| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Articles |
From the Department of Cardiovascular Medicine (T.S., A.M., Y.K., M.I., K.O., Y.I., T.Y., A.I, S.S.), Kyoto (Japan) University; the Department of Pharmacology (K.M.), Cancer Research Institution, Kanazawa (Japan) University; and the Department of Molecular Preventive Medicine (K.M.), School of Medicine, University of Tokyo (Japan).
Correspondence to Akira Matsumori, MD, PhD, Department of Cardiovascular Medicine, Kyoto University, 54 Kawaracho, Shogoin, Sakyo-ku, Kyoto 606, Japan. E-mail amat{at}kuhp.kyoto-u.ac.jp
| Abstract |
|---|
|
|
|---|
Key Words: congestive heart failure hypertension cytokine chemokine macrophage
| Introduction |
|---|
|
|
|---|
The effects of some cytokines, which act in an autocrine or
paracrine manner, on the heart have been extensively studied.
Proinflammatory cytokines, such as IL-1ß and TNF-
, have a
negative inotropic effect on the perfused heart or cultured myocytes
via NO-dependent or -independent mechanisms.4 5 IL-1ß
induces hypertrophy of cultured myocytes associated with
the induction of fetal genes.6 These proinflammatory
cytokines are thought to be involved in the pathogenesis of
myocarditis, cardiac allograft rejection, some DCM, and
ischemic heart disease.3 7 8 9 10 However, the
involvement of proinflammatory cytokines in cardiac
hypertrophy and CHF induced by mechanical overload, such as
hypertension, remains unclear.
Despite numerous studies on cardiac hypertrophy and CHF, the precise mechanisms of CHF induced by mechanical overload are not fully understood.11 Analysis of the mechanism of transition from compensated hypertrophy to failure is considered especially important.12 To address these issues, we developed a rat model of CHF using DS rats.13 In this model, DS rats fed a high-salt diet develop hypertension, and concentric LV hypertrophy appears at 11 weeks. In DS rats with LV hypertrophy, signs of CHF and systemic neurohumoral activation do not appear.14 Subsequently, at 15 to 20 weeks (mean, 18 weeks), DS rats show labored respiration and die from pulmonary congestion. In DS rats with CHF, marked dilatation and global hypokinesis of the LV are evident by echocardiographic examination, and their plasma norepinephrine concentration is increased.14
To investigate the possible roles of proinflammatory cytokines in cardiac hypertrophy and CHF induced by mechanical overload, we examined the expression of IL-1ß, a representative proinflammatory cytokine, in the hearts of DS and control (DR) rats. We also investigated the expression of MCAF/MCP-1, which is an important chemotactic factor for macrophages,15 because macrophages are one of the important sources of IL-1ß.16
| Materials and Methods |
|---|
|
|
|---|
We used DR rats fed a high-salt diet rather than DS rats fed a low-salt diet as controls for DS rats fed a high-salt diet, because salt loading itself has a significant influence on hypertrophy and gene expression of the heart.17 18
Northern Hybridization
Total RNA was isolated from rat hearts using guanidinium
thiocyanate/phenol/chloroform/isoamylalcohol. Poly-A RNA was
prepared using oligotex-dT (Dupont). Poly-A RNA (2 µg) was
Northern-hybridized with the following cDNA probes as
described.19 Human GAPDH cDNA was purchased from the
American Type Culture Collection. The PCR product of rat IL-1ß
and MCAF were cloned into the EcoRV site of pBluescript
(Stratagene). The DNA sequence was confirmed by dideoxy-chain
termination. A sense primer (A) and an antisense primer (B) for rat
IL-1ß20 and MCAF21 were synthesized using
the published cDNA sequences. The actual sequences of the
oligonucleotides were as follows: rat IL-1ß A,
5'ATGGCAACTGTCCCTGAACTCAACT3'; rat IL-1ß B,
5'CAGGACAGGTATAGATTCAACCCCTT3'; rat MCAF A,
5'CGGAATTCCGAACTCTCACTGAAGCCAGATCTCT3'; and rat MCAF B,
5'CCAAGCTTGGAGGTGAGTGGGGCAT TAACTGCAT3.
The blots were analyzed with a FUJIX bioimaging analyzer BAS 2000.
Quantitative RT-PCR
We measured IL-1ß mRNA by quantitative RT-PCR because the
intensity of signals for IL-1ß was not sufficient for quantitative
analysis by Northern hybridization.
First-strand cDNA was synthesized as described.22 A
constant amount of cDNA was amplified by PCR with a serially diluted
nonhomologous DNA fragment containing primer template sequences as an
internal control23 according to the instructions supplied
(PCR MIMIC construction kit, Clontech). To determine the exact amount
of the target mRNA species, the internal control was diluted 2-fold.
