Original Contributions |
From the Department of Pathology, University of Washington, Seattle.
| Abstract |
|---|
|
|
|---|
1(I)procollagen, tropoelastin, and
fibronectin, were expressed highly at 7 days after the reinjury.
Expression of tropoelastin remained upregulated for the entire 28 days
after the reinjury, whereas
1(I)procollagen and
fibronectin returned to the control level by 28 days. Protease activity
was also increased after reinjury. Within days, a marked increase in
urokinase plasminogen activator activity was
observed in intima, and this activity decreased to control level by 14
days. The activity of tissue plasminogen
activator did not change. The 95-kDa
gelatinolytic activity was increased 1 to 2 days
after the reinjury, but no change in other
gelatinolytic activities was observed. These
findings demonstrate that the accumulation of extracellular matrix is
important in the increase in lesion size after reinjury and that a
balance of matrix synthesis and degradation may explain why no change
in matrix volume was detected until 28 days after the reinjury.
Key Words: angioplasty extracellular matrix plasminogen activator matrix metalloproteinase
| Introduction |
|---|
|
|
|---|
The purpose of the present study was to determine matrix synthesis and degradation in rat arterial lesions after angioplasty. In particular, we focused on the expression of matrix genes and on the presence of matrix-degrading enzymes. Our studies showed that although matrix gene expression is upregulated within days after angioplasty, there was an important decrease in proteolytic enzyme at later times. Together, these factors may be responsible for the increase in matrix seen at this time.
| Materials and Methods |
|---|
|
|
|---|
For morphological analysis, rats were killed at 14 and 28 days after the reinjury and the sham operation. After death by overdose injection of sodium pentobarbital (intravenous Nembutal, Abbott Laboratories), animals were prepared by perfusion/fixation using 4% paraformaldehyde as described previously.10 The left common carotid was excised, and two segments of carotid between 5 and 10 mm from carotid bifurcation were used for transmission electron microscopy and volume density analysis, and segments between 3 and 5 mm from the bifurcation were used for quantifying intimal size. For RNA and protein extraction, rats were killed at various times after the reinjury and at 28 days after the first injury (control). One group of preoperative rats was killed to provide normal control media. Ten minutes before death by pentobarbital overdose, rats received an intravenous injection of Evans blue (200 µL of 5% solution, Sigma) to mark the deendothelialized area. Carotid arteries were briefly flushed with ice-cold lactated Ringer's solution (Baxter Healthcare Co) at physiological pressure to remove blood, and the whole length of left carotid was excised. The reinjured carotids were opened longitudinally after removing the surrounding connective tissue. The neointima was then stripped (at the internal elastic lamina) from the media. For zymography, the media was stripped (at the external elastic lamina) from the adventitia. All specimens were then snap-frozen in liquid nitrogen and stored at -80°C.
Transmission Electron Microscopy and Volume Density of Matrix
in Intima
The volume density of intimal ECM was determined by the method
using a 108-point square lattice test grid on a transmission electron
micrograph.15 The excised arteries were immersed
in phosphate-buffered 2.5% glutaraldehyde/2%
paraformaldehyde for >24 hours. Three small pieces of
artery were cut per animal (each
1 mm apart), postfixed in 1%
OsO4 for 1 hour, stained en bloc in 2% uranyl
acetate for 30 minutes, and embedded in Medcast (Ted Pella Inc).
Sections were cut from each block, stained with 6% uranyl acetate and
Reynolds lead citrate, and examined by a Jeol JEM 1200EXII transmission
electron microscope at 80 kV. Ten electron micrographs of the
neointima were taken randomly per section at a final
magnification of x3000; thus, 30 micrographs were taken of each
animal. The length of linear probes in the test grid was 7.5 mm.
The 108-point test grid was placed over the electron micrographs, and
points that fell on cells were counted (PCELL).
Volume density of ECM was calculated as
(108-PCELL)÷108 on each micrograph, and the
average of these values from 30 micrographs per animal was used for
statistical analysis.
Measurement of Intimal Size
To evaluate the relation between the intimal size and the matrix
volume of intima after reinjury, the intimal size of reinjured carotid
was quantified by light microscopy. The specimens were fixed in 4%
paraformaldehyde for 1 hour after cutting out and
embedded in paraffin. The three 4-µm sections (each
100 µm
apart) per animal were cut out and stained with hematoxylin. The
intimal area of each section was measured, as described
previously.10 Mean values of intimal size were
determined by averaging values from three sections and used for
statistical analysis.
RNA Extraction and Northern Blot Analysis
Tissue samples from >7 animals were mixed together and prepared
for each time point (total, 45 animals). Frozen arterial
tissue was ground to a fine powder under liquid nitrogen, and total
cellular RNA was isolated with Trizol (GIBCO BRL) according to the
manufacturer's instruction. The RNA concentration was measured by
absorption at 260 nm. Equal amounts (5 µg of total RNA) of each
extract were separated on formaldehyde agarose gel (1.2%) and
transferred to nylon membranes (Zeta-Probe, Bio-Rad Laboratories), as
described previously.16 After transfer, RNA blots
were exposed to shortwave UV light and baked at 80°C for 2 hours to
cross-link RNA to the membrane. The blots were prehybridized with
hybridization buffer (50% formamide, 0.75 mol/L NaCl, 50 mmol/L
Tris [pH 7.4], 1x Denhardt's solution, 1% SDS, 10% dextran
sulfate, and 200 µg/mL salmon sperm DNA) at 42°C for 6 hours and
hybridized with hybridization buffer containing
32P-labeled cDNA probes
(1.5x106 cpm/mL) at 42°C for 16 to 24 hours.
The cDNA probes were labeled with [32P]dCTP by
random primer extension (Multi-Prime, Amersham). After hybridization,
the blots were washed in two changes of 2x SSC/0.1% SDS for 15
minutes at room temperature and in two changes of 0.3x SSC/0.1% SDS
for 15 minutes at 65°C and then autoradiographed. To verify loading
in each lane, the blots were probed with a labeled
oligonucleotide directed to the 28S rRNA, with the
sequence 5' GCGAGAGCGCCAGCTATCCTGAGG 3'. End labeling of the
nucleotide, hybridization, and washing were carried out as
described.17 Intensity of the signals on Northern
blot and the 28S bands were measured by densitometric analysis
of autoradiogram. X-ray films were scanned with a
transmissive scanner (UMAX UC1260, UMAX Data System Inc) using
Photoshop software (version 3.0), and the transmittance values were
converted to values of optical density by NIH Image software (version
1.59). The profile of each band was plotted using NIH Image, and the
area of peak corresponding to each band was measured as intensity
value. The mRNA signals in each lane were compared by using a ratio of
the signal to 28S rRNA. To reuse the blot, probes were stripped
according to the manufacturer's instruction for the membrane.
cDNA probes used were as follows:
1(I)procollagen, a
390-bp mouse cDNA, was generously provided by Dr P. Bornstein,
University of Washington, Seattle; tropoelastin, a 900-bp rat cDNA, was
a kind gift of Dr T.N. Wight, University of Washington,
Seattle18; fibronectin, clone
rlf1 from rat,
was generously supplied by Dr R.O. Hynes, Massachusetts Institute of
Technology, Cambridge19; TGF-ß1, a 985-bp rat
cDNA, was kindly provided by Dr A.B. Roberts, NCI/NIH, Bethesda,
Md20; UPA, a 380-bp rat cDNA, and TPA, a 380-bp
rat cDNA, were kindly supplied by Dr J.L. Degen, Children's Hospital
Medical Center, Cincinnati, Ohio.21
Zymography
Arteries from 5 animals per each time (total, 35 animals) were
pooled and pulverized under liquid nitrogen and incubated in ice-cold
lysis solution (1% SDS, 50 mmol/L Tris [pH 7.6], and 10 mg/mL
leupeptin) for 30 minutes while being pulled through a 23-gauge needle.
Insoluble matter was removed by centrifugation, and the
protein concentration was measured by bicinchoninic acid assay
(Pierce). Lysates were incubated with sample buffer (1% SDS, 10%
glycerol, 50 mmol/L Tris [pH 6.8], and 0.01% bromophenol blue
[final concentration]) for 15 minutes at 4°C for zymographic assay
of PAs and gelatinolytic enzymes or incubated with
sample buffer containing 2.5% 2-mercaptoethanol for reverse zymography
of PAI. To detect the activities of PAs and PAI, equal amounts (10 µg
of total protein) of each sample were separated on 8% SDS-PAGE. The
gel was soaked in two changes of 2.5% Triton X-100 (Sigma) for 45
minutes each time and in two changes of 100 mmol/L Tris (pH 8.1)
for 30 minutes each time at room temperature before being layered on
the substrate gels. For PA zymography, substrate gels consisted of a
mixture of 1.25% agar, 2% nonfat milk, and 40 µg/mL
plasminogen from human plasma (Sigma) in 100 mmol/L
Tris (pH 8.1) on a flat glass,22 and 50 mU/mL
urokinase (human high molecular weight, Calbiochem) was added to the
substrate gel for reverse zymography to detect PAI
activity.23 These zymograms were allowed to
develop at 37°C for 3 to 24 hours, and photographs were taken using
dark-ground illumination. To estimate the
gelatinolytic activity, equal amounts (10 µg of
total protein) of each sample were applied onto 8% SDS-PAGE
copolymerized with 0.1% gelatin (Sigma) as
substrate.24 After electrophoresis, the gels were
soaked in 2.5% Triton X-100 for 30 minutes at room temperature with
one change of the solution, followed by overnight incubation at 37°C
in incubation buffer (50 mmol/L Tris [pH 8.1], 2.5 mmol/L
CaCl2, and 0.02% NaN3). To
stop the reaction, the gels were washed in 10% trichloracetic acid
(Baker) and then stained with rapid Coomassie stain (Diversified
Biotech) for 30 minutes, destained in 30% methanol/10% acetic acid,
and photographed.
Western Blot Analysis
Equal amounts (10 µg of total protein) of each lysate
were incubated for 15 minutes at 4°C with sample buffer containing
2.5% 2-mercaptoethanol to detect PAI-1. Samples were separated on 8%
SDS-PAGE and transferred to nitrocellulose membrane (Protran,
Schleicher & Schuell). Blocking, incubation with antibodies, washing,
and detection by enhanced chemiluminescence (Amersham) were carried out
according to the protocol described previously.10
The primary antibody used for the analysis was a rabbit
polyclonal antibody against rat PAI-1 (American Diagnostica
Inc).
Statistics
The difference in matrix volume density between reinjured rats
and sham-operated rats was analyzed by unpaired Student
t test, and the Pearson correlation coefficient was used to
examine the correlation between intimal size and matrix volume density
after reinjury. All data were considered significant at
P<0.05.
| Results |
|---|
|
|
|---|
|
|
It should be noted that the volume density of the matrix was obtained
from individual animals and average values are shown (Figure 2A
). This
is in contrast to the data presented below, for which it was
necessary to pool tissues from different animals to determine gene
expression or proteolytic activities.
Expression of Matrix and TGF-ß1 Genes
The expressions of
1(I)procollagen, tropoelastin,
and fibronectin genes were examined using Northern blot
analysis. At 7 days after the reinjury, expression of mRNA for
all three was increased in the intima (Figure 3
). Expression of
1(I)procollagen returned to the control level by 14 days
after the reinjury (Figure 3A
and 3a
), whereas the expression of
tropoelastin was still elevated 28 days after the reinjury (Figure 3B
and 3b
). An increase in fibronectin expression was observed at 7 to 14
days after the reinjury, although the level was decreased by day 28
(Figure 3C
and 3c
). TGF-ß1 expression in the intima was also
upregulated at all times studied after reinjury (Figure 3D
and 3d
).
|
In the media after the reinjury, no significant change was observed in
the expression of
1(I)procollagen, fibronectin,
tropoelastin, or TGF-ß1 (data not shown).
PA Activity and Expression
The above data show that an increase in matrix synthesis occurred
at times after reinjury when no apparent change in matrix volume
density was detected. One possible explanation for this findings is
that the newly synthesized matrix was degraded. Therefore, we measured
the activity of PAs and gelatinolytic enzymes in
these arteries.
PA activity, assessed by zymography, showed an increase in UPA activity
1 day after the reinjury, but thereafter, the activity decreased
gradually and returned to baseline by day 14 (Figure 4A
). TPA activity in the intima, however,
did not change (Figure 4B
). In the media, UPA activity increased after
reinjury in a pattern similar to that for the intima, and no
significant change in TPA activity was detected after reinjury (Figure 4C
).
|
Expression of UPA mRNA increased at 2 and 7 days after the reinjury in
the intima and returned to the control level by day 14 (Figure 5A
and 5a
). In contrast, TPA expression
in intima was downregulated at 2 days after the reinjury but returned
to control level by day 14 (Figure 5B
and 5b
). In media, neither UPA
nor TPA mRNA changed significantly after reinjury (data not shown).
|
PAI Activity and Protein Expression in Intima
Both UPA and TPA are blocked by PAI; therefore, we wished to
determine whether this PAI was also regulated by reinjury. Reverse
zymogram showed a lysis-resistant zone at
50 kDa, suggesting
PAI activity (Figure 6A
). This activity
was detected at 2 days and reached its maximum at 4 days after the
reinjury. No PAI activity was detected at day 14. A Western blot for
rat PAI-1 also showed a 49-kDa protein whose expression was increased
at day 2, with strong expression at day 4 (Figure 6B
). PAI-1 was still
detected by day 7 but not by day 14.
|
Gelatinolytic Activity
In the control vessel, four prominent bands of
gelatinolytic activity were present in both the
intima and media, with molecular masses of 55, 62, 70, and 88 kDa
(Figure 7
). At 1 and 2 days after the
reinjury, an extra band of 95 kDa appeared in both the intima and
media, but it disappeared by day 4 (Figure 7
). No significant changes
in other gelatinolytic activities were observed in
either the intima or media (Figure 7
). We believe that 88- and 95-kDa
gelatinolytic activities represented
active and latent forms of MMP-9, respectively.25
The 70-kDa activity corresponded to a latent form of MMP-2, and the 55-
and 62-kDa activities probably represented its active
form.26 27
|
| Discussion |
|---|
|
|
|---|
11% of the neointimal
volume of human restenotic samples and that the other part was
ECM. The increase in matrix volume density in these rat tissues would
support these data. Serial coronary angiography after PTCA has
revealed that restenosis developed between the first and third
month after angioplasty,31 and it is interesting
to note that the increase in these rat lesions was first observed at
day 28. In the development of human lesions, there are several critical
aspects not seen in the rat reinjury model, such as inflammatory cell
infiltration, lipid deposition, and mural
thrombus,10 32 and care must be taken in
extrapolating our data with the progression of lesion growth in
humans. Since an increase in lesion size was detected 28 days after the reinjury, we would have predicted matrix molecules to be strongly expressed at late times (14 to 28 days) after the reinjury. Surprisingly, this was found not to be true, and our data show that although three common matrix molecules investigated in the present study were strongly expressed in the intima at 7 days after the reinjury, only tropoelastin was expressed above background levels after 28 days. Even allowing for a delay between matrix expression and our ability to detect any matrix accumulation, this result was unexpected. Therefore, we examined changes in expression and activity of proteolytic enzymes that are known to be expressed by rat arterial cells,24 33 34 since any accumulation of matrix is a balance between synthesis and its degradation. An increase in UPA mRNA was noted in the intima at 2 and 7 days after the reinjury, but the expression was downregulated to background levels by 14 days. Surprisingly, UPA activity was highest at day 1 and decreased thereafter. A similar discrepancy between UPA expression and activity has been observed in a normal rat carotid subjected to balloon injury, with no obvious explanation.33 One possibility is that the activity values of UPA are influenced by the presence of PAI-1. The activity of this PAI in the intima peaked at 4 days after the reinjury, which is the same time when UPA activity was decreased. One possibility, therefore, is that diminished UPA activity, despite an increase in mRNA, can be attributed to the presence of PAI-1.
TPA mRNA expression in the intima was downregulated at 2 and 7 days after the reinjury, but there was no change in its activity. The lack of concordance between activity and expression may be due to plasma-derived TPA. This could be because of net TPA synthesis by endothelial cells and an increase in plasma concentrations. The fact that these lesions do not possess an intact endothelium would render the arterial wall permeable to plasma proteins, which would include TPA.35 36
The presence of increased PA activity at early times (1 to 7 days) after reinjury may explain why no increase in matrix accumulation was detected at the early times after reinjury but does not provide an answer as to why an increase in ECM was detected 28 days after reinjury. In understanding this result, it is important to note that of the three common matrix molecules expressed after reinjury, only tropoelastin is significantly elevated at 14 and 28 days. Elastin is not a preferred substrate for plasmin,37 but MMPs do have elastinolytic activity.38 39 In these reinjured lesions, 95-kDa gelatinolytic activity (latent form of MMP-9) was detected at 1 to 2 days after the reinjury, but other gelatinolytic activities were not increased. We and others have not detected other elastases in the intima of rat arteries, and few macrophages, which possess an elastase, are detected in these lesions.10 24 40 Thus, an increase in tropoelastin expression is not accompanied by elastinolytic activity. Under these conditions, an increase in elastin would be anticipated. Indeed, electron microscopy confirms that elastin fibrils are abundant in the lesions of arteries after reinjury.
Why SMCs express tropoelastin in preference to other matrix proteins is
not clear but may relate to a change in the ability of the artery to
respond to the arterial wall stress. An increase in stretch
and/or tensile stress is frequently associated with an increase in
elastin synthesis by arterial
SMCs.41 42 One possibility, therefore, is that
the elastic lamellae were damaged by angioplasty and that as a
reparative response, the SMCs express tropoelastin. This suggestion is
supported by the finding that hypertension induces elastin expression
and that increased stretch of pulmonary arteries causes a
9-fold increase in elastin with only a 2-fold increase in
collagen.43 In rat arteries, Nikkari et
al18 showed an increase in elastin as well as
other matrix molecules after balloon injury, and the increase in
expression of elastin was strong and remained high even after 28 days.
Capron et al44 found a significant increase of
elastin volume 14 days after reinjury to atherosclerotic rat aorta,
although the same authors detected no significant increase in collagen
volume. Furthermore, in a rabbit model, Strauss et
al11 found that elastin content at 28 days
increased
30% after the reinjury; however, collagen content was
unchanged. Our observation of an increase in tropoelastin expression
would support the concept that elastin is a major component of the
arterial lesion after a sequential injury to an intimal
lesion.
In the present study, we chose to examine those matrix proteins
that are abundantly expressed in rat arteries. Furthermore, one hope
was that we might provide collaborative data for at least
1(I)procollagen and tropoelastin from an ultrastructural
examination of these arteries. With respect to tropoelastin, it would
appear that our choice was well founded. These data, however, do not
rule out the possibility that other matrix proteins such as
proteoglycan(s) may contribute to the intimal
lesion.11 18
In a similar manner, other MMPs may be active in these arteries. We limited the present study to examine the gelatinases, since they are the only MMPs that we have found in both normal and injured rat arteries.24 Furthermore, it is possible that a change in the tissue inhibitors of MMP expression could influence MMP activity,45 46 and future studies will examine their role in these arteries.
TGF-ß1 expression in the intima is upregulated after reinjury, and
one consideration is that this cytokine is responsible for the
increased expression of matrix proteins in these arteries, since there
are many studies showing that TGF-ß1 induces matrix synthesis in
vascular cells.47 48 49 50 In the
present study, TGF-ß1 expression is upregulated for the
entire 28 days after the reinjury, yet expression of
1(I)procollagen and fibronectin returned to
control level at late times (14 to 28 days). One explanation for the
weak correlation between expression of the matrix genes and TGF-ß1
may relate to the action of plasmin as a
physiological activator of
TGF-ß1.51 In the present study, intimal UPA
activity was detected at only the early times (1 to 7 days) and not at
14 days after the reinjury. If TGF-ß1 is activated by plasmin
and consequently by expression of the UPA, then matrix expression
correlates well with the upregulation of UPA activity. In contrast,
tropoelastin is expressed through the entire experimental period and
does not correlate well with UPA expression. As stated above, one
possibility is that the angioplasty-induced injury to the artery may
regulate its expression. In support of this, recent studies have shown
that in pulmonary hypertension, the increase in matrix is not
related to any expression of TGF-ß1.52 53
The expression of proteases including TPA and MMPs has also been linked to the migration of SMCs into the intima.24 33 54 Indeed, a block of migration can impede the growth of intimal lesion in a balloon-injured artery.55 56 These data were obtained using rat arteries, which do not normally possess an intima with SMCs; therefore, migration of SMCs is necessary for the development of an intimal lesion. We do not know whether the movement of cells into the intima is important for the growth of lesions in arteries with a preexisting intima. In this present study, we were not able to directly measure the migration of cells, since this is not possible if an intima already exists. However, there was only a transitory increase in UPA activity with no change in either TPA activity or the gelatinolytic activities representing active forms of MMPs. This finding should be contrasted with the results following balloon catheter injury of a normal artery, after which increases in both TPA and MMP activity are detected for several days and there is a significant increase in cell migration.24 33 54 Thus, although there are no direct data, it would appear that migration of SMCs does not occur after angioplasty of a preexisting arterial lesion.
In summary, the present study showed that matrix accumulation was a critical reason for the lesion increase observed at 28 days after the reinjury and that the matrix accumulation depended on a balance between the matrix synthesis and degradation. Matrix synthesis was increased 7 days after the reinjury and partially continued up to 28 days, and the prolonged synthesis was mainly dependent on tropoelastin. Meanwhile, in matrix degradation, activity of UPA quickly increased after the reinjury and returned to the baseline level by day 14, whereas there was no change in TPA activity or the gelatinolytic activities representing active forms of MMPs. These data explain why matrix accumulation appeared at 28 days after the injury and not at earlier time points.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received November 10, 1997; accepted March 2, 1998.
| References |
|---|
|
|
|---|
2.
Essed CE, van den Brand M, Becker AE. Transluminal
coronary angioplasty and early restenosis:
fibrocellular occulusion after wall laceration. Br Heart
J. 1983;49:393396.
3. Austin GE, Ratliff NB, Hollman J, Tabei S, Phillips DF. Intimal proliferation of smooth muscle cells as an explanation for recurrent coronary artery stenosis after percutaneous transluminal coronary angioplasty. J Am Coll Cardiol. 1985;6:369375.[Abstract]
4.
MERCATOR Study Group. Does the new
angiotensin converting enzyme inhibitor
cilazapril prevent restenosis after
percutaneous transluminal coronary angioplasty?
Results of the MERCATOR study: a multicenter, randomized, double-blind
placebo-controlled trial. Circulation. 1992;86:100110.
5.
Faxon DP, Spiro TE, Minor S, Coté G, Douglas J,
Gottlieb R, Califf R, Dorosti K, Topol E, Gordon JB, Ohmen M, the ERA
Investigators. Low molecular weight heparin in prevention of
restenosis after angioplasty: results of Enoxaparin
restenosis (ERA) trial. Circulation. 1994;90:908914.
6.
Emanuelsson H, Beatt KJ, Bagger J, Balcon R,
Heikkilä J, Piessens J, Schaeffer M, Suryapranata H, Foegh M.
Long-term effects of angiopeptin treatment in coronary
angioplasty: reduction of clinical events but not angiographic
restenosis. Circulation. 1995;91:16891696.
7. Groves HM, Kinlough-Rathbone RL, Richardson M, Moore S, Mustard JF. Platelet interaction with damaged rabbit aorta. Lab Invest. 1979;40:194200.[Medline] [Order article via Infotrieve]
8. Clowes AW, Reidy MA, Clowes MM. Kinetics of cellular proliferation after arterial injury, I: smooth muscle growth in the absence of endothelium. Lab Invest. 1983;49:327333.[Medline] [Order article via Infotrieve]
9. Guyton JR, Dao DT, Lindsay KL. Endothelial denudation and myointimal thickening in the rat carotid artery induced by the passage of bubbles. Exp Mol Pathol. 1984;40:340348.[Medline] [Order article via Infotrieve]
10. Koyama H, Reidy MA. Reinjury of arterial lesions induces intimal smooth muscle cell replication that is not controlled by fibroblast growth factor 2. Circ Res. 1997;80:408417.
11.
Strauss BH, Chisholm RJ, Keeley FW, Gotlieb AI, Logan
RA, Armstrong PW. Extracellular matrix remodeling after balloon
angioplasty injury in a rabbit model of restenosis. Circ
Res. 1994;75:650658.
12.
Strauss BH, Robinson R, Batchelor WB, Chrisholm RJ,
Ravi G, Natarajan MK, Logan RA, Mehta SR, Levy DE, Ezrin AM, Keeley
FW. In vivo collagen turnover following experimental balloon
angioplasty injury and the role of matrix metalloproteinases.
Circ Res. 1996;79:541550.
13.
Karim MA, Miller DD, Farrar MA, Eleftheriades E, Reddy
BH, Breland CM, Samarel AM. Histomorphometric and biochemical
correlates of arterial procollagen gene expression during
vascular repair after experimental angioplasty. Circulation. 1995;91:20492057.
14. Coats WD, Cheung DT, Han B, Currier JW, Faxon DP. Balloon angioplasty significantly increases collagen content but does not alter collagen subtype I/III ratios in the atherosclerotic rabbit iliac model. J Mol Cell Cardiol. 1996;28:441446.[Medline] [Order article via Infotrieve]
15. Snow AD, Bolender RP, Wight TN, Clowes AW. Heparin modulates the composition of the extracellular matrix domain surrounding arterial smooth muscle cells. Am J Pathol. 1990;137:313330.[Abstract]
16.
Majesky MW, Benditt EP, Schwartz SM. Expression and
developmental control of platelet-derived growth factor A-chain and
B-chain/Sis genes in rat aortic smooth muscle cells.
Proc Natl Acad Sci U S A.. 1988;85:15241528.
17. Murry CE, Giachelli CM, Schwartz SM, Vracko R. Macrophages express osteopontin during repair of myocardial necrosis. Am J Pathol. 1994;145:14501462.[Abstract]
18. Nikkari ST, Järveläinen HT, Wight TN, Ferguson M, Clowes AW. Smooth muscle cell expression of extracellular matrix genes after arterial injury. Am J Pathol. 1994;144:13481356.[Abstract]
19. Schwarzbauer JE, Tamkun JW, Lemischka IR, Hynes RO. Three different fibronectin mRNAs arise by alternative splicing within the coding region. Cell. 1983;35:421431.[Medline] [Order article via Infotrieve]
20.
Qian SW, Kondaiah P, Roberts AB, Sporn MB. cDNA cloning
by PCR of rat transforming growth factor beta-1. Nucleic Acids
Res. 1990;18:3059.
21.
Reidy MA, Irvin C, Lindner V. Migration of
arterial wall cells: expression of plasminogen
activators and inhibitors in injured rat
arteries. Circ Res. 1996;78:405414.
22.
Vassalli J, Dayer J, Wohlwend A, Belin D. Concomitant
secretion of prourokinase and of plasminogen
activator-specific inhibitor by cultured human
monocytes-macrophages. J Exp Med. 1984;159:16531668.
23.
Loskutoff DJ, van Mourik JA, Erickson LA, Lawerence D.
Detection of an unusually stable fibrinolytic inhibitor
produced by bovine endothelial cells. Proc Natl
Acad Sci U S A.. 1983;80:29562960.
24.
Bendeck MP, Zempo N, Clowes AW, Galardy RE, Reidy MA.
Smooth muscle cell migration and matrix metalloproteinases expression
after arterial injury in the rat. Circ Res. 1994;75:539545.
25. Lyons JG, Birkedal-Hansen B, Moore WGI, O'Grady RL, Birkedal-Hansen H. Characteristics of a 95-kDa matrix metalloproteinase produced by mammary carcinoma cells. Biochemistry. 1991;30:14491456.[Medline] [Order article via Infotrieve]
26.
Salo T, Liotta LA, Tyggvason K. Purification and
characterization of a murine basement membrane collagen-degrading
enzyme secreted by metastatic tumor cells. J Biol Chem. 1983;258:30583063.
27. Marti H, McNeil L, Davies M, Martin J, Lovett DH. Homology cloning of rat 72 kDa type IV collagenase: cytokine and second-messenger inducibility in glomerular mesangial cells. Biochem J. 1993;291:441446.
28. Nobuyoshi M, Kimura T, Ohishi H, Horiuchi H, Nosaka H, Hamasaki N, Yokoi H, Kim K. Restenosis after percutaneous transluminal coronary angioplasty: pathologic observations in 20 patients. J Am Coll Cardiol. 1991;17:433439.[Abstract]
29. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol. 1991;17:758769.[Abstract]
30. Schwartz RS, Holmes DRJ, Topol EJ. The restenosis paradigm revisited: an alternative proposal for cellular mechanisms. J Am Coll Cardiol. 1992;20:12841293.[Abstract]
31. Nobuyoshi M, Kimura T, Nosaka H, Mioka S, Ueno K, Yokoi H, Hamasaki N, Horiuchi H, Ohishi H. Restenosis after successful percutaneous transluminal coronary angioplasty: serial angiographic follow-up of 229 patients. J Am Coll Cardiol. 1988;12:616623.[Abstract]
32. Jackson CL. Animal models of restenosis. Trends Cardiovasc Med. 1994;4:122130.
33.
Clowes AW, Clowes MM, Au YPT, Reidy MA, Belin D. Smooth
muscle cells express urokinase during mitogenesis and tissue-type
plasminogen activator during migration in
injured rat carotid artery. Circ Res. 1990;67:6167.
34. Jackson CL, Reidy MA. Basic fibroblast growth factor: its role in the control of smooth muscle cell migration. Am J Pathol. 1993;143:10241031.[Abstract]
35. Reidy MA, Clowes AW, Schwartz SM. Endothelial regeneration, V: inhibition of endothelial regrowth in arteries of rat and rabbit. Lab Invest. 1983;49:569575.[Medline] [Order article via Infotrieve]
36. Lindner V, Reidy MA, Fingerle J. Regrowth of arterial endothelium: denudation with minimal trauma leads to complete endothelial cell regrowth. Lab Invest. 1989;61:556563.[Medline] [Order article via Infotrieve]
37. Chapman HA, Stone OL. Co-operation between plasmin and elastase in elastin degradation by intact murine macrophages. Biochem J. 1984;222:721728.[Medline] [Order article via Infotrieve]
38.
Senior RM, Griffin GL, Fliszar CJ, Shapiro SD, Goldberg
GI, Welgus HG. Human 92- and 72-kilodalton type IV
collagenases are elastases. J Biol
Chem. 1991;266:78707875.
39. Shapiro SD, Campbell EJ, Welgus HG, Senior RM. Elastin degradation by mononuclear phagocytes. Ann N Y Acad Sci. 1991;624:6980.[Medline] [Order article via Infotrieve]
40. Zempo N, Kenagy RD, Au YPT, Bendeck M, Clowes MM, Reidy MA, Clowes AW. Matrix metalloproteinases of vascular wall cells are increased in balloon-injured rat carotid artery. J Vasc Surg. 1994;20:209217.[Medline] [Order article via Infotrieve]
41.
Kolpakov V, Rekhter MD, Gordon D, Wang WH, Kulik TJ.
Effect of mechanical forces on growth and matrix protein synthesis in
the in vitro pulmonary artery: analysis of the role of
individual cell types. Circ Res. 1995;77:823831.
42.
Ben-Driss A, Benessiano J, Poitevin P, Levy BI, Michel
JB. Arterial expansive remodeling induced by high flow
rates. Am J Physiol. 1997;272:H851H858.
43.
Poiani GJ, Tozzi CA, Yohn SE, Pierce RA, Belsky SA,
Berg RA, Yu SY, Deak SB, Riley DJ. Collagen and elastin
metabolism in hypertensive pulmonary arteries of
rats. Circ Res. 1990;66:968978.
44.
Capron L, Jarnet J, Heudes D, Joseph-Monrose D,
Bruneval P. Repeated balloon injury of rat aorta: a model of
neointima with attenuated inhibition by heparin.
Arterioscler Thromb Vasc Biol. 1997;17:16491656.
45.
Hasenstab D, Forough R, Clowes AW.
Plasminogen activator inhibitor
type 1 and tissue inhibitor of metalloproteinases-2
increase after arterial injury in rats. Circ
Res. 1997;80:490496.
46.
Webb KE, Henney AM, Anglin S, Humphries SE, McEwan JR.
Expression of matrix metalloproteinases and their inhibitor
TIMP-1 in the rat carotid artery after balloon injury.
Arterioscler Thromb Vasc Biol. 1997;17:18371844.
47.
Chen J, Hoshi H, McKeehan WL. Transforming growth
factor type ß specifically stimulates the synthesis of
proteoglycan in human adult arterial smooth muscle cells.
Proc Natl Acad Sci U S A.. 1987;84:52875291.
48. Liu J, Davidson JM. The elastogenic effect of recombinant transforming growth factor-beta on porcine aortic smooth muscle cells. Biochem Biophys Res Commun. 1988;154:895901.[Medline] [Order article via Infotrieve]
49.
Nabel EG, Shum L, Pompili VJ, Yang Z, San H, Shu HB,
Liptay S, Gold L, Gordon D, Derynck R, Nabel GJ. Direct transfer of
transforming growth factor ß1 gene into arteries stimulates
fibrocellular hyperplasia. Proc Natl Acad Sci U S A.. 1993;90:1075910763.
50.
Kanzaki T, Tamura K, Takahashi K, Saito Y, Akikusa B,
Oohashi H, Kasayuki N, Ueda M, Morisaki N. In vivo effect of
TGF-ß1: enhanced intimal thickening by administration of
TGF-ß1 in rabbit arteries injured with a balloon catheter.
Arterioscler Thromb Vasc Biol. 1995;15:19511957.
51.
Lyons RM, Gentry LE, Purchio AF, Moses HL. Mechanism of
activation of latent recombinant transforming growth factor ß1
by plasmin. J Cell Biol. 1990;110:13611367.
52. Botney MD, Parks WC, Crouch EC, Stenmark K, Mecham RP. Transforming growth factor-beta 1 is decreased in remodeling hypertensive bovine pulmonary arteries. J Clin Invest. 1992;89:16291635.
53. Botney MD, Bahadori L, Gold LI. Vascular remodeling in primary pulmonary hypertension: potential role for transforming growth factor-beta. Am J Pathol. 1994;144:286295.[Abstract]
54.
Jackson CL, Raines EW, Ross R, Reidy MA. Role of
endogenous platelet-derived growth factor in
arterial smooth muscle cell migration after balloon
catheterization. Arterioscler Thromb. 1993;13:12181226.
55.
Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA,
Ross R. Inhibition of neointimal smooth muscle accumulation
after angioplasty by an antibody to PDGF. Science. 1991;253:11291132.
56.
Bendeck MP, Irvin C, Reidy MA. Inhibition of matrix
metalloproteinase activity inhibits smooth muscle cell migration but
not neointimal thickening after arterial
injury. Circ Res. 1996;78:3843.
This article has been cited by other articles:
![]() |
M. Degertekin, P. A. Lemos, C. H. Lee, K. Tanabe, J.E. Sousa, A. Abizaid, E. Regar, G. Sianos, W. J. van der Giessen, P. J. de Feyter, et al. Intravascular ultrasound evaluation after sirolimus eluting stent implantation for de novo and in-stent restenosis lesions Eur. Heart J., January 1, 2004; 25(1): 32 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kishore, C. Luedemann, E. Bord, D. Goukassian, and D. W. Losordo Tumor Necrosis Factor-Mediated E2F1 Suppression in Endothelial Cells: Differential Requirement of c-Jun N-Terminal Kinase and p38 Mitogen-Activated Protein Kinase Signal Transduction Pathways Circ. Res., November 14, 2003; 93(10): 932 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. M. Weiser-Evans, P. E. Schwartz, N. A. Grieshaber, B. E. Quinn, S. S. Grieshaber, J. K. Belknap, P. M. Mourani, R. A. Majack, and K. R. Stenmark Novel Embryonic Genes Are Preferentially Expressed by Autonomously Replicating Rat Embryonic and Neointimal Smooth Muscle Cells Circ. Res., September 29, 2000; 87(7): 608 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Rekhter Collagen synthesis in atherosclerosis: too much and not enough Cardiovasc Res, February 1, 1999; 41(2): 376 - 384. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |