, Mathur R, Mori Y, Buckett P, Koren G. A cellular model for long QT syndrome. J Biol Chem. 1997;272:26505–26510.[Abstract/Free Full Text]

41. London B, Jeron A, Zhous J, Buckett P, Han X, Mitchell GF, Koren G. Long QT and ventricular arrhythmias in transgenic mice expressing the N terminus and first transmembrane segment of a voltage-gated potassium channel. Proc Natl Acad Sci U S A. 1998;95:2926–2931.[Abstract/Free Full Text]

42. Colatsky TJ, Hamilton TC. Potassium channel modulators: clinical experience and future prospects. In: Evans JM, Hamilton TC, Longman SD, Stemp G, eds. Potassium Channels and Their Modulators: From Synthesis to Clinical Experience. London, England: Taylor & Francis; 1996:383–411.

43. Crijns HJGM, Kingma H, Gosselink ATM, Lie KI. Comparison in the same patient of aberrant conduction and bundle branch reentry after dofetilide, a new selective class III antiarrhythmic agent. PACE Pacing Clin Electrophysiol. 1993;16:1006–1016.[Medline] [Order article via Infotrieve]

44. Crijns HJGM, Kingma JH, Gosselink ATM, Dalrymple HW, DeLangen CDJ, Lie K. Sequential bilateral bundle branch block during dofetilide, a new class III antiarrhythmic agent in a patient with atrial fibrillation. J Cardiovasc Electrophysiol. 1993;4:459–466.[Medline] [Order article via Infotrieve]

45. Hashiba K. Hereditary QT prolongation syndrome in Japan: genetic analysis and pathological findings of the conduction system. Jpn Circ J. 1978;42:1133–1150.[Medline] [Order article via Infotrieve]

46. Phillips J, Ichinose H. Clinical and pathologic studies in the hereditary syndrome of a long QT interval, syncopal spells and sudden death. Chest. 1970;58:236–243.[Abstract/Free Full Text]

47. Fraser GR, Froggatt P, James TN. Congenital deafness associated with electrocardiographic abnormalities, fainting attacks and sudden death. A recessive syndrome. Q J Med. 1964;33:361–385.[Free Full Text]

48. Morano I, Gerstner J, Ruegg JC, Ganten U, Ganten D, Vosberg HP. Regulation of myosin heavy chain expression in the hearts of hypertensive rats by testosterone. Circ Res. 1990;66:1585–1590.[Abstract/Free Full Text]

49. Calovini T, Haase H, Morano I. Steroid-hormone regulation of myosin subunit expression in smooth and cardiac muscle. J Cell Biochem. 1995;59:69–78.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
FASEB J.Home page
T. K. Roepke, A. Kontogeorgis, C. Ovanez, X. Xu, J. B. Young, K. Purtell, P. A. Goldstein, D. J. Christini, N. S. Peters, F. G. Akar, et al.
Targeted deletion of kcne2 impairs ventricular repolarization via disruption of IK,slow1 and Ito,f
FASEB J, October 1, 2008; 22(10): 3648 - 3660.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Arnaout, T. Ferrer, J. Huisken, K. Spitzer, D. Y. R. Stainier, M. Tristani-Firouzi, and N. C. Chi
Zebrafish model for human long QT syndrome
PNAS, July 3, 2007; 104(27): 11316 - 11321.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Salama and B. London
Mouse models of long QT syndrome
J. Physiol., January 1, 2007; 578(1): 43 - 53.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Thomas, M. J. Killeen, I. S. Gurung, P. Hakim, R. Balasubramaniam, C. A. Goddard, A. A. Grace, and C. L.-H. Huang
Mechanisms of ventricular arrhythmogenesis in mice following targeted disruption of KCNE1 modelling long QT syndrome 5
J. Physiol., January 1, 2007; 578(1): 99 - 114.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. J. Milan and C. A. MacRae
Animal models for arrhythmias
Cardiovasc Res, August 15, 2005; 67(3): 426 - 437.
[Abstract] [Full Text] [PDF]


Home page
EuropaceHome page
J. V. Tranquillo, J. Hlavacek, and C. S. Henriquez
An integrative model of mouse cardiac electrophysiology from cell to torso
Europace, January 1, 2005; 7(s2): S56 - S70.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Brouillette, R. B. Clark, W. R. Giles, and C. Fiset
Functional properties of K+ currents in adult mouse ventricular myocytes
J. Physiol., September 15, 2004; 559(3): 777 - 798.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. B. Clark, M. E. Mangoni, A. Lueger, B. Couette, J. Nargeot, and W. R. Giles
A rapidly activating delayed rectifier K+ current regulates pacemaker activity in adult mouse sinoatrial node cells
Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1757 - H1766.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. X. Liu, J. Zhou, S. Nattel, and G. Koren
Single-channel recordings of a rapid delayed rectifier current in adult mouse ventricular myocytes: basic properties and effects of divalent cations
J. Physiol., April 15, 2004; 556(2): 401 - 413.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Kodirov, M. Brunner, J. M. Nerbonne, P. Buckett, G. F. Mitchell, and G. Koren
Attenuation of IK,slow1 and IK,slow2 in Kv1/Kv2DN mice prolongs APD and QT intervals but does not suppress spontaneous or inducible arrhythmias
Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H368 - H374.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H.-S. Cho, M. Takano, and A. Noma
The electrophysiological properties of spontaneously beating pacemaker cells isolated from mouse sinoatrial node
J. Physiol., July 1, 2003; 550(1): 169 - 180.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. P. Lees-Miller, J. Guo, J. R. Somers, D. E. Roach, R. S. Sheldon, D. E. Rancourt, and H. J. Duff
Selective Knockout of Mouse ERG1 B Potassium Channel Eliminates IKr in Adult Ventricular Myocytes and Elicits Episodes of Abrupt Sinus Bradycardia
Mol. Cell. Biol., March 15, 2003; 23(6): 1856 - 1862.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Zhou, S. Kodirov, M. Murata, P. D. Buckett, J. M. Nerbonne, and G. Koren
Regional upregulation of Kv2.1-encoded current, IK,slow2, in Kv1DN mice is abolished by crossbreeding with Kv2DN mice
Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H491 - H500.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Danik, C. Cabo, C. Chiello, S. Kang, A. L. Wit, and J. Coromilas
Correlation of repolarization of ventricular monophasic action potential with ECG in the murine heart
Am J Physiol Heart Circ Physiol, July 1, 2002; 283(1): H372 - H381.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. M. Nerbonne, C. G. Nichols, T. L. Schwarz, and D. Escande
Genetic Manipulation of Cardiac K+ Channel Function in Mice: What Have We Learned, and Where Do We Go From Here?
Circ. Res., November 23, 2001; 89(11): 944 - 956.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Demolombe, G. Lande, F. Charpentier, M. A van Roon, M. J.B van den Hoff, G. Toumaniantz, I. Baro, G. Guihard, N. Le Berre, A. Corbier, et al.
Transgenic mice overexpressing human KvLQT1 dominant-negative isoform Part I: Phenotypic characterisation
Cardiovasc Res, May 1, 2001; 50(2): 314 - 327.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Lande, S. Demolombe, A. Bammert, A. Moorman, F. Charpentier, and D. Escande
Transgenic mice overexpressing human KvLQT1 dominant-negative isoform Part II: Pharmacological profile
Cardiovasc Res, May 1, 2001; 50(2): 328 - 334.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
U. C. Hoppe, E. Marban, and D. C. Johns
Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1
PNAS, April 24, 2001; 98(9): 5335 - 5340.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan
Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities
Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. P. Thomas, L. Bircher-Lehmann, S. A. Thomas, J. Zhuang, J. E. Saffitz, and A. G. Kleber
Synthetic Strands of Neonatal Mouse Cardiac Myocytes : Structural and Electrophysiological Properties
Circ. Res., September 15, 2000; 87(6): 467 - 473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Jeron, G. F. Mitchell, J. Zhou, M. Murata, B. London, P. Buckett, S. D. Wiviott, and G. Koren
Inducible polymorphic ventricular tachyarrhythmias in a transgenic mouse model with a long Q-T phenotype
Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H1891 - H1898.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
V. S. Chauhan, S. Tuvia, M. Buhusi, V. Bennett, and A. O. Grant
Abnormal Cardiac Na+ Channel Properties and QT Heart Rate Adaptation in Neonatal AnkyrinB Knockout Mice
Circ. Res., March 3, 2000; 86(4): 441 - 447.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Zaniboni, A. E. Pollard, L. Yang, and K. W. Spitzer
Beat-to-beat repolarization variability in ventricular myocytes and its suppression by electrical coupling
Am J Physiol Heart Circ Physiol, March 1, 2000; 278(3): H677 - H687.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Wang, S. Swirp, and H. Duff
Age-dependent response of the electrocardiogram to K+ channel blockers in mice
Am J Physiol Cell Physiol, January 1, 2000; 278(1): C73 - C80.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X. H.T. Wehrens, S. Kirchhoff, and P. A. Doevendans
Mouse electrocardiography: An interval of thirty years
Cardiovasc Res, January 1, 2000; 45(1): 231 - 237.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. I. Akbarali, H. Thatte, X. D. He, W. R. Giles, and R. K. Goyal
Role of HERG-like K+ currents in opossum esophageal circular smooth muscle
Am J Physiol Cell Physiol, December 1, 1999; 277(6): C1284 - C1290.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. D. Wickenden, P. Lee, R. Sah, Q. Huang, G. I. Fishman, and P. H. Backx
Targeted Expression of a Dominant-Negative Kv4.2 K+ Channel Subunit in the Mouse Heart
Circ. Res., November 26, 1999; 85(11): 1067 - 1076.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. A. Selyanko, P. Delmas, J. K. Hadley, L. Tatulian, I. C. Wood, M. Mistry, B. London, and D. A. Brown
Dominant-Negative Subunits Reveal Potassium Channel Families That Contribute to M-Like Potassium Currents
J. Neurosci., March 1, 2002; 22(5): RC212 - RC212.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. London, W. Guo, X.-h. Pan, J. S. Lee, V. Shusterman, C. J. Rocco, D. A. Logothetis, J. M. Nerbonne, and J. A. Hill
Targeted Replacement of Kv1.5 in the Mouse Leads to Loss of the 4-Aminopyridine-Sensitive Component of IK,slow and Resistance to Drug-Induced QT Prolongation
Circ. Res., May 11, 2001; 88(9): 940 - 946.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Babij, P.
Right arrow Articles by Colatsky, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Babij, P.
Right arrow Articles by Colatsky, T. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH