Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1997;81:1005-1010

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanchard, E. M.
Right arrow Articles by Seidman, J.G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanchard, E. M.
Right arrow Articles by Seidman, J.G.
(Circulation Research. 1997;81:1005-1010.)
© 1997 American Heart Association, Inc.


Articles

Targeted Ablation of the Murine {alpha}-Tropomyosin Gene

Edward M. Blanchard, Kenji Iizuka, Michael Christe, David A. Conner, Anja Geisterfer-Lowrance, Frederick J. Schoen, David W. Maughan, Christine E. Seidman, , J.G. Seidman

From Howard Hughes Medical Institute and Department of Genetics, Harvard Medical School, Boston, Mass (E.M.B., K.I., M.C., D.A.C., J.G.S.); the Department of Molecular Physiology and Biophysics, University of Vermont Medical School, Burlington (D.W.M.); Brigham and Women's Hospital, Boston, Mass (F.J.S.); Howard Hughes Medical Institute and Brigham and Women's Hospital, Boston, Mass (C.E.S.); and Allelix Biopharmaceuticals Inc, Mississauga, Ontario, Canada (A.G.-L.).

Correspondence to Dr Jonathan Seidman, Department of Genetics, Harvard Medical School, 200 Longwood Ave, Boston, MA 02115. E-mail seidman{at}rascal.med.harvard.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract We created a mouse that lacks a functional {alpha}-tropomyosin gene using gene targeting in embryonic stem cells and blastocyst-mediated transgenesis. Homozygous {alpha}-tropomyosin "knockout" mice die between embryonic day 9.5 and 13.5 and lack {alpha}-tropomyosin mRNA. Heterozygous {alpha}-tropomyosin knockout mice have {approx}50% as much cardiac {alpha}-tropomyosin mRNA as wild-type littermates but similar {alpha}-tropomyosin protein levels. Cardiac gross morphology, histology, and function (assessed by working heart preparations) of heterozygous {alpha}-tropomyosin knockout and wild-type mice were indistinguishable. Mechanical performance of skinned papillary muscle strips derived from mutant and wild-type hearts also revealed no differences. We conclude that haploinsufficiency of the {alpha}-tropomyosin gene produces little or no change in cardiac function or structure, whereas total {alpha}-tropomyosin deficiency is incompatible with life. These findings imply that in heterozygotes there is a regulatory mechanism that maintains the level of myofibrillar tropomyosin despite the reduction in {alpha}-tropomyosin mRNA.


Key Words: {alpha}-tropomyosin • haploinsufficiency • knockout mouse


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Sarcomere assembly is a complex process involving the arrangement of multiple polypeptides into a highly ordered array. The full complement of these proteins and the mechanisms that regulate synthesis and assembly remain unknown. Genetic approaches for elucidating these processes have involved the production of organisms with sarcomere gene defects and analyses of the resultant effects on muscle formation. Strains of invertebrates bearing null alleles of sarcomere protein genes have been used to assess whether the stochiometry of particular contractile proteins is critical for normal sarcomere assembly and function. Haploinsufficiency of some sarcomere proteins alters structure and function of muscle, whereas haploinsufficiency of other sarcomere proteins does not. For example, heterozygous Drosophila bearing null mutations in one allele of the genes that encode either actin or myosin heavy chains of indirect flight muscle lead to disordered myofibrils and defective flight muscle.1 In contrast, heterozygous Caenorhabditis elegans bearing a null mutation in one allele of their myosin heavy chain genes have normal wall muscle function.2 Very little information is available regarding the role of particular sarcomere proteins in regulating mammalian sarcomere assembly. In particular, the role of tropomyosin in regulating sarcomere protein assembly is uncertain.

Tropomyosin has multiple functions, including stabilization of the thin filament and regulation of Ca2+ activation of the sarcomere.3 Tropomyosin polypeptides are {approx}284 amino acids in length and form coiled-coil dimers that lie head-to-tail in the major groove of the sarcomere thin filament. In vertebrates there are four tropomyosin genes, each consisting of 10 exons and a variety of alternate exons, which encode {alpha}-tropomyosin, ß-tropomyosin, nonmuscle tropomyosin, and tropomyosin-4. Tropomyosin polypeptides found in muscle sarcomeres are derived primarily from the {alpha} and ß genes, but in the murine heart, most tropomyosin is derived from the {alpha}-tropomyosin gene.

The production of mice bearing null alleles of sarcomere protein genes provides a useful system for assessing the role of the protein in regulating sarcomere assembly. Recent studies of a mouse bearing a knockout mutation in cardiac {alpha}-myosin heavy chain gene have suggested that haploinsufficiency of this gene affects cardiac development and function.4 We have created mice that lack {alpha}-tropomyosin and mice with {alpha}-tropomyosin haploinsufficiency to determine whether levels of this sarcomere component modulate sarcomere structure in the murine heart. In the present study, we report that haploinsufficiency of the {alpha}-tropomyosin gene does not produce a demonstrable reduction in protein, nor does it create a demonstrable phenotype. We suggest that compensatory mechanisms exist to maintain physiological levels of this thin filament component in the heterozygous {alpha}-tropomyosin knockout mouse despite a reduction in mRNA levels. Further, we demonstrate that mouse embryos lacking {alpha}-tropomyosin die early in embryogenesis.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Targeting Construct, ES Cell Manipulation, and Generation of Targeted Mice
A 13-kb pair fragment of the mouse {alpha}-tropomyosin gene containing exon 8, exon 9, and 3' sequences was cloned from a {lambda} DASH (Stratagene) genomic library derived from a strain 129/SvJ mouse using a 32P-labeled 263-bp probe (primer sequences: {alpha}-tropomyosin exon 9d, forward and reverse). The probe contained a portion of the 3' untranslated region associated with exon 9a.5 A 5-kb Sal I–BamHI fragment was subcloned into pBSII+ and modified as indicated in Fig 1Down to create the targeting construct (designated pTMKO).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Structures of the {alpha}-tropomyosin (Tm) targeting construct, a portion of the Tm gene, and the knockout Tm allele. The targeting construct contained {approx}5 kb of the Tm gene. Both the neomycin (Neo) and thymidine kinase (TK) genes were inserted in reverse orientation and were expressed under control of the phosphoglycerate kinase promoter. The Neo gene was inserted at the splice junction between intron 8 and the striated muscle-specific exon 9a; 32 base pairs were removed from this site. The precise location of exon 9d is not known. The left and right arms of the construct contained {approx}1.8 and 3.2 kb of the Tm gene, respectively. The region used as an external genomic probe to detect homologous recombination is indicated by the black bar. UTR indicates untranslated region. H indicates HindIII. At the lower right is a Southern blot of HindIII-digested wild-type and TMKO/+. The image was derived from a Phosphoimager (see "Materials and Methods").

The following forward (F) and reverse (R) oligonucleotide primers were used and were derived from published {alpha}-tropomyosin (Tm) sequences6 : Tm exon 9d, (F)5' GAAAGTGGCCCATGCCAAAGAAGAA and (R)5' ACCCTGATATGGAGAACTGGGAAGG; Tm exon 5, (F)5' GTGGCCCGTAAGCTGGTCATCATCG; Tm exon 6b, (R)5' TGAGCCTCCAGTGACTTCAA; Tm 3' untranslated region, (F)5' TTGTACAGAAGCAATTCGCCCAGTG and (R)5' GCACGGGTATGGGCAGCATTTCAAA; Tm intron 8, (F)TCTGCCTTCCACTTCCTGGT; and Tm intron 9, (R)5' CAAGGAGGCATGGTGGTGAGTTTA.

Linearized targeting construct pTMKO was introduced into the male ES cell line C1 as described by Geisterfer-Lowrance et al.7 Targeted ES cell lines were identified by Southern blot analysis (Fig 1Up). Homologous recombination resulted in introduction of a neomycin-resistant gene (neor) into exon 9a, with a resultant 8.6-kb HindIII fragment in the targeted allele rather than the 6.8-kb HindIII fragment in the wild-type allele. A 32P-labeled 900-bp polymerase chain reaction product generated from exons 5 and 6 (designated exon 5,6 probe) was used to screen for ES cell lines in which one allele of the {alpha}-tropomyosin had been targeted (Fig 1Up).

Targeted ES cells were injected into C57BL/6 (male)x B6D2F1 (female) blastocysts and transferred to Swiss Webster pseudopregnant females by standard procedures.7 Chimeric males were then bred with Black Swiss females to test for germline transmission. Young mice and embryos were genotyped by Southern blot analysis as described above, using tail or embryonic yolk sack DNA.

Histological Analysis of Cardiac Tissue
Hearts from representative 15-week-old males were isolated from heparinized mice anesthetized with Avertin, trimmed in cold PBS, transversely sectioned at a midventricular level, and prepared for microscopy as described by Geisterfer-Lowrance et al.7 Slides for light microscopy from single wild-type and heterozygous mutants were scored for myocyte hypertrophy, disarray, and injury or fibrosis, without knowledge of genotype. For electron microscopy, hearts were bisected and immediately immersed in freshly prepared 2.5% glutaraldehyde (25% EM grade, SPI-Structure Probe) diluted in 0.1 mol/L Millonig's phosphate buffer, pH 7.4. Triangular pieces (1-mm base x 2-mm height) were cut out of the basal half of the left ventricular free wall and placed in vials with fresh fixative for 1 hour at 4°C. Sections were washed 3 times for 15 minutes in 0.1 mol/L Millonig's phosphate buffer, pH 7.4, and postfixed (1 hour at room temperature) in 1% osmium tetroxide prepared in the same buffer. Washes were repeated (3 times for 15 minutes) in fresh buffer and dehydrated through a graded series of ethanol (10% to 95%). Sections were stained en bloc in 2% uranyl acetate (in 95% ethanol), dehydrated in two changes of 100% ethanol, transferred through two changes of propylene oxide, and then incubated overnight at room temperature in 50:50 (vol/vol) mixture of propylene-epoxy resin (Embed 812/Araldite 502, SPI-Structure Probe). The samples were transferred on the second day through two changes (1 hour each) of fresh epoxy resin, blocked in flat embedding molds, and polymerized overnight. On the third day, samples were cut out of resin blocks, glued onto plastic stubs, and sectioned for both longitudinal and cross-sectional views of sarcomeres. Thin sections were contrasted with lead and uranyl acetate, and micrographs were taken on a JEOL 100CX II transmission electron microscope operated at 60-kV accelerating voltage.

DNA, RNA, and Protein Analysis
Total RNA was isolated from hearts trimmed of atria and great vessels by the guanidium isothiocyanate method.8 Total RNA was isolated from ED8.5 embryos in the following manner: After genotyping, 12 embryos for each of the wild-type, heterozygous, and homozygous groups were pooled, and the RNA was isolated with an RNA Stat-60 kit (Tel-test "B," Inc).

Southern and Northern blots were performed as described by Ausubel et al9 and Spiegelman et al8 , using probes corresponding to exons 9a (primers, {alpha}-tropomyosin intron 8 and {alpha}-tropomyosin intron 9), 9d (primers, {alpha}-tropomyosin exon 9d), and actin.8 Filters were "stripped" in 0.1% SDS at 90°C for 45 minutes. Images were obtained from a Phosphoimager (Molecular Dynamics). The intensity of the hybridization signals was assessed using a Molecular Dynamics scanning densitometer. Quantification was performed on the pooled samples of ED8.5 embryos and on three separate wild-type and three null heterozygous ventricular preparations.

Myofibrillar protein fractions were prepared as described by Solaro et al,10 supplemented with 2 µmol/L leupeptin, 1 µg/mL papstatin, 1 µg/mL aprotinin, 0.5 mmol/L 4-(2-aminoethyl)-benzenesulfonyl fluoride, hydrochloride, 100 µmol/L benzamidine HCl, and 1 mmol/L phenanthroline. The protein concentration of each sample was determined using the Bio-Rad protein assay method. Equal amounts of protein (2.4 µg) were loaded per lane on duplicate 7.5% SDS-polyacrylamide gels. One gel was stained with silver stain, and protein from the other gel was transferred to nitrocellulose membrane by using an Amersham semidry transblot apparatus. The membrane was probed first with CH1 monoclonal anti-tropomyosin antibody (Sigma, no. T-9283) as the primary antibody at 1:1000 dilution for 1 hour at room temperature. After washing in PBS solution, the membrane was probed with the secondary antibody (peroxidase-labeled anti-mouse Ig antibody from sheep). The membrane was exposed to autoradiography film according to the specifications of the Western blotting kit (Amersham). These steps were repeated for ventricular myosin light chain 1 (Biogenesis, No. 6490-4504) antibody after stripping the filters in the following manner: filters were incubated in 100 mmol/L 2-mercaptoethanol, 2% SDS, and 622.5 mmol/L Tris-HCl (pH 6.7) for 30 minutes at 50°C and washed twice for 10 minutes in PBS. Quantification was performed by scanning densitometry and standardization to the ventricular myosin light chain single. Average values from two wild-type and two null heterozygous preparations are reported.

Working Heart Preparations
Left ventricular pressure, dP/dT, and cardiac output were measured from hearts of 15 week-old males, without knowledge of genotype, through an indwelling cannula coupled to a pressure transducer and were recorded on a Maclab A/D system as previously described.7 Pressure development, pressure time derivatives, and cardiac output were determined at variable LAFPs with a fixed resistance and at variable resistance with a constant filling pressure.

Skinned Strip Mechanics
Mice (male, 24 to 36 weeks old) were killed by cervical dislocation. The hearts were removed and placed in a specialized Ringer's solution (with 95% O2/5% CO2) containing 30 mmol/L BDM, designed to protect the myocardial tissue from cutting injury.11 Small sections of left ventricular papillary muscles were dissected in the BDM-Ringer's solution to yield strips {approx}120 µm in diameter and {approx}1500 µm in length (125±4 and 119±3, respectively, from TMAKO/+ and wild-type mice). Ends of the strips were tethered with silk and transferred to a vessel that contained clips, which allowed the tethered strip to be stretched just beyond slack length. The strips were skinned by incubation in a pCa 8 relaxing solution (5 mmol/L MgATP, 30 mmol/L phosphocreatine, 240 U/mL creatine kinase, 1 mmol/L free Mg2+, 0.11 mmol/L CaCl2, 5 mmol/L EGTA, and 20 mmol/L BES buffer, pH 7.0); ionic strength was adjusted to 175 mmol/L with added sodium methyl sulfonate containing 1% (wt/vol) Triton X-100 and incubated overnight at 4°C. Strips were used for mechanical experiments either the next day or, after transfer to a storage solution and incubation at -20°C, within a week of dissection. The storage solution consisted of relaxing solution with 50% (wt/vol) glycerol and 10 µg/mL leupeptin.

The skinned strips with tethers were placed in relaxing solution in a second vessel where small aluminum clips were used to isolate a uniform segment ({approx}700 µm in length) of the strip. The clipped segment was cut free and transferred to a 30 µL drop of relaxing solution in a glass-bottom aluminum chamber filled with mineral oil. One end of the strip was attached to a strain gauge (AE801, SensoNor), and the other end was attached to a piezoelectric motor (P173, Physik Instrumente GmbH & Co). The position of the motor head was monitored by a variable impedance displacement transducer (KD-2310, Kaman Instrumentation Corp). Oil temperature was maintained at 37°C or 27°C (±0.5°C) by a Peltier device (Cambion, Cambridge Thermionic Corp). The force transducer had the following characteristics: sensitivity, 1.63 mN/V; compliance (transducer and hook), {approx}5 µN/mN; and resonant frequency, 7.7 kHz. The -3-dB roll-off frequency of the servomotor was 600 Hz, and its compliance (servomotor and hook) was <1 nm/µN.

The skinned strips were stretched (incrementally, in 0.05-µm steps per sarcomere) to a sarcomere spacing of {approx}2.2 µm (estimated with an inverted microscope and filar micrometer). Analogue displacement and tension signals were monitored by a thermal strip-chart recorder with a high-gain amplifier (WR3101, Watanabe Corp) and a digital storage oscilloscope (2201 Tektronix Corp). Strip tension (mN/mm2) was calculated by dividing the force by the fiber cross-sectional area, calculated from an elliptical cross-sectional area using widths measured at the major and minor axis.

The skinned strips were activated incrementally by Ca2+. Equal volumes of relaxing solution were exchanged with activating solution (pCa 4.5) to attain pCa of 7, 6, 5.75, 5.5, and 5. Activating solutions had the same ionic composition as relaxing solution, except the total concentration of CaCl2 was 5.03 mmol/L (pCa 4.5). The solutions were formulated by solving a set of simultaneous equations describing the multiple equlibria of ions in the solutions.12 13 14

Sinusoidal analysis14 was used to determine the power output (in nW/mm3) of skinned strips in response to small-amplitude perturbations. The end of each segment was oscillated at a specific frequency, and the resulting force response was recorded. A strip of latex membrane (Trojan-enz, Carter-Wallace) was used as a reference material to characterize the system transfer function.

Sinusoidal length perturbations of 0.25% fiber length (peak to peak) and 0.5 to 1000 Hz were applied at 42 discrete frequencies (0.1 to 100 Hz) using a microcomputer and 16-bit data acquisition board (DT2838, Data Translation Inc). The length and force signals from the servomotor and strain gauge were digitized, and the elastic and viscous components of the complex stiffness were calculated by computing the amplitude ratio and the phase difference for the change in tension and length at each frequency. Maximum oscillatory power output was calculated as {pi}f · Ev({Delta}L/L)2, where f is the frequency of the length perturbation (s-1), Ev is the viscous modulus (mN/mm2), and {Delta}L/L is the fractional change in strip length.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Creation of the {alpha}-Tropomyosin Knockout Line
The {alpha}-tropomyosin targeting construct was electroporated into ES cells, and 16 independent neomycin-resistant targeted clones were identified (Fig 1Up). Cells from three independent cell lines were injected into C57BL/6 blastocysts. One cell line, designated C1TMA165, yielded one chimeric male that passed the disrupted {alpha}-tropomyosin gene to one male offspring. This heterozygous male was bred with Black Swiss females to generate mice used in this study. All heterozygous offspring (designated TMAKO/+) were indistinguishable from their wild-type littermates in size and general appearance.

By contrast, homozygous {alpha}-tropomyosin knockout mice were not viable (P<.0001). Ninety-eight offspring derived from mating between TMAKO/+ parents were obtained. None of these offspring were homozygous for the {alpha}-tropomyosin disruption. Embryos from heterozygous crosses were characterized at different gestational ages to determine when the homozygote TMAKO/TMAKO embryos died. None of 18 ED13.5 embryos were homozygous (12 heterozygotes, 6 wild-type), whereas 45 ED9.5 and 73 ED8.5 embryos were similar to the expected 1:2:1 ratio of homozygote:heterozygote:wild-type (8:22:15 and 17:40:16, respectively). However, the homozygous ED9.5 embryos were poorly developed and only one fourth the size of the heterozygous and wild-type embryos. SDS gels and Western blots with samples from single embryos revealed evidence of protein degradation for the ED9.5 embryos, suggesting that reabsorption of these embryos had been initiated by this developmental stage. The mRNA from homozygous ED8.5 embryos contained no detectable {alpha}-tropomyosin mRNA, demonstrating that the TMAKO gene disruption produced a null allele (Fig 2Down). Heterozygous TMKO/+ embryos contained only one half as much {alpha}-tropomyosin mRNA as wild-type embryos (Fig 2BDown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Northern blots of total RNA from wild-type (+/+), heterozygous (+/-), and homozygous (-/-) ED8.5 embryos (A and B) and of ventricles of adult male mice (C). Total cellular RNA ({approx}10 µg/lane) from each tissue was fractionated on formaldehyde-agarose gels. Each panel (A to C) represents the results obtained after fractionation of RNA on separate gels. After fractionation, the RNA was transferred onto a nylon filter. A and B, Each filter was hybridized sequentially with {alpha}-tropomyosin (Tm) exon 9a probe (1.3-kb message) or the Tm exon 9d probe (1.8-kb message) and ß-actin probe. C, A single filter was hybridized sequentially with the exon 9a probe, the exon 9d probe, and the GAPDH probe.

Characterization of {alpha}-Tropomyosin in TMKO/+ Mice
The structure and amount of {alpha}-tropomyosin mRNA and protein in TMKO/+ hearts were analyzed by Northern and Western blotting. To determine if the introduction of the neomycin-selectable marker in exon 9a produced an isoform-specific knockout, Northern blots were hybridized with isoform-specific probes. Exon 9a was used as a probe for the striated muscle-specific {alpha}-tropomyosin isoform, and exon 9d was used to detect the majority of other nonstriated isoforms, including those expressed in smooth muscle and fibroblasts.15 16 Band intensities were determined by scanning densitometry and standardized to the loading control. The ratio of the two splice forms was the same in the wild-type and mutant mouse mRNAs (Fig 2Up). The amount of {alpha}-tropomyosin mRNA containing either exon 9a or exon 9d was diminished by 46% and 44%, respectively, in the heterozygous mouse heart compared with the wild-type mouse heart (Fig 2CUp). That is, cardiac mRNA from heterozygous adult male mice contained about one half as much 1.3-kb and 1.8-kb {alpha}-tropomyosin mRNA as wild-type mouse heart mRNA.

The amount of tropomyosin protein in heterozygous TMKO/+ and wild-type hearts and skeletal muscle was compared by Western blot analysis. Whole-heart homogenates (data not shown) and myofibrillar preparations from 15-week-old heterozygous TMKO/+ and wild-type male mice were compared (Fig 3Down). The amount of tropomyosin in the mutant and wild-type heart preparations was indistinguishable (Fig 3Down, top blot) when corrected for the amount of protein loaded in each lane (myosin light chain 1 [VMLC] antibody; Fig 3Down, bottom blot). Similarly, skeletal myofibrillar preparations from a predominantly slow-muscle fiber type (the soleus muscle) and a fast-muscle fiber type, (the external oblique back muscle) were the same in wild-type and mutant mice (Fig 3Down). The slower migrating protein species that reacted with the tropomyosin antibody was ß-tropomyosin,17 which constitutes a significant fraction (30% to 40%) of sarcomeric tropomyosin in soleus muscle and 13% to 18% of sarcomeric tropomyosin in the external oblique muscle. The {alpha}/ß-tropomyosin ratio in mutant and wild-type mouse soleus and external oblique muscle samples was similar (Fig 3Down). No ß-tropomyosin was detected in heart samples from either the heterozygous TMKO/+ or wild-type mouse.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Western blot of myofibrillar protein from ventricular, soleus (slow skeletal), and external oblique (fast skeletal) muscles. Myofibrillar samples ({approx}2.5 µg/lane) were loaded on 7.5% gels, transferred to filters, and reacted with the primary {alpha}-tropomyosin (Tm) and ventricular light chain 1 (VMLC) antibodies. The skeletal muscle samples demonstrated two bands binding the Tm antibody, corresponding to the slower migrating ß-tropomyosin (ß-Tm) protein and the faster migrating {alpha}-tropomyosin ({alpha}-Tm) protein.22 There was very little ß-Tm in skeletal muscle, and the bands did not reproduce well; the position of the ß-Tm protein band is indicated. The ratio of ß-Tm to {alpha}-Tm was assessed by densitometry in each sample; for each tissue, the ratio was the same in each heterozygote and wild-type sample.

Cardiac Structure and Function in TMKO/+ Mice
The gross appearance of hearts from heterozygous TMKO/+ and wild-type mice was indistinguishable. The heart/body weight ratio of 15-week heterozygous TMKO/+ male mice (0.00401±0.00014) was not significantly different from that of 15-week wild-type mice (0.00406±0.00019).

Sections from heterozygous TMKO/+ mice demonstrated normal histology. No evidence of myocyte hypertrophy, disorder, or fibrosis was detected in hematoxylin and eosin–stained sections or in sections stained with Masson's trichrome to highlight connective tissue among the myocytes (data not shown). Electron micrographs demonstrated identical sarcomere ultrastructure in the heterozygote TMKO/+ and wild-type mouse hearts (Fig 4Down).



View larger version (136K):
[in this window]
[in a new window]
 
Figure 4. Ultrastructure of left ventricular myocardium from wild-type (A) and heterozygous TMKO/+ (B) mice. Longitudinal sections at x30 000 magnification show well-ordered myofibrils from both mouse lines, with straight and well-defined M lines and Z lines. No differences in ultrastructure were detected between the two groups. Data are representative of electron micrographs obtained from 2 wild-type and 2 null heterozygous mice.

Left ventricular pressures and cardiac outputs were measured from isolated working hearts from wild-type and heterozygote TMKO/+ mice. Neither the maximum left ventricular systolic pressure nor cardiac output generated over a range of LAFP differed significantly between the wild-type and heterozygous mouse hearts (Fig 5Down).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Peak left ventricular pressure (mm Hg, A) and cardiac output (mL/min, B) from isolated working hearts of adult male mice that were wild-type (+/+, n=8) or {alpha}-tropomyosin null heterozygotes (+/-, n=7). Bars represent standard error; none of the observed differences were statistically significant (P>.05).

The steady-state and oscillatory mechanical characteristics of skinned strips from left ventricular papillary muscles were identical in mutant and wild-type mice (Fig 6Down). In particular, at a given pCa, sarcomeres from heterozygous TMAKO/+ hearts generate steady-state tensions that were not significantly different from those in similar muscle preparations from wild-type mice. The heterozygous TMAKO/+-derived muscles did not exhibit any significant decrement in maximum oscillatory power (or in the frequency of maximum power output, {approx}15 Hz) evaluated by the sinusoidal length perturbations (Fig 6BDown). Although a slight power difference between the mutant and wild-type mouse–derived muscle preparations was observed at pCa 6, we are uncertain of the significance of this observation, since no differences in power output were observed at other Ca2+ concentrations.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. Mechanical analysis of skinned strips from left ventricular papillary muscles of wild-type (+/+, n=12 strips from 5 mice) and heterozygote TMKO/+ mice (+/-, n=13 strips from 4 mice). A, Absolute tension (mN/mm2) vs pCa. B, Maximum oscillatory power (nW/m3) vs pCa.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrates that mice lacking a functional {alpha}-tropomyosin gene are nonviable, whereas cardiac structure and function of mice bearing one functional {alpha}-tropomyosin gene are indistinguishable from those of their wild-type littermates. The early embryonic lethality observed in the homozygous mutants is consistant with the early expression of striated (ED7.5) and smooth muscle isoforms (ED4.5) of {alpha}-tropomyosin in the developing mouse embryo.18 The heterozygous TMKO/+ mice had a 50% reduction of {alpha}-tropomyosin mRNA, normal myofibrillar tropomyosin protein levels, and no detectable pathology. We conclude that the TMKO/+ mice have a regulatory mechanism that maintains the normal level of myofibrillar tropomyosin despite a 50% reduction in mRNA.

Two vastly different areas of research have provided genetic evidence for the critical role of tropomyosin in muscle function. In humans missense mutations in several sarcomeric protein genes, including {alpha}-tropomyosin, have been shown to cause FHC.19 This autosomal-dominant disease is characterized by increased myocardial mass, myocyte and myofibrillar disarray, and an increased risk of sudden death. Whether {alpha}-tropomyosin mutations cause FHC by creating a poison polypeptide that disrupts myofibrillar organization when it is incorporated into the sarcomere or whether these mutations cause FHC by creating a heart with insufficient {alpha}-tropomyosin (haploinsufficiency) is unclear.6 In Drosophila melanogaster, myofibrillar protein stochiometry appears to be a critical factor in determining normal structure and function of the indirect flight muscle, suggesting that {alpha}-tropomyosin haploinsufficiency might cause FHC. Single heterozygous null mutations in actin, myosin heavy chain, and tropomyosin genes of the indirect flight muscle lead to a reduction in the respective protein, a disorganization of the myofibrillar lattice, and a deficit in flight.20 21 Compound actin/myosin null heterozygotes have equivalently reduced actin and myosin protein levels and nearly normal myofibrils.20

The data suggest, assuming that human and murine cardiac muscle are similar, that inactivation of one {alpha}-tropomyosin allele would not cause the pathology observed in FHC. The major difference between mouse and in D melanogaster is the effect of heterozygous null mutations on tropomyosin protein levels. The mouse can maintain the wild-type level of myofibrillar tropomyosin protein with a single functional allele, whereas D melanogaster cannot.

The data also imply that there is a regulatory mechanism in the mouse that maintains myofibrillar tropomyosin content despite decreased {alpha}-tropomyosin mRNA levels. Coordinate regulation of {alpha}- and ß-tropomyosin has been reported as an apparent mechanism to maintain a constant level of myofibrilar tropomyosin. In transgenic mice with ß-tropomyosin driven by the cardiac-specific promoter from the {alpha}-myosin heavy chain gene, there is a 34-fold increase in ß-tropomyosin protein in the heart.17 A concomitant decrease in {alpha}-tropomyosin results in levels of total myofibrillar tropomyosin that are nearly the same as those in wild-type mice. Interestingly, when the ß-tropomyosin transgene is downregulated by inducing hypothyroidism with 5-propyl-2-thiouracil, there is an upregulation of endogenous {alpha}-tropomyosin, resulting in normal levels of myofibrillar tropomyosin.17 The mechanism of coordinate regulation is not understood. Possibly, a component of this system is involved in maintaining levels of {alpha}-tropomyosin protein in the TMKO/+ mice comparable to {alpha}-tropomyosin protein levels in wild-type mice.

Whether alterations in {alpha}-tropomyosin protein stochiometry can cause cardiac pathology in mice is still an open question. Experimental manipulations that reduce cardiac tropomyosin protein levels may change cardiac muscle function and bring the vertebrate and invertebrate studies into agreement. However, the disruption of a single {alpha}-tropomyosin allele in mice does not lead to a detectable alteration in cardiac function in sedentary mice with nonhypertrophic hearts, because myofibrillar tropomyosin protein levels are not changed. Future studies are needed to determine whether variations in genetic background or stress, such as exercise or other hypertrophic stimuli, might overwhelm the regulatory mechanism and result in alterations in the cardiac response in mice with only one functional {alpha}-tropomyosin allele.


*    Selected Abbreviations and Acronyms
 
BDM = 2,3-butanedione monoxime
ED = embryonic day
ES = embryonic stem
FHC = familial hypertrophic cardiomyopathy
LAFP = left atrial filling pressure


*    Acknowledgments
 
We thank Dr Martin LeWinter, Chief of Cardiology at the University of Vermont Medical School, for financial support for the mechanical studies and Bill Barnes for technical help.


*    Footnotes
 
The manuscript was sent to Leslie Leinwand, Consulting Editor, for review by expert referees, editorial decision, and final disposition.

Received April 30, 1997; accepted September 24, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Fyrberg E, Beall C. Genetic approaches to myofibril form and function in Drosophila. Trends Genet.. 1990;6:126-131.[Medline] [Order article via Infotrieve]

2. Bejsovec A, Anderson P. Myosin heavy-chain mutations that disrupt Caenorhabditis elegans thick filament assembly. Genes Dev.. 1988;2:1307-1317.[Abstract/Free Full Text]

3. Farah CS, Reinach FC. The troponin complex and regulation of muscle contraction. FASEB J.. 1995;9:755-767.[Abstract]

4. Jones WK, Grupp IL, Doetschman T, Grupp G, Osinska H, Hewett TE, Boivin G, Gulick J, Ng WA, Robbins J. Ablation of the murine alpha myosin heavy chain gene leads to dosage effects and functional deficits in the heart. J Clin Invest.. 1996;98:1906-1917.[Medline] [Order article via Infotrieve]

5. Schleef M, Werner K, Satzger U, Kaupmann K, Jockusch H. Chromosomal localization and genomic cloning of the mouse alpha-tropomyosin gene Tpm-1. Genomics.. 1993;17:519-521.[Medline] [Order article via Infotrieve]

6. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg HP, Seidman JG, Seidman CE. Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell.. 1994;77:701-712.[Medline] [Order article via Infotrieve]

7. Geisterfer-Lowrance AA, Christe M, Conner DA, Ingwall JS, Schoen FJ, Seidman CE, Seidman JG. A mouse model of familial hypertrophic cardiomyopathy. Science.. 1996;272:731-734.[Abstract]

8. Spiegelman BM, Frank M, Green H. Molecular cloning of mRNA from 3T3 adipocytes: regulation of mRNA content for glycerophosphate dehydrogenase and other differentiation-dependent proteins during adipocyte development. J Biol Chem.. 1983;258:10083-10089.[Abstract/Free Full Text]

9. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1996.

10. Solaro RJ, el-Saleh SC, Kentish J, Meyer A, Martin A. Transitions in isoform populations of thick and thin filament proteins and calcium activation of force and ATP hydrolysis by cardiac myofilaments. Prog Clin Biol Res.. 1989;315:487-502.[Medline] [Order article via Infotrieve]

11. Mulieri LA, Hasenfuss G, Ittleman F, Blanchard EM, Alpert NR. Protection of human left ventricular myocardium from cutting injury with 2,3-butanedione monoxime. Circ Res.. 1989;65:1441-1449.[Abstract/Free Full Text]

12. Godt RE, Lindley BD. Influence of temperature upon contractile activation and isometric force production in mechanically skinned muscle fibers of the frog. J Gen Physiol.. 1982;80:279-297.[Abstract/Free Full Text]

13. Andrews MA, Maughan DW, Nosek TM, Godt RE. Ion-specific and general ionic effects on contraction of skinned fast-twitch skeletal muscle from the rabbit. J Gen Physiol.. 1991;98:1105-11025.[Abstract/Free Full Text]

14. Kawai M, Brandt PW. Sinusoidal analysis: a high resolution method for correlating biochemical reactions with physiological processes in activated skeletal muscles of rabbit, frog and crayfish. J Muscle Res Cell Motil.. 1980;1:279-303.[Medline] [Order article via Infotrieve]

15. Ruiz-Opazo N, Nadal-Ginard B. Alpha-tropomyosin gene organization: alternative splicing of duplicated isotype-specific exons accounts for the production of smooth and striated muscle isoforms. J Biol Chem.. 1987;262:4755-4765.[Abstract/Free Full Text]

16. Lees-Miller JP, Goodwin LO, Helfman DM. Three novel brain tropomyosin isoforms are expressed from the rat alpha-tropomyosin gene through the use of alternative promoters and alternative RNA processing. Mol Cell Biol.. 1990;10:1729-1742.[Abstract/Free Full Text]

17. Muthuchamy M, Grupp IL, Grupp G, O'Toole BA, Kier AB, Boivin GP, Neumann J, Wieczorek DF. Molecular and physiological effects of overexpressing striated muscle beta-tropomyosin in the adult murine heart. J Biol Chem.. 1995;270:30593-30603.[Abstract/Free Full Text]

18. Muthuchamy M, Pajak L, Howles P, Doetschman T, Wieczorek DF. Developmental analysis of tropomyosin gene expression in embryonic stem cells and mouse embryos. Mol Cell Biol.. 1993;13:3311-3323.[Abstract/Free Full Text]

19. Seidman CE, Seidman JG. Molecular Studies of Inherited Cardiomyopathies. New York, NY: Marcel Dekker Inc; 1996.

20. Beall CJ, Sepanski MA, Fyrberg EA. Genetic dissection of Drosophila myofibril formation: effects of actin and myosin heavy chain null alleles. Genes Dev.. 1989;3:131-140.[Abstract/Free Full Text]

21. Karlik CC, Fyrberg EA. An insertion within a variably spliced Drosophila tropomyosin gene blocks accumulation of only one encoded isoform. Cell.. 1985;41:57-66.[Medline] [Order article via Infotrieve]

22. Burkholder TJ, Fingado B, Baron S, Lieber RL. Relationship between muscle fiber types and sizes and muscle architectural properties in the mouse hindlimb. J Morphol.. 1994;221:177-190.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Schevzov, T. Fath, B. Vrhovski, N. Vlahovich, S. Rajan, J. Hook, J. E. Joya, F. Lemckert, F. Puttur, J. J.-C. Lin, et al.
Divergent Regulation of the Sarcomere and the Cytoskeleton
J. Biol. Chem., January 4, 2008; 283(1): 275 - 283.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Gunning, G. O'neill, and E. Hardeman
Tropomyosin-Based Regulation of the Actin Cytoskeleton in Time and Space
Physiol Rev, January 1, 2008; 88(1): 1 - 35.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
F. Houle, A. Poirier, J. Dumaresq, and J. Huot
DAP kinase mediates the phosphorylation of tropomyosin-1 downstream of the ERK pathway, which regulates the formation of stress fibers in response to oxidative stress
J. Cell Sci., October 15, 2007; 120(20): 3666 - 3677.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Pasquet, F. Naye, C. Faucheux, O. Bronchain, A. Chesneau, P. Thiebaud, and N. Theze
Transcription Enhancer Factor-1-dependent Expression of the {alpha}-Tropomyosin Gene in the Three Muscle Cell Types
J. Biol. Chem., November 10, 2006; 281(45): 34406 - 34420.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Wernicke, C. Thiel, C. M. Duja-Isac, K. V. Essin, M. Spindler, D. J. R. Nunez, R. Plehm, N. Wessel, A. Hammes, R.-J. Edwards, et al.
{alpha}-Tropomyosin mutations Asp175Asn and Glu180Gly affect cardiac function in transgenic rats in different ways
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2004; 287(3): R685 - R695.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. D. Ellis, C. W. J. Smith, and P. Kemp
Regulated Tissue-specific Alternative Splicing of Enhanced Green Fluorescent Protein Transgenes Conferred by {alpha}-Tropomyosin Regulatory Elements in Transgenic Mice
J. Biol. Chem., August 27, 2004; 279(35): 36660 - 36669.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Ono and S. Ono
Tropomyosin and Troponin Are Required for Ovarian Contraction in the Caenorhabditis elegans Reproductive System
Mol. Biol. Cell, June 1, 2004; 15(6): 2782 - 2793.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Hook, F. Lemckert, H. Qin, G. Schevzov, and P. Gunning
Gamma Tropomyosin Gene Products Are Required for Embryonic Development
Mol. Cell. Biol., March 15, 2004; 24(6): 2318 - 2323.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
K. L. Fritz-Six, P. R. Cox, R. S. Fischer, B. Xu, C. C. Gregorio, H. Y. Zoghbi, and V. M. Fowler
Aberrant myofibril assembly in tropomodulin1 null mice leads to aborted heart development and embryonic lethality
J. Cell Biol., December 8, 2003; 163(5): 1033 - 1044.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
R. E. Mudry, C. N. Perry, M. Richards, V. M. Fowler, and C. C. Gregorio
The interaction of tropomodulin with tropomyosin stabilizes thin filaments in cardiac myocytes
J. Cell Biol., September 15, 2003; 162(6): 1057 - 1068.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Ono and K. Ono
Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics
J. Cell Biol., March 18, 2002; 156(6): 1065 - 1076.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Muthuchamy, K. Pieples, P. Rethinasamy, B. Hoit, I. L. Grupp, G. P. Boivin, B. Wolska, C. Evans, R. J. Solaro, and D. F. Wieczorek
Mouse Model of a Familial Hypertrophic Cardiomyopathy Mutation in {alpha}-Tropomyosin Manifests Cardiac Dysfunction
Circ. Res., July 9, 1999; 85(1): 47 - 56.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. E. Michele, F. P. Albayya, and J. M. Metzger
Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
J. Cell Biol., June 28, 1999; 145(7): 1483 - 1495.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Minamisawa, Y. Gu, J. Ross Jr., K. R. Chien, and J. Chen
A Post-transcriptional Compensatory Pathway in Heterozygous Ventricular Myosin Light Chain 2-Deficient Mice Results in Lack of Gene Dosage Effect during Normal Cardiac Growth or Hypertrophy
J. Biol. Chem., April 9, 1999; 274(15): 10066 - 10070.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Blanchard, C. Seidman, J. G. Seidman, M. LeWinter, and D. Maughan
Altered Crossbridge Kinetics in the {alpha}MHC403/+ Mouse Model of Familial Hypertrophic Cardiomyopathy
Circ. Res., March 5, 1999; 84(4): 475 - 483.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Robbins
{alpha}-Tropomyosin Knockouts : A Blow Against Transcriptional Chauvinism
Circ. Res., January 23, 1998; 82(1): 134 - 136.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. Klein, C. Muller, P. Chu, M. Birnbaumer, and M. von Zastrow
Heterologous Inhibition of G Protein-coupled Receptor Endocytosis Mediated by Receptor-specific Trafficking of beta -Arrestins
J. Biol. Chem., May 11, 2001; 276(20): 17442 - 17447.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanchard, E. M.
Right arrow Articles by Seidman, J.G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanchard, E. M.
Right arrow Articles by Seidman, J.G.