Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1998;82:204-209

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagoshi, H.
Right arrow Articles by Omata, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagoshi, H.
Right arrow Articles by Omata, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE
(Circulation Research. 1998;82:204-209.)
© 1998 American Heart Association, Inc.


Original Contributions

Prostaglandin D2 Inhibits Inducible Nitric Oxide Synthase Expression in Rat Vascular Smooth Muscle Cells

Hiroshi Nagoshi, Yoshio Uehara, Fumihiko Kanai, Shin Maeda, Tsutomu Ogura, Atsuo Goto, Teruhiko Toyo-oka, Hiroyasu Esumi, Takao Shimizu, , Masao Omata

From the Second Department of Internal Medicine (H.N., Y.U., F.K., S.M., A.G., T.T., M.O.) and the Department of Biochemistry (T.S.), University of Tokyo; and the Biochemistry Division (T.O., H.E.), National Cancer Center Research Institute, Tokyo, Japan.

Correspondence to Hiroshi Nagoshi, MD, The Second Department of Internal Medicine, University of Tokyo, 7–3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Vascular smooth muscle cells (VSMCs) as well as macrophages have been shown to generate a substantial amount of NO in inflammatory vascular lesions. Prostaglandin (PG) D2 (PGD2) is produced by inflammatory cells, including mast cells and macrophages. We investigated whether PGD2 modulates NO metabolism in rat VSMCs. PGD2 at a concentration of 10–7 mol/L or greater dose-dependently inhibited nitrite accumulation in the medium of cultured VSMCs stimulated with interleukin 1ß (IL-1ß). In a dose-response analysis of IL-1ß and nitrite accumulation, PGD2 was seen to decrease the maximal ability of VSMCs to generate NO, arguing against competition by PGD2 at cytokine receptors. Northern analysis showed that PGD2 suppresses induction of inducible NO synthase (iNOS) mRNA in IL-1ß–stimulated VSMCs, with consequent inhibition of iNOS protein expression in Western analysis. A thromboxane A2 (TXA2) analogue, U46619 (10–5 mol/L), produced less inhibition of NO generation than did PGD2. Neither the PGI2 analog carbaprostacyclin nor PGE1 showed any inhibition. PGD2 dose-dependently inhibited NO generation despite the addition of the TXA2 antagonist SQ29548. PGJ2, {Delta}12-PGJ2, and 15-deoxy-{Delta}12,14-PGJ2, all metabolites of PGD2, were as potent as or slightly stronger than PGD2 in the inhibition of NO generation. These data suggest that PGD2 suppresses NO generation in VSMCs by inhibiting iNOS mRNA expression, most likely through the cascade of the PGJ2 series rather than through the TX receptor or cAMP upregulation. Such action makes it likely that PGD2 regulates NO metabolism in vascular lesions.


Key Words: inducible nitric oxide synthase • prostaglandin D2 • vascular smooth muscle cells {blacksquare} expression inhibition • prostaglandin J2


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Nitric oxide has been highlighted as a potent chemical mediator of vascular, immune, and neural function.1 Enhanced expression of iNOS and increased NO generation have also been reported with various inflammatory states, including atherosclerosis,2 3 vasculopathy in septic shock,4 and postangioplastic vascular injury.5 In atherosclerosis, inflammatory cells such as macrophages and lymphocytes infiltrate into the lesions,6 releasing various mediators including cytokines.7 Recent studies have found NO generation to be enhanced in atherosclerotic lesions.2 In addition, VSMCs may be more important than macrophages as a source of NO in atherosclerotic lesions.3

PGD2 is a metabolite of arachidonic acid derived from PGH2, a common precursor in the synthesis of most PGs. PGD2 is predominant among prostanoids in many organs, including liver, spleen, central nerve system, and intestines.8 PGD2 inhibits platelet aggregation through activation of adenylate cyclase,9 relaxes or constricts arterial vessels according to viability of the endothelium,10 and acts as a neurotransmitter in the brain, mediating sleep.11 PGD2 and its metabolites also are known to inhibit proliferation of various cell lines.12 More interestingly, PGD2 is generated in arteries by endothelial cells,13 platelets,14 macrophages,15 and mast cells,16 17 which are the component cells of atheromatous lesions.6 18

To the best of our knowledge, however, few studies have directly addressed the roles of PGD2 in the pathogenesis of vascular lesions. Hypothesizing that an interaction between PGD2 and NO exists in vessel walls, we investigated the effect of PGD2 on NO metabolism in cultured rat VSMCs.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
PGD2, {Delta}12-PGJ2, and PGE1 were gifts from Ono Pharmaceutical (Osaka, Japan). All other prostanoids and related reagents were purchased from Cayman Chemical. Recombinant murine IL-1ß and TNF-{alpha} were purchased from R&D Systems. Reduced NADPH was obtained from Sigma. cDNA probes for murine ß-actin and GAPDH were purchased from Wako and the American Type Culture Collection (ATCC No. 57091), respectively. Moloney murine leukemia virus reverse transcriptase was obtained from GIBCO-BRL, and recombinant Taq DNA polymerase was obtained from TaKaRa Biomedicals. Deoxycytidine 5'-[{alpha}-32P]triphosphate and L-[4,5-3H]leucine were purchased from DuPont-NEN. Other materials and reagents were obtained from commercial sources.

Cell Culture and Incubation
VSMCs were isolated from the thoracic aorta of 10- to 12-week-old male Wistar-Kyoto rats (Doken, Shimodate, Japan) by a standard explant method of Ross et al19 and grown in DMEM supplemented with 10% fetal calf serum (Bioserum) and antibiotics. Culture purity was assessed by immunofluorescence staining with a monoclonal antibody specific for smooth muscle {alpha}-actin. Confluent cells between the 10th and 20th passages were used for all experiments. Incubation of cultured cells was performed at 37°C in a humidified atmosphere of 95% air/5% CO2. Solutions of cytokines were prepared with DMEM containing 0.1% bovine serum albumin.

Measurement of NO Production
NO production was measured as nitrite accumulation in medium from cultured VSMCs. After incubation of the cells in serum-free DMEM with the respective test compounds in 24-well culture clusters, aliquots of the media were mixed with an equal volume of Griess reagent [1% sulfonamide/0.1% N-(1-naphthyl)ethylenediamine dihydrochloride/5% phosphoric acid]. Optical absorption was measured spectrophotometrically at a wavelength of 540 nm, using sodium nitrite as the standard. Medium incubated in a cell-free well was used to obtain a baseline value. In the present assay system, nitrite accumulation induced by cytokines was dose-dependently inhibited by NG-monomethyl-L-arginine, an action reversed by L-arginine (data not shown).

Western Analysis
Polyclonal anti-iNOS antibody was raised as reported previously.20 After incubation periods with respective test compounds, VSMCs in culture were harvested and sonicated in ice-cold Tris buffer containing 50 mmol/L Tris-HCl (pH 7.5), 0.5 mmol/L EDTA, 0.5 mmol/L EGTA, 1 mmol/L leupeptin, 0.1 mmol/L phenylmethylsulfonyl fluoride, and 1 mmol/L dithiothreitol. The homogenate was centrifuged at 100 000g for 60 minutes at 4°C. The supernatant containing 5 mg cytosolic protein was incubated at 4°C for 30 minutes with ADP Sepharose gel (Pharmacia) with gentle agitation.20 NO synthase was eluted with Tris buffer supplemented with 10 mmol/L NADPH. The partially purified enzyme was subjected to 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Immobilon-PSQ, Millipore). NO synthase protein was detected with anti-iNOS antibody using peroxidase-labeled anti-rabbit IgG as the second antibody and 4-chloro-1-naphthol as the substrate.

Measurement of Total Protein Synthesis
VSMCs grown in 24-well culture clusters were incubated for 24 hours in serum-free DMEM containing 1 µCi/mL [3H]leucine and various concentrations of PGD2. After harvesting the cells, cellular protein was precipitated with ice-cold 10% TCA and redissolved in 0.2N NaOH. After neutralization with HCl, TCA again was added, and the radioactivity of [3H]leucine incorporated into the TCA-insoluble cellular fraction was measured by liquid scintillation counting.

Preparation of cDNA Probe for iNOS
Total RNA was extracted from IL-1ß–stimulated VSMCs by an acid-guanidinium-thiocyanate method and subjected to reverse-transcription PCR. The cDNA was amplified by PCR with primers for rat iNOS (upper, 5'CATGGCTTCCCGCGTCAGAG 3'; lower, 5'TCCAGCACCTCCAGGAACGT 3') corresponding to nucleotide sequences 1587 to 1606 and 2642 to 2623, respectively,21 with 32 cycles of denaturing at 94°C for 1 minute, annealing at 56°C for 1 minute, and extension at 72°C for 1.5 minutes. PCR product of the expected size was ligated into pCR II plasmid vector (Invitrogen) by a T/A cloning method.22 The nucleotide sequence of the subcloned cDNA was determined by the dideoxynucleotide chain-termination method using an autosequencer (373 DNA sequencing system, Perkin-Elmer). The sequence coincided with that of iNOS reported previously with 98.5% similarity.21 An insert of BstXI restriction fragment of the iNOS plasmid was used as a probe for Northern blotting.

Northern Analysis
After respective incubation periods of cultured VSMCs, total RNA was extracted by the acid-guanidinium-thiocyanate method. Thirty micrograms of total RNA was separated by formaldehyde/1.0% agarose gel electrophoresis and transferred to a nylon membrane (Hibond N+, Amersham) in 20x SSC. After ultraviolet wave cross-linking, RNA immobilized on the membrane was hybridized for 16 hours at 65°C with 32P-labeled cDNA probe for rat iNOS, murine ß-actin, or human GAPDH in hybridization buffer (Amersham). The membrane was washed finally at 65°C in 0.1x SSC containing 0.1% SDS and was autoradiographed on radiographic film at -80°C.

Statistical Analysis
Values are expressed as mean±SEM. Statistical analysis was performed by unpaired Student's t test or by ANOVA followed by Scheffé's F (multiple-comparison) test. Values of P<.05 were considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Effect of PGD2 on Cytokine-Stimulated NO Production in VSMCs
We incubated VSMCs in culture with 20 U/mL IL-1ß or 30 ng/mL TNF-{alpha} in the presence of various concentrations of PGD2 (Fig 1Down). Nitrite accumulation in the culture medium over a 24-hour period was measured. Stimulation of VSMCs with IL-1ß or TNF-{alpha} caused remarkable accumulation of nitrite. This was dose-dependently inhibited by simultaneous treatment of the cells with PGD2 at doses of 10–7 mol/L or greater.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Effect of PGD2 on NO generation in cytokine-stimulated VSMCs. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß (A) or 30 ng/mL TNF-{alpha} (B) with the indicated concentrations of PGD2 for measurement of nitrite. Columns and bars represent mean±SEM (n=5). (-) indicates without cytokine. *P<.01 vs 0 mol/L.

We next examined the time course of nitrite accumulation in the culture medium, stimulating the cells with a cytokine cocktail (20 U/mL IL-1ß and 30 ng/mL TNF-{alpha}) in the presence or absence of 10–5 mol/L PGD2 for various intervals of time (Fig 2ADown). Nitrite accumulation increased with time, over 24 hours, an effect suppressed by PGD2.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Analysis of the effect of PGD2 on NO generation in VSMCs. A, Time course of nitrite accumulation. VSMCs were incubated with a cytokine cocktail (20 U/mL IL-1ß and 30 ng/mL TNF-{alpha}) ({bullet}), with the cytokine cocktail and 10–5 mol/L PGD2 ({blacksquare}), or with their vehicles only ({circ}) for indicated periods. Nitrite accumulation in the culture medium was measured. Points and bars represent mean±SEM (n=5). *P<.01 vs incubation with cytokines only. B, Dose-response curve of IL-1ß concentration and NO production. VSMCs were incubated for 24 hours with various concentrations of IL-1ß and PGD2 as indicated for measurement of nitrite. Points and bars represent mean±SEM (n=5). *P<.01 vs 0 mol/L PGD2. C, Chronology of inhibitory action of PGD2. VSMCs were incubated for 24 hours with the cytokine cocktail. PGD2 (3x10–5 mol/L) was added at various time points indicated after the addition of cytokines. Nitrite accumulation during the 24-hour incubation was measured. Points and bars represent mean±SEM (n=4). The column indicates nitrite accumulation without cytokine stimulation. *P<.01 vs time 0.

In a dose-response curve of IL-1ß concentration and nitrite accumulation (Fig 2BUp), treatment with PGD2 mainly shifted the curve downward; ie, PGD2 lessened the maximal response (nmol/106 cells per 24 hours: 35.8±0.41 at 0 mol/L, 22.2±0.11 at 10–6 mol/L, and 11.4±0.15 at 10–5 mol/L PGD2). PGD2 also shifted the curve slightly to the right (ED50 in U/mL: 3.85 at 0 mol/L, 7.58 at 10–6 mol/L, and 9.89 at 10–5 mol/L PGD2). These data suggest that the inhibitory effect of PGD2 is not due to antagonism at cytokine receptors.

In a chronological analysis of the inhibitory action of PGD2 (Fig 2CUp), cultured VSMCs were incubated for 24 hours with the cytokine cocktail, and PGD2 (3x10–5 mol/L) was added into the culture medium at various intervals after the start of incubation with cytokines. Nitrite accumulation in the culture medium over the 24-hour incubation period was measured. The addition of PGD2 within 6 hours from the start effectively inhibited NO generation, whereas the inhibition was strikingly lessened when PGD2 addition was delayed over 6 hours, which may represent a critical time point for PGD2 inhibition of NO synthesis.

Effect of PGD2 on iNOS mRNA and Protein Expression
We next examined whether PGD2 influences cytokine-induced expression of iNOS mRNA or iNOS protein (Fig 3Down). VSMCs in culture were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence of various concentrations of PGD2, after which total RNA or partially purified iNOS protein was extracted. In the Northern analysis (Fig 3ADown), PGD2 dose-dependently inhibited IL-1ß–stimulated induction of iNOS mRNA. PGD2 at a concentration of 10–6 mol/L or greater effectively decreased iNOS mRNA expression. IL-1ß suppressed ß-actin mRNA expression, whereas PGD2 restored it, arguing against an overall cytotoxic effect of PGD2. In Western analysis (Fig 3BDown), PGD2 dose-dependently inhibited a cytokine-stimulated increase in iNOS protein.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Effect of PGD2 on iNOS mRNA and protein expression. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence of various concentrations of PGD2 as indicated. A, Northern blotting for iNOS and ß-actin. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; 3, with the cytokine and 10–6 mol/L PGD2; and 4, with the cytokine and 10–5 mol/L PGD2. Data shown are representative of three independent experiments that gave identical results. B, Western blotting for iNOS ({approx}125 kD) partially purified with ADP-Sepharose. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; 3, with the cytokine and 10–5 mol/L PGD2; and 4, with the cytokine and 10–4 mol/L PGD2.

Effect of PGD2 on Total Protein Synthesis
PGD2, at concentrations up to 10–4 mol/L, did not significantly affect total protein synthesis in VSMCs (TableDown), providing further evidence that the reduction of iNOS expression by PGD2 is not due to cytotoxicity.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of PGD2 on Total Protein Synthesis

Effects of Related Prostanoids on NO Generation in VSMCs
We compared the effect of PGD2 with those of related prostanoids (Fig 4ADown). VSMCs were incubated for 24 hours with 20 U/mL IL-1ß in the presence of 10–5 mol/L of PGD2, U46619 (a stable TXA2 analogue), carbaprostacyclin (a stable PGI2 analogue), or PGE1, after which nitrite accumulation in the medium was measured. PGD2 reportedly acts as an agonist at TXA2 receptors.23 In the present study, U46619 at 10–5 mol/L significantly, but less potently than PGD2, reduced NO generation in VSMCs. Both carbaprostacyclin and PGE1, which upregulate intracellular cAMP in VSMCs,24 25 26 slightly increased NO production by VSMCs.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Effects of related prostanoids on NO generation in VSMCs. A, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and 10–5 mol/L of the respective prostanoids indicated for measurement of nitrite. Columns and bars represent mean±SEM (n=4). (-) indicates without cytokine; (+), with cytokine only. *P<.01 vs (+). B, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and various concentrations of PGD2 as indicated, in the presence or absence of 10–3 mol/L SQ29548 for measurement of nitrite. Columns and bars represent mean±SEM (n=4). (-) indicates without cytokine. *P<.01 vs 0 mol/L PGD2; {dagger}P<.01.

We next examined the effect of PGD2 on NO generation in VSMCs stimulated for 24 hours with 20 U/mL IL-1ß in the presence of the TXA2 receptor antagonist SQ29548 (Fig 4BUp). In the present assay system, 10–4 mol/L of SQ29548 reversed the inhibitory effect of 10–5 mol/L U46619 by 70% (data not shown). SQ29548 did not alter the pattern of inhibition by PGD2 (Fig 4BUp), although it slightly reversed the effect of PGD2 (P<.01 by two-way ANOVA for 10–7 to 10–4 mol/L PGD2).

Effects of PGs of the J2 Series on NO Production in VSMCs
Since PGD2 is converted to PGJ2 and its metabolites (Fig 5ADown),27 28 29 30 we next examined the effects of these PGD2 metabolites on NO production by VSMCs (Fig 5BDown). VSMCs were incubated for 24 hours with 20 U/mL IL-1ß in the presence of various concentrations of PGD2, PGJ2, {Delta}12-PGJ2, or 15-deoxy-{Delta}12,14-PGJ2, after which nitrite accumulation in the medium was measured. PGJ2, {Delta}12-PGJ2, and 15-deoxy-{Delta}12,14-PGJ2 were equipotent with or slightly stronger than PGD2 in inhibition. The calculated doses of the PGs (expressed as negative log mol/L) evoking 50% inhibition were 6.03 (15-deoxy-{Delta}12,14-PGJ2), 5.53 ({Delta}12-PGJ2), 5.47(PGJ2), and 5.43 (PGD2), respectively.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Effects of PGs of the J2 series on NO production in VSMCs. A, PGD2 metabolic pathway leading to the formation of PGJ2, {Delta}12-PGJ2, and 15-deoxy-{Delta}12,14-PGJ2 is shown. B, VSMCs were incubated for 24 hours with 20 U/mL IL-1ß and various concentrations of the PGD2 metabolites, as indicated, for measurement of nitrite. Points and bars represent mean±SEM (n=4). C indicates control without cytokine. *P<.01 vs PGD2.

We also verified the inhibitory effect of 15-deoxy-{Delta}12,14-PGJ2 on the expression of iNOS mRNA in VSMCs (Fig 6Down).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 6. Effect of 15-deoxy-{Delta}12,14-PGJ2 on the iNOS mRNA expression. VSMCs were incubated for 24 hours with 20 U/mL IL-1ß or its vehicle in the presence or absence of 10–5 mol/L 15-deoxy-{Delta}12,14-PGJ2. Lanes are as follows: 1, without cytokine; 2, with the cytokine alone; and 3, with the cytokine and 10–5 mol/L 15-deoxy-{Delta}12,14-PGJ2. Data shown are representative of three independent Northern analyses that gave identical results.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We investigated whether PGD2 modulates NO synthesis in VSMCs. To the best of our knowledge, this is the first report demonstrating a relationship between PGD2 and NO synthase expression. In the present study, PGD2 at >=10–7 mol/L dose-dependently inhibited cytokine-induced NO production in cultured VSMCs (Fig 1Up). Stimulation of VSMCs by the cytokine cocktail resulted in time-dependent accumulation of nitrite over 24 hours, which PGD2 suppressed (Fig 2AUp). Downward shift of the dose-response curve of IL-1ß and nitrite accumulation ruled out antagonism by PGD2 at cytokine receptors (Fig 2BUp). The chronological analysis indicated the existence of a critical time point of PGD2 addition for inhibition, suggesting impairment of iNOS expression by PGD2 (Fig 2CUp). PGD2 was shown to inhibit expression of the iNOS mRNA and the iNOS protein (Fig 3Up). TXA2 analogue U46619 slightly, and less effectively than PGD2, reduced NO production by VSMCs, whereas neither the PGI2 analogue carbaprostacyclin nor PGE1 had an inhibitory effect (Fig 4AUp). Even under blockade of TXA2 receptors by SQ29548, PGD2 dose-dependently inhibited the NO generation (Fig 4BUp). PGJ2, {Delta}12-PGJ2, and 15-deoxy-{Delta}12,14-PGJ2 were at least as potent as PGD2 in inhibiting NO generation (Fig 5Up). Finally, 15-deoxy-{Delta}12,14-PGJ2 inhibited iNOS mRNA expression in VSMCs (Fig 6Up). These data suggest that PGD2 inhibits iNOS mRNA expression in VSMCs most likely through the PGJ2 cascade.

Recent studies have demonstrated that NO production is enhanced in inflammatory vascular lesions such as atherosclerosis,2 3 where inflammatory cells (including macrophages, lymphocytes, platelets, and mast cells) infiltrate the thickened intima.6 18 In such circumstances, large amounts of cytokines are generated,7 which are likely to cause massive NO generation through induction of iNOS. Furthermore, some reports have suggested that VSMCs may be the primary source of NO in atherosclerotic lesions.3 On the other hand, PGD2 reportedly is produced by endothelial cells,13 platelets,14 macrophages,15 and mast cells.16 17 Mast cells in particular play a pivotal role in formation of atheromatous lesions31 and, in addition, have a potent capacity to produce substantial amounts of PGD2, releasing secretory granules that contain cyclooxygenase and are able to generate PGD2.15 16 17 Moreover, granules phagocytosed by macrophages or VSMCs might release considerable amounts of PGD2 into the intracellular space of, or the extracellular space near, NO-producing cells.15 Accordingly, we think it important to address the interaction between PGD2 and NO in vascular lesions.

The present data suggest that PGD2 may act as a local mediator suppressing iNOS induction and consequent massive NO generation. Some steroids also have been demonstrated to inhibit iNOS expression in vascular cells,32 33 consistent with their use in treating septic shock.4 In cultured rat VSMCs, 10–7 mol/L of dexamethasone is sufficient to suppress iNOS expression.32 In the present study, concentrations of PGD2 or its metabolites one to two orders higher were required to equal the degree of inhibition by steroids. Steroids, however, are circulating hormones, whereas prostanoids generally behave as local tissue mediators. Much higher concentrations of the PGs are attainable in limited local areas, where they are generated by inflammatory or vascular cells. PGD2 actually has been found abundantly in homogenates from various tissues, including rat spleen, where its concentrations in extracts are >10–5 mol/L.34 Furthermore, PGD2 and its J2 metabolites have been demonstrated to promote adipocyte differentiation with EC50 values in excess of 10–6 mol/L,29 30 similar to those values for inhibition of NO generation in VSMCs. These findings, combined with the present data, support the pathophysiological involvement of PGD2 at these high concentrations in NO metabolism.

PGD2 increases intracellular cAMP via adenylate cyclase activation in platelets.9 The cell-surface PGD receptor is G protein–coupled and transmits a signal leading to cAMP upregulation.35 In cultured VSMCs and mesangial cells, cAMP-elevating agents, including PGI2 and PGE1, enhance iNOS expression and NO generation.24 25 26 In the present study, both the PGI2 analogue and PGE1, at a dose of 10–5 mol/L, again increased NO generation, although to relatively small degrees (Fig 4AUp), probably because the cells had been almost maximally stimulated by the cytokine. In contrast, PGD2 decreased NO generation in VSMCs, arguing against significant involvement of cAMP upregulation in the effect of PGD2 on iNOS expression. Angiotensin II also inhibits iNOS expression in VSMCs, at least in part through upregulation of PKC.36 PGD2 also can act as an agonist of the vasoconstrictor TXA2,23 which elevates PKC levels in VSMCs.37 However, we observed only a slight inhibitory effect of the TXA2 analogue on NO generation in VSMCs, failing to adequately explain the mechanism of the effect of PGD2 in this manner (Fig 4AUp). In fact, PGD2 addition dose-dependently inhibited the NO generation even under blockade of TXA2 receptors (Fig 4BUp), indicating that a pathway other than via TXA2 receptors is predominantly involved in the effect of PGD2.

PGD2 readily undergoes conversion in vivo and in vitro to yield additional, biologically active PGs of the J2 series27 28 29 30 (Fig 5AUp). Incubation of PGD2 in the presence of plasma or serum albumin results in the rapid accumulation of several major dehydration and isomerization products, including {Delta}12-PGJ2 and 15-deoxy-{Delta}12,14-PGJ2.27 28 30 Some of these products, including {Delta}12-PGJ2, have antiproliferative effects, presumably involving their direct binding to nuclear proteins.12 38 Furthermore, 15-deoxy-{Delta}12,14-PGJ2, a PGJ2 derivative, recently has been demonstrated to be a natural ligand for an intranuclear receptor promoting adipocyte differentiation.29 30 In the present study, the four PGs showed doses producing 50% inhibition (expressed as negative log mol/L) in the following order: 15-deoxy-{Delta}12,14-PGJ2>{Delta}12-PGJ2>PGJ2>PGD2 (Fig 5BUp), which may reflect the delay involved in conversion of these products. These results suggest that the inhibitory effect of PGD2 on NO generation is exhibited most likely through the PGJ2 cascade. Therefore, although the inhibitory effect of PGD2 on iNOS induction may be partially mediated by TXA2 receptors, it appears to result mainly from a direct action of PGD2 or its J2 metabolites on intranuclear components rather than via the adenylate cyclase–cAMP or inositol phospholipid–PKC pathway. The need for relatively high doses of the PGs also argues for this, because it would require much higher doses in the culture media to attain concentrations high enough to act on intracellular receptors than cell-surface ones. An intracrine mechanism might cause considerably high intracellular concentrations. The subcellular pathway downstream of the PGJ2 cascade remains to be investigated.

In conclusion, we demonstrated that PGD2 suppresses NO generation in VSMCs, which is due to inhibition of iNOS mRNA expression most likely operating mainly through a novel PGD2 signaling pathway, the PGJ2 cascade. These results suggest the possibility of involvement of PGD2 in NO metabolism in the pathogenesis of vascular diseases.


*    Selected Abbreviations and Acronyms
 
IL-1ß = interleukin 1ß
iNOS = inducible NO synthase
PCR = polymerase chain reaction
PG = prostaglandin
PKC = protein kinase C
TCA = trichloroacetic acid
TNF-{alpha} = tumor necrosis factor {alpha}
TX = thromboxane
VSMC = vascular smooth muscle cell


*    Acknowledgments
 
This study was supported in part by a Grant-in-Aid from the Ministry of Education, Science and Culture of Japan. The authors acknowledge Dr Yukiko Kurashima (Biochemistry Division, National Cancer Center Research Institute), Dr Wee Soo Shin and Yukari Kawabata (the Second Department of Internal Medicine, University of Tokyo) for their technical assistance.

Received March 31, 1997; accepted October 23, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Moncada S, Palmer R, Higgs E. Nitric oxide: physiology, pathophysiology and pharmacology. Pharmacol Rev. 1991;43:109–142.[Medline] [Order article via Infotrieve]

2. Minor RL, Myers PR, Guerra R, Bates JN, Harrison DG. Diet-induced atherosclerosis increases the release of nitrogen oxides from rabbit aorta. J Clin Invest. 1990;86:2109–2116.

3. Sobey CG, Brooks RM, Heistad DD. Evidence that expression of inducible nitric oxide synthase in response to endotoxin is augmented in atherosclerotic rabbits. Circ Res. 1995;77:536–554.[Abstract/Free Full Text]

4. Petros A, Bennett D, Vallance P. Effect of nitric oxide synthase inhibitors on hypotension in patients with septic shock. Lancet. 1991;338:1557–1558.[Medline] [Order article via Infotrieve]

5. Joly GA, Sehini VB, Vanhoutte PM. Balloon injury and interleukin-1ß induce nitric oxide synthase activity in rat carotid arteries. Circ Res. 1992;71:331–338.[Abstract/Free Full Text]

6. Tsukada T, Rosenfeld M, Ross R, Gown AM. Immunocytochemical analysis of cellular components in lesions of atherosclerosis of the Watanabe and fat-fed rabbit using monoclonal antibodies. Arteriosclerosis. 1986;6:601–613.[Abstract]

7. Bernard C, Szekely B, Philip I, Wollman E, Payen D, Tedgui A. Activated macrophages depress the contractility of rabbit carotids via an L-arginine/nitric oxide-dependent effector mechanism: connection with amplified cytokine release. J Clin Invest. 1992;89:851–860.

8. Urade Y, Ujihara M, Horiguchi Y, Ikai K, Hayaishi O. The major source of endogenous prostaglandin D2 production is likely antigen-presenting cells: localization of glutathione-requiring prostaglandin D synthetase in histiocytes, dendritic, and Kupffer cells in various rat tissues. J Immunol. 1989;143:2982–2989.[Abstract]

9. Bushfield M, McNicol A, MacIntyre DE. Inhibition of platelet-activating-factor-induced human platelet activation by prostaglandin D2: differential sensitivity of platelet transduction processes and functional response to inhibition by cyclic AMP. Biochem J. 1985;232:267–271.[Medline] [Order article via Infotrieve]

10. Braun M, Schror K. Prostaglandin D2 relaxes bovine coronary arteries by endothelium-dependent nitric oxide–mediated cGMP formation. Circ Res. 1992;71:1305–1313.[Abstract/Free Full Text]

11. Onoe H, Ueno R, Fujita I, Nishino H, Oomura Y, Hayaishi O. Prostaglandin D2, a cerebral sleep-inducing substance in monkey. Proc Natl Acad Sci U S A.. 1988;85:4082–4086.[Abstract/Free Full Text]

12. Fukushima M. Prostaglandin J2: anti-tumor and anti-viral activities and the mechanisms involved. Eicosanoids. 1990;3:189–199.[Medline] [Order article via Infotrieve]

13. Spatz M, Stanimirovic D, Bacic F, Uematsu S, McCarron RM. Vasoconstrictive peptides induce endothelin-1 and prostanoids in human cerebromicrovascular endothelium. Am J Physiol. 1994;266(pt 1):C654–C660.

14. Watanabe T, Narumiya S, Shimizu T, Hayaishi O. Characterization of the biosynthetic pathway of prostaglandin D2 in human platelet-rich plasma. J Biol Chem. 1982;257:14847–14853.[Abstract/Free Full Text]

15. Salari H, Chan YM. Mast cell mediators stimulate synthesis of arachidonic acid metabolites in macrophages. J Immunol. 1989;142:2821–2827.[Abstract]

16. Katz HR, Raizman MB, Gartner CS, Scott HC, Benson AC, Austen KF. Secretory granule mediator release and generation of oxidative metabolites of arachidonic acid via Fc-IgG receptor bridging in mouse mast cells. J Immunol. 1992;148:868–871.[Abstract]

17. Thomas PS, Wilson AN, Schreck RE, Lazarus SC. Prostaglandin D2 production and identification of prostaglandin H synthase within canine mast cell granule. Am J Physiol. 1992;263(pt 1):L168–L176.

18. Kaartinen M, Penttila A, Kovanen PT. Mast cells of two types differing in neutral protease composition in the human aortic intima. Demonstration of tryptase- and tryptase/chymase-containing mast cells in normal intimas, fatty streaks, and the shoulder region of atheromas. Arterioscler Thromb Vasc Biol. 1994;14:966–972.[Abstract/Free Full Text]

19. Ross R, Glomset J, Kariya B, Harker L. A platelet-dependent serum factor that stimulates the proliferation of arterial smooth muscle cells in vitro. Proc Natl Acad Sci U S A.. 1974;71:1207–1210.[Abstract/Free Full Text]

20. Ohshima H, Brouet IM, Bandaletova T, Adachi H, Oguchi S, Iida S, Kurashima Y, Morishita Y, Sugiura T, Esumi H. Polyclonal antibody against an inducible form of nitric oxide synthase purified from the liver of rats treated with Propionibacterium acnes and lipopolysaccharide. Biochem Biophys Res Commun. 1992;187:1291–1297.[Medline] [Order article via Infotrieve]

21. Nunokawa Y, Ishida N, Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun. 1993;191:89–94.[Medline] [Order article via Infotrieve]

22. Marchuk D, Drumm M, Saulino A, Collins F. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 1990;19:1154.[Free Full Text]

23. McKenniff MG, Norman P, Cuthbert NJ, Gardiner PJ. BAY u3405, a potent and selective thromboxane A2 receptor antagonist on airway smooth muscle in vitro. Br J Pharmacol. 1991;104:585–590.[Medline] [Order article via Infotrieve]

24. Koide M, Kawahara Y, Nakayama I, Tsuda T, Yokoyama M. Cyclic AMP-elevation agents induce an inducible type of nitric oxide synthase in cultured vascular smooth muscle cells. J Biol Chem. 1993;268:24959–24966.[Abstract/Free Full Text]

25. Imai T, Hirata Y, Kanno K, Marumo F. Induction of nitric oxide synthase by cyclic AMP in rat vascular smooth muscle cells. J Clin Invest. 1994;93:543–549.

26. Tetsuka T, Daphna-Iken D, Srivastava SK, Baier LD, DuMaine J, Morrison AR. Cross-talk between cyclooxygenase and nitric oxide pathways: prostaglandin E2 negatively modulates induction of nitric oxide synthase by interleukin 1. Proc Natl Acad Sci U S A.. 1994;91:12168–12172.[Abstract/Free Full Text]

27. Fitzpatrick FA, Wynalda MA. Albumin-catalyzed metabolism of prostaglandin D2. J Biol Chem. 1983;258:11713–11718.[Abstract/Free Full Text]

28. Kikawa Y, Narumiya S, Fukushima M, Wakatsuka H, Hayaishi O. 9-Deoxy-{Delta},9{Delta}12-13,14-dihydroprostaglandin D2, a metabolite of prostaglandin D2 formed in human plasma. Proc Natl Acad Sci U S A.. 1984;81:1317–1321.[Abstract/Free Full Text]

29. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxy-{Delta}12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR{gamma}. Cell. 1995;83:803–812.[Medline] [Order article via Infotrieve]

30. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM. A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor {gamma} and promotes adipocyte differentiation. Cell. 1995;83:813–819.[Medline] [Order article via Infotrieve]

31. Kaartinen M, Penttila A, Kovanen PT. Extracellular mast cell granules carry apolipoprotein B-100–containing lipoproteins into phagocytes in human arterial intima. Functional coupling of exocytosis and phagocytosis in neighboring cells. Arterioscler Thromb Vasc Biol. 1995;15:2047–2054.[Abstract/Free Full Text]

32. Kanno K, Hirata Y, Imai T, Marumo F. Induction of nitric oxide synthase gene by interleukin in vascular smooth muscle cells. Hypertension. 1993;22:34–39.[Abstract/Free Full Text]

33. Di Rosa RM, Radomski M, Carnuccio R, S. Moncada S. Glucocorticoids inhibit the induction of nitric oxide synthase in macrophages. Biochem Biophys Res Commun. 1990;172:1246–1252.[Medline] [Order article via Infotrieve]

34. Ujihara M, Urade Y, Eguchi N, Hayashi H, Ikai K, Hayaishi O. Prostaglandin D2 formation and characterization of its synthetases in various tissues of adult rats. Arch Biochem Biophys. 1988;260:521–531.[Medline] [Order article via Infotrieve]

35. Hirata M, Kakizuka A, Aizawa M, Ushikubi F, Narumiya S. Molecular characterization of a mouse prostaglandin D receptor and functional expression of the cloned gene. Proc Natl Acad Sci U S A.. 1994;91:11192–11196.[Abstract/Free Full Text]

36. Nakayama I, Kawahara Y, Tsuda T, Okuda M, Yokoyama M. Angiotensin II inhibits cytokine-stimulated inducible nitric oxide synthase expression in vascular smooth muscle cells. J Biol Chem. 1994;269:11628–11633.[Abstract/Free Full Text]

37. Ali S, Becker MW, Davis MG, Dorn GW. Dissociation of vasocontrictor-stimulated basic fibroblast growth factor expression from hypertrophic growth in cultured vascular smooth muscle cells. Circ Res. 1994;75:836–843.[Abstract/Free Full Text]

38. Narumiya S, Ohno K, Fukusima M, Fujiwara M. Site and mechanism of growth inhibition by prostaglandins. III. Distribution and binding of prostaglandin A2 and {Delta}12-prostaglandin J2 in nuclei. J Pharmacol Exp Ther. 1985;242:306–311.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Satoh, R. Moroi, K. Aritake, Y. Urade, Y. Kanai, K. Sumi, H. Yokozeki, H. Hirai, K. Nagata, T. Hara, et al.
Prostaglandin D2 Plays an Essential Role in Chronic Allergic Inflammation of the Skin via CRTH2 Receptor
J. Immunol., August 15, 2006; 177(4): 2621 - 2629.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Ogawa, N. Hirawa, T. Tsuchida, N. Eguchi, Y. Kawabata, A. Numabe, H. Negoro, R. Hakamada-Taguchi, K. Seiki, S. Umemura, et al.
Urinary excretions of lipocalin-type prostaglandin D2 synthase predict the development of proteinuria and renal injury in OLETF rats
Nephrol. Dial. Transplant., April 1, 2006; 21(4): 924 - 934.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Taniike, I. Mohri, N. Eguchi, C. T. Beuckmann, K. Suzuki, and Y. Urade
Perineuronal Oligodendrocytes Protect against Neuronal Apoptosis through the Production of Lipocalin-Type Prostaglandin D Synthase in a Genetic Demyelinating Model
J. Neurosci., June 15, 2002; 22(12): 4885 - 4896.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Hirawa, Y. Uehara, M. Yamakado, Y. Toya, T. Gomi, T. Ikeda, Y. Eguchi, M. Takagi, H. Oda, K. Seiki, et al.
Lipocalin-Type Prostaglandin D Synthase in Essential Hypertension
Hypertension, February 1, 2002; 39(2): 449 - 454.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Guyton, R. Bond, C. Reilly, G. Gilkeson, P. Halushka, and J. Cook
Differential effects of 15-deoxy-{Delta}12,14-prostaglandin J2 and a peroxisome proliferator-activated receptor {gamma} agonist on macrophage activation
J. Leukoc. Biol., April 1, 2001; 69(4): 631 - 638.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Monroy, J. W. Kuluz, D. He, W. D. Dietrich, and C. L. Schleien
Role of nitric oxide in the cerebrovascular and thermoregulatory response to interleukin-1{beta}
Am J Physiol Heart Circ Physiol, April 1, 2001; 280(4): H1448 - H1453.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Shimpo, U. Ikeda, Y. Maeda, K.-i. Ohya, Y. Murakami, and K. Shimada
Effects of Aspirin-Like Drugs on Nitric Oxide Synthesis in Rat Vascular Smooth Muscle Cells
Hypertension, May 1, 2000; 35(5): 1085 - 1091.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagoshi, H.
Right arrow Articles by Omata, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagoshi, H.
Right arrow Articles by Omata, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE