Recombinant Murine Interleukin-12 Facilitates Induction of Cardiac Myosin–Specific Type 1 Helper T Cells in Rats

From the Department of Immunology (Y.O., K.T., S.H., H.W., T.A.) and the First Department of Internal Medicine (Y.O., H.H., M.K., Y.A.), Niigata University School of Medicine, Niigata, Japan; the Department of Internal Medicine (T.I.), Kitasato University School of Medicine, Sagamihara, Japan; and the Division of Basic Traumatology, National Defense Medical College Research Institute (S.S.), Tokorozawa, Japan.

Correspondence to Yuji Okura, MD, First Department of Internal Medicine, Niigata University School of Medicine, Asahimachi, Niigata 951, Japan. E-mail dogwood{at}med.niigata-u.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—Autoimmunity after viral myocarditis is considered to be one of the causes of dilated cardiomyopathy. Cytokines are assumed to play an important role in the pathogenesis. We recently reported that interleukin (IL)-2 and interferon (IFN)- mRNA are expressed in the myocardium of rats with experimental autoimmune myocarditis (EAM). However, the role of cytokines in autoimmune myocardial injury in detail is still not clear. Reverse transcription–polymerase chain reaction identified IL-12 (p40) mRNA in antigen-presenting cells in the initial phase of EAM. Cardiac myosin–specific T lymphocytes (MSTLs) were cultured with cardiac myosin peptide (CMP) in the presence of IL-2 and/or IL-12 and were transferred to other naive rats. The results showed that EAM could be effectively induced by transfer of MSTLs cultured with IL-12, whereas transfer of MSTLs cultured with IL-2 was less effective. However, IL-2 acts synergistically with IL-12, and MSTLs cultured with both cytokines most efficiently induce EAM. In vitro experiments showed that MSTLs cultured with both IL-12 and IL-2 produced a much greater amount of IFN- than did MSTLs cultured with either IL-12 or IL-2 alone. The amount of IFN- production was correlated with pathogenicity of MSTLs. Transfer experiments after sorting further demonstrated that the transfer was affected by CD4⁺ helper T (Th) cells but not by CD8⁺ cytotoxic T lymphocytes. IL-12 and IL-2 synergistically enhance the pathogenicity of MSTLs. Furthermore, a type 1 Th (Th1) cytokine, IFN-, which is a potent regulatory cytokine of autoimmunity, is produced by MSTLs. IL-12 and IL-2 potentiate the expansion of cardiac myosin–specific Th1 cells and play an important role in the development of autoimmune myocardial injury.

Key Words: helper T cell • cytokine • interleukin • autoimmunity • myocardial injury

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Recurrent myocardial injury in postviral myocarditis is a serious disorder that often results in DCM.^{1 2 3 4} In a rat model wherein myocarditis is inducible by purified cardiac myosin, T cells reportedly play an important role in inducing myocarditis.^{5 6} This model may serve as a system to investigate the pathological mechanisms underlying postinfectious myocardial injury by autoimmunity.

It has been hypothesized that immune dysregulation associated with autoimmune disease may relate to an imbalance between Th1 and Th2 cells.^{7 8 9} The former secrete IL-2 and IFN- and mediate proinflammatory reactions (termed the Th1 response), whereas the latter secrete IL-4 and IL-10 and promote humoral immunity (termed the Th2 response). Th1 cells suppress Th2 responses through IFN-. IL-10, one of the Th2 cytokines, is a major inhibitor of Th1 responses. As a result, Th1 and Th2 often seem to negatively cross-regulate through their cytokines.^{7 8 9 10 11 12} We recently demonstrated the mRNA expressions of Th1 and Th2 cytokines during the course of EAM by RNase protection assay.¹³ In brief, IL-2 appears in the initial inflammatory phase, and IFN-, IL-1ß, and TNF- follow in the maximum inflammatory phase; IL-10 mRNA can be detected after the maximum inflammatory stage and persists into the recovery phase. These findings support the idea that Th1 and Th2 cells may cross-regulate the inflammation through their cytokines and modulate the course of autoimmune myocardial injury. However, the exact role of cytokines in autoimmune myocardial injury is still undefined. To further investigate the role of cytokines in myocardial injury by autoimmunity, we studied the pathogenicity of myosin-specific Th cells influenced by a specific cytokine milieu. In the present study, we show that IL-12 and IL-2 have major roles in the potentiation of pathogenicity of cardiac myosin–specific Th1 cells in myocardial injury caused by autoimmunity.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Experimental Animals
Male Lewis rats (6 weeks old) were purchased from Charles River, Japan (Atsugi, Kanagawa, Japan) and were maintained in our animal facilities.

Peptide Synthesis
A synthetic peptide corresponding to amino acids 1539 to 1555 of rat cardiac -myosin heavy chain was synthesized by the fluorenylmethoxycarbonyl/t-butyl–based solid-phase peptide chemistry method.¹⁴ An ABI 433 (Perkin Elmer Corp) peptide synthesizer using a single coupling program was used to carry out the chain assembly, starting with commercially available fluorenylmethoxycarbonyl amide resin. The peptide-resin compound was N-terminally acetylated. Complete peptide was cleaved from the resin by treatment with trifluoroacetic acid and phenol. After standard diethyl ether extractions and peptide solubilization in water, the peptide was lyophilized and stored at -80°C. CMP, acetyl-KLELQSALEEAEASLEH-NH₂, was shown to contain one major peak on HPLC. For a control peptide, we used the same technique to synthesize a randomly arranged peptide, acetyl-SLALLKAQHELSEEAEE-NH₂, which has no mimic.

Active Induction of EAM
CMP was dissolved in PBS at a concentration of 5 mg/mL and emulsified with an equal volume of complete Freund's adjuvant supplemented with 10 mg/mL of Mycobacterium tuberculosis H37RA (Difco). To produce actively induced EAM, rats received a single immunization dose (0.4 mL of emulsion) by way of a subcutaneous injection into a foot pad, thus yielding an immunizing dose of 1.0 mg of CMP per rat.

Histological Evaluation of Disease
Macroscopic findings were classified into five grades: 0, no inflammation; 1, presence of a small discolored focus; 2, presence of multiple small discolored foci; 3, diffuse discolored areas not exceeding a total of one third of the cardiac surface; and 4, diffuse discolored areas totaling more than one third of the cardiac surface.

In order to grade the microscopic score, the hearts were fixed in 10% formalin. Paraffin-embedded tissues were cut and stained with hematoxylin-eosin for histological examination. Severity of inflammation in the biventricular cardiac cross sections was graded as follows: 0, no inflammation; 1, presence of a few small lesions, not exceeding 0.25 mm² in size; 2, presence of multiple small lesions or a few moderately sized lesions, not exceeding 6.25 mm²; and 3, the presence of multiple moderately sized lesions or more, larger lesions.¹⁵

Isolation of MNCs Infiltrating the Heart and MNCs From Peripheral Blood
MNCs infiltrating the heart were obtained by forcing the myocardium through a 200-gauge stainless mesh in MEM medium supplemented with 7.5 mol/L HEPES and 2% newborn calf serum. The cells were then hemolyzed in 0.17 mol/L Tris buffer supplemented with 0.83% NH₄Cl. After washing twice, MNCs infiltrating the heart were separated by specific density using Histopaque 1.077 (Sigma Chemical Co) and used for flow cytometric analysis. Furthermore, they were separated into adherent cells and nonadherent cells for analysis of gene expression, as described previously.¹³ MNCs from peripheral blood were used after lysing red blood cells for flow cytometric analysis.

RT-PCR for Detection of IL-12 (p40) mRNA
RT-PCR was used to determine whether IL-12 (p40) mRNA was expressed. Two micrograms of polyA⁺ RNA was reverse-transcribed in the presence of random hexamers using 20 U of RNase H^-, M-MLV reverse transcriptase (Toyobo), and the buffer supplied by the manufacturer. The reaction was conducted at 30°C for 10 minutes, followed by 20 minutes at 20°C. The reverse transcriptase was inactivated at 95°C for 5 minutes, and samples were kept at 4°C. Amplification reactions were carried out in the same tube used for RT, with 1 µg of each primer, 2.5 U of Taq DNA polymerase, and the PCR buffer supplied by the manufacturer. Taq DNA polymerase was added at 90°C just before the first denaturation. Samples were placed in a thermocycler (Perkin Elmer Corp) using 95°C denaturation, 58°C annealing, and 72°C extension temperatures for one cycle. Thirty-eight cycles were performed, and 10% of the PCR reaction was electrophoresed on agarose/ethidium bromide gels and visualized under UV light so that amplified gene fragments could be compared with DNA standards (HaeIII-digested øX174 DNA, Promega) electrophoresed on the same gel.

Positive- and negative-stranded primers used for amplification IL-12 (p40) mRNA were CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG, respectively, as described by Bost et al.¹⁶ Primers for G3PDH mRNA were ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA. Positive control for RT-PCR was reverse-transcribed RNA from lipopolysaccharide-activated splenic macrophages. mRNA isolated from lipopolysaccharide-activated macrophages was also used as a negative control, which was not added to reverse transcriptase during the RT reaction. The identity of the PCR products of appropriate length was confirmed by cycle sequencing using dye-labeled terminations (Amersham International).

In Vivo Administration of Recombinant Murine IL-12 to Rats With EAM
IL-12–treated rats received an intraperitoneal injection of 1.0 µg rmIL-12 (Genetic Institute) dissolved in 1.0 mL PBS. The IL-12 was administered on 6 occasions, at days 0, 4, 8, 12, 16, and 20 after immunization. Control rats received PBS at the same intervals. To clarify the onset and time course, the rats were killed at days 10, 14, 21, and 28.

Culture of LNCs and Preparation for Transfer
Ten days after immunization, popliteal lymph nodes were harvested, and the cells were resuspended in RPMI-1640 containing 10% FBS, 1% sodium pyruvate, 1% nonessential amino acids (GIBCO BRL), 5x10^-5 mol/L 2-mercaptoethanol, 100 µg/mL streptomycin, and 100 U/mL penicillin. CMP was added to the cultures at 20 µg/mL. At the start of the culture, rmIL-12 (4 ng/mL) and/or recombinant rat IL-2 (20 U/mL) (Genzyme) was added to the medium. After incubation for 72 hours, the cells were harvested, washed twice, separated by specific density using Histopaque 1.077, suspended with PBS, and transferred to naive Lewis rats intravenously at doses of 5x10⁶, 1x10⁷, 3x10⁷, and 5x10⁷ cells. Recipient rats were killed on day 14 for histological examination.

IFN-, TNF-, IL-4, and IL-10 Determination by ELISA
At the end of the culture period, supernatants were collected, and IFN-, TNF-, IL-4, and IL-10 were measured by a Cytoscreen rat IFN- ELISA kit (BioSource International), a rat TNF- ELISA kit (Genzyme), and a rat IL-4 and rat IL-10 ELISA kit (Cosmo Bio). Optical densities were measured on a Multiskan MC ELISA reader (Titertek) at a wavelength of 450 nm.

Flow Cytometric Analysis and Cell Sorting
LNCs and MNCs from peripheral blood and heart were isolated from rats at the peak inflammatory phase of EAM, as described previously. LNCs after culture were separated by specific density using Histopaque 1.077. They were incubated with a mixture of phycoerythrin-labeled W3/25 (CD4), 3.2.3 (NKR-P1, Serotec), OX-8 (CD8, Pharmingen), or OX42 (CD11b/c, Pharmingen), followed by incubation with FITC-labeled OX-8 or R73 (CD3) (Pharmingen). A total of 10 000 cells were analyzed by FACScan flow cytometry (Becton Dickinson). Dead cells were excluded by propidium iodide gating. CD8-positive (OX8⁺) cells and CD8-negative (OX8^-) cells of cultured LNCs were sorted by FACS Vantage (Becton Dickinson).

Proliferation Assay
Ten days after immunization, LNCs were isolated as noted above. Viable lymphocytes (2x10⁵ cells per well) were cultured with antigen-presenting cells in the presence of indicated concentrations of CMP alone or rrIL-2 and/or rmIL-12 in 96-well U-bottomed microtiter plates (Costar Co). Incorporation of 0.5 µCi methyl-[³H]thymidine was determined after 72 hours of incubation in 5% CO₂ and air at 37°C. After further incubation for 18 hours, the cells were harvested, and radioactivity was assessed by the liquid scintillation counting method.

Statistical Analysis
Data are presented as mean±SD. Statistical comparisons of histopathological scores, cytokine levels, and cell proliferation were performed by one-way ANOVA and Student paired t tests. Differences were considered significant at P0.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-12 (p40) mRNA Expression by Heart-Infiltrating Macrophages in the Initial Inflammatory Phase
IL-12 (p40) mRNA in plastic adherent cells isolated from the heart on days 14 and 19 was identified by RT-PCR (Figure 1). However, IL-12 (p40) mRNA was not detected in nonadherent cells on days 14 and 19 or in any cells on other days. We previously reported that most of the adherent cells (93%) were macrophages.¹³ Therefore, we suggest that IL-12 (p40) mRNA is expressed by macrophages infiltrating the heart.

View larger version (47K): [in this window] [in a new window]   Figure 1. IL-12 (p40) mRNA expression by heart-infiltrating adherent cells in the initial inflammatory phase (days 14 and 19). mRNA extracted from adherent and nonadherent cells that infiltrated the heart was reverse-transcribed and amplified by PCR with primers specific for IL-12 (p40) and (G3PDH). Lane M is a DNA size marker (HaeIII-digested øX174). Lanes 14, 19, and 25 represent days 14, 19, and 25 after immunization with CMP; adherent and nonadherent cells were harvested on each of these days. S represents mRNA of spleen cells cultured with lipopolysaccharide as a positive control. PCR product sizes are indicated the left: 266 bp for IL-12 (p40) and 450 bp for G3PDH. Note the presence of IL-12 (p40) mRNA in adherent cells on days 14 and 19.

Effect of In Vivo Administration of rmIL-12 on the Progression of EAM
Rats were treated with rmIL-12 (1.0 µg IP per rat) or PBS every 4 days after immunization by CMP and monitored by macroscopic (Figure 2a) and microscopic (Figure 2b) findings in the heart. Although the time of onset of EAM was almost the same in IL-12–treated and PBS-treated groups, EAM of IL-12–treated rats was significantly (P<0.05) more severe than that of PBS-treated control rats at any time point examined. Normal rats treated with IL-12 did not show any cardiac damage.

View larger version (37K): [in this window] [in a new window]   Figure 2. The effect of in vivo administration of rmIL-12 on disease progression of EAM rats. Rats were treated with rmIL-12 (1.0 µg IP per rat) or PBS every 4 days after immunization by CMP and monitored by macroscopic (a) and microscopic (b) findings in the heart. The scores are defined in "Materials and Methods." The onset of disease was almost the same in the two groups, but the severity of disease of IL-12–treated rats was significantly higher than in control rats at any point (n=7 in each group). *P<0.05.

Characterization of the Phenotype of MNCs Infiltrating the Heart of EAM Rats Treated With IL-12
MNCs isolated from the heart and peripheral blood were analyzed by flow cytometry. The absolute number of MNCs in the heart was significantly (P<0.01) increased by in vivo administration of rmIL-12 (Table 1). CD4-positive T cells appeared as major populations in MNCs isolated from the hearts of EAM rats and were dominant in the heart rather than in peripheral blood. In contrast, CD8-positive T cells and NK cells appeared as small populations in the heart and in peripheral blood of EAM rats. However, compared with the control condition, NK cells in the peripheral blood were significantly (P<0.05) increased, and CD4-positive T cells were significantly decreased by in vivo administration of rmIL-12. The results indicate that IL-12 exerts an immunomodulatory effect on rats. However, despite the decrease of CD4-positive T cells in peripheral blood, CD4-positive T cells remained dominant in the heart of IL-12–treated EAM rats.

Induction of EAM by the Transfer of Cardiac MSTLs Stimulated In Vitro by IL-2, IL-12, or a Combination of the Two
LNCs from CMP-immunized rats were stimulated in vitro with CMP alone or with CMP along with rmIL-12, rrIL-2, or both. After they were cultured for 72 hours, LNCs were transferred to other naive rats, and the ability to induce EAM was examined on day 14, since an examination of the time course of adoptive EAM transfer revealed that the peak occurred on day 14 (data not shown). Compared with active induction, the peak is earlier in transferred EAM. None of the rats injected with lymphocytes that had been stimulated with CMP alone at doses of 5.0x10⁷ cells developed myocarditis. Even injections of 2x10⁸ cells did not elicit myocarditis in two trials (data not shown). LNCs stimulated with CMP and IL-2 required as many as 5.0x10⁷ cells to elicit myocarditis; those with CMP and IL-12 required as many as 3.0x10⁷ cells (Table 2). Of note, myocarditis could be transferred into naive rats by lymphocytes stimulated with CMP and both IL-2 and IL-12 at doses of 1.0x10⁷ cells. As the number of transferred cells increased, the rate of myocarditis and severity also increased. Thus, IL-12 and IL-2 synergize to activate MSTLs and promote inflammation in autoimmune myocardial injury. However, LNCs without in vitro stimulation by CMP could not elicit myocarditis, even when cultured with IL-2 and IL-12.

Enhancement of In Vitro IFN- Production of MSTLs by rmIL-12
Cell proliferation, cytokine production, and surface markers of LNCs were analyzed to determine the characteristic changes of MSTLs by IL-12 during in vitro stimulation with antigen. Proliferation of LNCs was determined at 72 hours by the incorporation of [³H]thymidine. Although compared with LNCs alone, the addition of CMP during culturing resulted in a 2-fold increase of incorporation of [³H]thymidine, cell proliferation with CMP was not affected by the addition of either IL-2 or IL-12 (Table 3). However, the addition of IL-12 during in vitro stimulation of LNCs with CMP, especially in combination with IL-2, resulted in a 2- to 4-fold increase of IFN- production compared with cells cultured with CMP alone (Figure 3a). In contrast, LNCs cultured in various conditions showed no differences in production of TNF-, IL-4, and IL-10 (Figures 3b, 3c, and 3d, respectively). Surface markers of lymphocytes, as analyzed by FACScan with antibodies specific for CD3, CD4, CD8, CD11b/c, and NKR-P1, revealed little change during culturing in the presence of CMP, IL-2, and IL-12 (data not shown).

View larger version (25K): [in this window] [in a new window]   Figure 3. Amounts of IFN-, TNF-, IL-4, and IL-10 produced by LNCs as measured by ELISA at the end of the culture period. Mean±SD cytokine concentrations of LNCs of 5 individual rats are shown. LNC indicates popliteal LNCs previously stimulated with CMP in vivo; RPMI, popliteal LNCs previously stimulated with RPMI in culture medium not containing CMP in vivo. *P<0.05.

CD4⁺ T Cells Are Responsible for EAM
To clarify which T-cell type (stimulated with CMP, IL-12, and IL-2) is responsible for EAM, CD4-positive cells or CD8-positive cells after culture were sorted out and transferred (intravenously) into naive rats. Transfer of CD4-positive cells sorted from cultured lymphocytes elicits myocarditis in naive rats, but transfer of CD8-positive cells does not (Figure 4). Accordingly, CD4-positive T cells are considered to be essential to EAM, and the pathogenicity is enhanced by the addition of IL-2 and IL-12.

View larger version (35K): [in this window] [in a new window]   Figure 4. Transfer of sorted lymphocytes after culturing with IL-2 and IL-12. OX8-positive cells were considered to be CD8-positive T cells; W3/25, CD4-positive T cells. Transfer of CD4-positive T cells (2.0x107) elicited myocarditis in naive rats, but CD8-positive T cells (2.0x107) did not. Accordingly, CD4-positive T cells are considered essential to EAM and enhanced the pathogenicity of IL-2 and IL-12. The number of animals eliciting EAM is presented as the number of rats showing myocarditis/total number of rats subjected to T-lymphocyte transfers.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Circumstantial evidence implicates a number of cytokines as mediators of inflammation and immunity in the pathogenesis of cardiovascular diseases, ranging from heart failure to atherosclerosis. Some studies have revealed cytokine expression in situ during the course of myocarditis and have suggested key roles played by these cytokines.^{13 17} As demonstrated earlier¹³ and again in the present study, IL-2 and IL-12 (p40) mRNA appears initially in EAM and is followed by IFN- mRNA. These data imply that IL-2 and IL-12 contribute to the pathogenesis in EAM and motivated us to investigate the pathogenicity of myosin-specific Th cells activated by these cytokines.

IL-12, originally identified as an NK cell stimulatory factor,¹⁸ is a 75-kDa glycoprotein that is composed of two distinct disulfide-linked subunits with molecular masses of 35 and 40 kDa.^{19 20} IL-12 is secreted by a variety of antigen-presenting cells, including monocytes, macrophages, and dendritic cells; it directs the generation of Th1 response via the induction of IFN- production, enhances the cytotoxicity of NK cells, cytotoxic T lymphocytes,^{18 21 22 23 24} and a novel population of T cells with an NK cell marker,^{25 26} and induces antitumor and antimicrobial responses. In addition to IL-2, IL-12 is a Th1 cytokine; it develops the precursor Th cells to Th1 cells and inhibits the differentiation of Th2 cells via IFN- production.^{10 27 28}

In the present study, we found that CMP-specific Th1 cells are involved in the pathogenesis of EAM and that IL-12 enhances the disease, as revealed by both in vivo and in vitro experiments. Administration of IL-12 into rats challenged with CMP aggravates myocarditis; the number of NK cells in peripheral blood increased significantly, but CD4⁺ T cells remained predominantly in the heart. From these findings, it is suggested that the aggravation of autoimmune myocarditis is a function of Th1 cells but is not caused by the toxicity of IL-12 per se or by activated NK cells. Furthermore, it was confirmed by transfer experiments that antigen-primed CD4⁺ T cells can be inducers of autoimmune myocarditis, especially when these cells are cultured with IL-12 and IL-2 in vitro. Popliteal LNCs contain MSTLs, as evidenced by proliferation assay and transfer experiments wherein lymphocytes respond to CMP after injection of CMP and complete Freund's adjuvant into foot pads. Although IL-12 and IL-2 do not significantly affect the proliferation and phenotypes of LNCs stimulated with CMP, IL-12 and IL-2 strongly promote the pathogenicity of the induction of EAM by CD4⁺ Th cells. This finding is further supported by the augmented production of IFN- by MSTLs stimulated with CMP in combination with IL-2 and IL-12. Although Th1 cells appear to be induced by CMP immunization alone, CMP immunization may actually induce increased numbers of precursor or Th0 cells, which themselves have no pathogenicity but recognize cardiac myosin and, in turn, are converted to Th1 cells, probably by IL-12.

IL-12 and IFN- are currently viewed as the prime inducers of Th1 immune response, which is necessary not only for initiating cell-mediated immune responses but also for protection against malignant tumors and intracellular pathogens, such as HIV and Leishumania.^{29 30 31 32 33 34 35} On the other hand, there is a controversy regarding the role of IFN- in EAM. Smith and Allen³⁶ have reported that neutralization of IFN- with monoclonal antibody rather deteriorates the EAM response. They postulated that the local effects of IFN- promote inflammation, whereas the systemic effects are anti-inflammatory; therefore, systemic administration of IFN- mAb would neutralize circulating IFN- and preferentially promote an enhanced local inflammatory response. This raises interesting questions relating to where a cytokine mediator functions during an inflammatory response and how to effectively deliver a neutralizing antibody to the target tissue. We have recently reported that nonadherent cells (presumably T cells) in myocardium exhibiting EAM produce a substantial amount of IFN-,¹³ and we demonstrate in the present study that MSTLs cultured with antigen and a combination of IL-12 and IL-2 can produce great amounts of IFN- in vitro. These facts, coupled with indications that the degree of IFN- production seems to be correlated with pathogenicity of MSTLs, strongly support the idea that IFN- locally promotes the inflammation of autoimmune myocarditis.

TNF- has attracted considerable interest in the pathogenesis of cardiovascular diseases, ranging from heart failure to atherosclerosis.³⁷ TNF- is produced by heart-infiltrating macrophages in EAM and is believed to contribute to the pathogenesis in several ways.¹³ The present study shows that even T cells stimulated with CMP and a combination of IL-2 and IL-12 do not produce increased amounts of TNF-. This outcome is not unexpected, since TNF- is produced mainly by macrophages¹³ and LNCs usually contain only a small number of macrophages. However, by producing IFN-, CMP-activated Th1 cells migrating into the myocardium can activate resident macrophages and thereby induce TNF- production. This speculation is supported by the fact that antigen- or pathogen-activated phagocytic cells produce IL-12 and promote T or NK cells to produce IFN-, and then IFN- further activates monocytes or macrophages in a positive-feedback loop and augments their function.³⁸

It is recognized that inflammation persists after the acute phase in some patients with viral myocarditis and that these patients sometimes respond to immunosuppressive therapy.^{39 40} These facts suggest the presence of recurrent myocardial damage followed by DCM. Persistent viral infections are associated with proinflammatory cytokine synthesis, which might affect the clinical course of diseases such as juvenile-onset diabetes mellitus and DCM.^{16 41 42} Although IL-12 could be an important cytokine against some viruses,^{43 44} IL-12 synthesis and subsequent IFN- production during recurrent infections instead may induce a sustained activation of potentially autoreactive cells (such as MSTLs) and sometimes cause cardiac tissue damage and subsequent DCM under certain immune conditions.

In conclusion, IL-12 together with IL-2 enhances the pathogenicity of cardiac myosin–specific Th cells and plays an important role in myocardial injury by autoimmunity. Considering the reciprocal regulation of Th cell subsets, modulating the Th1-Th2 balance by intrinsic regulatory mechanisms of the immune system may regulate the clinical course of EAM. Although further studies are needed, immunointervention strategies based on the administration of IL-12 antagonists may be helpful in the prevention of postmyocarditis DCM by autoimmunity.

	Selected Abbreviations and Acronyms

 

CMP = cardiac myosin peptide DCM = dilated cardiomyopathy EAM = experimental autoimmune myocarditis G3PDH = glucose-3-phosphate dehydrogenase IFN = interferon IL = interleukin LNC = lymph node cell MNC = mononuclear cell MSTL = myosin-specific T lymphocyte NK cell = natural killer cell PCR = polymerase chain reaction rm = recombinant murine rr = recombinant rat RT = reverse transcription Th cell = helper T cell Th1 cell = type 1 Th cell Th2 cell = type 2 Th cell TNF = tumor necrosis factor

	Acknowledgments

 
This study was supported by a grant from the Research Committee for Epidemiology and Etiology of Idiopathic Cardiomyopathy from the Ministry of Health and Welfare of Japan and the Japan Heart Foundation and from a Pfizer Pharmaceuticals Grant for Research on Coronary Artery Disease. We thank Dr M. Kobayashi (Immunology Department, Genetics Institute, Cambridge, Mass) for providing rmIL-12 and H. Sekikawa and M. Kenmotsu for technical support.

Received October 8, 1997; accepted March 19, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Woodruff JF. Viral myocarditis: a review. Am J Pathol. 1980;101:425–484.[Medline] [Order article via Infotrieve]

2. Olinde KD, O'Connell JB. Inflammatory heart disease: pathogenesis, clinical manifestations, and treatment of myocarditis. Annu Rev Med. 1994;45:481–490.[Medline] [Order article via Infotrieve]

3. James TN. Myocarditis and cardiomyopathy. N Engl J Med. 1983;308:39–41.[Medline] [Order article via Infotrieve]

4. Huber SA. Viral myocarditis: a tale of two diseases. Lab Invest. 1992;66:1–3.[Medline] [Order article via Infotrieve]

5. Kodama M, Hanawa H, Saeki M, Hosono H, Inomata T, Suzuki K, Shibata A. Rat dilated cardiomyopathy after autoimmune giant cell myocarditis. Circ Res. 1994;75:278–284.[Abstract/Free Full Text]

6. Kodama M, Matsumoto Y, Fujiwara M. In vivo lymphocyte-mediated myocardial injuries demonstrated by adoptive transfer of experimental autoimmune myocarditis. Circulation. 1992;85:1918–1926.[Abstract/Free Full Text]

7. Liblau RS, Singer SM, McDevitt HO. Th1 and Th2 CD4⁺ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol Today. 1995;16:34–38.[Medline] [Order article via Infotrieve]

8. Rabinovitch A. Immunoregulatory and cytokine imbalances in the pathogenesis of IDDM: therapeutic intervention by immunostimulation? Diabetes. 1994;43:613–621.[Abstract]

9. Mosmann TR, Cherwinski H, Bond MW, Giedlin MA, Coffman RL. Two types of murine helper T cell clone, I: definition according to profiles of lymphokine activities and secreted proteins. J Immunol. 1986;136:2348–2357.[Abstract]

10. Trinchieri G. Interleukin-12 and its role in the generation of TH1 cells. Immunol Today. 1993;14:335–338.[Medline] [Order article via Infotrieve]

11. Paul WE, Seder RA. Lymphocyte responses and cytokines. Cell. 1994;76:241–251.[Medline] [Order article via Infotrieve]

12. Trinchieri G, Scott P. The role of interleukin 12 in the immune response, disease and therapy. Immunol Today. 1994;15:460–463.[Medline] [Order article via Infotrieve]

13. Okura Y, Yamamoto T, Goto S, Inomata T, Hirono S, Hanawa H, Feng L, Wilson CB, Kihara I, Izumi T, Shibata A, Aizawa Y, Seki S, Abo T. Characterization of cytokine and iNOS mRNA expression in situ during the course of experimental autoimmune myocarditis in rats. J Mol Cell Cardiol. 1997;29:491–502.[Medline] [Order article via Infotrieve]

14. Wegmann KW, Zhao W, Griffin AC, Hickey WF. Identification of myocarditogenic peptides derived from cardiac myosin capable of inducing experimental allergic myocarditis in the Lewis rat: the utility of a class II binding motif in selecting self-reactive peptides. J Immunol. 1994;153:892–900.[Abstract]

15. Kodama M, Zhang S, Hanawa H, Saeki M, Inomata T, Suzuki K, Koyama S, Shibata A. Effects of 15-deoxyspergualin on experimental autoimmune giant cell myocarditis of the rat. Circulation. 1995;91:1116–1122.[Abstract/Free Full Text]

16. Bost KL, Bieligk SC, Jaffe BM. Lymphokine mRNA expression by transplantable murine B lymphocytic malignancies: tumor-derived IL-10 as a possible mechanism for modulating the anti-tumor response. J Immunol. 1995;154:718–729.[Abstract]

17. Shioi T, Matsumori A, Sasayama S. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation. 1996;94:2930–2937.[Abstract/Free Full Text]

18. Kobayashi M, Fitz L, Ryan M, Hewick RM, Clark SC, Chan S, Loudon R, Sherman F, Perussia B, Trinchieri G. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J Exp Med. 1989;170:827–845.[Abstract/Free Full Text]

19. Wolf SF, Temple PA, Kobayashi M, Young D, Dicig M, Lowe L, Dzialo R, Fitz L, Ferenz C, Hewick RM, Kelleher K, Hermann SH, Clark SC, Azzoni L, Chan SH, Trinchieri G, Perussia B. Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J Immunol. 1991;146:3074–3081.[Abstract]

20. Gubler U, Chua AO, Schoenhaut DS, Dwyer CM, McComas W, Motyka R, Nabavi N, Wolitzky AG, Quinn PM, Familletti PC, Gately MK. Coexpression of two distinct genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor. Proc Natl Acad Sci U S A.. 1991;88:4143–4147.[Abstract/Free Full Text]

21. Chan SH, Kobayashi M, Santoli D, Perussia B, Trinchieri G. Mechanisms of IFN-gamma induction by natural killer cell stimulatory factor (NKSF/IL-12): role of transcription and mRNA stability in the synergistic interaction between NKSF and IL-2. J Immunol. 1992;148:92–98.[Abstract]

22. Perussia B, Chan SH, D'Andrea A, Tsuji K, Santoli D, Pospisil M, Young D, Wolf SF, Trinchieri G. Natural killer (NK) cell stimulatory factor or IL-12 has differential effects on the proliferation of TCR-alpha beta+, TCR-gamma delta+ T lymphocytes, and NK cells. J Immunol. 1992;149:3495–3502.[Abstract]

23. Gately MK, Wolitzky AG, Quinn PM, Chizzonite R. Regulation of human cytolytic lymphocyte responses by interleukin-12. Cell Immunol. 1992;143:127–142.[Medline] [Order article via Infotrieve]

24. Gately MK, Desai BB, Wolitzky AG, Quinn PM, Dwyer CM, Podlaski FJ, Familletti PC, Sinigaglia F, Chizonnite R, Gubler U, Stern AS. Regulation of human lymphocyte proliferation by a heterodimeric cytokine, IL-12 (cytotoxic lymphocyte maturation factor). J Immunol. 1991;147:874–882.[Abstract]

25. Satoh M, Seki S, Hashimoto W, Ogasawara K, Kobayashi T, Kumagai K, Matsuno S, Takeda K. Cytotoxic gamma delta or alpha beta T cells with a natural killer cell marker, CD56, induced from human peripheral blood lymphocytes by a combination of IL-12 and IL-2. J Immunol. 1996;157:3886–3892.[Abstract]

26. Takeda K, Seki S, Ogasawara K, Anzai R, Hashimoto W, Sugiura K, Takahashi M, Satoh M, Kumagai K. Liver NK1.1⁺ CD4⁺ alpha beta T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J Immunol. 1996;156:3366–3373.[Abstract]

27. Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, Romagnani S. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J Exp Med. 1993;177:1199–1204.[Abstract/Free Full Text]

28. Hsieh CS, Macatonia SE, Tripp CS, Wolf SF, O'Garra A, Murphy KM. Development of TH1 CD4⁺ T cells through IL-12 produced by Listeria-induced macrophages. Science. 1993;260:547–549.[Abstract/Free Full Text]

29. Brunda MJ, Luistro L, Warrier RR, Wright RB, Hubbard BR, Murphy M, Wolf SF, Gately MK. Antitumor and antimetastatic activity of interleukin 12 against murine tumors. J Exp Med. 1993;178:1223–1230.[Abstract/Free Full Text]

30. Nastala CL, Edington HD, McKinney TG, Tahara H, Nalesnik MA, Brunda MJ, Gately MK, Wolf SF, Schreiber RD, Storkus WJ, Lotze MT. Recombinant IL-12 administration induces tumor regression in association with IFN-gamma production. J Immunol. 1994;153:1697–1706.[Abstract]

31. Heinzel FP, Schoenhaut DS, Rerko RM, Rosser LE, Gately MK. Recombinant interleukin 12 cures mice infected with Leishmania major. J Exp Med. 1993;177:1505–1509.[Abstract/Free Full Text]

32. Sypek JP, Chung CL, Mayor SE, Subramanyam JM, Goldman SJ, Sieburth DS, Wolf SF, Schaub RG. Resolution of cutaneous leishmaniasis: interleukin 12 initiates a protective T helper type 1 immune response. J Exp Med. 1993;177:1797–1802.[Abstract/Free Full Text]

33. Hondowicz B, Scott P. The role of IL12 in modulating an established Th2 response in experimental leishmaniasis. Res Immunol. 1995;146:560–565.[Medline] [Order article via Infotrieve]

34. Clerici M, Lucey DR, Berzofsky JA, Pinto LA, Wynn TA, Blatt SP, Dolan MJ, Hendrix CW, Wolf SF, Shearer GM. Restoration of HIV-specific cell-mediated immune responses by interleukin-12 in vitro. Science. 1993;262:1721–1724.[Abstract/Free Full Text]

35. Chougnet C, Clerici M, Shearer GM. Role of IL12 in HIV disease/AIDS. Res Immunol. 1995;146:615–622.[Medline] [Order article via Infotrieve]

36. Smith SC, Allen PM. Neutralization of endogenous tumor necrosis factor ameliorates the severity of myosin-induced myocarditis. Circ Res. 1992;70:856–863.[Abstract/Free Full Text]

37. Libby P, Mitchell RN. Cytokines score a knockout: harnessing gene targeting to gain insight into the pathogenesis of myocarditis [editorial]. Circulation. 1997;95:551–552.[Free Full Text]

38. Ma X, Chow JM, Gri G, Carra G, Gerosa F, Wolf SF, Dzialo R, Trinchieri G. The interleukin 12 p40 gene promoter is primed by interferon gamma in monocytic cells. J Exp Med. 1996;183:147–157.[Abstract/Free Full Text]

39. Herskowitz A, Ansari AA. Myocarditis: cardiomyopathies, myocarditis, and pericardial disease. In: Abelmann WH, Braunwald E, eds. Atlas of Heart Disease. Philadelphia, Pa: Current Medicine; 1995;2:9.19.

40. Parrillo JE, Aretz HT, Palacios I, Fallon JT, Block PC. The results of transvenous endomyocardial biopsy can frequently be used to diagnose myocardial diseases in patients with idiopathic heart failure: endomyocardial biopsies in 100 consecutive patients revealed a substantial incidence of myocarditis. Circulation. 1984;69:93–101.[Abstract/Free Full Text]

41. Fohlman J, Friman G. Is juvenile diabetes a viral disease? Ann Med. 1993;25:569–574.[Medline] [Order article via Infotrieve]

42. Bendtzen K, Mandrup-Poulsen T, Nerup J, Nielsen JH, Dinarello CA, Svenson M. Cytotoxicity of human pI 7 interleukin-1 for pancreatic islets of Langerhans. Science. 1986;232:1545–1547.[Abstract/Free Full Text]

43. Bhardwaj N, Seder RA, Reddy A, Feldman MV. IL-12 in conjunction with dendritic cells enhances antiviral CD8⁺ CTL responses in vitro. J Clin Invest. 1996;98:715–722.[Medline] [Order article via Infotrieve]

44. Orange JS, Biron CA. An absolute and restricted requirement for IL-12 in natural killer cell IFN-gamma production and antiviral defense. J Immunol. 1996;156:1138–1142.[Abstract]

This article has been cited by other articles:

				M. Nishii, T. Inomata, H. Niwano, H. Takehana, I. Takeuchi, H. Nakano, H. Shinagawa, T. Naruke, T. Koitabashi, J.-i. Nakahata, et al. {beta}2-Adrenergic Agonists Suppress Rat Autoimmune Myocarditis: Potential Role of {beta}2-Adrenergic Stimulants as New Therapeutic Agents for Myocarditis Circulation, August 29, 2006; 114(9): 936 - 944. [Abstract] [Full Text] [PDF]

				T. Baba, A. Ishizu, S. Iwasaki, A. Suzuki, U. Tomaru, H. Ikeda, T. Yoshiki, and M. Kasahara CD4+/CD8+ macrophages infiltrating at inflammatory sites: a population of monocytes/macrophages with a cytotoxic phenotype Blood, March 1, 2006; 107(5): 2004 - 2012. [Abstract] [Full Text] [PDF]

				Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham Protection against Experimental Autoimmune Myocarditis Is Mediated by Interleukin-10-Producing T Cells that Are Controlled by Dendritic Cells Am. J. Pathol., July 1, 2005; 167(1): 5 - 15. [Abstract] [Full Text] [PDF]

				H. Futamatsu, J.-i. Suzuki, S. Mizuno, N. Koga, S. Adachi, H. Kosuge, Y. Maejima, K. Hirao, T. Nakamura, and M. Isobe Hepatocyte Growth Factor Ameliorates the Progression of Experimental Autoimmune Myocarditis: A Potential Role for Induction of T Helper 2 Cytokines Circ. Res., April 29, 2005; 96(8): 823 - 830. [Abstract] [Full Text] [PDF]

				D. Fairweather, S. Frisancho-Kiss, S. A. Yusung, M. A. Barrett, S. E. Davis, R. A. Steele, S. J. L. Gatewood, and N. R. Rose IL-12 Protects against Coxsackievirus B3-Induced Myocarditis by Increasing IFN-{gamma} and Macrophage and Neutrophil Populations in the Heart J. Immunol., January 1, 2005; 174(1): 261 - 269. [Abstract] [Full Text] [PDF]

				K. Shioji, Z. Yuan, T. Kita, and C. Kishimoto Immunoglobulin treatment suppressed adoptively transferred autoimmune myocarditis in severe combined immunodeficient mice Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2619 - H2625. [Abstract] [Full Text] [PDF]

				Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham Cryptic Epitope Identified in Rat and Human Cardiac Myosin S2 Region Induces Myocarditis in the Lewis Rat J. Immunol., March 1, 2004; 172(5): 3225 - 3234. [Abstract] [Full Text] [PDF]

				M. Afanasyeva and N.R. Rose Immune mediators in inflammatory heart disease: insights from a mouse model Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I31 - I36. [Abstract] [PDF]

				M. Afanasyeva, Y. Wang, Z. Kaya, E. A. Stafford, K. M. Dohmen, A. A. Sadighi Akha, and N. R. Rose Interleukin-12 Receptor/STAT4 Signaling Is Required for the Development of Autoimmune Myocarditis in Mice by an Interferon-{gamma}-Independent Pathway Circulation, December 18, 2001; 104(25): 3145 - 3151. [Abstract] [Full Text] [PDF]

				U. Eriksson, M. O. Kurrer, W. Sebald, F. Brombacher, and M. Kopf Dual Role of the IL-12/IFN-{gamma} Axis in the Development of Autoimmune Myocarditis: Induction by IL-12 and Protection by IFN-{gamma} J. Immunol., November 1, 2001; 167(9): 5464 - 5469. [Abstract] [Full Text] [PDF]

				M. W. Cunningham Cardiac Myosin and the TH1/TH2 Paradigm in Autoimmune Myocarditis Am. J. Pathol., July 1, 2001; 159(1): 5 - 12. [Full Text] [PDF]

				M. Afanasyeva, Y. Wang, Z. Kaya, S. Park, M. J. Zilliox, B. H. Schofield, S. L. Hill, and N. R. Rose Experimental Autoimmune Myocarditis in A/J mice Is an Interleukin-4-Dependent Disease with a Th2 Phenotype Am. J. Pathol., July 1, 2001; 159(1): 193 - 203. [Abstract] [Full Text] [PDF]

				K. Hong, A. Chu, B. R. Ludviksson, E. L. Berg, and R. O. Ehrhardt IL-12, Independently of IFN-{gamma}, Plays a Crucial Role in the Pathogenesis of a Murine Psoriasis-Like Skin Disorder J. Immunol., June 15, 1999; 162(12): 7480 - 7491. [Abstract] [Full Text] [PDF]

				R. D. Bungiro Jr., M. Goldberg, P. K. Suri, and P. M. Knopf Interleukin-12 as an Adjuvant for an Antischistosome Vaccine Consisting of Adult Worm Antigens: Protection of Rats from Cercarial Challenge Infect. Immun., May 1, 1999; 67(5): 2340 - 2348. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Okura, Y. Articles by Abo, T. Search for Related Content PubMed PubMed Citation Articles by Okura, Y. Articles by Abo, T.