The primers used in the quantitative PCR for rat IL-1ß were the same
as those used to clone cDNA probes. A sense primer (A) and an antisense
primer (B) for rat GAPDH24 were synthesized using the
published cDNA sequences. The sequences of the
oligonucleotides were as follows: GAPDH A,
5'TTCTTGTGCAGTGCCAGCCTCGTC3'; GAPDH B,
5'TAGGAACACGGAAGGCCATGCCAG3'. The primers were designed to cross
introns to avoid confusion between mRNA and genomic DNA. Each PCR
reaction contained 200 µmol/L of each dNTP, 0.4
µmol/L of each specific primer, 10 mmol/L Tris-HCl
(pH 8.3), 50 mmol/L KCl, 1.5 mmol/L
MgCl2, 0.001% gelatin, and 0.25 U Taq polymerase (Cetus)
in a volume of 25 µL. An aliquot of [
-32P]dCTP was
included in the PCR reaction. Each cycle consisted of denaturation at
94°C for 45 s, annealing at 55°C for 45 s, and extension
at 72°C for 90 s. IL-1ß was amplified by 30 cycles of PCR, and
GAPDH was amplified by 21 cycles under the conditions in which
linearity of the amplification was confirmed. A portion of the PCR
reaction product was then resolved by electrophoresis on a 4%
polyacrylamide gel and examined using a bioimaging
analyzer (BAS 2000, FUJIX). The molar ratio between the
internal control and target was calculated according to the following
formula: target/internal
control=(IT/IC)x(CC/CT),
where IT and IC represent the
intensity of the PCR product from the target and the internal
control, respectively, and CC and CT
represent the dCTP content in the PCR product from the
target and the internal control, respectively. The amount of target
molecule was determined as the point of an equal molar ratio between
the internal control and the target (Fig 1
). The amounts of IL-1ß were divided
by the amounts of GAPDH to correct the efficiency of cDNA
synthesis.
|
Histopathology
Heart sections were fixed in 10% formalin, embedded in
paraffin, and stained with Masson's trichrome.
Immunohistochemistry
Heart sections were embedded in O.C.T. compound tissue medium
(Miles Inc), snap-frozen on dry ice, and stored at -70°C. Tissues
were sectioned on a cryostat at 6 µm and then fixed for 10
minutes in 4% paraformaldehyde (for IL-1ß and
macrophages) or acetone (for MCAF) at 4°C. The following
primary antibodies were applied: hamster monoclonal anti-mouse IL-1ß
(Genzyme) at a concentration of 50 µg/mL, rabbit polyclonal
anti-human MCAF25 (gift from R.M. Strieter, University
of Michigan) diluted 1:1000, and mouse monoclonal anti-rat
macrophage (clone Ki-M2R, BMA) diluted 1:50. The sections were
incubated with primary antibodies at 4°C overnight. Biotinylated goat
anti-hamster IgG (Cedarlane) diluted 1:100, biotinylated goat
anti-rabbit IgG (DAKO) diluted 1:300, and biotinylated goat anti-mouse
IgG (DAKO) diluted 1:300 were the secondary antibodies. Sections were
incubated with secondary antibodies at room temperature for 30 minutes.
After an incubation with avidin/biotin/horseradish peroxidase complex
(Vector Labs), peroxidase was visualized using DAB, followed by DAB
enhancing solution (Vector Labs). The sections were counterstained with
methyl green. Omitting the primary antibody and blocking anti-mouse
IL-1ß with recombinant rat IL-1ß (provided by Otsuka Pharmaceutical
Co) were controls for the immunohistochemical analysis of
IL-1ß. The primary antibody was omitted as a control for the
immunohistochemical analysis of MCAF and macrophages.
The number of interstitial macrophages was determined by counting cells positively stained with anti-rat macrophage antibody in 0.25x0.25-mm portions of five separate high-power fields (x320). The perivascular area was not included. The results are expressed as the number of cells/mm2.
Statistics
The results are expressed as mean±SEM. Comparisons between two
groups were performed by Student's t test. Relationships
between two variables were tested by linear regression
analysis. The results were considered statistically significant
at P<.05.
| Results |
|---|
|
|
|---|
|
Echocardiographic Data
We serially assessed the cardiac function of DS and DR rats
by echocardiography (Table
). At 11 weeks, the
posterior wall thickness in the DS rats was greater than that of the
age-matched DR rats. The LV end-diastolic diameter in the
DS rats was smaller than that in the age-matched DR rats. These
findings indicated that LV concentric hypertrophy was
established in the DS rats at this stage. The end-diastolic
diameter in the DS rats with CHF was much greater than that in the
age-matched DR rats, whereas the fractional shortening was reduced,
indicating reduced LV wall motion in the DS rats with CHF. The
posterior wall thickness in these rats was decreased compared with that
in the DS rats at 11 weeks.
Histopathology
Hypertrophy of myocytes and increased
interstitial fibrosis were observed in the LV heart tissue
from 11-week-old DS rats and DS rats with CHF compared with DR rats
(Fig 2
). No massive regional necrosis was
observed in the LV myocardium from DS rats.
|
IL-1ß Expression in LV Myocardium
Northern hybridization showed that IL-1ß mRNA expression
increased in the LV of 11-week-old DS rats and DS rats with CHF
compared with age-matched DR rats (Fig 3
).
|
We measured IL-1ß mRNA by quantitative RT-PCR because the intensity
of signals by Northern hybridization was not sufficient for
quantitative analysis. The IL-1ß mRNA expression increased
3.9-fold at 11 weeks and reached 6.2-fold at the CHF stage, relative to
the age-matched DR rats (Fig 4
). The
amount of IL-1ß mRNA correlated with the LV weight/BW ratio in DS and
DR rats at all stages (r=.829, P<.0001,
n=30).
|
We localized IL-1ß protein within the heart tissue by
immunohistochemical means. The hearts were almost completely negative
for IL-1ß immunoreactivity in the DR rats at all stages and in the
6-week-old DS rats. In the LV heart tissue from 11-week-old DS rats and
DS rats with CHF, the endothelial cells of the
arterioles were positive for IL-1ß immunoreactivity (Fig 5a
). Some cells in the adventitia were
also positive for IL-1ß, and these cells were macrophages
(Fig 5a
and 5c
). In addition, many interstitial cells were
positive for IL-1ß in the myocardium of 11-week-old DS
rats and the DS rats with CHF (Fig 5b
and 5c
). Many of the
interstitial cells positive for IL-1ß were
macrophages (Fig 5c
).
|
MCAF Expression in LV Myocardium
Northern hybridization showed that the MCAF mRNA expression
increased 3.6-fold at 11 weeks and reached 4.8-fold at the CHF stage,
relative to the age-matched DR rats (Fig 3
and 6
).
|
The hearts were almost negative for MCAF immunoreactivity in the DR
rats at all stages and in the 6-week-old DS rats. In the LV heart
tissue from 11-week-old DS rats and DS rats with CHF, the
endothelial cells (Fig 5d
) and interstitial
cells (Fig 5e
) were positive for MCAF immunoreactivity. Most of the
interstitial cells were macrophages (Fig 5f
).
Quantitative Estimation of Number of Macrophages in LV
Myocardium
The number of macrophages in the perivascular regions
increased. In addition, diffuse increase of interstitial
macrophages between myocytes was also observed (Fig 5g
and 5h
).
The number of macrophages in the myocardium of the
LV in the 11-week-old DS rats was increased 4.2-fold relative to that
in the age-matched DR rats, and that in the DS rats with CHF was also
increased 4.2-fold relative to that in the age-matched DR rats (Fig 7
).
|
| Discussion |
|---|
|
|
|---|
The number of macrophages has been reported to be increased in some animal models of hypertension,26 27 which agrees with our results. In addition to the findings of previous studies, we showed that the expression of MCAF, a potent chemotactic factor for macrophages, increased and that infiltrating macrophages were associated with the expression of IL-1ß, a representative proinflammatory cytokine known to have several direct effects on cardiac myocytes, in the hypertrophied LV myocardium from rats that developed CHF.
An increased number of macrophages in the hearts of patients with DCM and CHF has been demonstrated.28 Electron microscopic analysis has revealed that macrophages in the hearts of patients with end-stage DCM are activated.29 Enhanced expression of the major histocompatibility complex has been reported in macrophages in the hearts of patients with valvular heart disease and in the hearts of patients with DCM,30 suggesting that mechanical overload induces proinflammatory responses in the human heart.
The hearts of 6-week-old DS rats and DR rats at all stages were also negative for IL-1ß immunoreactivity in the presence of IL-1ß mRNA. This might be explained by the fact that expression of proinflammatory cytokines is regulated at the posttranscriptional level as well as at the transcriptional level31 32 or by the difference of the sensitivity of the methods used.
Expression of TNF-
immunoreactivity has been demonstrated in cardiac
myocytes in the hearts of patients with end-stage DCM.8 10
In the present study, increased IL-1ß mRNA levels and
immunoreactivity correlated with an increase in the number of
interstitial macrophages, and they were localized
to endothelial cells and interstitial
cells, including macrophages. Various cellular sources of
TNF-
in the myocardium have been described. These
include cardiac myocytes33 and microvascular
endothelial cells9 in the rat model of
sepsis and vascular endothelial and smooth muscle cells
in the hearts of patients with DCM.10 We examined the
expression of IL-1ß and TNF-
in the hearts of mice with viral
myocarditis and found that macrophages, lymphocytes,
endothelial cells, and fibroblasts, but not myocytes,
were positive for IL-1ß or TNF-
.22
MCAF is a chemotactic factor for macrophages and belongs to the chemokine family. MCAF is produced by a variety of tissue and cells, including endothelial cells and macrophages.15 MCAF mRNA is induced by IL-1 or hypoxia in cultured myocytes.34 MCAF enhances intracellular adhesion molecule-1 in cultured myocytes, which might also recruit macrophages.34 Our in vivo observation showed that MCAF protein was localized in interstitial macrophages and endothelial cells in this model. However, we cannot exclude the possibility that the antibody used in the present study was unable to detect the lower expression in the myocytes.
The expression of IL-1ß and MCAF increased in the hearts of DS rats at 11 weeks, when systemic neurohumoral activation is not evident,14 suggesting that the increased IL-1ß and MCAF expression in the myocardium was triggered by local factors. We have not elucidated the initial signal for the chemokine expression, macrophage infiltration, or proinflammatory cytokine expression seen in this model. One possibility is that the signaling involves the tissue renin-angiotensin system, which is activated in the hypertrophied heart,35 because angiotensin II activates macrophages.36 37
Myocytolytic necrosis may also be one of the causative factors of abnormal cytokine expression. However, at least part of the initial increase of IL-1ß and MCAF is not likely to be a secondary reaction to tissue injury that has caused heart failure. First, both of the cytokines are increased at the age of 11 weeks, when wall motion of the LV was not decreased. Second, LV weight progressively increased in the hypertrophied and failing hearts of DS rats, with a small increase in the percent area of fibrosis in the previous histological study (at most, 2%), suggesting that massive loss of myocytes is not likely to occur.13 In addition, macrophages are reported to increase in the heart of spontaneously hypertensive rats at the age of 2 months, when no apparent cellular necrosis is seen.27
In addition to necrosis, myocyte loss from apoptosis has
recently been recognized as a potentially important pathogenetic
mechanism in CHF.38 Using electrophoresis of extracted
DNA, in situ terminal deoxynucleotidyl transferase
assay, and bisbenzimide staining (T. Yamada, A. Matsumori, W. Wang, N.
Ohashi, K. Shiota, S. Sasayama, unpublished data, 1997), we found
apoptosis of infiltrating mononuclear cells in the hearts of
mice with viral myocarditis. However, we could not detect
apoptosis in the LV tissue of DS rats with CHF when we used the
same assay methods (authors' unpublished data, 1997).
Apoptosis has been previously detected in the hearts of
spontaneously hypertensive rats.39 In another study,
apoptosis was observed the first week after aortic
stenosis but not at 30 days.40 These reports
suggest that apoptosis of cardiac myocytes is induced by
different mechanisms under different experimental conditions.
Interstitial fibrosis was observed in the LV of DS rats as
shown in Fig 2
. However, it is currently not known whether
interstitial fibrosis can occur independent of necrotic and
apoptotic myocyte death.38
Although we have shown an interesting correlation between increased cytokine expression and the development of cardiac hypertrophy and failure, we have not defined the cause-result relationship. IL-1ß may augment the development of CHF in DS rats, since IL-1ß has a negative inotropic effect4 and suppresses the Ca2+ current.41 Although it is difficult to attribute decreased wall motion to IL-1ß alone in light of increased IL-1ß expression in the compensatory hypertrophied hearts, persistently enhanced IL-1ß and MCAF expression might negatively affect cardiac function because they have deleterious effects on myocyte metabolism42 and promote fibrosis,38 43 in addition to a negative inotropic effect. Chronic treatment with cytokine modulators, such as IL-1 antagonist,44 will clarify the role of IL-1ß in the pathogenesis of CHF.
Several factors have been suggested to play roles in the transition from compensated hypertrophy to a decompensated stage. These include abnormalities in calcium handling,45 contractile proteins,46 and extracellular matrix.46 However, the exact cause of transition to CHF still remains unclear and may be a result of a combination of many factors. A growing body of data suggests that myocyte hypertrophy and myocyte function are modulated not only by loading conditions but also by systemic or local neurohumoral processes.2 The cardiac renin-angiotensin system is activated in the pressure-overloaded heart35 47 and has been shown to play a deleterious role in the transition toward CHF.48 Oxidative stress, which is induced by proinflammatory cytokines,49 is also involved in this process.50 In addition, proinflammatory cytokines induce endothelin,51 which is increased in the pressure-overloaded heart52 53 and plays a deleterious role in experimental CHF.3 This increased expression of chemokines and proinflammatory cytokines may play, in conjunction with other humoral factors, a role in the development of cardiac hypertrophy and failure.
We chose the DS rat as a model of cardiac hypertrophy and CHF induced by pressure overload. Experiments to examine the expression of proinflammatory cytokines in a rat model of heart failure due to myocardial infarction are in progress in our laboratory to confirm that the observations made in the present study are not confined to DS rats.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received February 4, 1997; accepted August 6, 1997.
| References |
|---|
|
|
|---|
2.
Dzau VJ. Tissue renin-angiotensin
system in myocardial hypertrophy and failure.
Arch Intern Med. 1993;153:937-942.
3. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita Y. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353-355.[Medline] [Order article via Infotrieve]
4.
Balligand JL, Ungureanu-Longrois D, Simmons WW,
Pimental D, Malinski TA, Kapturczak M, Taha Z, Lowenstein CJ, Davidoff
AJ, Kelly RA, Smith TW, Michel T. Cytokine-inducible nitric
oxide synthase (iNOS) expression in cardiac myocytes: characterization
and regulation of iNOS expression and detection of iNOS activity in
single cardiac myocytes in vitro. J Biol Chem. 1994;269:27580-27588.
5. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:2303-2312.
6. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1 beta modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest. 1995;96:1093-1099.
7.
Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama
S. Increased circulating cytokines in patients with
myocarditis and cardiomyopathy. Br
Heart J. 1994;72:561-566.
8.
Torre Amione G, Kapadia S, Lee J, Durand J-B, Bies RD,
Young JB, Mann DL. Tumor necrosis factor-
and tumor necrosis
factor receptors in the failing human heart.
Circulation. 1996;93:704-711.
9. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419-428.[Abstract]
10. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, Polak JM. Tumor necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151-1155.[Medline] [Order article via Infotrieve]
11.
Katz AM. The cardiomyopathy
of overload: an unnatural growth response in the hypertrophied
heart. Ann Intern Med. 1994;121:363-371.
12.
Lenfant C. Report of the Task Force on Research
in Heart Failure. Circulation. 1994;90:1118-1123.
News.
13.
Inoko M, Kihara Y, Morii I, Fujiwara H, Sasayama
S. Transition from compensatory hypertrophy to
dilated, failing left ventricles in Dahl salt-sensitive rats.
Am J Physiol. 1994;267:H2471-H2482.
14. Inoko M, Kihara Y, Sasayama S. Neurohumoral factors during transition from left ventricular hypertrophy to failure in Dahl salt-sensitive rats. Biochem Biophys Res Commun. 1995;206:814-820.[Medline] [Order article via Infotrieve]
15. Leonard EJ, Yoshimura T. Human monocyte chemoattractant protein-1 (MCP-1). Immunol Today. 1990;11:97-101.[Medline] [Order article via Infotrieve]
16. Arai KI, Lee F, Miyajima A, Miyatake S, Arai N, Yokota T. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783-836.[Medline] [Order article via Infotrieve]
17.
Lindpaintner K, Sen S. Role of sodium in
hypertensive cardiac hypertrophy. Circ
Res. 1985;57:610-617.
18. Sen S, Young D. Effect of sodium deprivation on cardiac hypertrophy in spontaneously hypertensive rats: influence of aging. J Mol Cell Cardiol. 1991;23:695-704.[Medline] [Order article via Infotrieve]
19. Suzuki H, Matsumori A, Matoba Y, Kyu BS, Tanaka A, Fujita J, Sasayama S. Enhanced expression of superoxide dismutase messenger RNA in viral myocarditis: an SH-dependent reduction of its expression and myocardial injury. J Clin Invest. 1993;91:2727-2733.
20. Feeser W, Freimark BD. Nucleotide sequence of rat pro-interleukin-1 beta mRNA. GenBank database; 1992.
21. Yoshimura T, Takeya M, Takahashi K. Molecular cloning of rat monocyte chemoattractant protein-1 (MCP-1) and its expression in rat spleen cells and tumor cell lines. Biochem Biophys Res Commun. 1991;174:504-509.[Medline] [Order article via Infotrieve]
22.
Shioi T, Matsumori A, Sasayama S. Persistent
expression of cytokine in the chronic stage of viral
myocarditis in mice. Circulation. 1996;94:2930-2937.
23.
Nadeau KC, Azuma H, Tilney NL. Sequential
cytokine dynamics in chronic rejection of rat renal allografts:
roles for cytokines RANTES and MCP-1. Proc Natl
Acad Sci U S A. 1995;92:8729-8733.
24.
Fort P, Marty L, Piechaczyk M, el Sabrouty S,
Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues
express only one major mRNA species from the
glyceraldehyde-3-phosphate-dehydrogenase multigenic
family. Nucleic Acids Res. 1985;13:1431-1442.
25. Koch AE, Kunkel SL, Pearce WH, Shah MR, Parikh D, Evanoff HL, Haines GK, Burdick MD, Strieter RM. Enhanced production of the chemotactic cytokines interleukin-8 and monocyte chemoattractant protein-1 in human abdominal aortic aneurysms. Am J Pathol. 1993;142:1423-1431.[Abstract]
26.
Haller H, Behrend M, Park JK, Schaberg T, Luft FC,
Distler A. Monocyte infiltration and c-fms expression in hearts
of spontaneously hypertensive rats. Hypertension. 1995;25:132-138.
27. Hinglais N, Heudes D, Nicoletti A, Mandet C, Laurent M, Bariety J, Michel JB. Colocalization of myocardial fibrosis and inflammatory cells in rats. Lab Invest. 1994;70:286-294.[Medline] [Order article via Infotrieve]
28.
Holzinger C, Schollhammer A, Imhof M, Reinwald C,
Kramer G, Zuckermann A, Wolner E, Steiner G. Phenotypic patterns
of mononuclear cells in dilated
cardiomyopathy. Circulation. 1995;92:2876-2885.
29. Schaper J, Speiser B. The extracellular matrix in the failing human heart. Basic Res Cardiol. 1992;87(suppl 1):303-309.
30. Caforio AL, Stewart JT, Bonifacio E, Burke M, Davies MJ, McKenna WJ, Bottazzo GF. Inappropriate major histocompatibility complex expression on cardiac tissue in dilated cardiomyopathy: relevance for autoimmunity? J Autoimmun. 1990;3:187-200.[Medline] [Order article via Infotrieve]
31.
Han J, Thompson P, Beutler B.
Dexamethasone and pentoxifylline inhibit endotoxin-induced
cachectin/tumor necrosis factor synthesis at separate points in the
signaling pathway. J Exp Med. 1990;172:391-394.
32.
Schindler R, Clark BD, Dinarello CA.
Dissociation between interleukin-1 beta mRNA and protein synthesis in
human peripheral blood mononuclear cells.
J Biol Chem. 1990;265:10232-10237.
33. Kapadia S, Lee J, Torre Amione G, Birdsall HH, Ma TS, Mann DL. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042-1052.
34.
Ban K, Ikeda U, Takahashi M, Kanbe T, Kasahara T,
Shimada K. Expression of intercellular adhesion molecule-1 on
rat cardiac myocytes by monocyte chemoattractant protein-1.
Cardiovasc Res. 1994;28:1258-1262.
35.
Baker KM, Chernin MI, Wixson SK, Aceto JF.
Renin-angiotensin system involvement in pressure-overload
cardiac hypertrophy in rats. Am J
Physiol. 1990;259:H324-H332.
36. Hahn AW, Jonas U, Buhler FR, Resink TJ. Activation of human peripheral monocytes by angiotensin II. FEBS Lett. 1994;347:178-180.[Medline] [Order article via Infotrieve]
37. Foris G, Dezso B, Medgyesi GA, Fust G. Effect of angiotensin II on macrophage functions. Immunology. 1983;48:529-535.[Medline] [Order article via Infotrieve]
38. Zhang Y, Lee TC, Guillemin B, Yu MC, Rom WN. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J Immunol. 1993;150:4188-4196.[Abstract]
39.
Hamet P, Richard L, Dam TV, Teiger E, Orlov SN, Gaboury
L, Gossard F, Tremblay J. Apoptosis in target organs of
hypertension. Hypertension. 1995;26:642-648.
40. Teiger E, Dam TV, Richard L, Wisnewsky C, Tea BS, Baboury L, Tremblay J, Schwartz K, Hamet P. Apoptosis in pressure overload-induced heart hypertrophy in the rat. J Clin Invest. 1995;97:2891-2897.[Medline] [Order article via Infotrieve]
41.
Liu S, Schreur KD. G protein-mediated
suppression of L-type Ca2+ current by interleukin-1 beta in
cultured rat ventricular myocytes. Am J
Physiol. 1995;268:C339-C349. Errata: Am J Physiol.
1995;268(pt 1):section C.
42. Hosenpud JD. The effects of interleukin 1 on myocardial function and metabolism. Clin Immunol Immunopathol. 1993;68:175-180.[Medline] [Order article via Infotrieve]
43.
Lloyd CM, Minto AW, Dorf ME, Proudfoot A, Wells TN,
Salant DJ. RANTES and monocyte chemoattractant protein-1 (MCP-1)
play an important role in the inflammatory phase of crescentic
nephritis, but only MCP-1 is involved in crescent formation and
interstitial fibrosis. J Exp Med. 1997;185:1371-1380.
44. Dinarello CA. Modalities for reducing interleukin 1 activity in disease. Trends Pharmacol Sci. 1993;14:155-159.[Medline] [Order article via Infotrieve]
45. Feldman AM, Weinberg EO, Ray PE, Lorell BH. Selective changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with chronic aortic banding. Circ Res. 1993;73:184-192.[Abstract]
46.
Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks
WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene
expression during the transition from stable hypertrophy to
heart failure: marked upregulation of genes encoding extracellular
matrix components. Circ Res. 1994;75:23-32.
47.
Zhang X, Dostal DE, Reiss K, Cheng W, Kajstura J, Li P,
Huang H, Sonnenblick EH, Meggs LG, Baker KM, Anversa P. Identification
and activation of autocrine renin-angiotensin system in
adult ventricular myocytes. Am J Physiol. 1995;269:H1791-H1802.
48.
Litwin SE, Katz SE, Weinberg EO, Lorell BH, Aurigemma
GP, Douglas PS. Serial
echocardiographic-Doppler assessment of left
ventricular geometry and function in rats with
pressure-overload hypertrophy: chronic
angiotensin-converting enzyme inhibition attenuates the
transition to heart failure. Circulation. 1995;91:2642-2654.
49. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 1991;10:2247-2258.[Medline] [Order article via Infotrieve]
50. Dhalla AK, Hill MF, Singal PK. Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol. 1996;28:506-514.[Abstract]
51. Katabami T, Shimizu M, Okano K, Yano Y, Nemoto K, Ogura M, Tsukamoto T, Suzuki S, Ohira K, Yamada Y, Sekita N, Yoshida A, Someya K. Intracellular signal transduction for interleukin-1 beta-induced endothelin production in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 1992;188:565-570.[Medline] [Order article via Infotrieve]
52. Feron O, Salomone S, Godfraind T. Influence of salt loading on the cardiac and renal preproendothelin-1 mRNA expression in stroke-prone spontaneously hypertensive rats. Biochem Biophys Res Commun. 1995;209:161-166.[Medline] [Order article via Infotrieve]
53. Lariviére R, Deng LY, Day R, Sventek P, Thibault G, Schiffrin EL. Increased endothelin-1 gene expression in the endothelium of coronary arteries and endocardium in the DOCA-salt hypertensive rat. J Mol Cell Cardiol. 1995;27:2123-2131.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
H. R. Zandbergen, U. C. Sharma, S. Gupta, J. W. H. Verjans, S. van den Borne, S. Pokharel, T. van Brakel, A. Duijvestijn, N. van Rooijen, J. G. Maessen, et al. Macrophage Depletion in Hypertensive Rats Accelerates Development of Cardiomyopathy Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2009; 14(1): 68 - 75. [Abstract] [PDF] |
||||
![]() |
P. Misra, D. Lebeche, H. Ly, M. Schwarzkopf, G. Diaz, R. J. Hajjar, A. D. Schecter, and J. V. Frangioni Quantitation of CXCR4 Expression in Myocardial Infarction Using 99mTc-Labeled SDF-1{alpha} J. Nucl. Med., June 1, 2008; 49(6): 963 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Westphal, Li Chen, C. Pilowski, S. Koch, H. Ebelt, U. Muller-Werdan, K. Werdan, and H. Loppnow Endotoxin-activated cultured neonatal rat cardiomyocytes express functional surface-associated interleukin-1{alpha} Innate Immunity, February 1, 2007; 13(1): 25 - 34. [Abstract] [PDF] |
||||
![]() |
T. Ohtani, M. Ohta, K. Yamamoto, T. Mano, Y. Sakata, M. Nishio, Y. Takeda, J. Yoshida, T. Miwa, M. Okamoto, et al. Elevated cardiac tissue level of aldosterone and mineralocorticoid receptor in diastolic heart failure: beneficial effects of mineralocorticoid receptor blocker Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R946 - R954. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nishikawa, M. Yoshida, M. Kusuhara, N. Ishigami, K. Isoda, K. Miyazaki, and F. Ohsuzu Left ventricular hypertrophy in mice with a cardiac-specific overexpression of interleukin-1 Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H176 - H183. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Enomoto, M Yoshiyama, T Omura, R Matsumoto, T Kusuyama, S Kim, Y Izumi, K Akioka, H Iwao, K Takeuchi, et al. Effects of eplerenone on transcriptional factors and mRNA expression related to cardiac remodelling after myocardial infarction Heart, December 1, 2005; 91(12): 1595 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kinoshita, M. Okada, M. Hara, Y. Furukawa, and A. Matsumori Mast Cell Tryptase in Mast Cell Granules Enhances MCP-1 and Interleukin-8 Production in Human Endothelial Cells Arterioscler Thromb Vasc Biol, September 1, 2005; 25(9): 1858 - 1863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Vanderheyden, W J Paulus, M Voss, P Knuefermann, N Sivasubramanian, D Mann, and G Baumgarten Myocardial cytokine gene expression is higher in aortic stenosis than in idiopathic dilated cardiomyopathy Heart, July 1, 2005; 91(7): 926 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes Cardiovasc Res, March 1, 2005; 65(4): 832 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Giannico, M. Mendez, and M. C. LaPointe Regulation of the membrane-localized prostaglandin E synthases mPGES-1 and mPGES-2 in cardiac myocytes and fibroblasts Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H165 - H174. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sakata, K. Yamamoto, T. Mano, N. Nishikawa, J. Yoshida, M. Hori, T. Miwa, and T. Masuyama Activation of Matrix Metalloproteinases Precedes Left Ventricular Remodeling in Hypertensive Heart Failure Rats: Its Inhibition as a Primary Effect of Angiotensin-Converting Enzyme Inhibitor Circulation, May 4, 2004; 109(17): 2143 - 2149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yoshida, K. Yamamoto, T. Mano, Y. Sakata, N. Nishikawa, M. Nishio, T. Ohtani, T. Miwa, M. Hori, and T. Masuyama AT1 Receptor Blocker Added to ACE Inhibitor Provides Benefits at Advanced Stage of Hypertensive Diastolic Heart Failure Hypertension, March 1, 2004; 43(3): 686 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Omura, M. Yoshiyama, S. Kim, R. Matsumoto, Y. Nakamura, Y. Izumi, H. Ichijo, T. Sudo, K. Akioka, H. Iwao, et al. Involvement of Apoptosis Signal-Regulating Kinase-1 on Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression Arterioscler Thromb Vasc Biol, February 1, 2004; 24(2): 270 - 275. [Abstract] [Full Text] |
||||
![]() |
F. Yang, X.-P. Yang, Y.-H. Liu, J. Xu, O. Cingolani, N.-E. Rhaleb, and O. A. Carretero Ac-SDKP Reverses Inflammation and Fibrosis in Rats With Heart Failure After Myocardial Infarction Hypertension, February 1, 2004; 43(2): 229 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hayashidani, H. Tsutsui, T. Shiomi, M. Ikeuchi, H. Matsusaka, N. Suematsu, J. Wen, K. Egashira, and A. Takeshita Anti-Monocyte Chemoattractant Protein-1 Gene Therapy Attenuates Left Ventricular Remodeling and Failure After Experimental Myocardial Infarction Circulation, October 28, 2003; 108(17): 2134 - 2140. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Giannuzzi, P. L. Temporelli, U. Corra, and L. Tavazzi Antiremodeling Effect of Long-Term Exercise Training in Patients With Stable Chronic Heart Failure: Results of the Exercise in Left Ventricular Dysfunction and Chronic Heart Failure (ELVD-CHF) Trial Circulation, August 5, 2003; 108(5): 554 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiomi, H. Tsutsui, M. Ikeuchi, H. Matsusaka, S. Hayashidani, N. Suematsu, J. Wen, T. Kubota, and A. Takeshita Streptozotocin-induced hyperglycemia exacerbates left ventricular remodeling and failure after experimental myocardial infarction J. Am. Coll. Cardiol., July 2, 2003; 42(1): 165 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Li, C.-S. Tsai, S.-H. Chueh, P.-C. Hsu, J.-Y. Wang, C.-S. Wong, and S.-T. Ho Dobutamine Inhibits Monocyte Chemoattractant Protein-1 Production and Chemotaxis in Human Monocytes Anesth. Analg., July 1, 2003; 97(1): 205 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Vasan, L. M. Sullivan, R. Roubenoff, C. A. Dinarello, T. Harris, E. J. Benjamin, D. B. Sawyer, D. Levy, P. W.F. Wilson, and R. B. D'Agostino Inflammatory Markers and Risk of Heart Failure in Elderly Subjects Without Prior Myocardial Infarction: The Framingham Heart Study Circulation, March 25, 2003; 107(11): 1486 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Egashira Molecular Mechanisms Mediating Inflammation in Vascular Disease: Special Reference to Monocyte Chemoattractant Protein-1 Hypertension, March 1, 2003; 41(3): 834 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiomi, H. Tsutsui, S. Hayashidani, N. Suematsu, M. Ikeuchi, J. Wen, M. Ishibashi, T. Kubota, K. Egashira, and A. Takeshita Pioglitazone, a Peroxisome Proliferator-Activated Receptor-{gamma} Agonist, Attenuates Left Ventricular Remodeling and Failure After Experimental Myocardial Infarction Circulation, December 10, 2002; 106(24): 3126 - 3132. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nakamura, K. Egashira, Y. Machida, S. Hayashidani, M. Takeya, H. Utsumi, H. Tsutsui, and A. Takeshita Probucol Attenuates Left Ventricular Dysfunction and Remodeling in Tachycardia-Induced Heart Failure: Roles of Oxidative Stress and Inflammation Circulation, July 16, 2002; 106(3): 362 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Iwanaga, T. Aoyama, Y. Kihara, Y. Onozawa, T. Yoneda, and S. Sasayama Excessive activation of matrix metalloproteinases coincides with left ventricular remodeling during transition from hypertrophy to heart failure in hypertensive rats J. Am. Coll. Cardiol., April 17, 2002; 39(8): 1384 - 1391. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mendez and M. C. LaPointe Trophic Effects of the Cyclooxygenase-2 Product Prostaglandin E2 in Cardiac Myocytes Hypertension, February 1, 2002; 39(2): 382 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Degousee, E. Stefanski, T. F. Lindsay, D. A. Ford, R. Shahani, C. A. Andrews, D. J. Thuerauf, C. C. Glembotski, T. J. Nevalainen, J. Tischfield, et al. p38 MAPK Regulates Group IIa Phospholipase A2 Expression in Interleukin-1beta -stimulated Rat Neonatal Cardiomyocytes J. Biol. Chem., November 16, 2001; 276(47): 43842 - 43849. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Adamopoulos, J. T. Parissis, and D. Th. Kremastinos A glossary of circulating cytokines in chronic heart failure Eur J Heart Fail, October 1, 2001; 3(5): 517 - 526. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. KIMURA, O. OKADA, N. TANABE, Y. TANAKA, M. TERAI, Y. TAKIGUCHI, M. MASUDA, N. NAKAJIMA, K. HIROSHIMA, H. INADERA, et al. Plasma Monocyte Chemoattractant Protein-1 and Pulmonary Vascular Resistance in Chronic Thromboembolic Pulmonary Hypertension Am. J. Respir. Crit. Care Med., July 15, 2001; 164(2): 319 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimoyama, D. Hayashi, Y. Zou, E. Takimoto, M. Mizukami, K. Monzen, S. Kudoh, Y. Hiroi, Y. Yazaki, R. Nagai, et al. Calcineurin Inhibitor Attenuates the Development and Induces the Regression of Cardiac Hypertrophy in Rats With Salt-Sensitive Hypertension Circulation, October 17, 2000; 102(16): 1996 - 2004. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Behr, X. Wang, N. Aiyar, R. W. Coatney, X. Li, P. Koster, C. E. Angermann, E. Ohlstein, G. Z. Feuerstein, and J. Winaver Monocyte Chemoattractant Protein-1 is Upregulated in Rats With Volume-Overload Congestive Heart Failure Circulation, September 12, 2000; 102(11): 1315 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Damas, H. G. Eiken, E. Oie, V. Bjerkeli, A. Yndestad, T. Ueland, T. Tonnessen, O. R. Geiran, H. Aass, S. Simonsen, et al. Myocardial expression of CC- and CXC-chemokines and their receptors in human end-stage heart failure Cardiovasc Res, September 1, 2000; 47(4): 778 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ishizaka, T. Aizawa, I. Mori, J.-I. Taguchi, Y. Yazaki, R. Nagai, and M. Ohno Heme oxygenase-1 is upregulated in the rat heart in response to chronic administration of angiotensin II Am J Physiol Heart Circ Physiol, August 1, 2000; 279(2): H672 - H678. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Aihara, M. Kurabayashi, Y. Saito, Y. Ohyama, T. Tanaka, S.-i. Takeda, K. Tomaru, K.-i. Sekiguchi, M. Arai, T. Nakamura, et al. Cardiac Ankyrin Repeat Protein Is a Novel Marker of Cardiac Hypertrophy : Role of M-CAT Element Within the Promoter Hypertension, July 1, 2000; 36(1): 48 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sadoshima Cytokine Actions of Angiotensin II Circ. Res., June 23, 2000; 86(12): 1187 - 1189. [Full Text] [PDF] |
||||
![]() |
D. A. Siwik, D. L.-F. Chang, and W. S. Colucci Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} Decrease Collagen Synthesis and Increase Matrix Metalloproteinase Activity in Cardiac Fibroblasts In Vitro Circ. Res., June 23, 2000; 86(12): 1259 - 1265. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sasayama, M. Okada, and A. Matsumori Chemokines and cardiovascular diseases Cardiovasc Res, January 14, 2000; 45(2): 267 - 269. [Full Text] [PDF] |
||||
![]() |
J. K. Damas, L. Gullestad, T. Ueland, N. O. Solum, S. Simonsen, S. S Froland, and P. Aukrust CXC-chemokines, a new group of cytokines in congestive heart failure -- possible role of platelets and monocytes Cardiovasc Res, January 14, 2000; 45(2): 428 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sasayama, A. Matsumori, and Y. Kihara New insights into the pathophysiological role for cytokines in heart failure Cardiovasc Res, June 1, 1999; 42(3): 557 - 564. [Full Text] [PDF] |
||||
![]() |
M. C. LaPointe and E. Isenovic Interleukin-1ß Regulation of Inducible Nitric Oxide Synthase and Cyclooxygenase-2 Involves the p42/44 and p38 MAPK Signaling Pathways in Cardiac Myocytes Hypertension, January 1, 1999; 33(1): 276 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Koudssi, J. E. Lopez, S. Villegas, and C. S. Long Cardiac Fibroblasts Arrest at the G1/S Restriction Point in Response to Interleukin (IL)-1beta . EVIDENCE FOR IL-1beta -INDUCED HYPOPHOSPHORYLATION OF THE RETINOBLASTOMA PROTEIN J. Biol. Chem., October 2, 1998; 273(40): 25796 - 25803. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. H. Ng, C. S. Long, and M. A. Bogoyevitch A Role for the Extracellular Signal-regulated Kinase and p38 Mitogen-activated Protein Kinases in Interleukin-1beta -stimulated Delayed Signal Tranducer and Activator of Transcription 3 Activation, Atrial Natriuretic Factor Expression, and Cardiac Myocyte Morphology J. Biol. Chem., July 27, 2001; 276(31): 29490 - 29498. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |