Articles |
-Tropomyosin Gene
From Howard Hughes Medical Institute and Department of Genetics, Harvard Medical School, Boston, Mass (E.M.B., K.I., M.C., D.A.C., J.G.S.); the Department of Molecular Physiology and Biophysics, University of Vermont Medical School, Burlington (D.W.M.); Brigham and Women's Hospital, Boston, Mass (F.J.S.); Howard Hughes Medical Institute and Brigham and Women's Hospital, Boston, Mass (C.E.S.); and Allelix Biopharmaceuticals Inc, Mississauga, Ontario, Canada (A.G.-L.).
Correspondence to Dr Jonathan Seidman, Department of Genetics, Harvard Medical School, 200 Longwood Ave, Boston, MA 02115. E-mail seidman{at}rascal.med.harvard.edu
| Abstract |
|---|
|
|
|---|
-tropomyosin gene using gene targeting in embryonic stem cells and
blastocyst-mediated transgenesis. Homozygous
-tropomyosin
"knockout" mice die between embryonic day 9.5 and 13.5 and lack
-tropomyosin mRNA. Heterozygous
-tropomyosin knockout mice have
50% as much cardiac
-tropomyosin mRNA as wild-type littermates
but similar
-tropomyosin protein levels. Cardiac gross morphology,
histology, and function (assessed by working heart preparations) of
heterozygous
-tropomyosin knockout and wild-type mice were
indistinguishable. Mechanical performance of skinned papillary
muscle strips derived from mutant and wild-type hearts also revealed no
differences. We conclude that haploinsufficiency of the
-tropomyosin
gene produces little or no change in cardiac function or structure,
whereas total
-tropomyosin deficiency is incompatible with life.
These findings imply that in heterozygotes there is a regulatory
mechanism that maintains the level of myofibrillar tropomyosin despite
the reduction in
-tropomyosin mRNA.
Key Words:
-tropomyosin haploinsufficiency knockout mouse
| Introduction |
|---|
|
|
|---|
Tropomyosin has multiple functions, including stabilization of the thin
filament and regulation of Ca2+ activation of the
sarcomere.3 Tropomyosin polypeptides are
284 amino
acids in length and form coiled-coil dimers that lie head-to-tail in
the major groove of the sarcomere thin filament. In vertebrates there
are four tropomyosin genes, each consisting of 10 exons and a variety
of alternate exons, which encode
-tropomyosin, ß-tropomyosin,
nonmuscle tropomyosin, and tropomyosin-4. Tropomyosin polypeptides
found in muscle sarcomeres are derived primarily from the
and ß
genes, but in the murine heart, most tropomyosin is derived from the
-tropomyosin gene.
The production of mice bearing null alleles of sarcomere
protein genes provides a useful system for assessing the role of the
protein in regulating sarcomere assembly. Recent studies of a mouse
bearing a knockout mutation in cardiac
-myosin heavy chain gene have
suggested that haploinsufficiency of this gene affects cardiac
development and function.4 We have created mice that lack
-tropomyosin and mice with
-tropomyosin haploinsufficiency to
determine whether levels of this sarcomere component modulate sarcomere
structure in the murine heart. In the present study, we report that
haploinsufficiency of the
-tropomyosin gene does not produce a
demonstrable reduction in protein, nor does it create a demonstrable
phenotype. We suggest that compensatory mechanisms exist to
maintain physiological levels of this thin filament
component in the heterozygous
-tropomyosin knockout mouse despite a
reduction in mRNA levels. Further, we demonstrate that mouse embryos
lacking
-tropomyosin die early in embryogenesis.
| Materials and Methods |
|---|
|
|
|---|
-tropomyosin gene
containing exon 8, exon 9, and 3' sequences was cloned from a
DASH
(Stratagene) genomic library derived from a strain 129/SvJ mouse using
a 32P-labeled 263-bp probe (primer sequences:
-tropomyosin exon 9d, forward and reverse). The probe contained a
portion of the 3' untranslated region associated with exon
9a.5 A 5-kb Sal IBamHI fragment
was subcloned into pBSII+ and modified as indicated in Fig 1
|
The following forward (F) and reverse (R)
oligonucleotide primers were used and were derived from
published
-tropomyosin (Tm) sequences6 : Tm exon 9d,
(F)5' GAAAGTGGCCCATGCCAAAGAAGAA and (R)5'
ACCCTGATATGGAGAACTGGGAAGG; Tm exon 5, (F)5'
GTGGCCCGTAAGCTGGTCATCATCG; Tm exon 6b, (R)5'
TGAGCCTCCAGTGACTTCAA; Tm 3' untranslated region, (F)5'
TTGTACAGAAGCAATTCGCCCAGTG and (R)5' GCACGGGTATGGGCAGCATTTCAAA; Tm
intron 8, (F)TCTGCCTTCCACTTCCTGGT; and Tm intron 9, (R)5'
CAAGGAGGCATGGTGGTGAGTTTA.
Linearized targeting construct pTMKO was introduced into the male ES
cell line C1 as described by Geisterfer-Lowrance et al.7
Targeted ES cell lines were identified by Southern blot
analysis (Fig 1
). Homologous recombination resulted in
introduction of a neomycin-resistant gene (neor)
into exon 9a, with a resultant 8.6-kb HindIII fragment in
the targeted allele rather than the 6.8-kb HindIII
fragment in the wild-type allele. A 32P-labeled 900-bp
polymerase chain reaction product generated from exons 5 and 6
(designated exon 5,6 probe) was used to screen for ES cell lines in
which one allele of the
-tropomyosin had been targeted (Fig 1
).
Targeted ES cells were injected into C57BL/6 (male)x B6D2F1 (female) blastocysts and transferred to Swiss Webster pseudopregnant females by standard procedures.7 Chimeric males were then bred with Black Swiss females to test for germline transmission. Young mice and embryos were genotyped by Southern blot analysis as described above, using tail or embryonic yolk sack DNA.
Histological Analysis of Cardiac
Tissue
Hearts from representative 15-week-old males
were isolated from heparinized mice anesthetized with Avertin,
trimmed in cold PBS, transversely sectioned at a
midventricular level, and prepared for microscopy as
described by Geisterfer-Lowrance et al.7 Slides for light
microscopy from single wild-type and heterozygous mutants were scored
for myocyte hypertrophy, disarray, and injury or fibrosis,
without knowledge of genotype. For electron microscopy, hearts
were bisected and immediately immersed in freshly prepared 2.5%
glutaraldehyde (25% EM grade, SPI-Structure Probe)
diluted in 0.1 mol/L Millonig's phosphate buffer, pH 7.4.
Triangular pieces (1-mm base x 2-mm height) were cut out of the
basal half of the left ventricular free wall and placed in
vials with fresh fixative for 1 hour at 4°C. Sections were washed 3
times for 15 minutes in 0.1 mol/L Millonig's phosphate buffer,
pH 7.4, and postfixed (1 hour at room temperature) in 1% osmium
tetroxide prepared in the same buffer. Washes were repeated (3 times
for 15 minutes) in fresh buffer and dehydrated through a graded series
of ethanol (10% to 95%). Sections were stained en bloc in 2% uranyl
acetate (in 95% ethanol), dehydrated in two changes of 100% ethanol,
transferred through two changes of propylene oxide, and then incubated
overnight at room temperature in 50:50 (vol/vol) mixture of
propylene-epoxy resin (Embed 812/Araldite 502, SPI-Structure Probe).
The samples were transferred on the second day through two changes (1
hour each) of fresh epoxy resin, blocked in flat embedding molds, and
polymerized overnight. On the third day, samples were cut out of resin
blocks, glued onto plastic stubs, and sectioned for both longitudinal
and cross-sectional views of sarcomeres. Thin sections were contrasted
with lead and uranyl acetate, and micrographs were taken on a JEOL
100CX II transmission electron microscope operated at 60-kV
accelerating voltage.
DNA, RNA, and Protein Analysis
Total RNA was isolated from hearts trimmed of atria and
great vessels by the guanidium isothiocyanate method.8
Total RNA was isolated from ED8.5 embryos in the following manner:
After genotyping, 12 embryos for each of the wild-type, heterozygous,
and homozygous groups were pooled, and the RNA was isolated with an RNA
Stat-60 kit (Tel-test "B," Inc).
Southern and Northern blots were performed as described by Ausubel et
al9 and Spiegelman et al8 , using probes
corresponding to exons 9a (primers,
-tropomyosin intron 8 and
-tropomyosin intron 9), 9d (primers,
-tropomyosin exon 9d), and
actin.8 Filters were "stripped" in 0.1% SDS at 90°C
for 45 minutes. Images were obtained from a Phosphoimager (Molecular
Dynamics). The intensity of the hybridization signals was assessed
using a Molecular Dynamics scanning densitometer. Quantification was
performed on the pooled samples of ED8.5 embryos and on three separate
wild-type and three null heterozygous ventricular
preparations.
Myofibrillar protein fractions were prepared as described by Solaro et al,10 supplemented with 2 µmol/L leupeptin, 1 µg/mL papstatin, 1 µg/mL aprotinin, 0.5 mmol/L 4-(2-aminoethyl)-benzenesulfonyl fluoride, hydrochloride, 100 µmol/L benzamidine HCl, and 1 mmol/L phenanthroline. The protein concentration of each sample was determined using the Bio-Rad protein assay method. Equal amounts of protein (2.4 µg) were loaded per lane on duplicate 7.5% SDS-polyacrylamide gels. One gel was stained with silver stain, and protein from the other gel was transferred to nitrocellulose membrane by using an Amersham semidry transblot apparatus. The membrane was probed first with CH1 monoclonal anti-tropomyosin antibody (Sigma, no. T-9283) as the primary antibody at 1:1000 dilution for 1 hour at room temperature. After washing in PBS solution, the membrane was probed with the secondary antibody (peroxidase-labeled anti-mouse Ig antibody from sheep). The membrane was exposed to autoradiography film according to the specifications of the Western blotting kit (Amersham). These steps were repeated for ventricular myosin light chain 1 (Biogenesis, No. 6490-4504) antibody after stripping the filters in the following manner: filters were incubated in 100 mmol/L 2-mercaptoethanol, 2% SDS, and 622.5 mmol/L Tris-HCl (pH 6.7) for 30 minutes at 50°C and washed twice for 10 minutes in PBS. Quantification was performed by scanning densitometry and standardization to the ventricular myosin light chain single. Average values from two wild-type and two null heterozygous preparations are reported.
Working Heart Preparations
Left ventricular pressure, dP/dT, and cardiac output
were measured from hearts of 15 week-old males, without knowledge of
genotype, through an indwelling cannula coupled to a pressure
transducer and were recorded on a Maclab A/D system as previously
described.7 Pressure development, pressure time
derivatives, and cardiac output were determined at variable LAFPs
with a fixed resistance and at variable resistance with a constant
filling pressure.
Skinned Strip Mechanics
Mice (male, 24 to 36 weeks old) were killed by cervical
dislocation. The hearts were removed and placed in a specialized
Ringer's solution (with 95% O2/5% CO2)
containing 30 mmol/L BDM, designed to protect the
myocardial tissue from cutting injury.11 Small sections of
left ventricular papillary muscles were dissected in the
BDM-Ringer's solution to yield strips
120 µm in diameter and
1500 µm in length (125±4 and 119±3, respectively, from
TMAKO/+ and wild-type mice). Ends of the strips were tethered with silk
and transferred to a vessel that contained clips, which allowed the
tethered strip to be stretched just beyond slack length. The strips
were skinned by incubation in a pCa 8 relaxing solution (5
mmol/L MgATP, 30 mmol/L phosphocreatine, 240 U/mL
creatine kinase, 1 mmol/L free Mg2+, 0.11
mmol/L CaCl2, 5 mmol/L EGTA, and 20
mmol/L BES buffer, pH 7.0); ionic strength was adjusted to
175 mmol/L with added sodium methyl sulfonate containing
1% (wt/vol) Triton X-100 and incubated overnight at 4°C. Strips were
used for mechanical experiments either the next day or, after transfer
to a storage solution and incubation at -20°C, within a week of
dissection. The storage solution consisted of relaxing solution with
50% (wt/vol) glycerol and 10 µg/mL leupeptin.
The skinned strips with tethers were placed in relaxing solution in a
second vessel where small aluminum clips were used to isolate a uniform
segment (
700 µm in length) of the strip. The clipped segment
was cut free and transferred to a 30 µL drop of relaxing solution in
a glass-bottom aluminum chamber filled with mineral oil. One end of the
strip was attached to a strain gauge (AE801, SensoNor), and the other
end was attached to a piezoelectric motor (P173, Physik Instrumente
GmbH & Co). The position of the motor head was monitored by a
variable impedance displacement transducer (KD-2310, Kaman
Instrumentation Corp). Oil temperature was maintained at 37°C or
27°C (±0.5°C) by a Peltier device (Cambion, Cambridge Thermionic
Corp). The force transducer had the following characteristics:
sensitivity, 1.63 mN/V; compliance (transducer and hook),
5 µN/mN;
and resonant frequency, 7.7 kHz. The -3-dB roll-off frequency of the
servomotor was 600 Hz, and its compliance (servomotor and hook) was <1
nm/µN.
The skinned strips were stretched (incrementally, in 0.05-µm steps
per sarcomere) to a sarcomere spacing of
2.2 µm (estimated
with an inverted microscope and filar micrometer). Analogue
displacement and tension signals were monitored by a thermal
strip-chart recorder with a high-gain amplifier (WR3101, Watanabe
Corp) and a digital storage oscilloscope (2201 Tektronix Corp). Strip
tension (mN/mm2) was calculated by dividing the force by
the fiber cross-sectional area, calculated from an elliptical
cross-sectional area using widths measured at the major and minor axis.
The skinned strips were activated incrementally by Ca2+. Equal volumes of relaxing solution were exchanged with activating solution (pCa 4.5) to attain pCa of 7, 6, 5.75, 5.5, and 5. Activating solutions had the same ionic composition as relaxing solution, except the total concentration of CaCl2 was 5.03 mmol/L (pCa 4.5). The solutions were formulated by solving a set of simultaneous equations describing the multiple equlibria of ions in the solutions.12 13 14
Sinusoidal analysis14 was used to determine the power output (in nW/mm3) of skinned strips in response to small-amplitude perturbations. The end of each segment was oscillated at a specific frequency, and the resulting force response was recorded. A strip of latex membrane (Trojan-enz, Carter-Wallace) was used as a reference material to characterize the system transfer function.
Sinusoidal length perturbations of 0.25% fiber length (peak to peak)
and 0.5 to 1000 Hz were applied at 42 discrete frequencies (0.1 to 100
Hz) using a microcomputer and 16-bit data acquisition board (DT2838,
Data Translation Inc). The length and force signals from the servomotor
and strain gauge were digitized, and the elastic and viscous components
of the complex stiffness were calculated by computing the amplitude
ratio and the phase difference for the change in tension and length at
each frequency. Maximum oscillatory power output was calculated as
f · Ev(
L/L)2, where f is the
frequency of the length perturbation (s-1), Ev
is the viscous modulus (mN/mm2), and
L/L is the
fractional change in strip length.
| Results |
|---|
|
|
|---|
-Tropomyosin Knockout Line
-tropomyosin targeting construct was electroporated into ES
cells, and 16 independent neomycin-resistant targeted clones
were identified (Fig 1
-tropomyosin gene to one male offspring. This heterozygous
male was bred with Black Swiss females to generate mice used in this
study. All heterozygous offspring (designated TMAKO/+) were
indistinguishable from their wild-type littermates in size and general
appearance.
By contrast, homozygous
-tropomyosin knockout mice were not viable
(P<.0001). Ninety-eight offspring derived from mating
between TMAKO/+ parents were obtained. None of these offspring were
homozygous for the
-tropomyosin disruption. Embryos from
heterozygous crosses were characterized at different gestational ages
to determine when the homozygote TMAKO/TMAKO embryos died. None of 18
ED13.5 embryos were homozygous (12 heterozygotes, 6 wild-type),
whereas 45 ED9.5 and 73 ED8.5 embryos were similar to the expected
1:2:1 ratio of homozygote:heterozygote:wild-type (8:22:15
and 17:40:16, respectively). However, the homozygous ED9.5 embryos
were poorly developed and only one fourth the size of the heterozygous
and wild-type embryos. SDS gels and Western blots with samples from
single embryos revealed evidence of protein degradation for the ED9.5
embryos, suggesting that reabsorption of these embryos had been
initiated by this developmental stage. The mRNA from homozygous ED8.5
embryos contained no detectable
-tropomyosin mRNA, demonstrating
that the TMAKO gene disruption produced a null allele (Fig 2
). Heterozygous TMKO/+ embryos contained
only one half as much
-tropomyosin mRNA as wild-type embryos (Fig 2B
).
|
Characterization of
-Tropomyosin in TMKO/+ Mice
The structure and amount of
-tropomyosin mRNA and protein in
TMKO/+ hearts were analyzed by Northern and Western blotting.
To determine if the introduction of the neomycin-selectable marker in
exon 9a produced an isoform-specific knockout, Northern blots were
hybridized with isoform-specific probes. Exon 9a was used as a probe
for the striated muscle-specific
-tropomyosin isoform, and exon 9d
was used to detect the majority of other nonstriated isoforms,
including those expressed in smooth muscle and
fibroblasts.15 16 Band intensities were determined by
scanning densitometry and standardized to the loading control. The
ratio of the two splice forms was the same in the wild-type and mutant
mouse mRNAs (Fig 2
). The amount of
-tropomyosin mRNA containing
either exon 9a or exon 9d was diminished by 46% and 44%,
respectively, in the heterozygous mouse heart compared with the
wild-type mouse heart (Fig 2C
). That is, cardiac mRNA from heterozygous
adult male mice contained about one half as much 1.3-kb and 1.8-kb
-tropomyosin mRNA as wild-type mouse heart mRNA.
The amount of tropomyosin protein in heterozygous TMKO/+ and wild-type
hearts and skeletal muscle was compared by Western blot
analysis. Whole-heart homogenates (data not shown)
and myofibrillar preparations from 15-week-old heterozygous TMKO/+ and
wild-type male mice were compared (Fig 3
). The amount of tropomyosin in the
mutant and wild-type heart preparations was indistinguishable (Fig 3
, top blot) when corrected for the amount of protein loaded in each lane
(myosin light chain 1 [VMLC] antibody; Fig 3
, bottom blot).
Similarly, skeletal myofibrillar preparations from a predominantly
slow-muscle fiber type (the soleus muscle) and a fast-muscle fiber
type, (the external oblique back muscle) were the same in wild-type and
mutant mice (Fig 3
). The slower migrating protein species that reacted
with the tropomyosin antibody was ß-tropomyosin,17 which
constitutes a significant fraction (30% to 40%) of sarcomeric
tropomyosin in soleus muscle and 13% to 18% of sarcomeric tropomyosin
in the external oblique muscle. The
/ß-tropomyosin ratio in mutant
and wild-type mouse soleus and external oblique muscle samples was
similar (Fig 3
). No ß-tropomyosin was detected in heart samples from
either the heterozygous TMKO/+ or wild-type mouse.
|
Cardiac Structure and Function in TMKO/+ Mice
The gross appearance of hearts from heterozygous TMKO/+ and
wild-type mice was indistinguishable. The heart/body weight ratio of
15-week heterozygous TMKO/+ male mice (0.00401±0.00014) was not
significantly different from that of 15-week wild-type mice
(0.00406±0.00019).
Sections from heterozygous TMKO/+ mice demonstrated normal
histology. No evidence of myocyte hypertrophy, disorder, or
fibrosis was detected in hematoxylin and eosinstained sections or in
sections stained with Masson's trichrome to highlight connective
tissue among the myocytes (data not shown). Electron micrographs
demonstrated identical sarcomere ultrastructure in the
heterozygote TMKO/+ and wild-type mouse hearts (Fig 4
).
|
Left ventricular pressures and cardiac outputs were
measured from isolated working hearts from wild-type and heterozygote
TMKO/+ mice. Neither the maximum left ventricular
systolic pressure nor cardiac output generated over a range of
LAFP differed significantly between the wild-type and heterozygous
mouse hearts (Fig 5
).
|
The steady-state and oscillatory mechanical characteristics of
skinned strips from left ventricular papillary muscles were
identical in mutant and wild-type mice (Fig 6
). In particular, at a given pCa,
sarcomeres from heterozygous TMAKO/+ hearts generate steady-state
tensions that were not significantly different from those in similar
muscle preparations from wild-type mice. The heterozygous
TMAKO/+-derived muscles did not exhibit any significant decrement in
maximum oscillatory power (or in the frequency of maximum power output,
15 Hz) evaluated by the sinusoidal length perturbations (Fig 6B
).
Although a slight power difference between the mutant and wild-type
mousederived muscle preparations was observed at pCa 6, we are
uncertain of the significance of this observation, since no differences
in power output were observed at other Ca2+ concentrations.
|
| Discussion |
|---|
|
|
|---|
-tropomyosin gene are nonviable, whereas cardiac structure and
function of mice bearing one functional
-tropomyosin gene are
indistinguishable from those of their wild-type littermates. The early
embryonic lethality observed in the homozygous mutants is consistant
with the early expression of striated (ED7.5) and smooth muscle
isoforms (ED4.5) of
-tropomyosin in the developing mouse
embryo.18 The heterozygous TMKO/+ mice had a 50%
reduction of
-tropomyosin mRNA, normal myofibrillar tropomyosin
protein levels, and no detectable pathology. We conclude that the
TMKO/+ mice have a regulatory mechanism that maintains the normal level
of myofibrillar tropomyosin despite a 50% reduction in mRNA.
Two vastly different areas of research have provided genetic evidence
for the critical role of tropomyosin in muscle function. In humans
missense mutations in several sarcomeric protein genes, including
-tropomyosin, have been shown to cause FHC.19 This
autosomal-dominant disease is characterized by increased myocardial
mass, myocyte and myofibrillar disarray, and an increased risk of
sudden death. Whether
-tropomyosin mutations cause FHC by creating a
poison polypeptide that disrupts myofibrillar organization when it is
incorporated into the sarcomere or whether these mutations cause FHC by
creating a heart with insufficient
-tropomyosin
(haploinsufficiency) is unclear.6 In Drosophila
melanogaster, myofibrillar protein stochiometry appears to be a
critical factor in determining normal structure and function of the
indirect flight muscle, suggesting that
-tropomyosin
haploinsufficiency might cause FHC. Single heterozygous null mutations
in actin, myosin heavy chain, and tropomyosin genes of the indirect
flight muscle lead to a reduction in the respective protein, a
disorganization of the myofibrillar lattice, and a deficit in
flight.20 21 Compound actin/myosin null heterozygotes have
equivalently reduced actin and myosin protein levels and nearly normal
myofibrils.20
The data suggest, assuming that human and murine cardiac muscle are
similar, that inactivation of one
-tropomyosin allele would not
cause the pathology observed in FHC. The major difference between mouse
and in D melanogaster is the effect of heterozygous null
mutations on tropomyosin protein levels. The mouse can maintain the
wild-type level of myofibrillar tropomyosin protein with a single
functional allele, whereas D melanogaster cannot.
The data also imply that there is a regulatory mechanism in the mouse
that maintains myofibrillar tropomyosin content despite decreased
-tropomyosin mRNA levels. Coordinate regulation of
- and
ß-tropomyosin has been reported as an apparent mechanism to maintain
a constant level of myofibrilar tropomyosin. In transgenic mice with
ß-tropomyosin driven by the cardiac-specific promoter from the
-myosin heavy chain gene, there is a 34-fold increase in
ß-tropomyosin protein in the heart.17 A concomitant
decrease in
-tropomyosin results in levels of total myofibrillar
tropomyosin that are nearly the same as those in wild-type mice.
Interestingly, when the ß-tropomyosin transgene is downregulated by
inducing hypothyroidism with 5-propyl-2-thiouracil, there is an
upregulation of endogenous
-tropomyosin, resulting in
normal levels of myofibrillar tropomyosin.17 The mechanism
of coordinate regulation is not understood. Possibly, a component of
this system is involved in maintaining levels of
-tropomyosin
protein in the TMKO/+ mice comparable to
-tropomyosin protein levels
in wild-type mice.
Whether alterations in
-tropomyosin protein stochiometry can cause
cardiac pathology in mice is still an open question. Experimental
manipulations that reduce cardiac tropomyosin protein levels may change
cardiac muscle function and bring the vertebrate and invertebrate
studies into agreement. However, the disruption of a single
-tropomyosin allele in mice does not lead to a detectable
alteration in cardiac function in sedentary mice with nonhypertrophic
hearts, because myofibrillar tropomyosin protein levels are not
changed. Future studies are needed to determine whether variations in
genetic background or stress, such as exercise or other hypertrophic
stimuli, might overwhelm the regulatory mechanism and result in
alterations in the cardiac response in mice with only one functional
-tropomyosin allele.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received April 30, 1997; accepted September 24, 1997.
| References |
|---|
|
|
|---|
2.
Bejsovec A, Anderson P. Myosin heavy-chain
mutations that disrupt Caenorhabditis elegans thick filament
assembly. Genes Dev.. 1988;2:1307-1317.
3. Farah CS, Reinach FC. The troponin complex and regulation of muscle contraction. FASEB J.. 1995;9:755-767.[Abstract]
4. Jones WK, Grupp IL, Doetschman T, Grupp G, Osinska H, Hewett TE, Boivin G, Gulick J, Ng WA, Robbins J. Ablation of the murine alpha myosin heavy chain gene leads to dosage effects and functional deficits in the heart. J Clin Invest.. 1996;98:1906-1917.[Medline] [Order article via Infotrieve]
5. Schleef M, Werner K, Satzger U, Kaupmann K, Jockusch H. Chromosomal localization and genomic cloning of the mouse alpha-tropomyosin gene Tpm-1. Genomics.. 1993;17:519-521.[Medline] [Order article via Infotrieve]
6. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg HP, Seidman JG, Seidman CE. Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell.. 1994;77:701-712.[Medline] [Order article via Infotrieve]
7. Geisterfer-Lowrance AA, Christe M, Conner DA, Ingwall JS, Schoen FJ, Seidman CE, Seidman JG. A mouse model of familial hypertrophic cardiomyopathy. Science.. 1996;272:731-734.[Abstract]
8.
Spiegelman BM, Frank M, Green H. Molecular
cloning of mRNA from 3T3 adipocytes: regulation of mRNA content for
glycerophosphate dehydrogenase and other differentiation-dependent
proteins during adipocyte development. J Biol
Chem.. 1983;258:10083-10089.
9. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1996.
10. Solaro RJ, el-Saleh SC, Kentish J, Meyer A, Martin A. Transitions in isoform populations of thick and thin filament proteins and calcium activation of force and ATP hydrolysis by cardiac myofilaments. Prog Clin Biol Res.. 1989;315:487-502.[Medline] [Order article via Infotrieve]
11.
Mulieri LA, Hasenfuss G, Ittleman F, Blanchard EM,
Alpert NR. Protection of human left ventricular
myocardium from cutting injury with 2,3-butanedione
monoxime. Circ Res.. 1989;65:1441-1449.
12.
Godt RE, Lindley BD. Influence of temperature
upon contractile activation and isometric force production in
mechanically skinned muscle fibers of the frog. J
Gen Physiol.. 1982;80:279-297.
13.
Andrews MA, Maughan DW, Nosek TM, Godt RE.
Ion-specific and general ionic effects on contraction of skinned
fast-twitch skeletal muscle from the rabbit. J Gen
Physiol.. 1991;98:1105-11025.
14. Kawai M, Brandt PW. Sinusoidal analysis: a high resolution method for correlating biochemical reactions with physiological processes in activated skeletal muscles of rabbit, frog and crayfish. J Muscle Res Cell Motil.. 1980;1:279-303.[Medline] [Order article via Infotrieve]
15.
Ruiz-Opazo N, Nadal-Ginard B. Alpha-tropomyosin
gene organization: alternative splicing of duplicated isotype-specific
exons accounts for the production of smooth and striated muscle
isoforms. J Biol Chem.. 1987;262:4755-4765.
16.
Lees-Miller JP, Goodwin LO, Helfman DM. Three
novel brain tropomyosin isoforms are expressed from the rat
alpha-tropomyosin gene through the use of alternative promoters and
alternative RNA processing. Mol Cell Biol.. 1990;10:1729-1742.
17.
Muthuchamy M, Grupp IL, Grupp G, O'Toole BA, Kier AB,
Boivin GP, Neumann J, Wieczorek DF. Molecular and
physiological effects of overexpressing striated
muscle beta-tropomyosin in the adult murine heart. J
Biol Chem.. 1995;270:30593-30603.
18.
Muthuchamy M, Pajak L, Howles P, Doetschman T,
Wieczorek DF. Developmental analysis of tropomyosin gene
expression in embryonic stem cells and mouse embryos. Mol
Cell Biol.. 1993;13:3311-3323.
19. Seidman CE, Seidman JG. Molecular Studies of Inherited Cardiomyopathies. New York, NY: Marcel Dekker Inc; 1996.
20.
Beall CJ, Sepanski MA, Fyrberg EA. Genetic
dissection of Drosophila myofibril formation: effects of actin and
myosin heavy chain null alleles. Genes Dev.. 1989;3:131-140.
21. Karlik CC, Fyrberg EA. An insertion within a variably spliced Drosophila tropomyosin gene blocks accumulation of only one encoded isoform. Cell.. 1985;41:57-66.[Medline] [Order article via Infotrieve]
22. Burkholder TJ, Fingado B, Baron S, Lieber RL. Relationship between muscle fiber types and sizes and muscle architectural properties in the mouse hindlimb. J Morphol.. 1994;221:177-190.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
G. Schevzov, T. Fath, B. Vrhovski, N. Vlahovich, S. Rajan, J. Hook, J. E. Joya, F. Lemckert, F. Puttur, J. J.-C. Lin, et al. Divergent Regulation of the Sarcomere and the Cytoskeleton J. Biol. Chem., January 4, 2008; 283(1): 275 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gunning, G. O'neill, and E. Hardeman Tropomyosin-Based Regulation of the Actin Cytoskeleton in Time and Space Physiol Rev, January 1, 2008; 88(1): 1 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Houle, A. Poirier, J. Dumaresq, and J. Huot DAP kinase mediates the phosphorylation of tropomyosin-1 downstream of the ERK pathway, which regulates the formation of stress fibers in response to oxidative stress J. Cell Sci., October 15, 2007; 120(20): 3666 - 3677. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pasquet, F. Naye, C. Faucheux, O. Bronchain, A. Chesneau, P. Thiebaud, and N. Theze Transcription Enhancer Factor-1-dependent Expression of the {alpha}-Tropomyosin Gene in the Three Muscle Cell Types J. Biol. Chem., November 10, 2006; 281(45): 34406 - 34420. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wernicke, C. Thiel, C. M. Duja-Isac, K. V. Essin, M. Spindler, D. J. R. Nunez, R. Plehm, N. Wessel, A. Hammes, R.-J. Edwards, et al. {alpha}-Tropomyosin mutations Asp175Asn and Glu180Gly affect cardiac function in transgenic rats in different ways Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2004; 287(3): R685 - R695. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Ellis, C. W. J. Smith, and P. Kemp Regulated Tissue-specific Alternative Splicing of Enhanced Green Fluorescent Protein Transgenes Conferred by {alpha}-Tropomyosin Regulatory Elements in Transgenic Mice J. Biol. Chem., August 27, 2004; 279(35): 36660 - 36669. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ono and S. Ono Tropomyosin and Troponin Are Required for Ovarian Contraction in the Caenorhabditis elegans Reproductive System Mol. Biol. Cell, June 1, 2004; 15(6): 2782 - 2793. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hook, F. Lemckert, H. Qin, G. Schevzov, and P. Gunning Gamma Tropomyosin Gene Products Are Required for Embryonic Development Mol. Cell. Biol., March 15, 2004; 24(6): 2318 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Fritz-Six, P. R. Cox, R. S. Fischer, B. Xu, C. C. Gregorio, H. Y. Zoghbi, and V. M. Fowler Aberrant myofibril assembly in tropomodulin1 null mice leads to aborted heart development and embryonic lethality J. Cell Biol., December 8, 2003; 163(5): 1033 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Mudry, C. N. Perry, M. Richards, V. M. Fowler, and C. C. Gregorio The interaction of tropomodulin with tropomyosin stabilizes thin filaments in cardiac myocytes J. Cell Biol., September 15, 2003; 162(6): 1057 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ono and K. Ono Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics J. Cell Biol., March 18, 2002; 156(6): 1065 - 1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muthuchamy, K. Pieples, P. Rethinasamy, B. Hoit, I. L. Grupp, G. P. Boivin, B. Wolska, C. Evans, R. J. Solaro, and D. F. Wieczorek Mouse Model of a Familial Hypertrophic Cardiomyopathy Mutation in {alpha}-Tropomyosin Manifests Cardiac Dysfunction Circ. Res., July 9, 1999; 85(1): 47 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Michele, F. P. Albayya, and J. M. Metzger Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance J. Cell Biol., June 28, 1999; 145(7): 1483 - 1495. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Minamisawa, Y. Gu, J. Ross Jr., K. R. Chien, and J. Chen A Post-transcriptional Compensatory Pathway in Heterozygous Ventricular Myosin Light Chain 2-Deficient Mice Results in Lack of Gene Dosage Effect during Normal Cardiac Growth or Hypertrophy J. Biol. Chem., April 9, 1999; 274(15): 10066 - 10070. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Blanchard, C. Seidman, J. G. Seidman, M. LeWinter, and D. Maughan Altered Crossbridge Kinetics in the {alpha}MHC403/+ Mouse Model of Familial Hypertrophic Cardiomyopathy Circ. Res., March 5, 1999; 84(4): 475 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Robbins {alpha}-Tropomyosin Knockouts : A Blow Against Transcriptional Chauvinism Circ. Res., January 23, 1998; 82(1): 134 - 136. [Full Text] [PDF] |
||||
![]() |
U. Klein, C. Muller, P. Chu, M. Birnbaumer, and M. von Zastrow Heterologous Inhibition of G Protein-coupled Receptor Endocytosis Mediated by Receptor-specific Trafficking of beta -Arrestins J. Biol. Chem., May 11, 2001; 276(20): 17442 - 17447. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |