Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1997;81:664-671

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shioi, T.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shioi, T.
Right arrow Articles by Sasayama, S.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Heart Failure
(Circulation Research. 1997;81:664-671.)
© 1997 American Heart Association, Inc.


Articles

Increased Expression of Interleukin-1ß and Monocyte Chemotactic and Activating Factor/Monocyte Chemoattractant Protein-1 in the Hypertrophied and Failing Heart With Pressure Overload

Tetsuo Shioi, Akira Matsumori, Yasuki Kihara, Moriaki Inoko, Koh Ono, Yoshitaka Iwanaga, Takehiko Yamada, Atsushi Iwasaki, Kouji Matsushima, , Shigetake Sasayama

From the Department of Cardiovascular Medicine (T.S., A.M., Y.K., M.I., K.O., Y.I., T.Y., A.I, S.S.), Kyoto (Japan) University; the Department of Pharmacology (K.M.), Cancer Research Institution, Kanazawa (Japan) University; and the Department of Molecular Preventive Medicine (K.M.), School of Medicine, University of Tokyo (Japan).

Correspondence to Akira Matsumori, MD, PhD, Department of Cardiovascular Medicine, Kyoto University, 54 Kawaracho, Shogoin, Sakyo-ku, Kyoto 606, Japan. E-mail amat{at}kuhp.kyoto-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Studies on the effects of proinflammatory cytokines on the heart suggest that they play some roles in the pathogenesis of congestive heart failure (CHF). To determine the involvement of proinflammatory cytokine in cardiac hypertrophy and CHF induced by mechanical overload, we investigated the expression of interleukin (IL)-1ß and monocyte chemotactic and activating factor (MCAF)/monocyte chemoattractant protein-1 (MCP-1) in the left ventricle (LV) of Dahl salt-sensitive (DS) rats that showed hypertrophy of the LV induced by hypertension and subsequently developed CHF. The IL-1ß mRNA content in the LV of DS rats increased 3.9-fold when LV hypertrophy developed, and the increase reached 6.2-fold at the CHF stage compared with that of age-matched Dahl salt-resistant (DR) rats. The amount of IL-1ß in the LV was positively correlated with the LV weight/body weight ratio. Most of the IL-1ß immunoreactivity was localized in the endothelial cells and interstitial macrophages. The mRNA levels of MCAF in the LV increased 3.6-fold at 11 weeks and reached 4.8-fold at the CHF stage relative to the age-matched DR rats. MCAF protein was localized to the endothelial cells and interstitial macrophages. In DS rats, the number of interstitial macrophages increased diffusely throughout the LV. We suggest that increased chemokine expression, macrophage infiltration, and proinflammatory cytokine expression play some role in the pathogenesis of cardiac hypertrophy and failure induced by chronic mechanical overload.


Key Words: congestive heart failure • hypertension • cytokine • chemokine • macrophage


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Congestive heart failure has evolved into the most important public health problem in cardiovascular medicine. Angiotensin-converting enzyme inhibitors improve the survival of patients with CHF.1 Studies in animal models of heart failure indicate that the effects of the converting enzyme inhibitors on the local renin-angiotensin system in the failing myocardium itself are important.2 Locally produced endothelin plays a deleterious role in experimental CHF.3 These findings suggest that analysis of local regulatory factors in the failing myocardium would clarify the pathogenesis of CHF.

The effects of some cytokines, which act in an autocrine or paracrine manner, on the heart have been extensively studied. Proinflammatory cytokines, such as IL-1ß and TNF-{alpha}, have a negative inotropic effect on the perfused heart or cultured myocytes via NO-dependent or -independent mechanisms.4 5 IL-1ß induces hypertrophy of cultured myocytes associated with the induction of fetal genes.6 These proinflammatory cytokines are thought to be involved in the pathogenesis of myocarditis, cardiac allograft rejection, some DCM, and ischemic heart disease.3 7 8 9 10 However, the involvement of proinflammatory cytokines in cardiac hypertrophy and CHF induced by mechanical overload, such as hypertension, remains unclear.

Despite numerous studies on cardiac hypertrophy and CHF, the precise mechanisms of CHF induced by mechanical overload are not fully understood.11 Analysis of the mechanism of transition from compensated hypertrophy to failure is considered especially important.12 To address these issues, we developed a rat model of CHF using DS rats.13 In this model, DS rats fed a high-salt diet develop hypertension, and concentric LV hypertrophy appears at 11 weeks. In DS rats with LV hypertrophy, signs of CHF and systemic neurohumoral activation do not appear.14 Subsequently, at 15 to 20 weeks (mean, 18 weeks), DS rats show labored respiration and die from pulmonary congestion. In DS rats with CHF, marked dilatation and global hypokinesis of the LV are evident by echocardiographic examination, and their plasma norepinephrine concentration is increased.14

To investigate the possible roles of proinflammatory cytokines in cardiac hypertrophy and CHF induced by mechanical overload, we examined the expression of IL-1ß, a representative proinflammatory cytokine, in the hearts of DS and control (DR) rats. We also investigated the expression of MCAF/MCP-1, which is an important chemotactic factor for macrophages,15 because macrophages are one of the important sources of IL-1ß.16


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals
Male inbred DS and DR rats, which were originally obtained from Brookhaven National Laboratories, Upton, NY, were bred and supplied by Eisai Co, Ltd, Tokyo, Japan. After they were weaned, the rats were fed a diet containing 0.3% NaCl until the age of 6 weeks, when they were fed a diet containing 8% NaCl. The rats were weighed (BW), systolic blood pressure was measured, and transthoracic echocardiography was performed on the day before the rats were killed as described.13 DS rats with CHF were killed when signs of CHF, such as labored respiration, and LV diffuse hypokinesis on echocardiography appeared. Six-week-old DS and DR rats, 11-week-old DS and DR rats, DS rats with CHF (mean age, 18 weeks), and 18-week-old DR rats were studied. Each group consisted of five animals.

We used DR rats fed a high-salt diet rather than DS rats fed a low-salt diet as controls for DS rats fed a high-salt diet, because salt loading itself has a significant influence on hypertrophy and gene expression of the heart.17 18

Northern Hybridization
Total RNA was isolated from rat hearts using guanidinium thiocyanate/phenol/chloroform/isoamylalcohol. Poly-A RNA was prepared using oligotex-dT (Dupont). Poly-A RNA (2 µg) was Northern-hybridized with the following cDNA probes as described.19 Human GAPDH cDNA was purchased from the American Type Culture Collection. The PCR product of rat IL-1ß and MCAF were cloned into the EcoRV site of pBluescript (Stratagene). The DNA sequence was confirmed by dideoxy-chain termination. A sense primer (A) and an antisense primer (B) for rat IL-1ß20 and MCAF21 were synthesized using the published cDNA sequences. The actual sequences of the oligonucleotides were as follows: rat IL-1ß A, 5'ATGGCAACTGTCCCTGAACTCAACT3'; rat IL-1ß B, 5'CAGGACAGGTATAGATTCAACCCCTT3'; rat MCAF A, 5'CGGAATTCCGAACTCTCACTGAAGCCAGATCTCT3'; and rat MCAF B, 5'CCAAGCTTGGAGGTGAGTGGGGCAT TAACTGCAT3.

The blots were analyzed with a FUJIX bioimaging analyzer BAS 2000.

Quantitative RT-PCR
We measured IL-1ß mRNA by quantitative RT-PCR because the intensity of signals for IL-1ß was not sufficient for quantitative analysis by Northern hybridization.

First-strand cDNA was synthesized as described.22 A constant amount of cDNA was amplified by PCR with a serially diluted nonhomologous DNA fragment containing primer template sequences as an internal control23 according to the instructions supplied (PCR MIMIC construction kit, Clontech). To determine the exact amount of the target mRNA species, the internal control was diluted 2-fold. The primers used in the quantitative PCR for rat IL-1ß were the same as those used to clone cDNA probes. A sense primer (A) and an antisense primer (B) for rat GAPDH24 were synthesized using the published cDNA sequences. The sequences of the oligonucleotides were as follows: GAPDH A, 5'TTCTTGTGCAGTGCCAGCCTCGTC3'; GAPDH B, 5'TAGGAACACGGAAGGCCATGCCAG3'. The primers were designed to cross introns to avoid confusion between mRNA and genomic DNA. Each PCR reaction contained 200 µmol/L of each dNTP, 0.4 µmol/L of each specific primer, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.001% gelatin, and 0.25 U Taq polymerase (Cetus) in a volume of 25 µL. An aliquot of [{alpha}-32P]dCTP was included in the PCR reaction. Each cycle consisted of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 90 s. IL-1ß was amplified by 30 cycles of PCR, and GAPDH was amplified by 21 cycles under the conditions in which linearity of the amplification was confirmed. A portion of the PCR reaction product was then resolved by electrophoresis on a 4% polyacrylamide gel and examined using a bioimaging analyzer (BAS 2000, FUJIX). The molar ratio between the internal control and target was calculated according to the following formula: target/internal control=(IT/IC)x(CC/CT), where IT and IC represent the intensity of the PCR product from the target and the internal control, respectively, and CC and CT represent the dCTP content in the PCR product from the target and the internal control, respectively. The amount of target molecule was determined as the point of an equal molar ratio between the internal control and the target (Fig 1Down). The amounts of IL-1ß were divided by the amounts of GAPDH to correct the efficiency of cDNA synthesis.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. Representative quantitative PCR analysis (top) of IL-1ß mRNA using internal controls. A constant amount of cDNA was amplified with 2-fold serial dilutions of internal controls. The amount of target molecule was determined as the point of an equal molar ratio between the internal control and the target. There was a good correlation (bottom) between the amount of internal control and the target/internal control ratio (r=.999, P<.0001).

Histopathology
Heart sections were fixed in 10% formalin, embedded in paraffin, and stained with Masson's trichrome.

Immunohistochemistry
Heart sections were embedded in O.C.T. compound tissue medium (Miles Inc), snap-frozen on dry ice, and stored at -70°C. Tissues were sectioned on a cryostat at 6 µm and then fixed for 10 minutes in 4% paraformaldehyde (for IL-1ß and macrophages) or acetone (for MCAF) at 4°C. The following primary antibodies were applied: hamster monoclonal anti-mouse IL-1ß (Genzyme) at a concentration of 50 µg/mL, rabbit polyclonal anti-human MCAF25 (gift from R.M. Strieter, University of Michigan) diluted 1:1000, and mouse monoclonal anti-rat macrophage (clone Ki-M2R, BMA) diluted 1:50. The sections were incubated with primary antibodies at 4°C overnight. Biotinylated goat anti-hamster IgG (Cedarlane) diluted 1:100, biotinylated goat anti-rabbit IgG (DAKO) diluted 1:300, and biotinylated goat anti-mouse IgG (DAKO) diluted 1:300 were the secondary antibodies. Sections were incubated with secondary antibodies at room temperature for 30 minutes. After an incubation with avidin/biotin/horseradish peroxidase complex (Vector Labs), peroxidase was visualized using DAB, followed by DAB enhancing solution (Vector Labs). The sections were counterstained with methyl green. Omitting the primary antibody and blocking anti-mouse IL-1ß with recombinant rat IL-1ß (provided by Otsuka Pharmaceutical Co) were controls for the immunohistochemical analysis of IL-1ß. The primary antibody was omitted as a control for the immunohistochemical analysis of MCAF and macrophages.

The number of interstitial macrophages was determined by counting cells positively stained with anti-rat macrophage antibody in 0.25x0.25-mm portions of five separate high-power fields (x320). The perivascular area was not included. The results are expressed as the number of cells/mm2.

Statistics
The results are expressed as mean±SEM. Comparisons between two groups were performed by Student's t test. Relationships between two variables were tested by linear regression analysis. The results were considered statistically significant at P<.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Blood Pressure, BW, and LV Weight
In DS rats fed a high-salt diet, the systolic blood pressure was higher than that in age-matched (11-week-old) DR rats (TableDown). The systolic blood pressure of DS rats with CHF was significantly lower than that of 11-week-old DS rats. The LV weight/BW ratio of the DS rats was 2.0-fold higher at 11 weeks and 2.2-fold higher at the CHF stage than that of the age-matched DR rats.


View this table:
[in this window]
[in a new window]
 
Table 1. Blood Pressure, BW, Heart Weight and Echocardiographic Parameters in DS and DR Rats at Three Stages

Echocardiographic Data
We serially assessed the cardiac function of DS and DR rats by echocardiography (TableUp). At 11 weeks, the posterior wall thickness in the DS rats was greater than that of the age-matched DR rats. The LV end-diastolic diameter in the DS rats was smaller than that in the age-matched DR rats. These findings indicated that LV concentric hypertrophy was established in the DS rats at this stage. The end-diastolic diameter in the DS rats with CHF was much greater than that in the age-matched DR rats, whereas the fractional shortening was reduced, indicating reduced LV wall motion in the DS rats with CHF. The posterior wall thickness in these rats was decreased compared with that in the DS rats at 11 weeks.

Histopathology
Hypertrophy of myocytes and increased interstitial fibrosis were observed in the LV heart tissue from 11-week-old DS rats and DS rats with CHF compared with DR rats (Fig 2Down). No massive regional necrosis was observed in the LV myocardium from DS rats.



View larger version (154K):
[in this window]
[in a new window]
 
Figure 2. Left ventricular tissue of 18-week-old DR rats (a ) and DS rats with CHF (b) stained with Masson's trichrome. In DS rats, myocardial hypertrophy and interstitial fibrosis were observed. Original magnification x80.

IL-1ß Expression in LV Myocardium
Northern hybridization showed that IL-1ß mRNA expression increased in the LV of 11-week-old DS rats and DS rats with CHF compared with age-matched DR rats (Fig 3Down).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Representative results of Northern hybridization to identify IL-1ß mRNA and MCAF mRNA in the LV of DS and DR rats at three stages. GAPDH mRNA was used as a control.

We measured IL-1ß mRNA by quantitative RT-PCR because the intensity of signals by Northern hybridization was not sufficient for quantitative analysis. The IL-1ß mRNA expression increased 3.9-fold at 11 weeks and reached 6.2-fold at the CHF stage, relative to the age-matched DR rats (Fig 4Down). The amount of IL-1ß mRNA correlated with the LV weight/BW ratio in DS and DR rats at all stages (r=.829, P<.0001, n=30).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Results of quantitative RT-PCR analysis of the IL-1ß mRNA in the LV of DS and DR rats. The IL-1ß mRNA content in the hearts of DS rats at 11 weeks was increased 3.9-fold relative to that of age-matched DR rats, and the increase reached 6.2-fold at the CHF stage. The vertical axis denotes the amount of IL-1ß mRNA normalized to that of GAPDH mRNA. The results are expressed as mean±SEM. *P<.05 vs age-matched DR rats.

We localized IL-1ß protein within the heart tissue by immunohistochemical means. The hearts were almost completely negative for IL-1ß immunoreactivity in the DR rats at all stages and in the 6-week-old DS rats. In the LV heart tissue from 11-week-old DS rats and DS rats with CHF, the endothelial cells of the arterioles were positive for IL-1ß immunoreactivity (Fig 5aDown). Some cells in the adventitia were also positive for IL-1ß, and these cells were macrophages (Fig 5aDown and 5cDown). In addition, many interstitial cells were positive for IL-1ß in the myocardium of 11-week-old DS rats and the DS rats with CHF (Fig 5bDown and 5cDown). Many of the interstitial cells positive for IL-1ß were macrophages (Fig 5cDown).



View larger version (119K):
[in this window]
[in a new window]
 
Figure 5. a, In the LV heart tissue from 11-week-old DS rats and DS rats with CHF, the intima (arrow) and some of the adventitial cells (arrowhead) of the arterioles were positive for IL-1ß immunoreactivity. Original magnification x400. b, In 11-week-old DS rats and DS rats with CHF, the interstitial cells (arrow) between cardiac myocytes were positive for IL-1ß. Original magnification x800. c, Serial sections of heart tissue stained with antibodies to macrophages (c1) or to IL-1ß (c2) are shown. The interstitial cells (arrows) and perivascular cells (open arrows) positive for IL-1ß were predominantly macrophages. Endothelial cells were also positive for IL-1ß (arrowheads). Original magnification x220. d, MCAF protein was localized in the endothelial cells (arrows). Original magnification x400. e, Interstitial cells (arrow) were also positive for MCAF. Original magnification x400. f, Serial sections of heart tissue stained with antibodies to macrophages (f1) or to MCAF (f2) are shown. The interstitial cells (arrows) positive for MCAF were predominantly macrophages. Original magnification x220. g, The number of macrophages was increased in the hearts of 11-week-old DS rats and DS rats with CHF (g2) compared with age-matched DR rats (g1). The excess macrophages were diffused throughout the myocardium. Original magnification x20. h, Interstitial macrophages (arrows) in the LV tissue of DS rats are shown. Original magnification x220.

MCAF Expression in LV Myocardium
Northern hybridization showed that the MCAF mRNA expression increased 3.6-fold at 11 weeks and reached 4.8-fold at the CHF stage, relative to the age-matched DR rats (Fig 3Up and 6Down).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 6. Results of Northern hybridization analysis of the MCAF mRNA in the LV of DS and DR rats. The MCAF mRNA content was increased 3.6-fold in the hearts of DS rats at 11 weeks and 4.8-fold at the CHF stage relative to that of age-matched DR rats. The vertical axis denotes the amount of MCAF mRNA normalized to that of GAPDH mRNA. The results are expressed as mean±SEM. *P<.05 vs age-matched DR rats; {dagger}P<.05 vs 11-week-old rats of the same strain.

The hearts were almost negative for MCAF immunoreactivity in the DR rats at all stages and in the 6-week-old DS rats. In the LV heart tissue from 11-week-old DS rats and DS rats with CHF, the endothelial cells (Fig 5dUp) and interstitial cells (Fig 5eUp) were positive for MCAF immunoreactivity. Most of the interstitial cells were macrophages (Fig 5fUp).

Quantitative Estimation of Number of Macrophages in LV Myocardium
The number of macrophages in the perivascular regions increased. In addition, diffuse increase of interstitial macrophages between myocytes was also observed (Fig 5gUp and 5hUp). The number of macrophages in the myocardium of the LV in the 11-week-old DS rats was increased 4.2-fold relative to that in the age-matched DR rats, and that in the DS rats with CHF was also increased 4.2-fold relative to that in the age-matched DR rats (Fig 7Down).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 7. Number of interstitial macrophages in the LV myocardium of DS and DR rats at three stages. The number of macrophages in the myocardium of the 11-week-old DS rats was increased 4.2-fold relative to that in the age-matched DR rats. The number of macrophages in the DS rats with CHF was also increased 4.2-fold relative to that in age-matched DR rats. The results are expressed as mean numbers of cells/mm2 (±SEM); n indicates number of animals. *P<.05 vs age-matched DR rats.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrated that the expression of IL-1ß, a representative proinflammatory cytokine, was increased in the hypertrophied heart and that the expression became more pronounced when CHF developed. The expression of MCAF, a potent chemotactic factor for macrophages, was also increased. The number of interstitial macrophages was increased, and IL-1ß protein was localized predominantly in those macrophages.

The number of macrophages has been reported to be increased in some animal models of hypertension,26 27 which agrees with our results. In addition to the findings of previous studies, we showed that the expression of MCAF, a potent chemotactic factor for macrophages, increased and that infiltrating macrophages were associated with the expression of IL-1ß, a representative proinflammatory cytokine known to have several direct effects on cardiac myocytes, in the hypertrophied LV myocardium from rats that developed CHF.

An increased number of macrophages in the hearts of patients with DCM and CHF has been demonstrated.28 Electron microscopic analysis has revealed that macrophages in the hearts of patients with end-stage DCM are activated.29 Enhanced expression of the major histocompatibility complex has been reported in macrophages in the hearts of patients with valvular heart disease and in the hearts of patients with DCM,30 suggesting that mechanical overload induces proinflammatory responses in the human heart.

The hearts of 6-week-old DS rats and DR rats at all stages were also negative for IL-1ß immunoreactivity in the presence of IL-1ß mRNA. This might be explained by the fact that expression of proinflammatory cytokines is regulated at the posttranscriptional level as well as at the transcriptional level31 32 or by the difference of the sensitivity of the methods used.

Expression of TNF-{alpha} immunoreactivity has been demonstrated in cardiac myocytes in the hearts of patients with end-stage DCM.8 10 In the present study, increased IL-1ß mRNA levels and immunoreactivity correlated with an increase in the number of interstitial macrophages, and they were localized to endothelial cells and interstitial cells, including macrophages. Various cellular sources of TNF-{alpha} in the myocardium have been described. These include cardiac myocytes33 and microvascular endothelial cells9 in the rat model of sepsis and vascular endothelial and smooth muscle cells in the hearts of patients with DCM.10 We examined the expression of IL-1ß and TNF-{alpha} in the hearts of mice with viral myocarditis and found that macrophages, lymphocytes, endothelial cells, and fibroblasts, but not myocytes, were positive for IL-1ß or TNF-{alpha}.22

MCAF is a chemotactic factor for macrophages and belongs to the chemokine family. MCAF is produced by a variety of tissue and cells, including endothelial cells and macrophages.15 MCAF mRNA is induced by IL-1 or hypoxia in cultured myocytes.34 MCAF enhances intracellular adhesion molecule-1 in cultured myocytes, which might also recruit macrophages.34 Our in vivo observation showed that MCAF protein was localized in interstitial macrophages and endothelial cells in this model. However, we cannot exclude the possibility that the antibody used in the present study was unable to detect the lower expression in the myocytes.

The expression of IL-1ß and MCAF increased in the hearts of DS rats at 11 weeks, when systemic neurohumoral activation is not evident,14 suggesting that the increased IL-1ß and MCAF expression in the myocardium was triggered by local factors. We have not elucidated the initial signal for the chemokine expression, macrophage infiltration, or proinflammatory cytokine expression seen in this model. One possibility is that the signaling involves the tissue renin-angiotensin system, which is activated in the hypertrophied heart,35 because angiotensin II activates macrophages.36 37

Myocytolytic necrosis may also be one of the causative factors of abnormal cytokine expression. However, at least part of the initial increase of IL-1ß and MCAF is not likely to be a secondary reaction to tissue injury that has caused heart failure. First, both of the cytokines are increased at the age of 11 weeks, when wall motion of the LV was not decreased. Second, LV weight progressively increased in the hypertrophied and failing hearts of DS rats, with a small increase in the percent area of fibrosis in the previous histological study (at most, 2%), suggesting that massive loss of myocytes is not likely to occur.13 In addition, macrophages are reported to increase in the heart of spontaneously hypertensive rats at the age of 2 months, when no apparent cellular necrosis is seen.27

In addition to necrosis, myocyte loss from apoptosis has recently been recognized as a potentially important pathogenetic mechanism in CHF.38 Using electrophoresis of extracted DNA, in situ terminal deoxynucleotidyl transferase assay, and bisbenzimide staining (T. Yamada, A. Matsumori, W. Wang, N. Ohashi, K. Shiota, S. Sasayama, unpublished data, 1997), we found apoptosis of infiltrating mononuclear cells in the hearts of mice with viral myocarditis. However, we could not detect apoptosis in the LV tissue of DS rats with CHF when we used the same assay methods (authors' unpublished data, 1997). Apoptosis has been previously detected in the hearts of spontaneously hypertensive rats.39 In another study, apoptosis was observed the first week after aortic stenosis but not at 30 days.40 These reports suggest that apoptosis of cardiac myocytes is induced by different mechanisms under different experimental conditions. Interstitial fibrosis was observed in the LV of DS rats as shown in Fig 2Up. However, it is currently not known whether interstitial fibrosis can occur independent of necrotic and apoptotic myocyte death.38

Although we have shown an interesting correlation between increased cytokine expression and the development of cardiac hypertrophy and failure, we have not defined the cause-result relationship. IL-1ß may augment the development of CHF in DS rats, since IL-1ß has a negative inotropic effect4 and suppresses the Ca2+ current.41 Although it is difficult to attribute decreased wall motion to IL-1ß alone in light of increased IL-1ß expression in the compensatory hypertrophied hearts, persistently enhanced IL-1ß and MCAF expression might negatively affect cardiac function because they have deleterious effects on myocyte metabolism42 and promote fibrosis,38 43 in addition to a negative inotropic effect. Chronic treatment with cytokine modulators, such as IL-1 antagonist,44 will clarify the role of IL-1ß in the pathogenesis of CHF.

Several factors have been suggested to play roles in the transition from compensated hypertrophy to a decompensated stage. These include abnormalities in calcium handling,45 contractile proteins,46 and extracellular matrix.46 However, the exact cause of transition to CHF still remains unclear and may be a result of a combination of many factors. A growing body of data suggests that myocyte hypertrophy and myocyte function are modulated not only by loading conditions but also by systemic or local neurohumoral processes.2 The cardiac renin-angiotensin system is activated in the pressure-overloaded heart35 47 and has been shown to play a deleterious role in the transition toward CHF.48 Oxidative stress, which is induced by proinflammatory cytokines,49 is also involved in this process.50 In addition, proinflammatory cytokines induce endothelin,51 which is increased in the pressure-overloaded heart52 53 and plays a deleterious role in experimental CHF.3 This increased expression of chemokines and proinflammatory cytokines may play, in conjunction with other humoral factors, a role in the development of cardiac hypertrophy and failure.

We chose the DS rat as a model of cardiac hypertrophy and CHF induced by pressure overload. Experiments to examine the expression of proinflammatory cytokines in a rat model of heart failure due to myocardial infarction are in progress in our laboratory to confirm that the observations made in the present study are not confined to DS rats.


*    Selected Abbreviations and Acronyms
 
BW = body weight
CHF = congestive heart failure
DAB = 3',3'-diaminobenzidine
DCM = dilated cardiomyopathy
DR = Dahl salt-resistant
DS = Dahl salt-sensitive
IL = interleukin
LV = left ventricle (ventricular)
MCAF = monocyte chemotactic and activating factor
MCP-1 = monocyte chemoattractant protein-1
PCR = polymerase chain reaction
RT-PCR = reverse-transcriptase PCR
TNF = tumor necrosis factor


*    Acknowledgments
 
This study was supported by a research grant from the Japanese Ministry of Health and Welfare and a Grant-in-Aid for General Scientific Research from the Japanese Ministry of Education, Science, and Culture. We thank R.M. Strieter for anti-MCAF antibody and Otsuka Pharmaceutical Co for recombinant rat IL-1ß.

Received February 4, 1997; accepted August 6, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. The CONSENSUS Trial Study Group. Effects of enalapril on mortality in severe congestive heart failure: results of the Cooperative North Scandinavian Enalapril Survival Study (CONSENSUS). N Engl J Med. 1987;316:1429-1435.[Abstract]

2. Dzau VJ. Tissue renin-angiotensin system in myocardial hypertrophy and failure. Arch Intern Med. 1993;153:937-942.[Abstract/Free Full Text]

3. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita Y. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353-355.[Medline] [Order article via Infotrieve]

4. Balligand JL, Ungureanu-Longrois D, Simmons WW, Pimental D, Malinski TA, Kapturczak M, Taha Z, Lowenstein CJ, Davidoff AJ, Kelly RA, Smith TW, Michel T. Cytokine-inducible nitric oxide synthase (iNOS) expression in cardiac myocytes: characterization and regulation of iNOS expression and detection of iNOS activity in single cardiac myocytes in vitro. J Biol Chem. 1994;269:27580-27588.[Abstract/Free Full Text]

5. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:2303-2312.

6. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1 beta modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest. 1995;96:1093-1099.

7. Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J. 1994;72:561-566.[Abstract/Free Full Text]

8. Torre Amione G, Kapadia S, Lee J, Durand J-B, Bies RD, Young JB, Mann DL. Tumor necrosis factor-{alpha} and tumor necrosis factor receptors in the failing human heart. Circulation. 1996;93:704-711.[Abstract/Free Full Text]

9. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419-428.[Abstract]

10. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, Polak JM. Tumor necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151-1155.[Medline] [Order article via Infotrieve]

11. Katz AM. The cardiomyopathy of overload: an unnatural growth response in the hypertrophied heart. Ann Intern Med. 1994;121:363-371.[Abstract/Free Full Text]

12. Lenfant C. Report of the Task Force on Research in Heart Failure. Circulation. 1994;90:1118-1123. News.[Free Full Text]

13. Inoko M, Kihara Y, Morii I, Fujiwara H, Sasayama S. Transition from compensatory hypertrophy to dilated, failing left ventricles in Dahl salt-sensitive rats. Am J Physiol. 1994;267:H2471-H2482.[Abstract/Free Full Text]

14. Inoko M, Kihara Y, Sasayama S. Neurohumoral factors during transition from left ventricular hypertrophy to failure in Dahl salt-sensitive rats. Biochem Biophys Res Commun. 1995;206:814-820.[Medline] [Order article via Infotrieve]

15. Leonard EJ, Yoshimura T. Human monocyte chemoattractant protein-1 (MCP-1). Immunol Today. 1990;11:97-101.[Medline] [Order article via Infotrieve]

16. Arai KI, Lee F, Miyajima A, Miyatake S, Arai N, Yokota T. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783-836.[Medline] [Order article via Infotrieve]

17. Lindpaintner K, Sen S. Role of sodium in hypertensive cardiac hypertrophy. Circ Res. 1985;57:610-617.[Abstract/Free Full Text]

18. Sen S, Young D. Effect of sodium deprivation on cardiac hypertrophy in spontaneously hypertensive rats: influence of aging. J Mol Cell Cardiol. 1991;23:695-704.[Medline] [Order article via Infotrieve]

19. Suzuki H, Matsumori A, Matoba Y, Kyu BS, Tanaka A, Fujita J, Sasayama S. Enhanced expression of superoxide dismutase messenger RNA in viral myocarditis: an SH-dependent reduction of its expression and myocardial injury. J Clin Invest. 1993;91:2727-2733.

20. Feeser W, Freimark BD. Nucleotide sequence of rat pro-interleukin-1 beta mRNA. GenBank database; 1992.

21. Yoshimura T, Takeya M, Takahashi K. Molecular cloning of rat monocyte chemoattractant protein-1 (MCP-1) and its expression in rat spleen cells and tumor cell lines. Biochem Biophys Res Commun. 1991;174:504-509.[Medline] [Order article via Infotrieve]

22. Shioi T, Matsumori A, Sasayama S. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation. 1996;94:2930-2937.[Abstract/Free Full Text]

23. Nadeau KC, Azuma H, Tilney NL. Sequential cytokine dynamics in chronic rejection of rat renal allografts: roles for cytokines RANTES and MCP-1. Proc Natl Acad Sci U S A. 1995;92:8729-8733.[Abstract/Free Full Text]

24. Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res. 1985;13:1431-1442.[Abstract/Free Full Text]

25. Koch AE, Kunkel SL, Pearce WH, Shah MR, Parikh D, Evanoff HL, Haines GK, Burdick MD, Strieter RM. Enhanced production of the chemotactic cytokines interleukin-8 and monocyte chemoattractant protein-1 in human abdominal aortic aneurysms. Am J Pathol. 1993;142:1423-1431.[Abstract]

26. Haller H, Behrend M, Park JK, Schaberg T, Luft FC, Distler A. Monocyte infiltration and c-fms expression in hearts of spontaneously hypertensive rats. Hypertension. 1995;25:132-138.[Abstract/Free Full Text]

27. Hinglais N, Heudes D, Nicoletti A, Mandet C, Laurent M, Bariety J, Michel JB. Colocalization of myocardial fibrosis and inflammatory cells in rats. Lab Invest. 1994;70:286-294.[Medline] [Order article via Infotrieve]

28. Holzinger C, Schollhammer A, Imhof M, Reinwald C, Kramer G, Zuckermann A, Wolner E, Steiner G. Phenotypic patterns of mononuclear cells in dilated cardiomyopathy. Circulation. 1995;92:2876-2885.[Abstract/Free Full Text]

29. Schaper J, Speiser B. The extracellular matrix in the failing human heart. Basic Res Cardiol. 1992;87(suppl 1):303-309.

30. Caforio AL, Stewart JT, Bonifacio E, Burke M, Davies MJ, McKenna WJ, Bottazzo GF. Inappropriate major histocompatibility complex expression on cardiac tissue in dilated cardiomyopathy: relevance for autoimmunity? J Autoimmun. 1990;3:187-200.[Medline] [Order article via Infotrieve]

31. Han J, Thompson P, Beutler B. Dexamethasone and pentoxifylline inhibit endotoxin-induced cachectin/tumor necrosis factor synthesis at separate points in the signaling pathway. J Exp Med. 1990;172:391-394.[Abstract/Free Full Text]

32. Schindler R, Clark BD, Dinarello CA. Dissociation between interleukin-1 beta mRNA and protein synthesis in human peripheral blood mononuclear cells. J Biol Chem. 1990;265:10232-10237.[Abstract/Free Full Text]

33. Kapadia S, Lee J, Torre Amione G, Birdsall HH, Ma TS, Mann DL. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042-1052.

34. Ban K, Ikeda U, Takahashi M, Kanbe T, Kasahara T, Shimada K. Expression of intercellular adhesion molecule-1 on rat cardiac myocytes by monocyte chemoattractant protein-1. Cardiovasc Res. 1994;28:1258-1262.[Abstract/Free Full Text]

35. Baker KM, Chernin MI, Wixson SK, Aceto JF. Renin-angiotensin system involvement in pressure-overload cardiac hypertrophy in rats. Am J Physiol. 1990;259:H324-H332.[Abstract/Free Full Text]

36. Hahn AW, Jonas U, Buhler FR, Resink TJ. Activation of human peripheral monocytes by angiotensin II. FEBS Lett. 1994;347:178-180.[Medline] [Order article via Infotrieve]

37. Foris G, Dezso B, Medgyesi GA, Fust G. Effect of angiotensin II on macrophage functions. Immunology. 1983;48:529-535.[Medline] [Order article via Infotrieve]

38. Zhang Y, Lee TC, Guillemin B, Yu MC, Rom WN. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J Immunol. 1993;150:4188-4196.[Abstract]

39. Hamet P, Richard L, Dam TV, Teiger E, Orlov SN, Gaboury L, Gossard F, Tremblay J. Apoptosis in target organs of hypertension. Hypertension. 1995;26:642-648.[Abstract/Free Full Text]

40. Teiger E, Dam TV, Richard L, Wisnewsky C, Tea BS, Baboury L, Tremblay J, Schwartz K, Hamet P. Apoptosis in pressure overload-induced heart hypertrophy in the rat. J Clin Invest. 1995;97:2891-2897.[Medline] [Order article via Infotrieve]

41. Liu S, Schreur KD. G protein-mediated suppression of L-type Ca2+ current by interleukin-1 beta in cultured rat ventricular myocytes. Am J Physiol. 1995;268:C339-C349. Errata: Am J Physiol. 1995;268(pt 1):section C.[Abstract/Free Full Text]

42. Hosenpud JD. The effects of interleukin 1 on myocardial function and metabolism. Clin Immunol Immunopathol. 1993;68:175-180.[Medline] [Order article via Infotrieve]

43. Lloyd CM, Minto AW, Dorf ME, Proudfoot A, Wells TN, Salant DJ. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J Exp Med. 1997;185:1371-1380.[Abstract/Free Full Text]

44. Dinarello CA. Modalities for reducing interleukin 1 activity in disease. Trends Pharmacol Sci. 1993;14:155-159.[Medline] [Order article via Infotrieve]

45. Feldman AM, Weinberg EO, Ray PE, Lorell BH. Selective changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with chronic aortic banding. Circ Res. 1993;73:184-192.[Abstract]

46. Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matrix components. Circ Res. 1994;75:23-32.[Abstract/Free Full Text]

47. Zhang X, Dostal DE, Reiss K, Cheng W, Kajstura J, Li P, Huang H, Sonnenblick EH, Meggs LG, Baker KM, Anversa P. Identification and activation of autocrine renin-angiotensin system in adult ventricular myocytes. Am J Physiol. 1995;269:H1791-H1802.[Abstract/Free Full Text]

48. Litwin SE, Katz SE, Weinberg EO, Lorell BH, Aurigemma GP, Douglas PS. Serial echocardiographic-Doppler assessment of left ventricular geometry and function in rats with pressure-overload hypertrophy: chronic angiotensin-converting enzyme inhibition attenuates the transition to heart failure. Circulation. 1995;91:2642-2654.[Abstract/Free Full Text]

49. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 1991;10:2247-2258.[Medline] [Order article via Infotrieve]

50. Dhalla AK, Hill MF, Singal PK. Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol. 1996;28:506-514.[Abstract]

51. Katabami T, Shimizu M, Okano K, Yano Y, Nemoto K, Ogura M, Tsukamoto T, Suzuki S, Ohira K, Yamada Y, Sekita N, Yoshida A, Someya K. Intracellular signal transduction for interleukin-1 beta-induced endothelin production in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 1992;188:565-570.[Medline] [Order article via Infotrieve]

52. Feron O, Salomone S, Godfraind T. Influence of salt loading on the cardiac and renal preproendothelin-1 mRNA expression in stroke-prone spontaneously hypertensive rats. Biochem Biophys Res Commun. 1995;209:161-166.[Medline] [Order article via Infotrieve]

53. Lariviére R, Deng LY, Day R, Sventek P, Thibault G, Schiffrin EL. Increased endothelin-1 gene expression in the endothelium of coronary arteries and endocardium in the DOCA-salt hypertensive rat. J Mol Cell Cardiol. 1995;27:2123-2131.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J CARDIOVASC PHARMACOL THERHome page
H. R. Zandbergen, U. C. Sharma, S. Gupta, J. W. H. Verjans, S. van den Borne, S. Pokharel, T. van Brakel, A. Duijvestijn, N. van Rooijen, J. G. Maessen, et al.
Macrophage Depletion in Hypertensive Rats Accelerates Development of Cardiomyopathy
Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2009; 14(1): 68 - 75.
[Abstract] [PDF]


Home page
JNMHome page
P. Misra, D. Lebeche, H. Ly, M. Schwarzkopf, G. Diaz, R. J. Hajjar, A. D. Schecter, and J. V. Frangioni
Quantitation of CXCR4 Expression in Myocardial Infarction Using 99mTc-Labeled SDF-1{alpha}
J. Nucl. Med., June 1, 2008; 49(6): 963 - 969.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
E. Westphal, Li Chen, C. Pilowski, S. Koch, H. Ebelt, U. Muller-Werdan, K. Werdan, and H. Loppnow
Endotoxin-activated cultured neonatal rat cardiomyocytes express functional surface-associated interleukin-1{alpha}
Innate Immunity, February 1, 2007; 13(1): 25 - 34.
[Abstract] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. Ohtani, M. Ohta, K. Yamamoto, T. Mano, Y. Sakata, M. Nishio, Y. Takeda, J. Yoshida, T. Miwa, M. Okamoto, et al.
Elevated cardiac tissue level of aldosterone and mineralocorticoid receptor in diastolic heart failure: beneficial effects of mineralocorticoid receptor blocker
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R946 - R954.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Nishikawa, M. Yoshida, M. Kusuhara, N. Ishigami, K. Isoda, K. Miyazaki, and F. Ohsuzu
Left ventricular hypertrophy in mice with a cardiac-specific overexpression of interleukin-1
Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H176 - H183.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
S Enomoto, M Yoshiyama, T Omura, R Matsumoto, T Kusuyama, S Kim, Y Izumi, K Akioka, H Iwao, K Takeuchi, et al.
Effects of eplerenone on transcriptional factors and mRNA expression related to cardiac remodelling after myocardial infarction
Heart, December 1, 2005; 91(12): 1595 - 1600.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Kinoshita, M. Okada, M. Hara, Y. Furukawa, and A. Matsumori
Mast Cell Tryptase in Mast Cell Granules Enhances MCP-1 and Interleukin-8 Production in Human Endothelial Cells
Arterioscler Thromb Vasc Biol, September 1, 2005; 25(9): 1858 - 1863.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M Vanderheyden, W J Paulus, M Voss, P Knuefermann, N Sivasubramanian, D Mann, and G Baumgarten
Myocardial cytokine gene expression is higher in aortic stenosis than in idiopathic dilated cardiomyopathy
Heart, July 1, 2005; 91(7): 926 - 931.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera
Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes
Cardiovasc Res, March 1, 2005; 65(4): 832 - 841.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Giannico, M. Mendez, and M. C. LaPointe
Regulation of the membrane-localized prostaglandin E synthases mPGES-1 and mPGES-2 in cardiac myocytes and fibroblasts
Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H165 - H174.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Sakata, K. Yamamoto, T. Mano, N. Nishikawa, J. Yoshida, M. Hori, T. Miwa, and T. Masuyama
Activation of Matrix Metalloproteinases Precedes Left Ventricular Remodeling in Hypertensive Heart Failure Rats: Its Inhibition as a Primary Effect of Angiotensin-Converting Enzyme Inhibitor
Circulation, May 4, 2004; 109(17): 2143 - 2149.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Yoshida, K. Yamamoto, T. Mano, Y. Sakata, N. Nishikawa, M. Nishio, T. Ohtani, T. Miwa, M. Hori, and T. Masuyama
AT1 Receptor Blocker Added to ACE Inhibitor Provides Benefits at Advanced Stage of Hypertensive Diastolic Heart Failure
Hypertension, March 1, 2004; 43(3): 686 - 691.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Omura, M. Yoshiyama, S. Kim, R. Matsumoto, Y. Nakamura, Y. Izumi, H. Ichijo, T. Sudo, K. Akioka, H. Iwao, et al.
Involvement of Apoptosis Signal-Regulating Kinase-1 on Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression
Arterioscler Thromb Vasc Biol, February 1, 2004; 24(2): 270 - 275.
[Abstract] [Full Text]


Home page
HypertensionHome page
F. Yang, X.-P. Yang, Y.-H. Liu, J. Xu, O. Cingolani, N.-E. Rhaleb, and O. A. Carretero
Ac-SDKP Reverses Inflammation and Fibrosis in Rats With Heart Failure After Myocardial Infarction
Hypertension, February 1, 2004; 43(2): 229 - 236.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Hayashidani, H. Tsutsui, T. Shiomi, M. Ikeuchi, H. Matsusaka, N. Suematsu, J. Wen, K. Egashira, and A. Takeshita
Anti-Monocyte Chemoattractant Protein-1 Gene Therapy Attenuates Left Ventricular Remodeling and Failure After Experimental Myocardial Infarction
Circulation, October 28, 2003; 108(17): 2134 - 2140.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Giannuzzi, P. L. Temporelli, U. Corra, and L. Tavazzi
Antiremodeling Effect of Long-Term Exercise Training in Patients With Stable Chronic Heart Failure: Results of the Exercise in Left Ventricular Dysfunction and Chronic Heart Failure (ELVD-CHF) Trial
Circulation, August 5, 2003; 108(5): 554 - 559.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. Shiomi, H. Tsutsui, M. Ikeuchi, H. Matsusaka, S. Hayashidani, N. Suematsu, J. Wen, T. Kubota, and A. Takeshita
Streptozotocin-induced hyperglycemia exacerbates left ventricular remodeling and failure after experimental myocardial infarction
J. Am. Coll. Cardiol., July 2, 2003; 42(1): 165 - 172.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
C.-Y. Li, C.-S. Tsai, S.-H. Chueh, P.-C. Hsu, J.-Y. Wang, C.-S. Wong, and S.-T. Ho
Dobutamine Inhibits Monocyte Chemoattractant Protein-1 Production and Chemotaxis in Human Monocytes
Anesth. Analg., July 1, 2003; 97(1): 205 - 209.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. S. Vasan, L. M. Sullivan, R. Roubenoff, C. A. Dinarello, T. Harris, E. J. Benjamin, D. B. Sawyer, D. Levy, P. W.F. Wilson, and R. B. D'Agostino
Inflammatory Markers and Risk of Heart Failure in Elderly Subjects Without Prior Myocardial Infarction: The Framingham Heart Study
Circulation, March 25, 2003; 107(11): 1486 - 1491.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Egashira
Molecular Mechanisms Mediating Inflammation in Vascular Disease: Special Reference to Monocyte Chemoattractant Protein-1
Hypertension, March 1, 2003; 41(3): 834 - 841.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Shiomi, H. Tsutsui, S. Hayashidani, N. Suematsu, M. Ikeuchi, J. Wen, M. Ishibashi, T. Kubota, K. Egashira, and A. Takeshita
Pioglitazone, a Peroxisome Proliferator-Activated Receptor-{gamma} Agonist, Attenuates Left Ventricular Remodeling and Failure After Experimental Myocardial Infarction
Circulation, December 10, 2002; 106(24): 3126 - 3132.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Nakamura, K. Egashira, Y. Machida, S. Hayashidani, M. Takeya, H. Utsumi, H. Tsutsui, and A. Takeshita
Probucol Attenuates Left Ventricular Dysfunction and Remodeling in Tachycardia-Induced Heart Failure: Roles of Oxidative Stress and Inflammation
Circulation, July 16, 2002; 106(3): 362 - 367.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
Y. Iwanaga, T. Aoyama, Y. Kihara, Y. Onozawa, T. Yoneda, and S. Sasayama
Excessive activation of matrix metalloproteinases coincides with left ventricular remodeling during transition from hypertrophy to heart failure in hypertensive rats
J. Am. Coll. Cardiol., April 17, 2002; 39(8): 1384 - 1391.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Mendez and M. C. LaPointe
Trophic Effects of the Cyclooxygenase-2 Product Prostaglandin E2 in Cardiac Myocytes
Hypertension, February 1, 2002; 39(2): 382 - 388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Degousee, E. Stefanski, T. F. Lindsay, D. A. Ford, R. Shahani, C. A. Andrews, D. J. Thuerauf, C. C. Glembotski, T. J. Nevalainen, J. Tischfield, et al.
p38 MAPK Regulates Group IIa Phospholipase A2 Expression in Interleukin-1beta -stimulated Rat Neonatal Cardiomyocytes
J. Biol. Chem., November 16, 2001; 276(47): 43842 - 43849.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
S. Adamopoulos, J. T. Parissis, and D. Th. Kremastinos
A glossary of circulating cytokines in chronic heart failure
Eur J Heart Fail, October 1, 2001; 3(5): 517 - 526.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. KIMURA, O. OKADA, N. TANABE, Y. TANAKA, M. TERAI, Y. TAKIGUCHI, M. MASUDA, N. NAKAJIMA, K. HIROSHIMA, H. INADERA, et al.
Plasma Monocyte Chemoattractant Protein-1 and Pulmonary Vascular Resistance in Chronic Thromboembolic Pulmonary Hypertension
Am. J. Respir. Crit. Care Med., July 15, 2001; 164(2): 319 - 324.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Shimoyama, D. Hayashi, Y. Zou, E. Takimoto, M. Mizukami, K. Monzen, S. Kudoh, Y. Hiroi, Y. Yazaki, R. Nagai, et al.
Calcineurin Inhibitor Attenuates the Development and Induces the Regression of Cardiac Hypertrophy in Rats With Salt-Sensitive Hypertension
Circulation, October 17, 2000; 102(16): 1996 - 2004.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. M. Behr, X. Wang, N. Aiyar, R. W. Coatney, X. Li, P. Koster, C. E. Angermann, E. Ohlstein, G. Z. Feuerstein, and J. Winaver
Monocyte Chemoattractant Protein-1 is Upregulated in Rats With Volume-Overload Congestive Heart Failure
Circulation, September 12, 2000; 102(11): 1315 - 1322.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. K. Damas, H. G. Eiken, E. Oie, V. Bjerkeli, A. Yndestad, T. Ueland, T. Tonnessen, O. R. Geiran, H. Aass, S. Simonsen, et al.
Myocardial expression of CC- and CXC-chemokines and their receptors in human end-stage heart failure
Cardiovasc Res, September 1, 2000; 47(4): 778 - 787.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
N. Ishizaka, T. Aizawa, I. Mori, J.-I. Taguchi, Y. Yazaki, R. Nagai, and M. Ohno
Heme oxygenase-1 is upregulated in the rat heart in response to chronic administration of angiotensin II
Am J Physiol Heart Circ Physiol, August 1, 2000; 279(2): H672 - H678.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Y. Aihara, M. Kurabayashi, Y. Saito, Y. Ohyama, T. Tanaka, S.-i. Takeda, K. Tomaru, K.-i. Sekiguchi, M. Arai, T. Nakamura, et al.
Cardiac Ankyrin Repeat Protein Is a Novel Marker of Cardiac Hypertrophy : Role of M-CAT Element Within the Promoter
Hypertension, July 1, 2000; 36(1): 48 - 53.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Sadoshima
Cytokine Actions of Angiotensin II
Circ. Res., June 23, 2000; 86(12): 1187 - 1189.
[Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Siwik, D. L.-F. Chang, and W. S. Colucci
Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} Decrease Collagen Synthesis and Increase Matrix Metalloproteinase Activity in Cardiac Fibroblasts In Vitro
Circ. Res., June 23, 2000; 86(12): 1259 - 1265.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Sasayama, M. Okada, and A. Matsumori
Chemokines and cardiovascular diseases
Cardiovasc Res, January 14, 2000; 45(2): 267 - 269.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. K. Damas, L. Gullestad, T. Ueland, N. O. Solum, S. Simonsen, S. S Froland, and P. Aukrust
CXC-chemokines, a new group of cytokines in congestive heart failure -- possible role of platelets and monocytes
Cardiovasc Res, January 14, 2000; 45(2): 428 - 436.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Sasayama, A. Matsumori, and Y. Kihara
New insights into the pathophysiological role for cytokines in heart failure
Cardiovasc Res, June 1, 1999; 42(3): 557 - 564.
[Full Text] [PDF]


Home page
HypertensionHome page
M. C. LaPointe and E. Isenovic
Interleukin-1ß Regulation of Inducible Nitric Oxide Synthase and Cyclooxygenase-2 Involves the p42/44 and p38 MAPK Signaling Pathways in Cardiac Myocytes
Hypertension, January 1, 1999; 33(1): 276 - 282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Koudssi, J. E. Lopez, S. Villegas, and C. S. Long
Cardiac Fibroblasts Arrest at the G1/S Restriction Point in Response to Interleukin (IL)-1beta . EVIDENCE FOR IL-1beta -INDUCED HYPOPHOSPHORYLATION OF THE RETINOBLASTOMA PROTEIN
J. Biol. Chem., October 2, 1998; 273(40): 25796 - 25803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. C. H. Ng, C. S. Long, and M. A. Bogoyevitch
A Role for the Extracellular Signal-regulated Kinase and p38 Mitogen-activated Protein Kinases in Interleukin-1beta -stimulated Delayed Signal Tranducer and Activator of Transcription 3 Activation, Atrial Natriuretic Factor Expression, and Cardiac Myocyte Morphology
J. Biol. Chem., July 27, 2001; 276(31): 29490 - 29498.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shioi, T.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shioi, T.
Right arrow Articles by Sasayama, S.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Heart Failure