Prostaglandin D₂ Inhibits Inducible Nitric Oxide Synthase Expression in Rat Vascular Smooth Muscle Cells

From the Second Department of Internal Medicine (H.N., Y.U., F.K., S.M., A.G., T.T., M.O.) and the Department of Biochemistry (T.S.), University of Tokyo; and the Biochemistry Division (T.O., H.E.), National Cancer Center Research Institute, Tokyo, Japan.

Correspondence to Hiroshi Nagoshi, MD, The Second Department of Internal Medicine, University of Tokyo, 7–3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—Vascular smooth muscle cells (VSMCs) as well as macrophages have been shown to generate a substantial amount of NO in inflammatory vascular lesions. Prostaglandin (PG) D₂ (PGD₂) is produced by inflammatory cells, including mast cells and macrophages. We investigated whether PGD₂ modulates NO metabolism in rat VSMCs. PGD₂ at a concentration of 10^–7 mol/L or greater dose-dependently inhibited nitrite accumulation in the medium of cultured VSMCs stimulated with interleukin 1ß (IL-1ß). In a dose-response analysis of IL-1ß and nitrite accumulation, PGD₂ was seen to decrease the maximal ability of VSMCs to generate NO, arguing against competition by PGD₂ at cytokine receptors. Northern analysis showed that PGD₂ suppresses induction of inducible NO synthase (iNOS) mRNA in IL-1ß–stimulated VSMCs, with consequent inhibition of iNOS protein expression in Western analysis. A thromboxane A₂ (TXA₂) analogue, U46619 (10^–5 mol/L), produced less inhibition of NO generation than did PGD₂. Neither the PGI₂ analog carbaprostacyclin nor PGE₁ showed any inhibition. PGD₂ dose-dependently inhibited NO generation despite the addition of the TXA₂ antagonist SQ29548. PGJ₂, ¹²-PGJ₂, and 15-deoxy-^12,14-PGJ₂, all metabolites of PGD₂, were as potent as or slightly stronger than PGD₂ in the inhibition of NO generation. These data suggest that PGD₂ suppresses NO generation in VSMCs by inhibiting iNOS mRNA expression, most likely through the cascade of the PGJ₂ series rather than through the TX receptor or cAMP upregulation. Such action makes it likely that PGD₂ regulates NO metabolism in vascular lesions.

Key Words: inducible nitric oxide synthase • prostaglandin D₂ • vascular smooth muscle cells expression inhibition • prostaglandin J₂

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Nitric oxide has been highlighted as a potent chemical mediator of vascular, immune, and neural function.¹ Enhanced expression of iNOS and increased NO generation have also been reported with various inflammatory states, including atherosclerosis,^{2 3} vasculopathy in septic shock,⁴ and postangioplastic vascular injury.⁵ In atherosclerosis, inflammatory cells such as macrophages and lymphocytes infiltrate into the lesions,⁶ releasing various mediators including cytokines.⁷ Recent studies have found NO generation to be enhanced in atherosclerotic lesions.² In addition, VSMCs may be more important than macrophages as a source of NO in atherosclerotic lesions.³

PGD₂ is a metabolite of arachidonic acid derived from PGH₂, a common precursor in the synthesis of most PGs. PGD₂ is predominant among prostanoids in many organs, including liver, spleen, central nerve system, and intestines.⁸ PGD₂ inhibits platelet aggregation through activation of adenylate cyclase,⁹ relaxes or constricts arterial vessels according to viability of the endothelium,¹⁰ and acts as a neurotransmitter in the brain, mediating sleep.¹¹ PGD₂ and its metabolites also are known to inhibit proliferation of various cell lines.¹² More interestingly, PGD₂ is generated in arteries by endothelial cells,¹³ platelets,¹⁴ macrophages,¹⁵ and mast cells,^{16 17} which are the component cells of atheromatous lesions.^{6 18}

To the best of our knowledge, however, few studies have directly addressed the roles of PGD₂ in the pathogenesis of vascular lesions. Hypothesizing that an interaction between PGD₂ and NO exists in vessel walls, we investigated the effect of PGD₂ on NO metabolism in cultured rat VSMCs.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials
PGD₂, ¹²-PGJ₂, and PGE₁ were gifts from Ono Pharmaceutical (Osaka, Japan). All other prostanoids and related reagents were purchased from Cayman Chemical. Recombinant murine IL-1ß and TNF- were purchased from R&D Systems. Reduced NADPH was obtained from Sigma. cDNA probes for murine ß-actin and GAPDH were purchased from Wako and the American Type Culture Collection (ATCC No. 57091), respectively. Moloney murine leukemia virus reverse transcriptase was obtained from GIBCO-BRL, and recombinant Taq DNA polymerase was obtained from TaKaRa Biomedicals. Deoxycytidine 5'-[-³²P]triphosphate and L-[4,5-³H]leucine were purchased from DuPont-NEN. Other materials and reagents were obtained from commercial sources.

Cell Culture and Incubation
VSMCs were isolated from the thoracic aorta of 10- to 12-week-old male Wistar-Kyoto rats (Doken, Shimodate, Japan) by a standard explant method of Ross et al¹⁹ and grown in DMEM supplemented with 10% fetal calf serum (Bioserum) and antibiotics. Culture purity was assessed by immunofluorescence staining with a monoclonal antibody specific for smooth muscle -actin. Confluent cells between the 10th and 20th passages were used for all experiments. Incubation of cultured cells was performed at 37°C in a humidified atmosphere of 95% air/5% CO₂. Solutions of cytokines were prepared with DMEM containing 0.1% bovine serum albumin.

Measurement of NO Production
NO production was measured as nitrite accumulation in medium from cultured VSMCs. After incubation of the cells in serum-free DMEM with the respective test compounds in 24-well culture clusters, aliquots of the media were mixed with an equal volume of Griess reagent [1% sulfonamide/0.1% N-(1-naphthyl)ethylenediamine dihydrochloride/5% phosphoric acid]. Optical absorption was measured spectrophotometrically at a wavelength of 540 nm, using sodium nitrite as the standard. Medium incubated in a cell-free well was used to obtain a baseline value. In the present assay system, nitrite accumulation induced by cytokines was dose-dependently inhibited by N^G-monomethyl-L-arginine, an action reversed by L-arginine (data not shown).

Western Analysis
Polyclonal anti-iNOS antibody was raised as reported previously.²⁰ After incubation periods with respective test compounds, VSMCs in culture were harvested and sonicated in ice-cold Tris buffer containing 50 mmol/L Tris-HCl (pH 7.5), 0.5 mmol/L EDTA, 0.5 mmol/L EGTA, 1 mmol/L leupeptin, 0.1 mmol/L phenylmethylsulfonyl fluoride, and 1 mmol/L dithiothreitol. The homogenate was centrifuged at 100 000g for 60 minutes at 4°C. The supernatant containing 5 mg cytosolic protein was incubated at 4°C for 30 minutes with ADP Sepharose gel (Pharmacia) with gentle agitation.²⁰ NO synthase was eluted with Tris buffer supplemented with 10 mmol/L NADPH. The partially purified enzyme was subjected to 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Immobilon-P^SQ, Millipore). NO synthase protein was detected with anti-iNOS antibody using peroxidase-labeled anti-rabbit IgG as the second antibody and 4-chloro-1-naphthol as the substrate.

Measurement of Total Protein Synthesis
VSMCs grown in 24-well culture clusters were incubated for 24 hours in serum-free DMEM containing 1 µCi/mL [³H]leucine and various concentrations of PGD₂. After harvesting the cells, cellular protein was precipitated with ice-cold 10% TCA and redissolved in 0.2N NaOH. After neutralization with HCl, TCA again was added, and the radioactivity of [³H]leucine incorporated into the TCA-insoluble cellular fraction was measured by liquid scintillation counting.

Preparation of cDNA Probe for iNOS
Total RNA was extracted from IL-1ß–stimulated VSMCs by an acid-guanidinium-thiocyanate method and subjected to reverse-transcription PCR. The cDNA was amplified by PCR with primers for rat iNOS (upper, 5'CATGGCTTCCCGCGTCAGAG 3'; lower, 5'TCCAGCACCTCCAGGAACGT 3') corresponding to nucleotide sequences 1587 to 1606 and 2642 to 2623, respectively,²¹ with 32 cycles of denaturing at 94°C for 1 minute, annealing at 56°C for 1 minute, and extension at 72°C for 1.5 minutes. PCR product of the expected size was ligated into pCR II plasmid vector (Invitrogen) by a T/A cloning method.²² The nucleotide sequence of the subcloned cDNA was determined by the dideoxynucleotide chain-termination method using an autosequencer (373 DNA sequencing system, Perkin-Elmer). The sequence coincided with that of iNOS reported previously with 98.5% similarity.²¹ An insert of BstXI restriction fragment of the iNOS plasmid was used as a probe for Northern blotting.

Northern Analysis
After respective incubation periods of cultured VSMCs, total RNA was extracted by the acid-guanidinium-thiocyanate method. Thirty micrograms of total RNA was separated by formaldehyde/1.0% agarose gel electrophoresis and transferred to a nylon membrane (Hibond N⁺, Amersham) in 20x SSC. After ultraviolet wave cross-linking, RNA immobilized on the membrane was hybridized for 16 hours at 65°C with ³²P-labeled cDNA probe for rat iNOS, murine ß-actin, or human GAPDH in hybridization buffer (Amersham). The membrane was washed finally at 65°C in 0.1x SSC containing 0.1% SDS and was autoradiographed on radiographic film at -80°C.

Statistical Analysis
Values are expressed as mean±SEM. Statistical analysis was performed by unpaired Student's t test or by ANOVA followed by Scheffé's F (multiple-comparison) test. Values of P<.05 were considered statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Effect of PGD₂ on Cytokine-Stimulated NO Production in VSMCs
We incubated VSMCs in culture with 20 U/mL IL-1ß or 30 ng/mL TNF- in the presence of various concentrations of PGD₂ (Fig 1). Nitrite accumulation in the culture medium over a 24-hour period was measured. Stimulation of VSMCs with IL-1ß or TNF- caused remarkable accumulation of nitrite. This was dose-dependently inhibited by simultaneous treatment of the cells with PGD₂ at doses of 10^–7 mol/L or greater.

View larger version (26K): [in this window] [in a new window]   Figure 1. Effect of PGD2 on NO generation in cytokine-stimulated VSMCs. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß (A) or 30 ng/mL TNF- (B) with the indicated concentrations of PGD2 for measurement of nitrite. Columns and bars represent mean±SEM (n=5). (-) indicates without cytokine. *P<.01 vs 0 mol/L.

We next examined the time course of nitrite accumulation in the culture medium, stimulating the cells with a cytokine cocktail (20 U/mL IL-1ß and 30 ng/mL TNF-) in the presence or absence of 10^–5 mol/L PGD₂ for various intervals of time (Fig 2A). Nitrite accumulation increased with time, over 24 hours, an effect suppressed by PGD₂.

View larger version (20K): [in this window] [in a new window]   Figure 2. Analysis of the effect of PGD2 on NO generation in VSMCs. A, Time course of nitrite accumulation. VSMCs were incubated with a cytokine cocktail (20 U/mL IL-1ß and 30 ng/mL TNF-) (), with the cytokine cocktail and 10–5 mol/L PGD2 (), or with their vehicles only () for indicated periods. Nitrite accumulation in the culture medium was measured. Points and bars represent mean±SEM (n=5). *P<.01 vs incubation with cytokines only. B, Dose-response curve of IL-1ß concentration and NO production. VSMCs were incubated for 24 hours with various concentrations of IL-1ß and PGD2 as indicated for measurement of nitrite. Points and bars represent mean±SEM (n=5). *P<.01 vs 0 mol/L PGD2. C, Chronology of inhibitory action of PGD2. VSMCs were incubated for 24 hours with the cytokine cocktail. PGD2 (3x10–5 mol/L) was added at various time points indicated after the addition of cytokines. Nitrite accumulation during the 24-hour incubation was measured. Points and bars represent mean±SEM (n=4). The column indicates nitrite accumulation without cytokine stimulation. *P<.01 vs time 0.

In a dose-response curve of IL-1ß concentration and nitrite accumulation (Fig 2B), treatment with PGD₂ mainly shifted the curve downward; ie, PGD₂ lessened the maximal response (nmol/10⁶ cells per 24 hours: 35.8±0.41 at 0 mol/L, 22.2±0.11 at 10^–6 mol/L, and 11.4±0.15 at 10^–5 mol/L PGD₂). PGD₂ also shifted the curve slightly to the right (ED₅₀ in U/mL: 3.85 at 0 mol/L, 7.58 at 10^–6 mol/L, and 9.89 at 10^–5 mol/L PGD₂). These data suggest that the inhibitory effect of PGD₂ is not due to antagonism at cytokine receptors.

In a chronological analysis of the inhibitory action of PGD₂ (Fig 2C), cultured VSMCs were incubated for 24 hours with the cytokine cocktail, and PGD₂ (3x10^–5 mol/L) was added into the culture medium at various intervals after the start of incubation with cytokines. Nitrite accumulation in the culture medium over the 24-hour incubation period was measured. The addition of PGD₂ within 6 hours from the start effectively inhibited NO generation, whereas the inhibition was strikingly lessened when PGD₂ addition was delayed over 6 hours, which may represent a critical time point for PGD₂ inhibition of NO synthesis.

Effect of PGD₂ on iNOS mRNA and Protein Expression
We next examined whether PGD₂ influences cytokine-induced expression of iNOS mRNA or iNOS protein (Fig 3). VSMCs in culture were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence of various concentrations of PGD₂, after which total RNA or partially purified iNOS protein was extracted. In the Northern analysis (Fig 3A), PGD₂ dose-dependently inhibited IL-1ß–stimulated induction of iNOS mRNA. PGD₂ at a concentration of 10^–6 mol/L or greater effectively decreased iNOS mRNA expression. IL-1ß suppressed ß-actin mRNA expression, whereas PGD₂ restored it, arguing against an overall cytotoxic effect of PGD₂. In Western analysis (Fig 3B), PGD₂ dose-dependently inhibited a cytokine-stimulated increase in iNOS protein.

View larger version (40K): [in this window] [in a new window]   Figure 3. Effect of PGD2 on iNOS mRNA and protein expression. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence of various concentrations of PGD2 as indicated. A, Northern blotting for iNOS and ß-actin. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; 3, with the cytokine and 10–6 mol/L PGD2; and 4, with the cytokine and 10–5 mol/L PGD2. Data shown are representative of three independent experiments that gave identical results. B, Western blotting for iNOS (125 kD) partially purified with ADP-Sepharose. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; 3, with the cytokine and 10–5 mol/L PGD2; and 4, with the cytokine and 10–4 mol/L PGD2.

Effect of PGD₂ on Total Protein Synthesis
PGD₂, at concentrations up to 10^–4 mol/L, did not significantly affect total protein synthesis in VSMCs (Table), providing further evidence that the reduction of iNOS expression by PGD₂ is not due to cytotoxicity.

Effects of Related Prostanoids on NO Generation in VSMCs
We compared the effect of PGD₂ with those of related prostanoids (Fig 4A). VSMCs were incubated for 24 hours with 20 U/mL IL-1ß in the presence of 10^–5 mol/L of PGD₂, U46619 (a stable TXA₂ analogue), carbaprostacyclin (a stable PGI₂ analogue), or PGE₁, after which nitrite accumulation in the medium was measured. PGD₂ reportedly acts as an agonist at TXA₂ receptors.²³ In the present study, U46619 at 10^–5 mol/L significantly, but less potently than PGD₂, reduced NO generation in VSMCs. Both carbaprostacyclin and PGE₁, which upregulate intracellular cAMP in VSMCs,^{24 25 26} slightly increased NO production by VSMCs.

View larger version (31K): [in this window] [in a new window]   Figure 4. Effects of related prostanoids on NO generation in VSMCs. A, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and 10–5 mol/L of the respective prostanoids indicated for measurement of nitrite. Columns and bars represent mean±SEM (n=4). (-) indicates without cytokine; (+), with cytokine only. *P<.01 vs (+). B, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and various concentrations of PGD2 as indicated, in the presence or absence of 10–3 mol/L SQ29548 for measurement of nitrite. Columns and bars represent mean±SEM (n=4). (-) indicates without cytokine. *P<.01 vs 0 mol/L PGD2; P<.01.

We next examined the effect of PGD₂ on NO generation in VSMCs stimulated for 24 hours with 20 U/mL IL-1ß in the presence of the TXA₂ receptor antagonist SQ29548 (Fig 4B). In the present assay system, 10^–4 mol/L of SQ29548 reversed the inhibitory effect of 10^–5 mol/L U46619 by 70% (data not shown). SQ29548 did not alter the pattern of inhibition by PGD₂ (Fig 4B), although it slightly reversed the effect of PGD₂ (P<.01 by two-way ANOVA for 10^–7 to 10^–4 mol/L PGD₂).

Effects of PGs of the J₂ Series on NO Production in VSMCs
Since PGD₂ is converted to PGJ₂ and its metabolites (Fig 5A),^{27 28 29 30} we next examined the effects of these PGD₂ metabolites on NO production by VSMCs (Fig 5B). VSMCs were incubated for 24 hours with 20 U/mL IL-1ß in the presence of various concentrations of PGD₂, PGJ₂, ¹²-PGJ₂, or 15-deoxy-^12,14-PGJ₂, after which nitrite accumulation in the medium was measured. PGJ₂, ¹²-PGJ₂, and 15-deoxy-^12,14-PGJ₂ were equipotent with or slightly stronger than PGD₂ in inhibition. The calculated doses of the PGs (expressed as negative log mol/L) evoking 50% inhibition were 6.03 (15-deoxy-^12,14-PGJ₂), 5.53 (¹²-PGJ₂), 5.47(PGJ₂), and 5.43 (PGD₂), respectively.

View larger version (22K): [in this window] [in a new window]   Figure 5. Effects of PGs of the J2 series on NO production in VSMCs. A, PGD2 metabolic pathway leading to the formation of PGJ2, 12-PGJ2, and 15-deoxy-12,14-PGJ2 is shown. B, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and various concentrations of the PGD2 metabolites, as indicated, for measurement of nitrite. Points and bars represent mean±SEM (n=4). C indicates control without cytokine. *P<.01 vs PGD2.

We also verified the inhibitory effect of 15-deoxy-^12,14-PGJ₂ on the expression of iNOS mRNA in VSMCs (Fig 6).

View larger version (50K): [in this window] [in a new window]   Figure 6. Effect of 15-deoxy-12,14-PGJ2 on the iNOS mRNA expression. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence or absence of 10–5 mol/L 15-deoxy-12,14-PGJ2. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; and 3, with the cytokine and 10–5 mol/L 15-deoxy-12,14-PGJ2. Data shown are representative of three independent Northern analyses that gave identical results.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We investigated whether PGD₂ modulates NO synthesis in VSMCs. To the best of our knowledge, this is the first report demonstrating a relationship between PGD₂ and NO synthase expression. In the present study, PGD₂ at 10^–7 mol/L dose-dependently inhibited cytokine-induced NO production in cultured VSMCs (Fig 1). Stimulation of VSMCs by the cytokine cocktail resulted in time-dependent accumulation of nitrite over 24 hours, which PGD₂ suppressed (Fig 2A). Downward shift of the dose-response curve of IL-1ß and nitrite accumulation ruled out antagonism by PGD₂ at cytokine receptors (Fig 2B). The chronological analysis indicated the existence of a critical time point of PGD₂ addition for inhibition, suggesting impairment of iNOS expression by PGD₂ (Fig 2C). PGD₂ was shown to inhibit expression of the iNOS mRNA and the iNOS protein (Fig 3). TXA₂ analogue U46619 slightly, and less effectively than PGD₂, reduced NO production by VSMCs, whereas neither the PGI₂ analogue carbaprostacyclin nor PGE₁ had an inhibitory effect (Fig 4A). Even under blockade of TXA₂ receptors by SQ29548, PGD₂ dose-dependently inhibited the NO generation (Fig 4B). PGJ₂, ¹²-PGJ₂, and 15-deoxy-^12,14-PGJ₂ were at least as potent as PGD₂ in inhibiting NO generation (Fig 5). Finally, 15-deoxy-^12,14-PGJ₂ inhibited iNOS mRNA expression in VSMCs (Fig 6). These data suggest that PGD₂ inhibits iNOS mRNA expression in VSMCs most likely through the PGJ₂ cascade.

Recent studies have demonstrated that NO production is enhanced in inflammatory vascular lesions such as atherosclerosis,^{2 3} where inflammatory cells (including macrophages, lymphocytes, platelets, and mast cells) infiltrate the thickened intima.^{6 18} In such circumstances, large amounts of cytokines are generated,⁷ which are likely to cause massive NO generation through induction of iNOS. Furthermore, some reports have suggested that VSMCs may be the primary source of NO in atherosclerotic lesions.³ On the other hand, PGD₂ reportedly is produced by endothelial cells,¹³ platelets,¹⁴ macrophages,¹⁵ and mast cells.^{16 17} Mast cells in particular play a pivotal role in formation of atheromatous lesions³¹ and, in addition, have a potent capacity to produce substantial amounts of PGD₂, releasing secretory granules that contain cyclooxygenase and are able to generate PGD₂.^{15 16 17} Moreover, granules phagocytosed by macrophages or VSMCs might release considerable amounts of PGD₂ into the intracellular space of, or the extracellular space near, NO-producing cells.¹⁵ Accordingly, we think it important to address the interaction between PGD₂ and NO in vascular lesions.

The present data suggest that PGD₂ may act as a local mediator suppressing iNOS induction and consequent massive NO generation. Some steroids also have been demonstrated to inhibit iNOS expression in vascular cells,^{32 33} consistent with their use in treating septic shock.⁴ In cultured rat VSMCs, 10^–7 mol/L of dexamethasone is sufficient to suppress iNOS expression.³² In the present study, concentrations of PGD₂ or its metabolites one to two orders higher were required to equal the degree of inhibition by steroids. Steroids, however, are circulating hormones, whereas prostanoids generally behave as local tissue mediators. Much higher concentrations of the PGs are attainable in limited local areas, where they are generated by inflammatory or vascular cells. PGD₂ actually has been found abundantly in homogenates from various tissues, including rat spleen, where its concentrations in extracts are >10^–5 mol/L.³⁴ Furthermore, PGD₂ and its J₂ metabolites have been demonstrated to promote adipocyte differentiation with EC₅₀ values in excess of 10^–6 mol/L,^{29 30} similar to those values for inhibition of NO generation in VSMCs. These findings, combined with the present data, support the pathophysiological involvement of PGD₂ at these high concentrations in NO metabolism.

PGD₂ increases intracellular cAMP via adenylate cyclase activation in platelets.⁹ The cell-surface PGD receptor is G protein–coupled and transmits a signal leading to cAMP upregulation.³⁵ In cultured VSMCs and mesangial cells, cAMP-elevating agents, including PGI₂ and PGE₁, enhance iNOS expression and NO generation.^{24 25 26} In the present study, both the PGI₂ analogue and PGE₁, at a dose of 10^–5 mol/L, again increased NO generation, although to relatively small degrees (Fig 4A), probably because the cells had been almost maximally stimulated by the cytokine. In contrast, PGD₂ decreased NO generation in VSMCs, arguing against significant involvement of cAMP upregulation in the effect of PGD₂ on iNOS expression. Angiotensin II also inhibits iNOS expression in VSMCs, at least in part through upregulation of PKC.³⁶ PGD₂ also can act as an agonist of the vasoconstrictor TXA₂,²³ which elevates PKC levels in VSMCs.³⁷ However, we observed only a slight inhibitory effect of the TXA₂ analogue on NO generation in VSMCs, failing to adequately explain the mechanism of the effect of PGD₂ in this manner (Fig 4A). In fact, PGD₂ addition dose-dependently inhibited the NO generation even under blockade of TXA₂ receptors (Fig 4B), indicating that a pathway other than via TXA₂ receptors is predominantly involved in the effect of PGD₂.

PGD₂ readily undergoes conversion in vivo and in vitro to yield additional, biologically active PGs of the J₂ series^{27 28 29 30} (Fig 5A). Incubation of PGD₂ in the presence of plasma or serum albumin results in the rapid accumulation of several major dehydration and isomerization products, including ¹²-PGJ₂ and 15-deoxy-^12,14-PGJ₂.^{27 28 30} Some of these products, including ¹²-PGJ₂, have antiproliferative effects, presumably involving their direct binding to nuclear proteins.^{12 38} Furthermore, 15-deoxy-^12,14-PGJ₂, a PGJ₂ derivative, recently has been demonstrated to be a natural ligand for an intranuclear receptor promoting adipocyte differentiation.^{29 30} In the present study, the four PGs showed doses producing 50% inhibition (expressed as negative log mol/L) in the following order: 15-deoxy-^12,14-PGJ₂>¹²-PGJ₂>PGJ₂>PGD₂ (Fig 5B), which may reflect the delay involved in conversion of these products. These results suggest that the inhibitory effect of PGD₂ on NO generation is exhibited most likely through the PGJ₂ cascade. Therefore, although the inhibitory effect of PGD₂ on iNOS induction may be partially mediated by TXA₂ receptors, it appears to result mainly from a direct action of PGD₂ or its J₂ metabolites on intranuclear components rather than via the adenylate cyclase–cAMP or inositol phospholipid–PKC pathway. The need for relatively high doses of the PGs also argues for this, because it would require much higher doses in the culture media to attain concentrations high enough to act on intracellular receptors than cell-surface ones. An intracrine mechanism might cause considerably high intracellular concentrations. The subcellular pathway downstream of the PGJ₂ cascade remains to be investigated.

In conclusion, we demonstrated that PGD₂ suppresses NO generation in VSMCs, which is due to inhibition of iNOS mRNA expression most likely operating mainly through a novel PGD₂ signaling pathway, the PGJ₂ cascade. These results suggest the possibility of involvement of PGD₂ in NO metabolism in the pathogenesis of vascular diseases.

	Selected Abbreviations and Acronyms

 

IL-1ß = interleukin 1ß iNOS = inducible NO synthase PCR = polymerase chain reaction PG = prostaglandin PKC = protein kinase C TCA = trichloroacetic acid TNF- = tumor necrosis factor TX = thromboxane VSMC = vascular smooth muscle cell

	Acknowledgments

 
This study was supported in part by a Grant-in-Aid from the Ministry of Education, Science and Culture of Japan. The authors acknowledge Dr Yukiko Kurashima (Biochemistry Division, National Cancer Center Research Institute), Dr Wee Soo Shin and Yukari Kawabata (the Second Department of Internal Medicine, University of Tokyo) for their technical assistance.

Received March 31, 1997; accepted October 23, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Moncada S, Palmer R, Higgs E. Nitric oxide: physiology, pathophysiology and pharmacology. Pharmacol Rev. 1991;43:109–142.[Medline] [Order article via Infotrieve]

2. Minor RL, Myers PR, Guerra R, Bates JN, Harrison DG. Diet-induced atherosclerosis increases the release of nitrogen oxides from rabbit aorta. J Clin Invest. 1990;86:2109–2116.

3. Sobey CG, Brooks RM, Heistad DD. Evidence that expression of inducible nitric oxide synthase in response to endotoxin is augmented in atherosclerotic rabbits. Circ Res. 1995;77:536–554.[Abstract/Free Full Text]

4. Petros A, Bennett D, Vallance P. Effect of nitric oxide synthase inhibitors on hypotension in patients with septic shock. Lancet. 1991;338:1557–1558.[Medline] [Order article via Infotrieve]

5. Joly GA, Sehini VB, Vanhoutte PM. Balloon injury and interleukin-1ß induce nitric oxide synthase activity in rat carotid arteries. Circ Res. 1992;71:331–338.[Abstract/Free Full Text]

6. Tsukada T, Rosenfeld M, Ross R, Gown AM. Immunocytochemical analysis of cellular components in lesions of atherosclerosis of the Watanabe and fat-fed rabbit using monoclonal antibodies. Arteriosclerosis. 1986;6:601–613.[Abstract]

7. Bernard C, Szekely B, Philip I, Wollman E, Payen D, Tedgui A. Activated macrophages depress the contractility of rabbit carotids via an L-arginine/nitric oxide-dependent effector mechanism: connection with amplified cytokine release. J Clin Invest. 1992;89:851–860.

8. Urade Y, Ujihara M, Horiguchi Y, Ikai K, Hayaishi O. The major source of endogenous prostaglandin D₂ production is likely antigen-presenting cells: localization of glutathione-requiring prostaglandin D synthetase in histiocytes, dendritic, and Kupffer cells in various rat tissues. J Immunol. 1989;143:2982–2989.[Abstract]

9. Bushfield M, McNicol A, MacIntyre DE. Inhibition of platelet-activating-factor-induced human platelet activation by prostaglandin D₂: differential sensitivity of platelet transduction processes and functional response to inhibition by cyclic AMP. Biochem J. 1985;232:267–271.[Medline] [Order article via Infotrieve]

10. Braun M, Schror K. Prostaglandin D₂ relaxes bovine coronary arteries by endothelium-dependent nitric oxide–mediated cGMP formation. Circ Res. 1992;71:1305–1313.[Abstract/Free Full Text]

11. Onoe H, Ueno R, Fujita I, Nishino H, Oomura Y, Hayaishi O. Prostaglandin D₂, a cerebral sleep-inducing substance in monkey. Proc Natl Acad Sci U S A.. 1988;85:4082–4086.[Abstract/Free Full Text]

12. Fukushima M. Prostaglandin J₂: anti-tumor and anti-viral activities and the mechanisms involved. Eicosanoids. 1990;3:189–199.[Medline] [Order article via Infotrieve]

13. Spatz M, Stanimirovic D, Bacic F, Uematsu S, McCarron RM. Vasoconstrictive peptides induce endothelin-1 and prostanoids in human cerebromicrovascular endothelium. Am J Physiol. 1994;266(pt 1):C654–C660.

14. Watanabe T, Narumiya S, Shimizu T, Hayaishi O. Characterization of the biosynthetic pathway of prostaglandin D₂ in human platelet-rich plasma. J Biol Chem. 1982;257:14847–14853.[Abstract/Free Full Text]

15. Salari H, Chan YM. Mast cell mediators stimulate synthesis of arachidonic acid metabolites in macrophages. J Immunol. 1989;142:2821–2827.[Abstract]

16. Katz HR, Raizman MB, Gartner CS, Scott HC, Benson AC, Austen KF. Secretory granule mediator release and generation of oxidative metabolites of arachidonic acid via Fc-IgG receptor bridging in mouse mast cells. J Immunol. 1992;148:868–871.[Abstract]

17. Thomas PS, Wilson AN, Schreck RE, Lazarus SC. Prostaglandin D₂ production and identification of prostaglandin H synthase within canine mast cell granule. Am J Physiol. 1992;263(pt 1):L168–L176.

18. Kaartinen M, Penttila A, Kovanen PT. Mast cells of two types differing in neutral protease composition in the human aortic intima. Demonstration of tryptase- and tryptase/chymase-containing mast cells in normal intimas, fatty streaks, and the shoulder region of atheromas. Arterioscler Thromb Vasc Biol. 1994;14:966–972.[Abstract/Free Full Text]

19. Ross R, Glomset J, Kariya B, Harker L. A platelet-dependent serum factor that stimulates the proliferation of arterial smooth muscle cells in vitro. Proc Natl Acad Sci U S A.. 1974;71:1207–1210.[Abstract/Free Full Text]

20. Ohshima H, Brouet IM, Bandaletova T, Adachi H, Oguchi S, Iida S, Kurashima Y, Morishita Y, Sugiura T, Esumi H. Polyclonal antibody against an inducible form of nitric oxide synthase purified from the liver of rats treated with Propionibacterium acnes and lipopolysaccharide. Biochem Biophys Res Commun. 1992;187:1291–1297.[Medline] [Order article via Infotrieve]

21. Nunokawa Y, Ishida N, Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun. 1993;191:89–94.[Medline] [Order article via Infotrieve]

22. Marchuk D, Drumm M, Saulino A, Collins F. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 1990;19:1154.[Free Full Text]

23. McKenniff MG, Norman P, Cuthbert NJ, Gardiner PJ. BAY u3405, a potent and selective thromboxane A₂ receptor antagonist on airway smooth muscle in vitro. Br J Pharmacol. 1991;104:585–590.[Medline] [Order article via Infotrieve]

24. Koide M, Kawahara Y, Nakayama I, Tsuda T, Yokoyama M. Cyclic AMP-elevation agents induce an inducible type of nitric oxide synthase in cultured vascular smooth muscle cells. J Biol Chem. 1993;268:24959–24966.[Abstract/Free Full Text]

25. Imai T, Hirata Y, Kanno K, Marumo F. Induction of nitric oxide synthase by cyclic AMP in rat vascular smooth muscle cells. J Clin Invest. 1994;93:543–549.

26. Tetsuka T, Daphna-Iken D, Srivastava SK, Baier LD, DuMaine J, Morrison AR. Cross-talk between cyclooxygenase and nitric oxide pathways: prostaglandin E₂ negatively modulates induction of nitric oxide synthase by interleukin 1. Proc Natl Acad Sci U S A.. 1994;91:12168–12172.[Abstract/Free Full Text]

27. Fitzpatrick FA, Wynalda MA. Albumin-catalyzed metabolism of prostaglandin D₂. J Biol Chem. 1983;258:11713–11718.[Abstract/Free Full Text]

28. Kikawa Y, Narumiya S, Fukushima M, Wakatsuka H, Hayaishi O. 9-Deoxy-,⁹¹²-13,14-dihydroprostaglandin D₂, a metabolite of prostaglandin D₂ formed in human plasma. Proc Natl Acad Sci U S A.. 1984;81:1317–1321.[Abstract/Free Full Text]

29. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxy-^12,14-prostaglandin J₂ is a ligand for the adipocyte determination factor PPAR. Cell. 1995;83:803–812.[Medline] [Order article via Infotrieve]

30. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM. A prostaglandin J₂ metabolite binds peroxisome proliferator-activated receptor and promotes adipocyte differentiation. Cell. 1995;83:813–819.[Medline] [Order article via Infotrieve]

31. Kaartinen M, Penttila A, Kovanen PT. Extracellular mast cell granules carry apolipoprotein B-100–containing lipoproteins into phagocytes in human arterial intima. Functional coupling of exocytosis and phagocytosis in neighboring cells. Arterioscler Thromb Vasc Biol. 1995;15:2047–2054.[Abstract/Free Full Text]

32. Kanno K, Hirata Y, Imai T, Marumo F. Induction of nitric oxide synthase gene by interleukin in vascular smooth muscle cells. Hypertension. 1993;22:34–39.[Abstract/Free Full Text]

33. Di Rosa RM, Radomski M, Carnuccio R, S. Moncada S. Glucocorticoids inhibit the induction of nitric oxide synthase in macrophages. Biochem Biophys Res Commun. 1990;172:1246–1252.[Medline] [Order article via Infotrieve]

34. Ujihara M, Urade Y, Eguchi N, Hayashi H, Ikai K, Hayaishi O. Prostaglandin D₂ formation and characterization of its synthetases in various tissues of adult rats. Arch Biochem Biophys. 1988;260:521–531.[Medline] [Order article via Infotrieve]

35. Hirata M, Kakizuka A, Aizawa M, Ushikubi F, Narumiya S. Molecular characterization of a mouse prostaglandin D receptor and functional expression of the cloned gene. Proc Natl Acad Sci U S A.. 1994;91:11192–11196.[Abstract/Free Full Text]

36. Nakayama I, Kawahara Y, Tsuda T, Okuda M, Yokoyama M. Angiotensin II inhibits cytokine-stimulated inducible nitric oxide synthase expression in vascular smooth muscle cells. J Biol Chem. 1994;269:11628–11633.[Abstract/Free Full Text]

37. Ali S, Becker MW, Davis MG, Dorn GW. Dissociation of vasocontrictor-stimulated basic fibroblast growth factor expression from hypertrophic growth in cultured vascular smooth muscle cells. Circ Res. 1994;75:836–843.[Abstract/Free Full Text]

38. Narumiya S, Ohno K, Fukusima M, Fujiwara M. Site and mechanism of growth inhibition by prostaglandins. III. Distribution and binding of prostaglandin A₂ and ¹²-prostaglandin J₂ in nuclei. J Pharmacol Exp Ther. 1985;242:306–311.[Abstract/Free Full Text]

This article has been cited by other articles:

				T. Satoh, R. Moroi, K. Aritake, Y. Urade, Y. Kanai, K. Sumi, H. Yokozeki, H. Hirai, K. Nagata, T. Hara, et al. Prostaglandin D2 Plays an Essential Role in Chronic Allergic Inflammation of the Skin via CRTH2 Receptor J. Immunol., August 15, 2006; 177(4): 2621 - 2629. [Abstract] [Full Text] [PDF]

				M. Ogawa, N. Hirawa, T. Tsuchida, N. Eguchi, Y. Kawabata, A. Numabe, H. Negoro, R. Hakamada-Taguchi, K. Seiki, S. Umemura, et al. Urinary excretions of lipocalin-type prostaglandin D2 synthase predict the development of proteinuria and renal injury in OLETF rats Nephrol. Dial. Transplant., April 1, 2006; 21(4): 924 - 934. [Abstract] [Full Text] [PDF]

				M. Taniike, I. Mohri, N. Eguchi, C. T. Beuckmann, K. Suzuki, and Y. Urade Perineuronal Oligodendrocytes Protect against Neuronal Apoptosis through the Production of Lipocalin-Type Prostaglandin D Synthase in a Genetic Demyelinating Model J. Neurosci., June 15, 2002; 22(12): 4885 - 4896. [Abstract] [Full Text] [PDF]

				N. Hirawa, Y. Uehara, M. Yamakado, Y. Toya, T. Gomi, T. Ikeda, Y. Eguchi, M. Takagi, H. Oda, K. Seiki, et al. Lipocalin-Type Prostaglandin D Synthase in Essential Hypertension Hypertension, February 1, 2002; 39(2): 449 - 454. [Abstract] [Full Text] [PDF]

				K. Guyton, R. Bond, C. Reilly, G. Gilkeson, P. Halushka, and J. Cook Differential effects of 15-deoxy-{Delta}12,14-prostaglandin J2 and a peroxisome proliferator-activated receptor {gamma} agonist on macrophage activation J. Leukoc. Biol., April 1, 2001; 69(4): 631 - 638. [Abstract] [Full Text]

				M. Monroy, J. W. Kuluz, D. He, W. D. Dietrich, and C. L. Schleien Role of nitric oxide in the cerebrovascular and thermoregulatory response to interleukin-1{beta} Am J Physiol Heart Circ Physiol, April 1, 2001; 280(4): H1448 - H1453. [Abstract] [Full Text] [PDF]

				M. Shimpo, U. Ikeda, Y. Maeda, K.-i. Ohya, Y. Murakami, and K. Shimada Effects of Aspirin-Like Drugs on Nitric Oxide Synthesis in Rat Vascular Smooth Muscle Cells Hypertension, May 1, 2000; 35(5): 1085 - 1091. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nagoshi, H. Articles by Omata, M. Search for Related Content PubMed PubMed Citation Articles by Nagoshi, H. Articles by Omata, M.