Rapid Communications |
From the Divisions of Molecular Genetics (P.B., G.R.A., B.N., J.K., L.J.D.G.) and Cardiovascular and Metabolic Diseases (C.-M.S., T.R.B., B.J., T.M.A., W.S., T.J.C.), Wyeth-Ayerst Research, Princeton, NJ.
Correspondence to Dr Thomas J. Colatsky, Wyeth-Ayerst Research, PO Box 42528, Philadelphia, PA 19101-2528. E-mail colatst{at}war.wyeth.com
| Abstract |
|---|
|
|
|---|
Key Words: long-QT syndrome mice, transgenic HERG potassium channels electrocardiography
| Introduction |
|---|
|
|
|---|
Electrophysiological studies have demonstrated that IKr plays a dominant role in repolarizing the embryonic and neonatal mouse heart,19 20 21 but this current appears to be developmentally regulated and difficult to detect in the adult.22 However, mouse ERG (MERG) transcript is abundantly expressed in adult mouse atrium and ventricle, existing as 3 alternately processed isoforms that differ only in their NH2-terminal domains and share significant sequence homology with HERG.23 24 MERG1b (MERGB) is selectively expressed in the heart, whereas MERG1a (MERGA) has a wider tissue distribution. Human homologues of these isoforms have also been identified (HERGA, HERGB),24 and it has been suggested that native cardiac IKr current may be formed by the coassembly of the 2 subunits.23 All known mutations associated with LQT2 occur in regions common to both isoforms,3 11 14 although a preliminary report of mutations in nonconserved regions has recently been published.25
The mouse has become an important species for modeling cardiovascular disease.26 To determine whether the mouse heart might provide a useful model of human LQTS, we created transgenic mice expressing the HERG G628S mutation in the myocardium using a cardiac-specific promoter. These studies establish, for the first time, both the existence of an endogenous IKr in the adult mouse ventricle and the ability of the G628S mutation to exert a dominant negative effect on IKr in vivo. However, abolition of IKr did not lead to QT prolongation in intact animals but did increase action potential duration in single myocytes studied at slow rates and room temperature. Minor ECG abnormalities primarily involving the QRS complex were observed in some transgenic animals and appeared to distribute in a sex-specific manner.
| Materials and Methods |
|---|
|
|
|---|
-cardiac myosin heavy chain gene
promoter (a gift from Dr Jeffrey Robbins, University of Cincinnati),
which contains introns and the first 2 noncoding exons. The plasmid was
altered to accommodate an extra polylinker sequence (SalI,
ClaI, HindIII, NotI, SfiI,
EagI, KpnI) inserted into the
SalI-KpnI sites for subcloning of HERG. The
9.6-kb transgene fragment was isolated by NotI digestion,
gel-purified, further purified by cesium chloride density gradient
centrifugation and dialyzed extensively against 5
mmol/L Tris (pH 7.4) and 0.1 mmol/L EDTA. The transgene was
microinjected into the male pronucleus of fertilized FVB/N mouse
embryos. Founder transgenic mice were identified by PCR and Southern
blot analysis of genomic DNA isolated from tail clips. Founders
were backcrossed to WT FVB/Ns to produce heterozygous F1 offspring that
were used between 3 and 9 months of age for all studies. Nontransgenic
littermates were used for isolated cell studies and pathology and WT
FVB/N mice were used as controls for ECG recordings.
RNA and Protein Analysis
A 356-bp XmaI-NdeI fragment from the HERG
3'UTR was subcloned into pGEM5Z for riboprobe synthesis. Total RNA was
isolated from WT and transgenic mouse hearts using Trizol (Gibco BRL),
and 20 µg was taken for RNase protection analysis using 20
units of RNase T2. To study the effect of HERG on
endogenous MERG expression, the 3' RACE technique was used
to isolate MERG cDNA clones. Mouse heart poly A+
RNA (Clontech) was used as the starting material for 3' RACE (Gibco BRL
protocol) with these HERG gene-specific primers: GCATCGACATGAACGCGGTGCT
(outer) and CAGGCTGACATCTGCCT (inner). PCR products were cloned
using the TA Cloning system (Invitrogen), and multiple cDNAs were
sequenced in both directions. A 505-bp SacI-SalI
fragment from the MERG cDNA containing part of the 3' coding and the
entire 3' UTR was subcloned into pGEM3Z for riboprobe synthesis.
Because this region is common to all known isoforms, we discuss these
results in terms of changes in MERG expression, without differentiating
between isoforms. Based on the DNA sequence identity between MERG and
HERG in the 3' UTR, it was predicted that the 505-bp MERG probe would
also protect a 164-bp HERG fragment. Hearts from 18-day fetal and 1- to
3-day neonatal mice were pooled from each group for RNA
analysis.
To determine HERG protein expression in transgenic mouse hearts, we used a HERG polyclonal antibody (a gift from Dr Jeanne Nerbonne, Washington University, St. Louis, Mo) raised in rabbits against the carboxyl terminus peptide sequence between residues 1145 to 1159 (LTSQPLHRHGSDPGS). This peptide sequence is identical in humans and mice, and it is present in both MERG isoforms. The HERG antibody was used for immunohistochemical analysis on frozen heart sections using HRP- and FITC-conjugated secondary antibodies (Sigma). Expression of the K+ channel Kv2.1 was also analyzed using an anti-peptide antibody raised against the rat protein between residues 837 to 853.27 This antibody cross-reacts with the identical mouse epitope.
Pathology
WT (n=40) and transgenic (n=27) hearts were analyzed for
morphological abnormalities using gross and microscopic end points.
Body and heart wet weights were obtained, and the heart was dissected
using a stereomicroscope. Wet weights were acquired for the right and
left atria, the right ventricular free wall, and the
combined left ventricle and septum. Tissues were immersed in neutral
buffered 10% formalin, embedded in paraffin, sectioned at 6 µm,
and stained for histological examination. Sections were
evaluated independently by 2 pathologists.
Single Cell Studies
Single ventricular myocytes were isolated from adult
mice of either sex. Animals were anaesthetized with Avertin
(Aldrich Chemicals) 16 µL/g body weight diluted to 2.5% in sterile
irrigation saline. After thoracotomy, hearts were rapidly excised and
immersed in calcium-free Krebs-Henseleit buffer (KHB) at 4°C for
aortic cannulation. Ventricular myocytes were enzymatically
isolated using a modification of the Langendorff coronary
perfusion procedure.28 Briefly, the cannulated
heart was rinsed at 37°C with KHB for 5 minutes, followed by
perfusion for 5 to 10 minutes with KHB containing 0.7 mg/mL
collagenase (type I, Worthington), 60 to 80 µg/mL
protease (type XIV, Sigma), and 0.1% BSA. Ventricles were dissected
from the heart, cut longitudinally into 1- to 2-mm-thick strips and
slowly agitated for 5 to 10 minutes at 37°C in 3 changes of KHB with
concentrations of enzymes identical to those used in perfusion but with
the addition of 1% BSA. After each incubation period, the supernatant
fraction was drawn off and passed through a 200-µm-pore nylon mesh.
The filtrate was briefly centrifuged and cell pellets
resuspended in KHB with 100 µmol/L CaCl2,
0.5% BSA, and 10 mmol/L HEPES. Myocytes were used within 5 to 6
hours after isolation.
Current recordings were made using the whole-cell patch
configuration at room temperature (25°C to 26°C). Myocytes were
superfused with HEPES-buffered Tyrode's solution containing (mmol/L)
NaCl 138, KCl 4, MgCl2 0.5,
NaH2PO4 1.6,
NaHCO3 5, CaCl2 2, dextrose
5.5, and HEPES 10. Recording electrodes were made of 1.0-or
1.5-mm OD borosilicate capillary glass and filled with the following
internal solution (mmol/L): K-aspartate 110, KCl 20, HEPES 5, EGTA 5,
MgCl2 · 6H2O 2,
K2-ATP 5,
phosphocreatine-Na2 5, and
CaCl2 1; the solution was adjusted to pH 7.3 with
1 N KOH. Electrodes had resistances between 2 and 3.5 M
, as measured
in bath solution. The zero reference potential was adjusted in the bath
before forming seals. Recordings were performed with an Axon
Instruments 200B amplifier interfaced to a DigiData 1200 data
acquisition system (Axon Instruments). Signals were typically sampled
at 1 kHz and corrected for stray capacitance but not series resistance,
because the magnitude of the current being recorded was considered
too small (<0.2 pA/pF) to introduce significant errors. Data
acquisition and analysis were performed using pClamp v6.02
software (Axon Instruments). Currents were recorded in the presence
of 1 µmol/L nisoldipine to block L-type
Ca2+ current, and a holding potential of -40 mV
was used to inactivate the rapid Na+
current. In some studies, currents were recorded in the presence of
2 mmol/L 4-AP and 4 mmol/L TEA-Cl to isolate delayed
rectifier currents from other components of outward current. Membrane
currents were elicited by applying 500- or 1000-ms depolarizations in
10-mV increments at 10-second intervals, up to +60 mV. All measurements
were made at 100 ms after the step to reduce possible contamination
from 4-APsensitive tail components. Action potentials were elicited
by injection of brief current pulses at a cycle length of 1 second.
Cells from which action potentials were recorded were quiescent at
rest and yielded stable recordings for at least 15 minutes.
Intact Tissue Studies
Mice of either sex weighing between 20 and 30 grams were killed
by CO2 inhalation and exsanguination. Their
hearts were quickly removed and placed into cold (4°C)
physiological salt solution of the following
composition (mmol/L): NaCl 118.4, KCl 4.7, CaCl2
2.5, MgSO4 1.2,
KH2PO4 1.2,
NaHCO3 24.9, and D-glucose 11.1,
gassed with 95% O2/5%
CO2 to achieve a pH of 7.4. The atria were
removed and the ventricle was opened by cutting along the left anterior
descending artery tract. The ventricular preparation was
pinned to the bottom of a silicone elastomer-lined (Sylgard 184, Dow
Corning Corp) recording chamber exposing the left
ventricular septum and free wall. Impalements were
restricted to the area between the ventricular apex and the
base of the posterior papillary muscle. The chamber was maintained at
37°C and continually superfused with
physiological salt solution gassed with 95%
CO2/5% O2. Tissues were
paced with a 2- to 5-ms square pulse delivered by a bipolar silver
electrode (1 Hz) at 2 times diastolic threshold.
Preparations were allowed to equilibrate for 1 hour. Action potentials
were recorded using glass microelectrodes that had tip resistances
between 20 and 30 M
when filled with 3 mol/L KCl. Signals were
amplified using an Axoclamp 2A amplifier in current clamp mode and
monitored on a Tektronix 5111A oscilloscope. Action potentials were
digitized (12-bit ADC, 0.1-ms sampling resolution) and analyzed
on-line using a 486-based personal computer and custom software. Action
potential was measured at 50%, 75%, and 90% of repolarization
(APD50, APD75, and
APD95, respectively, expressed in
milliseconds).
Electrocardiography
Mice were anesthetized with ketamine (100 mg/kg)
and xylazine (8 mg/kg) intraperitoneally and placed
under a heating lamp to prevent loss of body heat. Body temperature was
monitored continuously by a rectal probe, and the position of the
heating lamp was adjusted to maintain a constant temperature (37°C).
The body was placed in a recumbent position, and subcutaneous needle
electrodes were inserted in the limbs for 6-lead ECG recording.
The leads were connected to a Gould ECG amplifier, and serial ECGs from
leads I, II, III, aVR, aVL, and aVF were recorded using a Gould
2400S chart recorder at a paper speed of 100 mm/s. All
reported measurements were obtained from lead I. The remaining leads
were used as a reference to validate the presence of abnormal ECG
patterns observed on the lead I records. The QT interval was
measured from the beginning of the QRS complex to the end of the T
wave, defined as the point of return to the isoelectric baseline,
similar to the convention used by Berul et al.29
To validate our recording conditions, animals were allowed to
recover for 2 days, and the ECG recording was repeated. The
results were consistent during the 2 days of study.
Analysis was performed by 2 investigators unaware whether the
records were obtained from WT or transgenic animals.
Drugs
E-4031 was synthesized as a free base and dissolved in DMSO (in
vitro studies) or in 1 N HCl (in vivo studies). TEA-Cl and 4-AP were
dissolved in water. Nisoldipine was a gift from Miles, Inc, and was
dissolved in 70% ethanol. Stock solutions of these agents (10
mmol/L) were diluted in Tyrode's buffer to achieve the desired final
bath concentration.
Statistical Analysis
Comparisons of heart weights and ECG parameters
between WT and transgenic mice were performed using the unpaired
Student t test. Action potential parameters from
tissue and cell studies were analyzed by ANOVA using a nested
factorial design. The factors considered were experimental intervention
(transgene versus WT), sex, and animal, with the animal being the
nested factor. The logarithmic transformation was used to stabilize the
variance of the action potential data. Frequency data were
analyzed using the
2 test.
Significance was set at P<0.05. Values are expressed as
mean±SEM. In cases for which nonparametric tests were
used, both median and mean population values are presented to
facilitate comparisons with the published literature.
| Results |
|---|
|
|
|---|
-cardiac myosin heavy chain promoter. Some expression was also
detected in lung tissue and probably represents the
pulmonary myocardium, where the promoter is also
known to be active.30 The level of HERG
expression determined by densitometric scanning of blots was estimated
to be 1- to 10-fold greater than the level of expression of
endogenous MERG. Overexpression of the HERG transgene in
adult mouse heart did not appear to alter the level of
endogenous MERG, as evidenced by a constant MERG/ß-actin
ratio, which differed by less than 25% in hearts sampled at different
stages of development. HERG G628S lines 18 and 48 (the former showing
2- to 3-fold higher expression), expressed
8- and 4-fold,
respectively, more HERG than MERG mRNA and were selected for detailed
study. Transmission of the transgene was not sex linked.
|
HERG antibody strongly reacted with HERG protein in transgenic mouse
hearts from line 18 (Figure 2A
). Similar
results were obtained in hearts from transgenic line 48 (data not
shown). Weaker staining was observed in WT heart sections, including
vascular structures, and probably represents cross-reactivity
of the HERG antibody with endogenous MERG. The pattern of
staining, which includes intercalated disk structures, suggests that
MERG is expressed uniformly across all regions of the mouse
myocardium. Detailed analysis of the data suggests
2 patterns of HERG G628S protein expression: (1) a uniform distribution
across ventricles and atria well beyond the endogenous
level represented by reactivity to MERG and (2) the
presence of small intense clusters of HERG G628S expression from apex
to atria throughout the heart (Figure 2B
). Expression of the HERG G628S
protein was particularly prominent around nuclei (Figure 2C
).
Additional analysis showed that the HERG G628S protein did not
colocalize with synaptophysin, ryanodine receptor, or tropomyosin
antibodies (data not shown). The punctate pattern of HERG protein
expression also differed significantly from that of the
endogenous Kv2.1 K+ channel, which
showed uniform membrane expression in ventricles and atria (Figure 2A
).
|
Pathology
Both gross and histopathological examination of transgenic mouse
hearts indicated no overt structural abnormalities compared with WT
controls. No significant inflammatory changes were noted within the
heart, and there was no evidence of increased interstitial
fibrosis. Body weights were similar in both WT and transgenic mice.
However, the ratio of heart weight to body weight was significantly
increased in female transgenic mice (6.2±0.2, n=10, line 18 G628S
females; 6.1±0.4, n=5, line 48 G628S females) compared with WT females
(4.7±0.2, n=15), with no differences observed between WT (5.7±0.2,
n=25) and transgenic (5.4±0.1, n=12) males. The cell capacitance of
isolated ventricular myocytes in both groups was unchanged,
averaging 184±8 and 186±5 pF in WT males (n=72) and females (n=102),
respectively, and 205±9 and 190±6 pF in transgenic males (n=39) and
females (n=61), respectively.
ECG Measurements
Basic ECG intervals in G628S and WT mice were generally
consistent with those reported in C57BL/6J
mice.29 Data were pooled from lines 18 and 48,
because a separate analysis did not show any significant
difference in the results obtained in these 2 lines. For adult WT mice,
the QT interval was 98.9±2.5 ms (n=23). The average sinus cycle length
corresponded to a heart rate of 191 bpm (R-R interval=315±14 ms).
Compared with age-matched WT controls, expression of the HERG G628S
mutation produced no significant change in any ECG interval including
the QT (89.5±3.5 ms) and R-R (286±16 ms) intervals (n=21). However,
20% of the transgenic mice screened from lines 18 (10/54, 18.5%)
and 48 (6/26, 23.1%) showed some form of irregularity, most frequently
involving alterations in the QRS complex. The most common aberrations
were accentuated negative Q or S waves and, less frequently, changes in
the configuration of the T wave (ie, a negative deflection of the
initial peak). No abnormality was observed in any of the 25 WT mice
under similar study conditions. When the animals with ECG
irregularities were analyzed according to sex, the
abnormalities distributed preferentially to transgenic females (13/37,
35%), with relatively few seen in transgenic males (3/43, 7%)
(P<0.01). Preliminary studies attempting to induce cardiac
arrhythmias in G628S mice using programmed electrical
stimulation yielded only infrequent and nonspecific responses,
suggesting an absence of any proarrhythmic potential associated with
overexpression of the HERG mutation (data not shown).
IKr Is Present in Adult WT
Mice
In ventricular myocytes isolated from WT adult mice, a
small delayed rectifier current was consistently observed that
displayed gating properties similar to IKr
in other species, including inward rectification at positive potentials
and sensitivity to E-4031 (Figure 3A
through 3C). Activation curves constructed using E-4031sensitive tail
currents were well fitted by a simple Boltzmann distribution with
V1/2=4.2±0.7 mV and k=10.5±0.7 mV (n=27)
(Figure 4A
). Kinetic analysis of
the difference tail currents revealed 2 components of deactivation with
time constants of 127±8 and 1686±330 ms (n=17). E-4031 was a potent
blocker of the current, with an IC50=59±6
nmol/L. However, block of the tail currents by E-4031 was incomplete,
with a small outward component, representing
25% of the
total tail current amplitude, remaining even after exposure to the
highest concentrations of E-4031 (10 µmol/L) and the presence of
both TEA (4 mmol/L) and 4-AP (2 mmol/L) (Figure 4B
). This
residual component of outward tail current was blocked by 30
µmol/L azimilide (data not shown), suggesting it represents
the slowly activating delayed rectifier K+
current, IKs. In a total of 90 cells
from 13 WT hearts studied under control conditions, total tail current
amplitudes averaged 45.6±2.1 pA and were normally distributed around
the mean (Figure 5
, open bars). Tail
currents measuring
30 pA were present in 87% of the preparations
tested. Together with the immunofluorescence
results, these data suggest a relatively uniform distribution of
IKr and its corresponding channel protein
within the murine ventricle.
|
|
|
Role of IKr in Normal Ventricular
Repolarization
Action potentials recorded from single WT
ventricular myocytes showed considerable variability in
both duration and waveform. Whereas most action potentials were
spike-like and lacked a well-defined plateau phase, some cells
exhibited a mildly prolonged low-voltage plateau or "bump" that
slowly decayed toward the resting potential (Figure 6A
). Measured values for action potential
duration ranged widely regardless of the level of repolarization used
for analysis. The amount of outward current recorded during
the test depolarization also varied markedly from cell to cell (Figure 6A
, insets).
|
Histograms summarizing all measurements of APD50,
APD75, and APD95 in WT mice
are presented in Figure 7A
. In
contrast to the normal distribution found for
IKr tail current amplitude, the
distribution of action potential durations was positively skewed. It is
not clear whether this result represents the inclusion of
different cell types in the analysis (eg, Purkinje fibers or M
cells) or a natural heterogeneity in repolarizing
currents within the ventricular myocardium.
Median action potential durations for the WT ventricle were 1.5, 3.6,
and 30.9 (n=96) at APD50,
APD75, and APD95,
respectively, which can be compared with means of 2.1±0.2, 5.2±0.4,
and 33.1±1.7 ms, respectively, calculated for the same population of
cells assuming an underlying normal distribution. There was no
significant difference in action potential duration between male and
female WT mice at any level of repolarization.
|
The addition of 5 µmol/L E-4031 to single WT ventricular cells produced relatively modest changes in action potential waveform. Action potential duration was prolonged by E-4031 at one or more levels of repolarization in 25 of 30 cells (83%) but was unchanged in the remainder. Overall, E-4031 increased median APD50, APD75, and APD95 values by 11.3%, 12.2%, and 9.5%, respectively (P>0.05 versus predrug, n=30). These data suggest that IKr plays a limited role in determining the repolarization time course in the adult murine ventricle. It should be noted, however, that the subpopulation of WT cells exposed to E-4031 differed somewhat from the total distribution of cells studied, tending to be shorter in duration at each level of repolarization. Specifically, 90% of the cells used in the E-4031 study had APD50, APD75, and APD95 values <2.5, 8, and 48 ms, respectively, whereas the corresponding 90% cutoff values for APD50, APD75, and APD95 in the more general WT population were 4, 12, and 58 ms, respectively. Correspondingly, the amount of E-4031sensitive tail current in this group of cells (22.6.±2.6 pA, n=28) was much smaller than expected from other experimental analyses of maximal IKr amplitude in the present study, eg, the concentration-response curve (36.3 pA) and the determination of the activation curve (36.0 pA). Given that maximal tail current amplitude before E-4031 exposure (47.0±3.2 pA, n=30) was comparable to that measured in the more general WT myocyte population (45.6±2.1 pA, n=90), these results suggest that IKr constituted a smaller fraction of total repolarizing current in the subgroup of WT cells used in the action potential experiment. The relatively modest effects of E-4031 on repolarization time course in this subgroup therefore does not necessarily preclude the possibility of a greater contribution of IKr to repolarization time course in different myocardial cell types and/or regions of the ventricle.
IKr Is Abolished in Adult Transgenic
Mouse Ventricular Myocytes
Tail currents in ventricular myocytes from HERG G628S
transgenic mice were typically much smaller than those observed in
cells from WT animals under similar conditions. A
representative tracing is shown in Figure 8
. Overall, mean tail current amplitude
in G628S myocytes (13.9±3.3 pA, n=46) was only 30% of that
recorded in WT controls, which is similar to the amount of
E-4031insensitive current seen in WT cells (Figure 4
). Tail currents
measuring
30 pA were present in only 11% of the preparations
tested. The small tail currents recorded in G628S cells were
insensitive to E-4031, 4-AP, and TEA, suggesting that they
represented deactivation of
IKs. The difference in the average tail
current amplitude between WT and G628S myocytes (31.7 pA) is comparable
to the amount of E-4031sensitive tail current in WT cells in other
experiments (
36 pA), consistent with the conclusion that
overexpression of the HERG G628S mutation effectively abolishes
endogenous IKr in the mouse
ventricle, presumably through a dominant negative action on the native
channel protein.
|
No data were obtained indicating that compensatory changes in other outward currents had occurred. However, exposure to TEA and 4-AP did not significantly alter tail current amplitude in G628S cells (13.9±3.3 pA, n=46 versus 17.8±2.3 pA, n=22), despite producing a significant 21.9% reduction in WT myocytes (45.6±2.1 pA, n=90 versus 35.6±1.6 pA, n=65). This result may suggest a possible decrease in 4-AP/TEAsensitive outward current in G628S ventricular cells.
Prolongation of Action Potential Duration in G628S Mice
In single ventricular myocytes isolated from G628S
mice of either sex (n=73), median action potential duration was
significantly prolonged by 50%, 61%, and 43% at
APD50, APD75, and
APD95, respectively, when compared with WT
controls (n=96). No within-group sex-based differences were noted in
action potential duration between WT or transgenic males and females.
Representative traces of action potentials from G628S
mice are shown in Figure 6B
. As in the case of the WT animals, there
was considerable variability in the amount of outward current during
the test pulse (Figure 6B
, insets). The distribution of measured action
potential durations was positively skewed and perhaps somewhat broader
than in the WT population (Figure 7B
).
Action potentials recorded using sharp microelectrodes in intact
ventricular tissue from G628S and WT mice did not differ
significantly in any of the parameters measured. No
sex-based differences in action potential duration, maximal upstroke
velocity, or maximum diastolic potential were
observed in either WT or transgenic populations at any cycle length
tested. These data are summarized in the Table
.
|
| Discussion |
|---|
|
|
|---|
The recording of IKr in adult mouse cardiac myocytes contrasts with previous reports that this current is developmentally regulated and present only in fetal and neonatal murine preparations.21 22 IKr-like currents were identified in nearly all cells studied, consistent with our finding that MERG protein is uniformly expressed across the murine ventricle. The gating properties and pharmacology of mouse IKr are similar to those in other species. The current is extremely sensitive to E-4031 (IC50=59 nmol/L) and is half maximally activated at +4 mV. The voltage dependence of activation is similar to that previously reported for IKr in AT-1 cells,31 HERG/minK current expressed in oocytes,32 and ventricular myocytes from cat,33 rabbit,34 and neonatal mouse21 but more positive than the IKr activation curves found in guinea pig ventricle,35 fetal mouse ventricular cells,19 human cardiomyocytes,36 37 or MERGB current.24 Because the analysis in the present study was performed using E-4031sensitive difference currents, the more positive location of the IKr activation curve cannot be explained by contamination with overlapping currents such as IKs, which is also present in this preparation, but rather may reflect real species and/or developmental differences in the subunit composition of the native channel. The decay of the E-4031sensitive tail current was biexponential, with time constants on the order of 80 to 200 ms and 600 to 2500 ms at a holding potential of -40 mV. This is in the same range as reported for the IKr tails in fetal mouse ventricle19 and AT-1 cells.31 It has been demonstrated23 that MERG1b, either alone or coassembled with MERG1a, can produce tail currents in oocytes that deactivate with kinetics similar to AT-1 cells.
IKr current density in WT mouse ventricle
(
0.25 pA/pF) is similar to that measured in adult
ventricular cells of other species, including cat (0.7
pA/pF),33 dog (0.2 pA/pF),38 guinea pig (0.7
pA/pF),35 and human (0.4 pA/pF)37 but
considerably smaller than the current densities reported in fetal mouse
ventricle and AT-1 cells (
2.5 pA/pF).22 31 The
apparent reduction in IKr density from
fetal to adult mouse is not consistent with a dramatic
downregulation of channel protein when differences in cell size are
taken into account, because absolute current magnitude shows at most a
2-fold increase whereas membrane capacitance increases more than
6-fold.21 This suggests that nearly the same
amount of channel protein is generated in both fetal and adult tissue
but is incorporated into a larger amount of cell membrane in the adult.
This conclusion is also supported by our observation that the amount of
MERG message remains fairly constant relative to the molecular marker
ß-actin in 18-day fetal and 1- to 3-day neonatal and adult myocytes.
Davies et al20 similarly concluded that the
expression levels of IKr remain the same in
the mouse heart from early (11 to 13 days postcoitum) to late (17 to 20
days postcoitum) embryonic development and that apparent differences in
E-403sensitive current magnitude disappeared when normalized to cell
capacitance. In the adult, a 6-fold increase in total amount of
membrane containing even a relatively constant number of channels would
be expected to confound 3H-dofetilide binding
studies, given the high degree of nonspecific binding (
50%)
present in this assay.22
There were 2 apparent discrepancies in the results obtained in the present study. First, action potential duration was significantly and markedly prolonged in single G628S myocytes but unchanged in intact ventricular strips, and no QT prolongation was seen in vivo. Second, we found that exposure of single myocytes to high concentrations of E-0431 prolonged action potential duration much less than would be expected given the data in G628S cells. The loss of an effect on ventricular repolarization in intact tissue and in vivo might be explained by a minimal role of IKr relative to other repolarization currents at more rapid heart rates, resembling the so-called reverse use-dependent effect of specific IKr blockers, compounded by the effects of temperature on channel gating. We did not test this hypothesis by recording action potentials in single cells at higher temperatures and faster rates, because the nonphysiological conditions used (25°C, 1-Hz pacing) were considered necessary for cell stability. The syncytial nature of the ventricular wall may further attenuate the prolongation that was seen at the single cell level.
It is more difficult to explain the relative lack of an E-4031 effect in WT cells. In principle, blocking IKr using E-4031 should be equivalent in its effects on the action potential to the dominant negative suppression of MERG channel assembly by the G628S mutation. However, the WT myocytes used in the E-4031 study may not have been a completely representative sample, because they appeared to have shorter action potentials at baseline and relatively less IKr as a fraction of their total tail current than the more general population studied. It is also possible that the pharmacological effects of E-4031 were reduced under the conditions of the study, with block either occurring too slowly during the brief action potential or recovering too completely during the intervening diastolic interval to alter the repolarization time course. However, we view this explanation as unlikely given the reported use- and state-dependent properties of E-4031 and other class III antiarrhythmics. Alternatively, the overexpression of the G628S mutation may have somehow resulted in the loss of other repolarizing currents, leading to a greater prolongation of action potential duration. Possible compensatory changes in other ion channel proteins were not rigorously followed, except for MERG and Kv2.1, which did not appear to change. There was also no dramatic change in the magnitude of the TEA/4AP-insensitive (ie, azimilide-sensitive) tail current. We did, however, find little or no TEA/4AP-sensitive tail current in the G628S cells, but this result is difficult to interpret, because the data were obtained using protocols that minimized the contribution of currents other than IKr. Given the natural and wide-ranging variability observed in both the duration of the repolarization phase and the amount of outward current present in each cell, it is difficult to exclude the possibility that some cell types or regions of the heart are more sensitive to this type of genetic perturbation or that compensatory changes in TEA- and/or 4AP-sensitive currents did in fact occur. The possibility of coordinate changes merits additional detailed study.
The in vivo suppression of endogenous
IKr by the cardiac-specific expression of
the HERG G628S mutation supports the view that the human mutation
functions in a dominant negative manner. Recently, the mechanism of
action of a
1261 HERG mutation was shown to occur via a subunit
interaction domain of 135 amino acids located at the N-terminal region
of the protein.39 This region appears to be
important for tetramer formation. The significance of the apparent
clustering of HERG G628S protein expression in the transgenic mouse
heart is unclear, but it may reflect an accumulation of mutant protein
assemblies in subcellular organelles during processing, as recently
reported for the trapping of heteromultimeric
complexes involving a truncated Kv1.1
polypeptide.40
Clinical Relevance
The cardiac-specific overexpression of the G628S mutation failed
to produce a murine model of LQTS. These results differ from the
phenotype obtained in transgenic mice generated by the
expression of a truncated Kv1.1 polypeptide in the
heart,41 which affects the assembly of the large,
slowly inactivating 4-APsensitive outward current and results in more
severe electrophysiological consequences
than seen with the selective inhibition of
IKr, including the generation of
spontaneous arrhythmias. In the mouse and rat, repolarization
is dominated by a large inactivating outward current that typically
plays a more limited role in higher species. Because the balance of
ionic currents underlying the murine ventricular action
potential differs so dramatically from that in human ventricle, the
mouse is likely to have only limited utility as an
electrophysiological model of human cardiac
disease. However, it may hold considerable value for dissecting
repolarization currents in the mouse heart and as a means of examining
the mechanism(s) by which the G628S mutation exerts its dominant
negative effect on native cardiac cells in vivo.
The ECG changes seen predominantly in female transgenic mice, although minor, are suggestive of an abnormal pattern of ventricular conduction and unexpected, on the basis of our current understanding of the LQTS and the role of IKr in ventricular electrogenesis. To date, there have been no reports of aberrant QRS complexes in any form of LQTS, including LQT3, which derives from a series of specific mutations in the SCN5a gene underlying the excitatory cardiac Na+ channel.11 Similarly, as a class, drugs that specifically block IKr, eg, dofetilide and E-4031, have no effect on intracardiac conduction or QRS morphology.42 There is one isolated anecdotal report of aberrant conduction in a patient with atrial fibrillation treated with dofetilide in whom right atrial pacing induced critical retrograde conduction delays that were associated with a large difference in refractoriness between the right bundle branch and right ventricular myocardium,43 44 but this appears to be a unique incident. Autopsies of patients with LQTS suggest the occurrence of subendocardial fibrosis and possible derangements in the His-Purkinje system.45 46 47 However, there was no evidence of such histopathological changes in the present study; hearts appeared to be completely normal, apart from a statistically significant and sex-specific increase in heart weight in female transgenic animals. At the present time, minor alterations in the pathway for ventricular excitation secondary to an increase in heart weight appears to be the most likely explanation for the observed ECG aberrancies.
Limitations of the Study
The primary focus of the current set of experiments was to
characterize the effects of overexpressing the human G628S mutation on
endogenous IKr in the mouse
ventricle and to determine whether this resulted in a model of LQT2.
Although some attempt was made to determine whether compensatory
changes in electrophysiology or cardiac structure might have occurred,
a rigorous analysis of these effects was beyond the scope of
the initial experiments.
The reason for the increased heart weight in transgenic females remains
unclear and may have little or no physiological
relevance. Although expression of the myosin heavy chain is known to be
regulated at the transcriptional level by
thyroid30 and steroid48 49
hormones, no sex-specific increases in heart weight have been noted in
other transgenic models that used the
-myosin heavy chain promoter
to achieve cardiac-specific protein expression (J. Robbins, PhD, oral
communication, April 1998). There are no data suggesting that
overexpression of the HERG G628S mutation would induce cardiac
hypertrophy or hyperplasia nor has cardiac enlargement been
reported in any of the clinical manifestations of LQTS. It will be
important to confirm the current findings and to identify a possible
molecular basis for the changes.
| Acknowledgments |
|---|
Received May 20, 1998; accepted August 3, 1998.
| References |
|---|
|
|
|---|
2. Jiang C, Atkinson D, Towbin JA, Splawski I, Lehmann MH, Li H, Timothy K, Taggart RT, Schwartz PJ, Vincent GM, Moss AJ, Keating MT. Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity. Nat Genet. 1994;8:141147.[Medline] [Order article via Infotrieve]
3. Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell. 1995;80:795803.[Medline] [Order article via Infotrieve]
4. Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson JL, Moss AJ, Towbin JA, Keating MT. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell. 1995;80:805811.[Medline] [Order article via Infotrieve]
5. Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:1723.[Medline] [Order article via Infotrieve]
6.
Benson DW, MacRae CA, Vesely MR, Walsh EP, Seidman JG,
Seidman CE, Satler CA. Missense mutation in the pore region of HERG
causes familial long QT syndrome. Circulation. 1996;93:17911795.
7.
Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta
K, Haneda N, Nakano O, Shibata A, Sawayama T, Kasai H, Yazaki Y,
Nakamura Y. Four novel KVLQT1 and four novel HERG mutations in familial
long QT syndrome. Circulation. 1997;95:565567.
8. Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet. 1997;17:338340.[Medline] [Order article via Infotrieve]
9.
Duggal P, Vesely MR, Wattanasirichaigoon D, Villafane
J, Kaushik V, Beggs AH. Mutation of the gene for IsK associated with
both Jervell and Lange-Nielsen and Romano-Ward forms of long QT
syndrome. Circulation. 1998;97:142146.
10.
Warmke JW, Ganetzky B. A family of potassium channel
genes related to eag in Drosophila and mammals. Proc Natl Acad
Sci U S A. 1994;91:34383442.
11. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell. 1995;81:299307.[Medline] [Order article via Infotrieve]
12.
Trudeau MC, Warmke JW, Ganetsky B, Robertson GA. HERG,
a human inward rectifier in the voltage-gated potassium channel family.
Science. 1995;269:9295.
13. Smith PL, Baukrowitz T, Yellen G. The inward rectification mechanism of the HERG cardiac potassium channel. Nature. 1996;379:833836.[Medline] [Order article via Infotrieve]
14.
Sanguinetti MC, Curran ME, Spector PS, Keating MT.
Spectrum of HERG K+-channel dysfunction in an inherited cardiac
arrhythmia. Proc Natl Acad Sci U S A.. 1996;93:22082212.
15.
Makkar RR, Fromm BS, Steinman RT, Meissner MD, Lehmann
MH. Female gender as a risk factor for torsades de pointes associated
with cardiovascular drugs. JAMA. 1993;270:25902597.
16. Lehmann MH, Timothy KW, Frankovich D, Fromm BS, Keating M, Locati EH, Taggart RT, Towbin JA, Moss AJ, Schwartz PJ, Vincent GM. Age-gender influence on the rate-corrected QT interval and the QT-heart rate relation in families with genotypically characterized long QT syndrome. J Am Coll Cardiol. 1997;29:9399.[Abstract]
17.
Lehmann MH, Hardy S, Archibald D, Quart B, MacNeil DJ.
Sex difference in risk of torsade de pointes with d,l-sotalol.
Circulation. 1996;94:25352541.
18.
Locati EH, Zareba W, Moss AJ, Schwartz PJ, Vincent GM,
Lehmann MH, Towbin JA, Priori SG, Napolitano C, Robinson JL, Andrews M,
Timothy K, Hall WJ. Age- and sex-related differences in clinical
manifestations in patients with congenital long-QT syndrome: findings
from the International LQTS Registry. Circulation. 1998;97:22372244.
19.
Wang L, Duff HJ. Identification and characteristics of
delayed rectifier K+ current in fetal mouse ventricular
myocytes. Am J Physiol. 1996;270:H2088H2093.
20.
Davies MP, An RH, Doevendans P, Kubalak S, Chien KR,
Kass RS. Developmental changes in ionic channel activity in the
embryonic murine heart. Circ Res. 1996;78:1525.
21.
Nuss HB, Marban E.
Electrophysiological properties of neonatal mouse
cardiac myocytes in primary culture. J Physiol (Lond). 1994;479:265279.
22.
Wang L, Feng Z-P, Kondo CS, Sheldon RS, Duff HJ.
Developmental changes in the delayed rectifier K+ channels in mouse
heart. Circ Res. 1996;79:7985.
23.
London B, Trudeau MC, Newton KP, Beyer AK, Copeland NG,
Gilbert DJ, Jenkins NA, Satler CA, Robertson GA. Two isoforms of the
mouse ether-a-go-go-related gene coassemble to form channels with
properties similar to the rapidly activating component of the cardiac
delayed rectifier K+ current. Circ Res. 1997;81:870878.
24.
Lees-Miller JP, Kondo C, Wang L, Duff HJ.
Electrophysiological characterization of an
alternatively processed ERG K+ channel in mouse and human hearts.
Circ Res. 1997;81:719726.
25. Vesely MR, Duggal P, London B, Wattanasirichaigoon D, Beggs AH. Complete analysis of the HERG gene for mutations in long QT syndrome [abstract]. Circulation. 1997;96:I-56.
26.
James JF, Hewett TE, Robbins J. Cardiac physiology
in transgenic mice. Circ Res. 1998;82:407415.
27.
Trimmer JS. Immunological identification and
characterization of a delayed rectifier K+ channel polypeptide in rat
brain. Proc Natl Acad Sci U S A.. 1991;88:1076410768.
28. Powell T. Methods for the preparation and characterization of cardiac myocytes. In: Dhalla NS, ed. Methods in Studying Cardiac Membranes. Vol 1. Boca Raton, Fla: CRC Press; 1984:4162.
29.
Berul CI, Aronovitz MJ, Wang PJ, Medelsohn ME. In vivo
cardiac electrophysiology studies in the mouse. Circulation. 1996;94:26412648.
30.
Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J,
Robbins J. Tissue-specific regulation of the
-myosin heavy
chain gene promoter in transgenic mice. J Biol Chem. 1991;266:2461324620.
31.
Yang T, Wathen MS, Felipe A, Tamkun MM, Snyders DJ,
Roden DM. K+ currents and K+ channel mRNA in cultured atrial cardiac
myocytes (AT-1 cells). Circ Res. 1994;75:870878.
32. McDonald TV, Yu Z, Ming Z, Palma E, Meyers MB, Wang K-W, Goldstein SAN, Fishman GI. A minK-HERG complex regulates the cardiac potassium current IKr. Nature. 1997;388:289292.[Medline] [Order article via Infotrieve]
33.
Follmer CH, Cullinan CA, Colatsky TJ. Differential
block of cardiac delayed rectifier current by class Ic antiarrhythmic
drugs: evidence for open channel block and unblock. Cardiovasc
Res. 1992;26:11211130.
34. Clay JR, Ogbaghebriel A, Paquette T, Sasyniuk BI, Shrier A. A quantitative description of the E-4031-sensitive repolarization current in rabbit ventricular myocytes. Biophys J. 1995;69:18301837.[Medline] [Order article via Infotrieve]
35.
Sanguinetti MC, Jurkiewicz NK. Two components of
cardiac delayed rectifier K+ current. J Gen Physiol. 1990;96:195215.
36.
Veldkamp MW, van Ginneken ACG, Opthof T, Bouman LN.
Delayed rectifier channels in human ventricular myocytes.
Circulation. 1995;92:34973504.
37.
Li G-R, Feng J, Yue L, Carrier M, Nattel S. Evidence
for two components of delayed rectifier K+ current in human
ventricular myocytes. Circ Res. 1996;78:689696.
38.
Gintant GA. Two components of delayed rectifier current
in canine atrium and ventricle. Does IKs play a role in the reverse
rate of dependence of class III agents? Circ Res. 1996;78:2637.
39.
Li X, Xu J, Li M. The human
1261 mutation of
the HERG potassium channel results in a truncated protein that contains
a subunit interaction domain and decreases the channel expression.
J Biol Chem. 1997;272:705708.
40.
Folco E, Mathur R, Mori Y, Buckett P, Koren G. A
cellular model for long QT syndrome. J Biol Chem. 1997;272:2650526510.
41.
London B, Jeron A, Zhous J, Buckett P, Han X, Mitchell
GF, Koren G. Long QT and ventricular arrhythmias in
transgenic mice expressing the N terminus and first transmembrane
segment of a voltage-gated potassium channel. Proc Natl Acad Sci
U S A. 1998;95:29262931.
42. Colatsky TJ, Hamilton TC. Potassium channel modulators: clinical experience and future prospects. In: Evans JM, Hamilton TC, Longman SD, Stemp G, eds. Potassium Channels and Their Modulators: From Synthesis to Clinical Experience. London, England: Taylor & Francis; 1996:383411.
43. Crijns HJGM, Kingma H, Gosselink ATM, Lie KI. Comparison in the same patient of aberrant conduction and bundle branch reentry after dofetilide, a new selective class III antiarrhythmic agent. PACE Pacing Clin Electrophysiol. 1993;16:10061016.[Medline] [Order article via Infotrieve]
44. Crijns HJGM, Kingma JH, Gosselink ATM, Dalrymple HW, DeLangen CDJ, Lie K. Sequential bilateral bundle branch block during dofetilide, a new class III antiarrhythmic agent in a patient with atrial fibrillation. J Cardiovasc Electrophysiol. 1993;4:459466.[Medline] [Order article via Infotrieve]
45. Hashiba K. Hereditary QT prolongation syndrome in Japan: genetic analysis and pathological findings of the conduction system. Jpn Circ J. 1978;42:11331150.[Medline] [Order article via Infotrieve]
46.
Phillips J, Ichinose H. Clinical and pathologic studies
in the hereditary syndrome of a long QT interval, syncopal spells and
sudden death. Chest. 1970;58:236243.
47.
Fraser GR, Froggatt P, James TN. Congenital deafness
associated with electrocardiographic abnormalities, fainting attacks
and sudden death. A recessive syndrome. Q J Med. 1964;33:361385.
48.
Morano I, Gerstner J, Ruegg JC, Ganten U, Ganten D,
Vosberg HP. Regulation of myosin heavy chain expression in the hearts
of hypertensive rats by testosterone. Circ Res. 1990;66:15851590.
49. Calovini T, Haase H, Morano I. Steroid-hormone regulation of myosin subunit expression in smooth and cardiac muscle. J Cell Biochem. 1995;59:6978.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
T. K. Roepke, A. Kontogeorgis, C. Ovanez, X. Xu, J. B. Young, K. Purtell, P. A. Goldstein, D. J. Christini, N. S. Peters, F. G. Akar, et al. Targeted deletion of kcne2 impairs ventricular repolarization via disruption of IK,slow1 and Ito,f FASEB J, October 1, 2008; 22(10): 3648 - 3660. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Arnaout, T. Ferrer, J. Huisken, K. Spitzer, D. Y. R. Stainier, M. Tristani-Firouzi, and N. C. Chi Zebrafish model for human long QT syndrome PNAS, July 3, 2007; 104(27): 11316 - 11321. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salama and B. London Mouse models of long QT syndrome J. Physiol., January 1, 2007; 578(1): 43 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Thomas, M. J. Killeen, I. S. Gurung, P. Hakim, R. Balasubramaniam, C. A. Goddard, A. A. Grace, and C. L.-H. Huang Mechanisms of ventricular arrhythmogenesis in mice following targeted disruption of KCNE1 modelling long QT syndrome 5 J. Physiol., January 1, 2007; 578(1): 99 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan and C. A. MacRae Animal models for arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Tranquillo, J. Hlavacek, and C. S. Henriquez An integrative model of mouse cardiac electrophysiology from cell to torso Europace, January 1, 2005; 7(s2): S56 - S70. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Brouillette, R. B. Clark, W. R. Giles, and C. Fiset Functional properties of K+ currents in adult mouse ventricular myocytes J. Physiol., September 15, 2004; 559(3): 777 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Clark, M. E. Mangoni, A. Lueger, B. Couette, J. Nargeot, and W. R. Giles A rapidly activating delayed rectifier K+ current regulates pacemaker activity in adult mouse sinoatrial node cells Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1757 - H1766. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. X. Liu, J. Zhou, S. Nattel, and G. Koren Single-channel recordings of a rapid delayed rectifier current in adult mouse ventricular myocytes: basic properties and effects of divalent cations J. Physiol., April 15, 2004; 556(2): 401 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kodirov, M. Brunner, J. M. Nerbonne, P. Buckett, G. F. Mitchell, and G. Koren Attenuation of IK,slow1 and IK,slow2 in Kv1/Kv2DN mice prolongs APD and QT intervals but does not suppress spontaneous or inducible arrhythmias Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H368 - H374. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Cho, M. Takano, and A. Noma The electrophysiological properties of spontaneously beating pacemaker cells isolated from mouse sinoatrial node J. Physiol., July 1, 2003; 550(1): 169 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Lees-Miller, J. Guo, J. R. Somers, D. E. Roach, R. S. Sheldon, D. E. Rancourt, and H. J. Duff Selective Knockout of Mouse ERG1 B Potassium Channel Eliminates IKr in Adult Ventricular Myocytes and Elicits Episodes of Abrupt Sinus Bradycardia Mol. Cell. Biol., March 15, 2003; 23(6): 1856 - 1862. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhou, S. Kodirov, M. Murata, P. D. Buckett, J. M. Nerbonne, and G. Koren Regional upregulation of Kv2.1-encoded current, IK,slow2, in Kv1DN mice is abolished by crossbreeding with Kv2DN mice Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H491 - H500. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Danik, C. Cabo, C. Chiello, S. Kang, A. L. Wit, and J. Coromilas Correlation of repolarization of ventricular monophasic action potential with ECG in the murine heart Am J Physiol Heart Circ Physiol, July 1, 2002; 283(1): H372 - H381. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Nerbonne, C. G. Nichols, T. L. Schwarz, and D. Escande Genetic Manipulation of Cardiac K+ Channel Function in Mice: What Have We Learned, and Where Do We Go From Here? Circ. Res., November 23, 2001; 89(11): 944 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Demolombe, G. Lande, F. Charpentier, M. A van Roon, M. J.B van den Hoff, G. Toumaniantz, I. Baro, G. Guihard, N. Le Berre, A. Corbier, et al. Transgenic mice overexpressing human KvLQT1 dominant-negative isoform Part I: Phenotypic characterisation Cardiovasc Res, May 1, 2001; 50(2): 314 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lande, S. Demolombe, A. Bammert, A. Moorman, F. Charpentier, and D. Escande Transgenic mice overexpressing human KvLQT1 dominant-negative isoform Part II: Pharmacological profile Cardiovasc Res, May 1, 2001; 50(2): 328 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. C. Hoppe, E. Marban, and D. C. Johns Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1 PNAS, April 24, 2001; 98(9): 5335 - 5340. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Thomas, L. Bircher-Lehmann, S. A. Thomas, J. Zhuang, J. E. Saffitz, and A. G. Kleber Synthetic Strands of Neonatal Mouse Cardiac Myocytes : Structural and Electrophysiological Properties Circ. Res., September 15, 2000; 87(6): 467 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jeron, G. F. Mitchell, J. Zhou, M. Murata, B. London, P. Buckett, S. D. Wiviott, and G. Koren Inducible polymorphic ventricular tachyarrhythmias in a transgenic mouse model with a long Q-T phenotype Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H1891 - H1898. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Chauhan, S. Tuvia, M. Buhusi, V. Bennett, and A. O. Grant Abnormal Cardiac Na+ Channel Properties and QT Heart Rate Adaptation in Neonatal AnkyrinB Knockout Mice Circ. Res., March 3, 2000; 86(4): 441 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zaniboni, A. E. Pollard, L. Yang, and K. W. Spitzer Beat-to-beat repolarization variability in ventricular myocytes and its suppression by electrical coupling Am J Physiol Heart Circ Physiol, March 1, 2000; 278(3): H677 - H687. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, S. Swirp, and H. Duff Age-dependent response of the electrocardiogram to K+ channel blockers in mice Am J Physiol Cell Physiol, January 1, 2000; 278(1): C73 - C80. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. H.T. Wehrens, S. Kirchhoff, and P. A. Doevendans Mouse electrocardiography: An interval of thirty years Cardiovasc Res, January 1, 2000; 45(1): 231 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. I. Akbarali, H. Thatte, X. D. He, W. R. Giles, and R. K. Goyal Role of HERG-like K+ currents in opossum esophageal circular smooth muscle Am J Physiol Cell Physiol, December 1, 1999; 277(6): C1284 - C1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Wickenden, P. Lee, R. Sah, Q. Huang, G. I. Fishman, and P. H. Backx Targeted Expression of a Dominant-Negative Kv4.2 K+ Channel Subunit in the Mouse Heart Circ. Res., November 26, 1999; 85(11): 1067 - 1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Selyanko, P. Delmas, J. K. Hadley, L. Tatulian, I. C. Wood, M. Mistry, B. London, and D. A. Brown Dominant-Negative Subunits Reveal Potassium Channel Families That Contribute to M-Like Potassium Currents J. Neurosci., March 1, 2002; 22(5): RC212 - RC212. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. London, W. Guo, X.-h. Pan, J. S. Lee, V. Shusterman, C. J. Rocco, D. A. Logothetis, J. M. Nerbonne, and J. A. Hill Targeted Replacement of Kv1.5 in the Mouse Leads to Loss of the 4-Aminopyridine-Sensitive Component of IK,slow and Resistance to Drug-Induced QT Prolongation Circ. Res., May 11, 2001; 88(9): 940 - 946. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |