Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1998;82:988-995

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koyama, H.
Right arrow Articles by Reidy, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koyama, H.
Right arrow Articles by Reidy, M. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
(Circulation Research. 1998;82:988-995.)
© 1998 American Heart Association, Inc.


Original Contributions

Expression of Extracellular Matrix Proteins Accompanies Lesion Growth in a Model of Intimal Reinjury

Hiroyuki Koyama, , Michael A. Reidy

From the Department of Pathology, University of Washington, Seattle.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Reinjury of rat arterial lesions induces an increase in lesion size that is not associated with an increase in cell number. In this study, matrix volume was examined after reinjury to preexisting lesions, and the kinetics of matrix gene expression and activity of proteolytic enzymes in the lesion were evaluated. Volume densitometry in intima showed a significant increase in matrix volume 28 days after the reinjury, although no change was observed at 14 days. Three common vascular matrix molecules, {alpha}1(I)procollagen, tropoelastin, and fibronectin, were expressed highly at 7 days after the reinjury. Expression of tropoelastin remained upregulated for the entire 28 days after the reinjury, whereas {alpha}1(I)procollagen and fibronectin returned to the control level by 28 days. Protease activity was also increased after reinjury. Within days, a marked increase in urokinase plasminogen activator activity was observed in intima, and this activity decreased to control level by 14 days. The activity of tissue plasminogen activator did not change. The 95-kDa gelatinolytic activity was increased 1 to 2 days after the reinjury, but no change in other gelatinolytic activities was observed. These findings demonstrate that the accumulation of extracellular matrix is important in the increase in lesion size after reinjury and that a balance of matrix synthesis and degradation may explain why no change in matrix volume was detected until 28 days after the reinjury.


Key Words: angioplasty • extracellular matrix • plasminogen activator • matrix metalloproteinase


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Intimal hyperplasia is thought to play a critical role in the development of restenosis in the atherosclerotic artery,1 2 3 but mechanisms promoting these lesions have been poorly understood. Animal models of arterial injury have significantly increased our understanding of how lesions develop, although thus far the data obtained from these experiments have not led to improved treatment of restenosis in humans.4 5 6 One possible reason is that most in vivo studies have examined the response of a normal healthy artery to mechanical injury, and restenosis is known to occur in previously diseased arteries.7 8 9 We previously studied the response of rat carotid arteries with preexisting lesions to angioplasty injury (reinjury model).10 We found that SMC replication was limited to a short window of time immediately after injury and that the increase in lesion size was not associated with an increase in cell number.10 One possible explanation for this latter result was that the increase in intimal lesion size was attributed to an increase in matrix content. Indeed, Strauss and colleagues11 12 have shown in a rabbit reinjury model that the accumulation of ECM was a major factor in stenosis formation; they suggested that regulation of both collagen synthesis and degradation was important. Other angioplasty models using atherosclerotic rabbits have also shown that the collagen content increased significantly 28 days after the angioplasty.13 14

The purpose of the present study was to determine matrix synthesis and degradation in rat arterial lesions after angioplasty. In particular, we focused on the expression of matrix genes and on the presence of matrix-degrading enzymes. Our studies showed that although matrix gene expression is upregulated within days after angioplasty, there was an important decrease in proteolytic enzyme at later times. Together, these factors may be responsible for the increase in matrix seen at this time.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Arterial Reinjury Model
Male Sprague-Dawley rats (B&K Universal, Kent, Wash), aged 3 to 4 months, were used in all experiments, and all surgery was performed under general anesthesia with an intraperitoneal injection of xylazine (Xyla-ject, 4.6 mg/kg body wt, Phoenix Pharmaceutical Inc) and ketamine (Ketaject, 70 mg/kg body wt, Phoenix Pharmaceutical Inc). Animals were subjected to reinjury of the left common carotid, as described previously.10 The left common carotid was injured three times with a 2F Fogarty catheter (Baxter Healthcare Co) introduced through the left femoral artery (first injury). At 28 days after the first injury, a reinjury or sham operation was performed. A 1.5-mm-diameter coronary dilation catheter (ACS TEN; balloon length, 20 mm; Advanced Cardiovascular Systems Inc) was introduced through the left external carotid, and the proximal edge of the catheter was positioned at carotid bifurcation. The injury consisted of two 1-minute inflations of the balloon at 4 atm with a 30-second interval (reinjury). For the sham operation, the left external carotid artery was exposed and ligated without dilation of the common carotid.

For morphological analysis, rats were killed at 14 and 28 days after the reinjury and the sham operation. After death by overdose injection of sodium pentobarbital (intravenous Nembutal, Abbott Laboratories), animals were prepared by perfusion/fixation using 4% paraformaldehyde as described previously.10 The left common carotid was excised, and two segments of carotid between 5 and 10 mm from carotid bifurcation were used for transmission electron microscopy and volume density analysis, and segments between 3 and 5 mm from the bifurcation were used for quantifying intimal size. For RNA and protein extraction, rats were killed at various times after the reinjury and at 28 days after the first injury (control). One group of preoperative rats was killed to provide normal control media. Ten minutes before death by pentobarbital overdose, rats received an intravenous injection of Evans blue (200 µL of 5% solution, Sigma) to mark the deendothelialized area. Carotid arteries were briefly flushed with ice-cold lactated Ringer's solution (Baxter Healthcare Co) at physiological pressure to remove blood, and the whole length of left carotid was excised. The reinjured carotids were opened longitudinally after removing the surrounding connective tissue. The neointima was then stripped (at the internal elastic lamina) from the media. For zymography, the media was stripped (at the external elastic lamina) from the adventitia. All specimens were then snap-frozen in liquid nitrogen and stored at -80°C.

Transmission Electron Microscopy and Volume Density of Matrix in Intima
The volume density of intimal ECM was determined by the method using a 108-point square lattice test grid on a transmission electron micrograph.15 The excised arteries were immersed in phosphate-buffered 2.5% glutaraldehyde/2% paraformaldehyde for >24 hours. Three small pieces of artery were cut per animal (each >=1 mm apart), postfixed in 1% OsO4 for 1 hour, stained en bloc in 2% uranyl acetate for 30 minutes, and embedded in Medcast (Ted Pella Inc). Sections were cut from each block, stained with 6% uranyl acetate and Reynolds lead citrate, and examined by a Jeol JEM 1200EXII transmission electron microscope at 80 kV. Ten electron micrographs of the neointima were taken randomly per section at a final magnification of x3000; thus, 30 micrographs were taken of each animal. The length of linear probes in the test grid was 7.5 mm. The 108-point test grid was placed over the electron micrographs, and points that fell on cells were counted (PCELL). Volume density of ECM was calculated as (108-PCELL)÷108 on each micrograph, and the average of these values from 30 micrographs per animal was used for statistical analysis.

Measurement of Intimal Size
To evaluate the relation between the intimal size and the matrix volume of intima after reinjury, the intimal size of reinjured carotid was quantified by light microscopy. The specimens were fixed in 4% paraformaldehyde for 1 hour after cutting out and embedded in paraffin. The three 4-µm sections (each >=100 µm apart) per animal were cut out and stained with hematoxylin. The intimal area of each section was measured, as described previously.10 Mean values of intimal size were determined by averaging values from three sections and used for statistical analysis.

RNA Extraction and Northern Blot Analysis
Tissue samples from >7 animals were mixed together and prepared for each time point (total, 45 animals). Frozen arterial tissue was ground to a fine powder under liquid nitrogen, and total cellular RNA was isolated with Trizol (GIBCO BRL) according to the manufacturer's instruction. The RNA concentration was measured by absorption at 260 nm. Equal amounts (5 µg of total RNA) of each extract were separated on formaldehyde agarose gel (1.2%) and transferred to nylon membranes (Zeta-Probe, Bio-Rad Laboratories), as described previously.16 After transfer, RNA blots were exposed to shortwave UV light and baked at 80°C for 2 hours to cross-link RNA to the membrane. The blots were prehybridized with hybridization buffer (50% formamide, 0.75 mol/L NaCl, 50 mmol/L Tris [pH 7.4], 1x Denhardt's solution, 1% SDS, 10% dextran sulfate, and 200 µg/mL salmon sperm DNA) at 42°C for 6 hours and hybridized with hybridization buffer containing 32P-labeled cDNA probes (1.5x106 cpm/mL) at 42°C for 16 to 24 hours. The cDNA probes were labeled with [32P]dCTP by random primer extension (Multi-Prime, Amersham). After hybridization, the blots were washed in two changes of 2x SSC/0.1% SDS for 15 minutes at room temperature and in two changes of 0.3x SSC/0.1% SDS for 15 minutes at 65°C and then autoradiographed. To verify loading in each lane, the blots were probed with a labeled oligonucleotide directed to the 28S rRNA, with the sequence 5' GCGAGAGCGCCAGCTATCCTGAGG 3'. End labeling of the nucleotide, hybridization, and washing were carried out as described.17 Intensity of the signals on Northern blot and the 28S bands were measured by densitometric analysis of autoradiogram. X-ray films were scanned with a transmissive scanner (UMAX UC1260, UMAX Data System Inc) using Photoshop software (version 3.0), and the transmittance values were converted to values of optical density by NIH Image software (version 1.59). The profile of each band was plotted using NIH Image, and the area of peak corresponding to each band was measured as intensity value. The mRNA signals in each lane were compared by using a ratio of the signal to 28S rRNA. To reuse the blot, probes were stripped according to the manufacturer's instruction for the membrane.

cDNA probes used were as follows: {alpha}1(I)procollagen, a 390-bp mouse cDNA, was generously provided by Dr P. Bornstein, University of Washington, Seattle; tropoelastin, a 900-bp rat cDNA, was a kind gift of Dr T.N. Wight, University of Washington, Seattle18; fibronectin, clone {lambda}rlf1 from rat, was generously supplied by Dr R.O. Hynes, Massachusetts Institute of Technology, Cambridge19; TGF-ß1, a 985-bp rat cDNA, was kindly provided by Dr A.B. Roberts, NCI/NIH, Bethesda, Md20; UPA, a 380-bp rat cDNA, and TPA, a 380-bp rat cDNA, were kindly supplied by Dr J.L. Degen, Children's Hospital Medical Center, Cincinnati, Ohio.21

Zymography
Arteries from 5 animals per each time (total, 35 animals) were pooled and pulverized under liquid nitrogen and incubated in ice-cold lysis solution (1% SDS, 50 mmol/L Tris [pH 7.6], and 10 mg/mL leupeptin) for 30 minutes while being pulled through a 23-gauge needle. Insoluble matter was removed by centrifugation, and the protein concentration was measured by bicinchoninic acid assay (Pierce). Lysates were incubated with sample buffer (1% SDS, 10% glycerol, 50 mmol/L Tris [pH 6.8], and 0.01% bromophenol blue [final concentration]) for 15 minutes at 4°C for zymographic assay of PAs and gelatinolytic enzymes or incubated with sample buffer containing 2.5% 2-mercaptoethanol for reverse zymography of PAI. To detect the activities of PAs and PAI, equal amounts (10 µg of total protein) of each sample were separated on 8% SDS-PAGE. The gel was soaked in two changes of 2.5% Triton X-100 (Sigma) for 45 minutes each time and in two changes of 100 mmol/L Tris (pH 8.1) for 30 minutes each time at room temperature before being layered on the substrate gels. For PA zymography, substrate gels consisted of a mixture of 1.25% agar, 2% nonfat milk, and 40 µg/mL plasminogen from human plasma (Sigma) in 100 mmol/L Tris (pH 8.1) on a flat glass,22 and 50 mU/mL urokinase (human high molecular weight, Calbiochem) was added to the substrate gel for reverse zymography to detect PAI activity.23 These zymograms were allowed to develop at 37°C for 3 to 24 hours, and photographs were taken using dark-ground illumination. To estimate the gelatinolytic activity, equal amounts (10 µg of total protein) of each sample were applied onto 8% SDS-PAGE copolymerized with 0.1% gelatin (Sigma) as substrate.24 After electrophoresis, the gels were soaked in 2.5% Triton X-100 for 30 minutes at room temperature with one change of the solution, followed by overnight incubation at 37°C in incubation buffer (50 mmol/L Tris [pH 8.1], 2.5 mmol/L CaCl2, and 0.02% NaN3). To stop the reaction, the gels were washed in 10% trichloracetic acid (Baker) and then stained with rapid Coomassie stain (Diversified Biotech) for 30 minutes, destained in 30% methanol/10% acetic acid, and photographed.

Western Blot Analysis
Equal amounts (10 µg of total protein) of each lysate were incubated for 15 minutes at 4°C with sample buffer containing 2.5% 2-mercaptoethanol to detect PAI-1. Samples were separated on 8% SDS-PAGE and transferred to nitrocellulose membrane (Protran, Schleicher & Schuell). Blocking, incubation with antibodies, washing, and detection by enhanced chemiluminescence (Amersham) were carried out according to the protocol described previously.10 The primary antibody used for the analysis was a rabbit polyclonal antibody against rat PAI-1 (American Diagnostica Inc).

Statistics
The difference in matrix volume density between reinjured rats and sham-operated rats was analyzed by unpaired Student t test, and the Pearson correlation coefficient was used to examine the correlation between intimal size and matrix volume density after reinjury. All data were considered significant at P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Transmission Electron Micrograph and Volume Density of Matrix in Intima
Our previous study on reinjury of rat arteries showed that there was an increase in intimal lesion size after 28 days that was not related to an increase in cell number.10 In the present study, transmission electron micrography revealed that intimal cell density was reduced in arteries at 28 days after the reinjury compared with sham-operated arteries (Figure 1Down). Furthermore, there was an abundance of elastic fibrils in the intercellular space 28 days after the reinjury (Figure 1Down). The volume density of intimal ECM was significantly increased 28 days after the reinjury (P=0.0003), although no apparent change was detected at 14 days after the reinjury (P=0.054) (Figure 2ADown). Furthermore, intimal size after reinjury was correlated significantly with the volume density of intimal matrix (r=0.792, P=0.0023) (Figure 2BDown).



View larger version (108K):
[in this window]
[in a new window]
 
Figure 1. Transmission electron microscopy of carotid intima. Panel A is from a rat at 28 days after reinjury, and panel B is from a rat at 28 days after sham operation. A reduction in cell density can be seen in panel A. Bar=5 µm. E indicates elastin.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Panel A shows volume density of matrix in the intima after reinjury (solid bar) and sham operation (open bar). Note the significant difference between reinjury and sham operation at day 28, but not at day 14 (d indicates days after reinjury). Values are shown as mean±SD. Panel B shows correlation between intimal size and volume density in intimal matrix after reinjury. These two values are significantly correlated by linear regression. {circ} indicates 14 days after reinjury; {square}, 28 days after reinjury.

It should be noted that the volume density of the matrix was obtained from individual animals and average values are shown (Figure 2AUp). This is in contrast to the data presented below, for which it was necessary to pool tissues from different animals to determine gene expression or proteolytic activities.

Expression of Matrix and TGF-ß1 Genes
The expressions of {alpha}1(I)procollagen, tropoelastin, and fibronectin genes were examined using Northern blot analysis. At 7 days after the reinjury, expression of mRNA for all three was increased in the intima (Figure 3Down). Expression of {alpha}1(I)procollagen returned to the control level by 14 days after the reinjury (Figure 3ADown and 3aDown), whereas the expression of tropoelastin was still elevated 28 days after the reinjury (Figure 3BDown and 3bDown). An increase in fibronectin expression was observed at 7 to 14 days after the reinjury, although the level was decreased by day 28 (Figure 3CDown and 3cDown). TGF-ß1 expression in the intima was also upregulated at all times studied after reinjury (Figure 3DDown and 3dDown).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 3. Northern blot probed with the cDNA fragments for {alpha}1(I)procollagen (A), tropoelastin (B), fibronectin (C), and TGF-ß1 (D). RNA was extracted from control intima and intima at each time point after reinjury. Bar graphs show relative expression of {alpha}1(I)procollagen (a), tropoelastin (b), fibronectin (c), and TGF-ß1 (d), corrected by intensity of 28S rRNA (bottom blot) to equalize loading. The value of control was set at 1.0, and all data were presented as ratio of the test value to the control value. C indicates control intima (28 days after first injury); d, days after reinjury.

In the media after the reinjury, no significant change was observed in the expression of {alpha}1(I)procollagen, fibronectin, tropoelastin, or TGF-ß1 (data not shown).

PA Activity and Expression
The above data show that an increase in matrix synthesis occurred at times after reinjury when no apparent change in matrix volume density was detected. One possible explanation for this findings is that the newly synthesized matrix was degraded. Therefore, we measured the activity of PAs and gelatinolytic enzymes in these arteries.

PA activity, assessed by zymography, showed an increase in UPA activity 1 day after the reinjury, but thereafter, the activity decreased gradually and returned to baseline by day 14 (Figure 4ADown). TPA activity in the intima, however, did not change (Figure 4BDown). In the media, UPA activity increased after reinjury in a pattern similar to that for the intima, and no significant change in TPA activity was detected after reinjury (Figure 4CDown).



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. PA zymograms developed for 12 hours (A) and 24 hours (B and C). Appropriate developing time was 12 and 24 hours for presenting intimal UPA and TPA activity, respectively. N indicates normal carotid; C, control intima (28 days after first injury); and d, days after reinjury.

Expression of UPA mRNA increased at 2 and 7 days after the reinjury in the intima and returned to the control level by day 14 (Figure 5ADown and 5aDown). In contrast, TPA expression in intima was downregulated at 2 days after the reinjury but returned to control level by day 14 (Figure 5BDown and 5bDown). In media, neither UPA nor TPA mRNA changed significantly after reinjury (data not shown).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. Intimal expression of UPA (A) and TPA (B) mRNA after reinjury. Bar graphs show intimal expression of UPA (a) and TPA (b), normalized by intensity of 28S rRNA (bottom blot). Data were presented as ratio of the text value to the control value (set at 1.0). C indicates control intima (28 days after first injury); d, days after reinjury.

PAI Activity and Protein Expression in Intima
Both UPA and TPA are blocked by PAI; therefore, we wished to determine whether this PAI was also regulated by reinjury. Reverse zymogram showed a lysis-resistant zone at {approx}50 kDa, suggesting PAI activity (Figure 6ADown). This activity was detected at 2 days and reached its maximum at 4 days after the reinjury. No PAI activity was detected at day 14. A Western blot for rat PAI-1 also showed a 49-kDa protein whose expression was increased at day 2, with strong expression at day 4 (Figure 6BDown). PAI-1 was still detected by day 7 but not by day 14.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Reverse zymogram shows that PAI activity in the intima increased from 2 to 7 days after the reinjury (A). The zymogram was developed for 3 hours. Western blot probed with anti–PAI-1 antibody showed the same pattern of PAI-1 expression in reinjured intima (B). C indicates control intima (28 days after first injury); d, days after reinjury.

Gelatinolytic Activity
In the control vessel, four prominent bands of gelatinolytic activity were present in both the intima and media, with molecular masses of 55, 62, 70, and 88 kDa (Figure 7Down). At 1 and 2 days after the reinjury, an extra band of 95 kDa appeared in both the intima and media, but it disappeared by day 4 (Figure 7Down). No significant changes in other gelatinolytic activities were observed in either the intima or media (Figure 7Down). We believe that 88- and 95-kDa gelatinolytic activities represented active and latent forms of MMP-9, respectively.25 The 70-kDa activity corresponded to a latent form of MMP-2, and the 55- and 62-kDa activities probably represented its active form.26 27



View larger version (61K):
[in this window]
[in a new window]
 
Figure 7. Gelatin zymograms show time course of gelatinolytic activities after reinjury in intima (A) and media (B). Note that 95-kDa gelatinolytic activity (latent form of MMP-9) appeared at 1 and 2 days after reinjury. N indicates normal carotid; C, control intima (28 days after first injury); and d, days after reinjury.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In a previous study, we showed that injury of a preexisting intimal lesion stimulated an increase in lesion size, but this was not accompanied by an increase in SMC number.10 In fact, the SMC density of these lesions was significantly reduced.10 These data led us to propose that unlike the lesion growth that occurs after injury to normal rat arteries, the growth of lesions in arteries with preexisting intimal lesions is due to cell matrix accumulation and not to an increase in cell number. One aim of the present study was to provide evidence to support this hypothesis, and our results clearly show that there is a significant increase in ECM volume 28 days after the reinjury. That this increase in matrix volume was detected at 28 and not at 14 days correlates well with our finding that a significant increase in intimal size was detected 28 days after the reinjury,10 and a significant correlation between matrix volume and intimal size after reinjury was detected in the present study. These data also show that lesion growth in an artery with a preexisting intimal lesion is a late event compared with that observed in normal arteries, where an increase in intimal mass can be detected as early as 4 days after balloon catheter injury.8 Several studies of human restenosis specimens after PTCA have suggested that ECM played an important role in the development of restenotic lesions.28 29 30 Schwartz et al30 presented data showing that the cellular component occupied only {approx}11% of the neointimal volume of human restenotic samples and that the other part was ECM. The increase in matrix volume density in these rat tissues would support these data. Serial coronary angiography after PTCA has revealed that restenosis developed between the first and third month after angioplasty,31 and it is interesting to note that the increase in these rat lesions was first observed at day 28. In the development of human lesions, there are several critical aspects not seen in the rat reinjury model, such as inflammatory cell infiltration, lipid deposition, and mural thrombus,10 32 and care must be taken in extrapolating our data with the progression of lesion growth in humans.

Since an increase in lesion size was detected 28 days after the reinjury, we would have predicted matrix molecules to be strongly expressed at late times (14 to 28 days) after the reinjury. Surprisingly, this was found not to be true, and our data show that although three common matrix molecules investigated in the present study were strongly expressed in the intima at 7 days after the reinjury, only tropoelastin was expressed above background levels after 28 days. Even allowing for a delay between matrix expression and our ability to detect any matrix accumulation, this result was unexpected. Therefore, we examined changes in expression and activity of proteolytic enzymes that are known to be expressed by rat arterial cells,24 33 34 since any accumulation of matrix is a balance between synthesis and its degradation. An increase in UPA mRNA was noted in the intima at 2 and 7 days after the reinjury, but the expression was downregulated to background levels by 14 days. Surprisingly, UPA activity was highest at day 1 and decreased thereafter. A similar discrepancy between UPA expression and activity has been observed in a normal rat carotid subjected to balloon injury, with no obvious explanation.33 One possibility is that the activity values of UPA are influenced by the presence of PAI-1. The activity of this PAI in the intima peaked at 4 days after the reinjury, which is the same time when UPA activity was decreased. One possibility, therefore, is that diminished UPA activity, despite an increase in mRNA, can be attributed to the presence of PAI-1.

TPA mRNA expression in the intima was downregulated at 2 and 7 days after the reinjury, but there was no change in its activity. The lack of concordance between activity and expression may be due to plasma-derived TPA. This could be because of net TPA synthesis by endothelial cells and an increase in plasma concentrations. The fact that these lesions do not possess an intact endothelium would render the arterial wall permeable to plasma proteins, which would include TPA.35 36

The presence of increased PA activity at early times (1 to 7 days) after reinjury may explain why no increase in matrix accumulation was detected at the early times after reinjury but does not provide an answer as to why an increase in ECM was detected 28 days after reinjury. In understanding this result, it is important to note that of the three common matrix molecules expressed after reinjury, only tropoelastin is significantly elevated at 14 and 28 days. Elastin is not a preferred substrate for plasmin,37 but MMPs do have elastinolytic activity.38 39 In these reinjured lesions, 95-kDa gelatinolytic activity (latent form of MMP-9) was detected at 1 to 2 days after the reinjury, but other gelatinolytic activities were not increased. We and others have not detected other elastases in the intima of rat arteries, and few macrophages, which possess an elastase, are detected in these lesions.10 24 40 Thus, an increase in tropoelastin expression is not accompanied by elastinolytic activity. Under these conditions, an increase in elastin would be anticipated. Indeed, electron microscopy confirms that elastin fibrils are abundant in the lesions of arteries after reinjury.

Why SMCs express tropoelastin in preference to other matrix proteins is not clear but may relate to a change in the ability of the artery to respond to the arterial wall stress. An increase in stretch and/or tensile stress is frequently associated with an increase in elastin synthesis by arterial SMCs.41 42 One possibility, therefore, is that the elastic lamellae were damaged by angioplasty and that as a reparative response, the SMCs express tropoelastin. This suggestion is supported by the finding that hypertension induces elastin expression and that increased stretch of pulmonary arteries causes a 9-fold increase in elastin with only a 2-fold increase in collagen.43 In rat arteries, Nikkari et al18 showed an increase in elastin as well as other matrix molecules after balloon injury, and the increase in expression of elastin was strong and remained high even after 28 days. Capron et al44 found a significant increase of elastin volume 14 days after reinjury to atherosclerotic rat aorta, although the same authors detected no significant increase in collagen volume. Furthermore, in a rabbit model, Strauss et al11 found that elastin content at 28 days increased {approx}30% after the reinjury; however, collagen content was unchanged. Our observation of an increase in tropoelastin expression would support the concept that elastin is a major component of the arterial lesion after a sequential injury to an intimal lesion.

In the present study, we chose to examine those matrix proteins that are abundantly expressed in rat arteries. Furthermore, one hope was that we might provide collaborative data for at least {alpha}1(I)procollagen and tropoelastin from an ultrastructural examination of these arteries. With respect to tropoelastin, it would appear that our choice was well founded. These data, however, do not rule out the possibility that other matrix proteins such as proteoglycan(s) may contribute to the intimal lesion.11 18

In a similar manner, other MMPs may be active in these arteries. We limited the present study to examine the gelatinases, since they are the only MMPs that we have found in both normal and injured rat arteries.24 Furthermore, it is possible that a change in the tissue inhibitors of MMP expression could influence MMP activity,45 46 and future studies will examine their role in these arteries.

TGF-ß1 expression in the intima is upregulated after reinjury, and one consideration is that this cytokine is responsible for the increased expression of matrix proteins in these arteries, since there are many studies showing that TGF-ß1 induces matrix synthesis in vascular cells.47 48 49 50 In the present study, TGF-ß1 expression is upregulated for the entire 28 days after the reinjury, yet expression of {alpha}1(I)procollagen and fibronectin returned to control level at late times (14 to 28 days). One explanation for the weak correlation between expression of the matrix genes and TGF-ß1 may relate to the action of plasmin as a physiological activator of TGF-ß1.51 In the present study, intimal UPA activity was detected at only the early times (1 to 7 days) and not at 14 days after the reinjury. If TGF-ß1 is activated by plasmin and consequently by expression of the UPA, then matrix expression correlates well with the upregulation of UPA activity. In contrast, tropoelastin is expressed through the entire experimental period and does not correlate well with UPA expression. As stated above, one possibility is that the angioplasty-induced injury to the artery may regulate its expression. In support of this, recent studies have shown that in pulmonary hypertension, the increase in matrix is not related to any expression of TGF-ß1.52 53

The expression of proteases including TPA and MMPs has also been linked to the migration of SMCs into the intima.24 33 54 Indeed, a block of migration can impede the growth of intimal lesion in a balloon-injured artery.55 56 These data were obtained using rat arteries, which do not normally possess an intima with SMCs; therefore, migration of SMCs is necessary for the development of an intimal lesion. We do not know whether the movement of cells into the intima is important for the growth of lesions in arteries with a preexisting intima. In this present study, we were not able to directly measure the migration of cells, since this is not possible if an intima already exists. However, there was only a transitory increase in UPA activity with no change in either TPA activity or the gelatinolytic activities representing active forms of MMPs. This finding should be contrasted with the results following balloon catheter injury of a normal artery, after which increases in both TPA and MMP activity are detected for several days and there is a significant increase in cell migration.24 33 54 Thus, although there are no direct data, it would appear that migration of SMCs does not occur after angioplasty of a preexisting arterial lesion.

In summary, the present study showed that matrix accumulation was a critical reason for the lesion increase observed at 28 days after the reinjury and that the matrix accumulation depended on a balance between the matrix synthesis and degradation. Matrix synthesis was increased 7 days after the reinjury and partially continued up to 28 days, and the prolonged synthesis was mainly dependent on tropoelastin. Meanwhile, in matrix degradation, activity of UPA quickly increased after the reinjury and returned to the baseline level by day 14, whereas there was no change in TPA activity or the gelatinolytic activities representing active forms of MMPs. These data explain why matrix accumulation appeared at 28 days after the injury and not at earlier time points.


*    Selected Abbreviations and Acronyms
 
ECM = extracellular matrix
MMP = matrix metalloproteinase
PA = plasminogen activator
PAI = PA inhibitor
PTCA = percutaneous transluminal coronary angioplasty
SMC = smooth muscle cell
TGF-ß1 = transforming growth factor-ß1
TPA = tissue plasminogen activator
UPA = urokinase plasminogen activator


*    Acknowledgments
 
This study was supported by National Institutes of Health grants HL-03174 and HL-41103.


*    Footnotes
 
Correspondence to Michael A. Reidy, PhD, Department of Pathology/Vascular Biology, Box 357335, University of Washington, Seattle, WA 98195-7335.

Received November 10, 1997; accepted March 2, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Block PC, Myler RK, Stertzer S, Fallon JT. Morphology after transluminal angioplasty in human beings. N Engl J Med. 1981;305:382–385.[Medline] [Order article via Infotrieve]

2. Essed CE, van den Brand M, Becker AE. Transluminal coronary angioplasty and early restenosis: fibrocellular occulusion after wall laceration. Br Heart J. 1983;49:393–396.[Abstract/Free Full Text]

3. Austin GE, Ratliff NB, Hollman J, Tabei S, Phillips DF. Intimal proliferation of smooth muscle cells as an explanation for recurrent coronary artery stenosis after percutaneous transluminal coronary angioplasty. J Am Coll Cardiol. 1985;6:369–375.[Abstract]

4. MERCATOR Study Group. Does the new angiotensin converting enzyme inhibitor cilazapril prevent restenosis after percutaneous transluminal coronary angioplasty? Results of the MERCATOR study: a multicenter, randomized, double-blind placebo-controlled trial. Circulation. 1992;86:100–110.[Abstract/Free Full Text]

5. Faxon DP, Spiro TE, Minor S, Coté G, Douglas J, Gottlieb R, Califf R, Dorosti K, Topol E, Gordon JB, Ohmen M, the ERA Investigators. Low molecular weight heparin in prevention of restenosis after angioplasty: results of Enoxaparin restenosis (ERA) trial. Circulation. 1994;90:908–914.[Abstract/Free Full Text]

6. Emanuelsson H, Beatt KJ, Bagger J, Balcon R, Heikkilä J, Piessens J, Schaeffer M, Suryapranata H, Foegh M. Long-term effects of angiopeptin treatment in coronary angioplasty: reduction of clinical events but not angiographic restenosis. Circulation. 1995;91:1689–1696.[Abstract/Free Full Text]

7. Groves HM, Kinlough-Rathbone RL, Richardson M, Moore S, Mustard JF. Platelet interaction with damaged rabbit aorta. Lab Invest. 1979;40:194–200.[Medline] [Order article via Infotrieve]

8. Clowes AW, Reidy MA, Clowes MM. Kinetics of cellular proliferation after arterial injury, I: smooth muscle growth in the absence of endothelium. Lab Invest. 1983;49:327–333.[Medline] [Order article via Infotrieve]

9. Guyton JR, Dao DT, Lindsay KL. Endothelial denudation and myointimal thickening in the rat carotid artery induced by the passage of bubbles. Exp Mol Pathol. 1984;40:340–348.[Medline] [Order article via Infotrieve]

10. Koyama H, Reidy MA. Reinjury of arterial lesions induces intimal smooth muscle cell replication that is not controlled by fibroblast growth factor 2. Circ Res. 1997;80:408–417.

11. Strauss BH, Chisholm RJ, Keeley FW, Gotlieb AI, Logan RA, Armstrong PW. Extracellular matrix remodeling after balloon angioplasty injury in a rabbit model of restenosis. Circ Res. 1994;75:650–658.[Abstract/Free Full Text]

12. Strauss BH, Robinson R, Batchelor WB, Chrisholm RJ, Ravi G, Natarajan MK, Logan RA, Mehta SR, Levy DE, Ezrin AM, Keeley FW. In vivo collagen turnover following experimental balloon angioplasty injury and the role of matrix metalloproteinases. Circ Res. 1996;79:541–550.[Abstract/Free Full Text]

13. Karim MA, Miller DD, Farrar MA, Eleftheriades E, Reddy BH, Breland CM, Samarel AM. Histomorphometric and biochemical correlates of arterial procollagen gene expression during vascular repair after experimental angioplasty. Circulation. 1995;91:2049–2057.[Abstract/Free Full Text]

14. Coats WD, Cheung DT, Han B, Currier JW, Faxon DP. Balloon angioplasty significantly increases collagen content but does not alter collagen subtype I/III ratios in the atherosclerotic rabbit iliac model. J Mol Cell Cardiol. 1996;28:441–446.[Medline] [Order article via Infotrieve]

15. Snow AD, Bolender RP, Wight TN, Clowes AW. Heparin modulates the composition of the extracellular matrix domain surrounding arterial smooth muscle cells. Am J Pathol. 1990;137:313–330.[Abstract]

16. Majesky MW, Benditt EP, Schwartz SM. Expression and developmental control of platelet-derived growth factor A-chain and B-chain/Sis genes in rat aortic smooth muscle cells. Proc Natl Acad Sci U S A.. 1988;85:1524–1528.[Abstract/Free Full Text]

17. Murry CE, Giachelli CM, Schwartz SM, Vracko R. Macrophages express osteopontin during repair of myocardial necrosis. Am J Pathol. 1994;145:1450–1462.[Abstract]

18. Nikkari ST, Järveläinen HT, Wight TN, Ferguson M, Clowes AW. Smooth muscle cell expression of extracellular matrix genes after arterial injury. Am J Pathol. 1994;144:1348–1356.[Abstract]

19. Schwarzbauer JE, Tamkun JW, Lemischka IR, Hynes RO. Three different fibronectin mRNAs arise by alternative splicing within the coding region. Cell. 1983;35:421–431.[Medline] [Order article via Infotrieve]

20. Qian SW, Kondaiah P, Roberts AB, Sporn MB. cDNA cloning by PCR of rat transforming growth factor beta-1. Nucleic Acids Res. 1990;18:3059.[Free Full Text]

21. Reidy MA, Irvin C, Lindner V. Migration of arterial wall cells: expression of plasminogen activators and inhibitors in injured rat arteries. Circ Res. 1996;78:405–414.[Abstract/Free Full Text]

22. Vassalli J, Dayer J, Wohlwend A, Belin D. Concomitant secretion of prourokinase and of plasminogen activator-specific inhibitor by cultured human monocytes-macrophages. J Exp Med. 1984;159:1653–1668.[Abstract/Free Full Text]

23. Loskutoff DJ, van Mourik JA, Erickson LA, Lawerence D. Detection of an unusually stable fibrinolytic inhibitor produced by bovine endothelial cells. Proc Natl Acad Sci U S A.. 1983;80:2956–2960.[Abstract/Free Full Text]

24. Bendeck MP, Zempo N, Clowes AW, Galardy RE, Reidy MA. Smooth muscle cell migration and matrix metalloproteinases expression after arterial injury in the rat. Circ Res. 1994;75:539–545.[Abstract/Free Full Text]

25. Lyons JG, Birkedal-Hansen B, Moore WGI, O'Grady RL, Birkedal-Hansen H. Characteristics of a 95-kDa matrix metalloproteinase produced by mammary carcinoma cells. Biochemistry. 1991;30:1449–1456.[Medline] [Order article via Infotrieve]

26. Salo T, Liotta LA, Tyggvason K. Purification and characterization of a murine basement membrane collagen-degrading enzyme secreted by metastatic tumor cells. J Biol Chem. 1983;258:3058–3063.[Abstract/Free Full Text]

27. Marti H, McNeil L, Davies M, Martin J, Lovett DH. Homology cloning of rat 72 kDa type IV collagenase: cytokine and second-messenger inducibility in glomerular mesangial cells. Biochem J. 1993;291:441–446.

28. Nobuyoshi M, Kimura T, Ohishi H, Horiuchi H, Nosaka H, Hamasaki N, Yokoi H, Kim K. Restenosis after percutaneous transluminal coronary angioplasty: pathologic observations in 20 patients. J Am Coll Cardiol. 1991;17:433–439.[Abstract]

29. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol. 1991;17:758–769.[Abstract]

30. Schwartz RS, Holmes DRJ, Topol EJ. The restenosis paradigm revisited: an alternative proposal for cellular mechanisms. J Am Coll Cardiol. 1992;20:1284–1293.[Abstract]

31. Nobuyoshi M, Kimura T, Nosaka H, Mioka S, Ueno K, Yokoi H, Hamasaki N, Horiuchi H, Ohishi H. Restenosis after successful percutaneous transluminal coronary angioplasty: serial angiographic follow-up of 229 patients. J Am Coll Cardiol. 1988;12:616–623.[Abstract]

32. Jackson CL. Animal models of restenosis. Trends Cardiovasc Med. 1994;4:122–130.

33. Clowes AW, Clowes MM, Au YPT, Reidy MA, Belin D. Smooth muscle cells express urokinase during mitogenesis and tissue-type plasminogen activator during migration in injured rat carotid artery. Circ Res. 1990;67:61–67.[Abstract/Free Full Text]

34. Jackson CL, Reidy MA. Basic fibroblast growth factor: its role in the control of smooth muscle cell migration. Am J Pathol. 1993;143:1024–1031.[Abstract]

35. Reidy MA, Clowes AW, Schwartz SM. Endothelial regeneration, V: inhibition of endothelial regrowth in arteries of rat and rabbit. Lab Invest. 1983;49:569–575.[Medline] [Order article via Infotrieve]

36. Lindner V, Reidy MA, Fingerle J. Regrowth of arterial endothelium: denudation with minimal trauma leads to complete endothelial cell regrowth. Lab Invest. 1989;61:556–563.[Medline] [Order article via Infotrieve]

37. Chapman HA, Stone OL. Co-operation between plasmin and elastase in elastin degradation by intact murine macrophages. Biochem J. 1984;222:721–728.[Medline] [Order article via Infotrieve]

38. Senior RM, Griffin GL, Fliszar CJ, Shapiro SD, Goldberg GI, Welgus HG. Human 92- and 72-kilodalton type IV collagenases are elastases. J Biol Chem. 1991;266:7870–7875.[Abstract/Free Full Text]

39. Shapiro SD, Campbell EJ, Welgus HG, Senior RM. Elastin degradation by mononuclear phagocytes. Ann N Y Acad Sci. 1991;624:69–80.[Medline] [Order article via Infotrieve]

40. Zempo N, Kenagy RD, Au YPT, Bendeck M, Clowes MM, Reidy MA, Clowes AW. Matrix metalloproteinases of vascular wall cells are increased in balloon-injured rat carotid artery. J Vasc Surg. 1994;20:209–217.[Medline] [Order article via Infotrieve]

41. Kolpakov V, Rekhter MD, Gordon D, Wang WH, Kulik TJ. Effect of mechanical forces on growth and matrix protein synthesis in the in vitro pulmonary artery: analysis of the role of individual cell types. Circ Res. 1995;77:823–831.[Abstract/Free Full Text]

42. Ben-Driss A, Benessiano J, Poitevin P, Levy BI, Michel JB. Arterial expansive remodeling induced by high flow rates. Am J Physiol. 1997;272:H851–H858.[Abstract/Free Full Text]

43. Poiani GJ, Tozzi CA, Yohn SE, Pierce RA, Belsky SA, Berg RA, Yu SY, Deak SB, Riley DJ. Collagen and elastin metabolism in hypertensive pulmonary arteries of rats. Circ Res. 1990;66:968–978.[Abstract/Free Full Text]

44. Capron L, Jarnet J, Heudes D, Joseph-Monrose D, Bruneval P. Repeated balloon injury of rat aorta: a model of neointima with attenuated inhibition by heparin. Arterioscler Thromb Vasc Biol. 1997;17:1649–1656.[Abstract/Free Full Text]

45. Hasenstab D, Forough R, Clowes AW. Plasminogen activator inhibitor type 1 and tissue inhibitor of metalloproteinases-2 increase after arterial injury in rats. Circ Res. 1997;80:490–496.[Abstract/Free Full Text]

46. Webb KE, Henney AM, Anglin S, Humphries SE, McEwan JR. Expression of matrix metalloproteinases and their inhibitor TIMP-1 in the rat carotid artery after balloon injury. Arterioscler Thromb Vasc Biol. 1997;17:1837–1844.[Abstract/Free Full Text]

47. Chen J, Hoshi H, McKeehan WL. Transforming growth factor type ß specifically stimulates the synthesis of proteoglycan in human adult arterial smooth muscle cells. Proc Natl Acad Sci U S A.. 1987;84:5287–5291.[Abstract/Free Full Text]

48. Liu J, Davidson JM. The elastogenic effect of recombinant transforming growth factor-beta on porcine aortic smooth muscle cells. Biochem Biophys Res Commun. 1988;154:895–901.[Medline] [Order article via Infotrieve]

49. Nabel EG, Shum L, Pompili VJ, Yang Z, San H, Shu HB, Liptay S, Gold L, Gordon D, Derynck R, Nabel GJ. Direct transfer of transforming growth factor ß1 gene into arteries stimulates fibrocellular hyperplasia. Proc Natl Acad Sci U S A.. 1993;90:10759–10763.[Abstract/Free Full Text]

50. Kanzaki T, Tamura K, Takahashi K, Saito Y, Akikusa B, Oohashi H, Kasayuki N, Ueda M, Morisaki N. In vivo effect of TGF-ß1: enhanced intimal thickening by administration of TGF-ß1 in rabbit arteries injured with a balloon catheter. Arterioscler Thromb Vasc Biol. 1995;15:1951–1957.[Abstract/Free Full Text]

51. Lyons RM, Gentry LE, Purchio AF, Moses HL. Mechanism of activation of latent recombinant transforming growth factor ß1 by plasmin. J Cell Biol. 1990;110:1361–1367.[Abstract/Free Full Text]

52. Botney MD, Parks WC, Crouch EC, Stenmark K, Mecham RP. Transforming growth factor-beta 1 is decreased in remodeling hypertensive bovine pulmonary arteries. J Clin Invest. 1992;89:1629–1635.

53. Botney MD, Bahadori L, Gold LI. Vascular remodeling in primary pulmonary hypertension: potential role for transforming growth factor-beta. Am J Pathol. 1994;144:286–295.[Abstract]

54. Jackson CL, Raines EW, Ross R, Reidy MA. Role of endogenous platelet-derived growth factor in arterial smooth muscle cell migration after balloon catheterization. Arterioscler Thromb. 1993;13:1218–1226.[Abstract/Free Full Text]

55. Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R. Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science. 1991;253:1129–1132.[Abstract/Free Full Text]

56. Bendeck MP, Irvin C, Reidy MA. Inhibition of matrix metalloproteinase activity inhibits smooth muscle cell migration but not neointimal thickening after arterial injury. Circ Res. 1996;78:38–43.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Eur Heart JHome page
M. Degertekin, P. A. Lemos, C. H. Lee, K. Tanabe, J.E. Sousa, A. Abizaid, E. Regar, G. Sianos, W. J. van der Giessen, P. J. de Feyter, et al.
Intravascular ultrasound evaluation after sirolimus eluting stent implantation for de novo and in-stent restenosis lesions
Eur. Heart J., January 1, 2004; 25(1): 32 - 38.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Kishore, C. Luedemann, E. Bord, D. Goukassian, and D. W. Losordo
Tumor Necrosis Factor-Mediated E2F1 Suppression in Endothelial Cells: Differential Requirement of c-Jun N-Terminal Kinase and p38 Mitogen-Activated Protein Kinase Signal Transduction Pathways
Circ. Res., November 14, 2003; 93(10): 932 - 940.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. C. M. Weiser-Evans, P. E. Schwartz, N. A. Grieshaber, B. E. Quinn, S. S. Grieshaber, J. K. Belknap, P. M. Mourani, R. A. Majack, and K. R. Stenmark
Novel Embryonic Genes Are Preferentially Expressed by Autonomously Replicating Rat Embryonic and Neointimal Smooth Muscle Cells
Circ. Res., September 29, 2000; 87(7): 608 - 615.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. D. Rekhter
Collagen synthesis in atherosclerosis: too much and not enough
Cardiovasc Res, February 1, 1999; 41(2): 376 - 384.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koyama, H.
Right arrow Articles by Reidy, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koyama, H.
Right arrow Articles by Reidy, M. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH