This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delbridge, G. J. Articles by Khachigian, L. M. Search for Related Content PubMed PubMed Citation Articles by Delbridge, G. J. Articles by Khachigian, L. M.

(Circulation Research. 1997;81:282-288.)
© 1997 American Heart Association, Inc.

Articles

FGF-1–Induced Platelet-Derived Growth Factor-A Chain Gene Expression in Endothelial Cells Involves Transcriptional Activation by Early Growth Response Factor-1

Gabrielle J. Delbridge, , Levon M. Khachigian

From The Centre for Thrombosis and Vascular Research, The University of New South Wales, and Department of Haematology, The Prince of Wales Hospital, Sydney, Australia.

Correspondence to Levon M. Khachigian, PhD, The Centre for Thrombosis and Vascular Research, School of Pathology, The University of New South Wales, Sydney NSW 2052, Australia. E-mail L.Khachigian{at}unsw.edu.au

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract Fibroblast growth factor-1 (FGF-1), a prototype member of the heparin-binding growth factor family, is a potent mitogen for vascular endothelial cells and a variety of other cell types. FGF-1 can induce the expression of the platelet-derived growth factor-A chain (PDGF-A) gene in endothelial cells; however, the underlying transcriptional mechanisms are not known. We used serial 5' deletion and transient transfection analysis of the human PDGF-A promoter to demonstrate that a 16-bp element, located 55 to 71 bp upstream of the transcriptional start site, is required for FGF-1–inducible promoter–dependent expression. This region contains nucleotide recognition elements for the early growth response gene product, early growth response factor-1 (Egr-1), and the related zinc-finger transcription factor, Sp1. Reverse-transcription polymerase chain reaction revealed that FGF-1 induced Egr-1 mRNA expression within 30 minutes. Electrophoretic mobility shift, supershift, and Western blot analysis demonstrated that Egr-1 protein accumulated in the nuclei of endothelial cells exposed to the growth factor, whereas levels of Sp1 did not change. Egr-1 bound to the FGF-1 response element in the proximal PDGF-A promoter in a specific and time-dependent manner. These findings indicate that Egr-1 plays a key regulatory role in FGF-1–inducible endothelial PDGF-A expression and implicate this transcription factor in pathological settings in which these mitogens are both expressed.

Key Words: early growth response factor • fibroblast growth factor • platelet-derived growth factor • transcription

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Fibroblast growth factor-1 and PDGF-A are two mitogens and chemoattractants implicated in the development of the atherosclerotic lesion. Increased levels of FGF-1 mRNA have been observed in human atheroma compared with nonatherosclerotic arteries.¹ FGF-1 protein has been strongly associated with regions of the plaque rich in microvessels, suggesting a role in neovascularization.¹ Hughes et al² demonstrated FGF-1 immunoreactivity in early, simple, and advanced plaques. Similarly, Flugelman³ detected FGF-1 protein in coronary atherectomy specimens from patients with unstable angina pectoris or postangioplasty restenosis. Barrett and Benditt⁴ first observed elevated levels of PDGF-A transcripts in carotid plaques a decade ago. The presence of PDGF-A mRNA in these lesions was confirmed later using competitive RT-PCR.⁵ Finally, Rekhter and Gordon⁶ used a triple immunolabeling approach to localize PDGF-A protein to endothelial cells and smooth muscle–like cells in the plaque.

PDGF is produced by a number of cells involved in the pathogenesis of atherosclerosis. These include endothelial cells, smooth muscle cells, macrophages, and platelets.⁷ PDGF, purified from natural sources, occurs as a dimer of an A and B chain held together in homodimeric or heterodimeric configuration by disulfide linkages, with an approximate molecular mass of 30 kD.⁸ PDGF binds with high affinity (10^-10 mol/L) to two cell-surface receptor subunits, termed ⁹ and ß^{10 11 12} ; each contains split tyrosine kinase domains and undergoes autophosphorylation upon ligand binding.¹³ The subunit is bound by both chains of PDGF, whereas the ß subunit is bound with high affinity by only the B chain.⁸

FGF-1, also known as acidic fibroblast growth factor or heparin-binding growth factor-1, occurs as a single-chain polypeptide of 155 amino acids with a molecular mass of 17 kD.¹⁴ It binds with high affinity to tyrosine kinase receptors on the cell surface. The occurrence of multiple FGF receptor subtypes is due to the use of different promoters and alternative splicing.¹⁵ FGF-1 is tightly adsorbed to the extracellular matrix by virtue of its affinity for heparin-like glycosaminoglycans.¹⁶

The human PDGF-A gene spans 24 kb of genomic DNA and contains a single transcriptional start site 36 bp downstream from a single TATA box.^{17 18 19} The promoter region of this gene has been investigated in epithelial carcinoma (HeLa) cells,²⁰ mesangial cells,²¹ vascular smooth muscle cells,²² endothelial cells,²³ and African green monkey renal epithelial (BSC-1) cells.²⁴ The proximal promoter region is G+C rich¹⁷ and is hypersensitive to cleavage by S1 nuclease.²⁵ It contains overlapping recognition elements for the zinc-finger transcription factors, Sp1,^{26 27} Egr-1,²⁸ and WT-1.^{29 30}

Expression of the PDGF-A gene is increased at the level of transcription in vascular endothelial cells exposed to FGF-1.³¹ Despite considerable interest in the role of growth factors and the pathogenesis of vascular proliferative disease, the molecular mechanisms whereby one factor modulates the expression of the other have not been defined. In the present study, we have investigated the regulatory mechanisms underlying the induction of PDGF-A transcription by FGF-1 in vascular endothelial cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oligonucleotide Synthesis and Radiolabeling
Oligonucleotides for EMSAs were synthesized by CyberSyn and purified using reverse-phase C₁₈ cartridges. Oligonucleotides for use as primers in RT-PCR were desalted. Double-stranded oligonucleotides were end-labeled with [-³²P]dATP (Bresatec Pty Ltd) using T4 polynucleotide kinase (New England Biolabs, Inc) and separated from the unbound label using Chromaspin-10 columns (Clontech Laboratories).

Cell Culture
BAECs were a generous gift of Dr Julie Campbell (Centre for Research in Vascular Biology, Brisbane, Australia) or obtained from Cell Applications, Inc, and grown in DMEM (GIBCO BRL, Life Technologies), pH 7.4, containing 10% FBS supplemented with 50 µg/mL streptomycin and 50 IU/mL penicillin. Cultures were maintained at 37°C in a humidified atmosphere of 5% CO₂/95% air.

RT-PCR
Total RNA was prepared using the TRIzol reagent (GIBCO-BRL, Life Technologies) in accordance with the manufacturer's instructions. For the RT reaction, 4 µg of RNA, 100 pmol random hexamer primer (Promega), and 200 U of M-MLV reverse transcriptase (Stratagene Cloning Systems) were combined in a total volume of 40 µL containing 50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl₂, 40 U RNasin (Promega), 10 mmol/L DTT, and 0.5 mmol/L of each dNTP. Samples were incubated in a PCR machine with the following profile: 5 minutes at 25°C, 5 minutes at 72°C, 90 minutes at 37°C, and 5 minutes at 95°C.

GAPDH amplification was performed in the same tube to allow relative quantification of PCR products; accordingly, two pairs of primers were included in every reaction. Twenty picomoles of 5' and 3' GAPDH primers, as well as 5' and 3' Egr-1 primers, were combined in a total volume of 25 µL containing 20 mmol/L (NH₄)₂SO_4, 75 mmol/L Tris-HCl, pH 9.0, 0.1% (wt/vol) Tween 20, 2.5 mmol/L MgCl₂, and 0.2 mmol/L of each dNTP and the reverse-transcribed cDNA. Reactions were overlaid with 40 µL of mineral oil, and samples were heated to 95°C for 5 minutes before the addition of 1 U Taq polymerase (Advanced Biotechnologies) through the oil. The samples were cycled through 95°C for 1 minute, 57°C for Egr-1 and 60°C for PDGF-A for 1 minute, and 72°C for 1.5 minutes. Twenty-seven cycles were followed by a further 20-minute extension at 72°C to facilitate complete extension of products. The entire PCR reaction was loaded onto 1.5% agarose gels with appropriate-sized markers, electrophoresed, stained with ethidium bromide, and photographed under ultraviolet illumination. Expected size products were GAPDH of 287 bp and Egr-1 of 345 bp. Sequences were as follows: GAPDH, GCCAAAAGGGTCATCATCTC (x5' forward) and GTAGAGGCAGGGATGATGTTC (x3' reverse); Egr-1, CAGCAGTCCCATTTACTCAG (x5' forward) and GACTG GTAGCTGGTATTG (x3' reverse).

Transient Transfection Analysis and Assay for CAT Activity
BAECs were transiently transfected with 15 µg of each PDGF-A promoter-reporter construct and 2 µg of pTKGH (Nichols Institute Diagnostics) using the modified calcium phosphate precipitation technique in 100-mm dishes.³² After incubation overnight at 37°C and 3% CO₂/97% air, the monolayers were washed twice with PBS, pH 7.4, and incubated in 1% FBS/DMEM for 24 hours before exposure to 10 ng/mL FGF-1 (Sigma Chemical Co) (maximal endotoxin content, <0.1 ng/µg) in 10 U/mL heparin (present whenever FGF-1 used) for a further 24 hours unless otherwise indicated. Before harvest, the conditioned medium was sampled for human growth hormone activity by enzyme-linked immunosorbent assay (Bioclone Australia Pty Ltd) to normalize for transfection efficiency. Lysates were assessed for CAT activity using the two-phase fluor-diffusion technique.^{32 33}

Preparation of Nuclear Extracts
Monolayers were washed twice with PBS at 4°C and removed from the surface by scraping. The cells were spun at 1200 rpm for 15 minutes at 4°C, resuspended in PBS, and transferred to Eppendorf tubes. The suspension was repelleted by spinning at 6500 rpm for 1 minute at 4°C. The cells were lysed by incubation in buffer A (10 mmol/L HEPES, pH 7.9, 1.5 mmol/L MgCl₂, 10 mmol/L KCl, 0.5 mmol/L DTT, 200 mmol/L sucrose, 0.5% Nonidet P-40, 0.5 mmol/L PMSF, 1 µg/mL leupeptin, and 1 µg/mL aprotinin) for 5 minutes at 4°C. The suspension was recentrifuged at 13 000 rpm, and the nuclei were lysed in buffer C (20 mmol/L HEPES, pH 7.9, 1.5 mmol/L MgCl₂, 420 mmol/L NaCl, 0.2 mmol/L EDTA, 1 mmol/L DTT, 0.5 mmol/L PMSF, 1 µg/mL leupeptin, and 1 µg/mL aprotinin) by gentle shaking for 20 minutes at 4°C. The nuclear extract was clarified by centrifugation, and the supernatant was combined 1:1 with buffer D (20 mmol/L HEPES, pH 7.9, 100 mmol/L KCl, 0.2 mmol/L EDTA, 20% glycerol, 1 mmol/L DTT, 0.5 mmol/L PMSF, 1 µg/mL leupeptin, and 1 µg/mL aprotinin). Extracts were snap-frozen on dry ice and stored at -80°C until use.

EMSA
Binding reactions were carried out in a total volume of 20 µL containing 5 to 10 µg of nuclear extract, 1 µg of poly(dI.dC)-poly(dI.dC) (Sigma), 1 µg of salmon sperm DNA (Sigma), 5% sucrose, and 100 000 cpm ³²P-labeled oligonucleotide probe in 10 mmol/L Tris-HCl, pH 8, 50 mmol/L MgCl₂, 1 mmol/L EDTA, 1 mmol/L DTT, 5% glycerol, and 1 mmol/L PMSF. The reaction was allowed to continue for 35 minutes at 22°C. In supershift studies, 1 µL of affinity-purified anti-peptide antibody (Santa Cruz Biotechnology, Inc) was incubated with the binding mixture 10 minutes before the addition of the probe. Bound complexes were separated from unbound probe by nondenaturing polyacrylamide gel electrophoresis using 1x TBE running buffer at 200 V (constant voltage). After drying, the gels were exposed to Hyperfilm-MP (Amersham Australia Pty Ltd) overnight at -80°C.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
FGF-1 Induces PDGF-A Promoter–Dependent Expression in Vascular Endothelial Cells
Previous studies using Northern blot and nuclear runoff analysis determined that PDGF-A gene expression is stimulated in endothelial cells exposed to FGF-1.³¹ To begin to address the question of the transcriptional mechanism(s) underlying FGF-1–inducible PDGF-A gene expression, we transiently transfected BAECs with a CAT reporter construct, f28, bearing a fragment of the PDGF-A promoter fragment extending 71 bp upstream from the transcriptional start site.¹⁷ The cells were exposed to 3 or 10 ng/mL of FGF-1, and normalized levels of the reporter in the lysates were determined 24 hours later. FGF-1 induced PDGF-A promoter–dependent expression at 10 ng/mL, but not at 3 ng/mL (Fig 1). Consequently, FGF-1 was used at a concentration of 10 ng/mL in all further experiments.

View larger version (17K): [in this window] [in a new window]   Figure 1. FGF-1 stimulates PDGF-A promoter–dependent expression in vascular endothelial cells. BAECs were transiently transfected with a CAT reporter construct bearing 71 bp of PDGF-A promoter sequence upstream using a modification of the calcium phosphate technique. Cells were exposed to 3 or 10 ng/mL of FGF-1 for 24 hours before harvest and determination of CAT activity in the lysate. CAT activity was normalized to levels of growth hormone (GH) secreted into the supernatant as a measure of transfection efficiency.

Endothelial cells were transfected with a series of reporter constructs bearing larger fragments of the PDGF-A promoter. Cells transfected with constructs Sac and e38, containing 643 bp and 98 bp of PDGF-A promoter sequence, respectively, increased reporter gene expression in the presence of FGF-1 (Fig 2) as effectively as cells transfected with construct f28 (Fig 1). This induction is consistent with a 2-fold increase in the rate of transcription of the endogenous gene.³¹ Cells transfected with construct e41, containing only 29 bp of promoter sequence and without an intact TATA box, failed to express the reporter basally or respond to the agonist (Fig 2). These findings indicate that responsiveness to FGF-1 is mediated by elements within the -71 to -29 region of the PDGF-A promoter.

View larger version (17K): [in this window] [in a new window]   Figure 2. Serial 5' deletion analysis of the PDGF-A promoter defines FGF-1 response region. BAECs were transfected with CAT reporter constructs bearing various-sized fragments of the PDGF-A promoter and a growth hormone (GH) expression vector. The cells were exposed to 10 ng/mL FGF-1 for 24 hours before harvest and determination of CAT activity in the lysate. CAT activity was normalized to levels of GH secreted into the supernatant as a measure of transfection efficiency.

Egr-1 Is Induced by FGF-1 in Vascular Endothelial Cells
Inspection of the -71/-29 region revealed two overlapping binding sites for the zinc-finger transcription factor, Egr-1 at the -71/-55 element.¹⁷ RT-PCR was used to determine whether FGF-1 could stimulate the expression of the egr-1 gene in endothelial cells. FGF-1 was incubated with the cells for various times before the extraction of total RNA and subsequent reverse transcription. Egr-1 was inducibly expressed within 30 minutes of exposure of the growth factor (Fig 3). This increase was transient, since levels of Egr-1 expression returned to baseline by 4 hours (Fig 3). In contrast, levels of GAPDH were unchanged over this time course (Fig 3). PMA, an inducer of steady state levels of Egr-1 mRNA in endothelial cells over several hours,²³ was used as a control. Interestingly, inducible Egr-1 expression precedes the earliest appearance of PDGF-A mRNA in endothelial cells exposed to FGF-1.³¹ This temporal pattern of expression led us to investigate whether Egr-1 plays a regulatory role in FGF-1–inducible expression of the PDGF-A gene.

View larger version (28K): [in this window] [in a new window]   Figure 3. Egr-1 gene expression is induced in vascular endothelial cells exposed to FGF-1. BAECs were exposed to 10 ng/mL FGF-1 for 0.5 or 4 hours, and total RNA was prepared using the TRIzol reagent and the manufacturer's instructions. The RNA was reverse-transcribed, and the cDNA was used as the template for PCR. The PCR product sizes are 287 bp for GAPDH and 345 bp for Egr-1.

Nuclear Proteins, Induced by FGF-1, Interact With the FGF-1 Response Region of the PDGF-A Promoter in a Transient and Specific Manner
Nuclear extracts of endothelial cells exposed to FGF-1 for various periods were run on Western blots and assessed for the presence of Egr-1 protein. FGF-1 induced Egr-1 within 1 hour; these levels were still apparent after 2 hours (Fig 4). By 4 hours, however, Egr-1 protein was no longer apparent in the nuclei (Fig 4). Since the FGF-1 response region of the PDGF-A promoter also contains multiple sites for Sp1, we investigated whether FGF-1 also modulated levels of this transcription factor. Unlike its effects on Egr-1, FGF-1 had no effect on levels of nuclear Sp1 (data not shown). These results demonstrate the nuclear accumulation of Egr-1 in endothelial cells exposed to FGF-1.

View larger version (37K): [in this window] [in a new window]   Figure 4. FGF-1 increases Egr-1 protein levels in nuclei of vascular endothelial cells. BAECs were exposed to 10 ng/mL FGF-1 for 0, 1, 2, 3, or 4 hours, and nuclear extracts were prepared as described in "Materials and Methods." Equal amounts of extracts were electrophoresed on denaturing 8% polyacrylamide-SDS gels, proteins were transferred to nitrocellulose, and Egr-1 was detected using rabbit polyclonal antipeptide antibodies and chemiluminescence.34

A ³²P-labeled double-stranded oligonucleotide bearing the proximal PDGF-A promoter sequence ([³²P]oligo A) was incubated with nuclear extracts from endothelial cells exposed to FGF-1 for various times. This resulted in the induction of an FGF-1–inducible nucleoprotein complex within 1 hour (Fig 5). This complex was apparent after 2 hours but returned to basal levels after 4 hours (Fig 5). When the cells were exposed for 1 hour to another agonist of PDGF-A transcription in endothelial cells, transforming growth factor-ß₁,^{35 36} this nucleoprotein complex was not observed (data not shown). A 100-fold molar excess of unlabeled oligo A completely inhibited the appearance of the FGF-1–inducible nucleoprotein complex (Fig 5). In contrast, the same molar excess of an irrelevant oligonucleotide, E74, failed to have any effect (Fig 5). Certain other nucleoprotein complexes unaffected by exposure to FGF-1 were also specifically competed (Fig 5).

View larger version (84K): [in this window] [in a new window]   Figure 5. Nuclear proteins, induced by FGF-1, interact with the FGF-1 response region of the PDGF-A promoter. Nuclear extracts from BAECs exposed to 10 ng/mL FGF-1 for 0, 1, 2, 3, or 4 hours were incubated with a 32P-labeled fragment of the proximal PDGF-A promoter ([32P]oligo A) and electrophoresed on a 6% nondenaturing polyacrylamide gel. The gel was dried and exposed to film as described in "Materials and Methods." When oligonucleotide competition experiments were performed, a 100-fold molar excess of unlabeled cognate was incubated with the nuclear extracts 15 minutes before the addition of the probe. The sequence of oligo A is 5'-GGGGGGGGCGGGGGCGGGGGCGGGGGAGGG-3' (sense strand) (consensus Egr-1 binding elements are underlined).

Antibody Inhibition Experiments Identify the Proteins Contributing to the Inducible Nucleoprotein Complex
Inclusion of polyclonal antibodies to activating protein-2 failed to affect the mobility or intensity of the inducible complex or indeed any other specific complex (Fig 6). Antibodies to Sp1 supershifted the constitutive complex with the slowest electrophoretic mobility (Fig 6). Interestingly, the FGF-1–inducible nucleoprotein complex had an electrophoretic mobility identical to that obtained using PMA, a potent inducer of Egr-1 (Fig 6). Antibodies to Egr-1 eliminated the inducible complex without affecting the appearance of any other band (Fig 6). These findings indicate that FGF-1 induces Egr-1 expression, its nuclear accumulation, and specific interaction with a fragment of the proximal PDGF-A promoter without affecting levels of Sp1.

View larger version (60K): [in this window] [in a new window]   Figure 6. Antibody inhibition experiments identify the protein component of the inducible nucleoprotein complex. Nuclear extracts from BAECs exposed to 10 ng/mL FGF-1 or 100 ng/mL PMA for 1 hour were incubated with a 32P-labeled fragment of the proximal PDGF-A promoter ([32P]oligo A) and electrophoresed on a 6% nondenaturing polyacrylamide gel. The gel was dried and exposed to film as described in "Materials and Methods." In antibody inhibition studies, 1 µL of the polyclonal antibody (1 mg/mL) was incubated with the nuclear extracts 10 minutes before the addition of the probe.

Egr-1 Binding Site in the Proximal PDGF-A Promoter Is Crucial for FGF-1–Induced PDGF-A Promoter–Dependent Expression
To demonstrate the importance of the Egr-1 binding element in FGF-1–inducible gene expression, transient transfection analysis was carried out using PDGF-A promoter-reporter constructs whose 5' end points were located either side of the Egr-1 binding site spanned in oligo A. Deletion of the Egr-1 binding element in f28 produced construct f36, which contained 55 bp of the PDGF-A promoter sequence. Cells transfected with f36 failed to increase reporter expression in the presence of FGF-1 (Fig 7), whereas those harboring f28 did respond (Fig 7). These findings demonstrate that the Egr-1 binding element in the proximal PDGF-A promoter (-71/-55) mediates FGF-1–inducible gene expression. Thus, FGF-1 stimulates the expression and nuclear accumulation of Egr-1, where it binds to the PDGF-A promoter and activates transcription.

View larger version (16K): [in this window] [in a new window]   Figure 7. Localization of FGF-1–inducible element in the proximal PDGF-A promoter. CAT reporter constructs with 5' end points of the PDGF-A promoter located 71 bp (f28) and 55 bp (f36) upstream from the transcriptional start were transiently transfected into BAECs and growth hormone (GH)–normalized CAT activity determined in cells exposed to 10 ng/mL FGF-1 for 24 hours.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we have investigated the transcriptional mechanisms underlying the inducible expression of the PDGF-A gene in vascular endothelial cells exposed to FGF-1. Serial 5' deletion and transient transfection analysis, using reporter constructs bearing fragments of the native PDGF-A promoter, defined the proximal promoter region as that which mediates FGF-1–inducible gene expression. This region contains overlapping nucleotide recognition elements for the immediate-early gene product, Egr-1, and the related zinc-finger transcription factor, Sp1. RT-PCR revealed that FGF-1 induced Egr-1 expression within 30 minutes, whereas EMSA and Western blot analysis showed that Egr-1 protein accumulates in the nuclei of cells exposed to FGF-1 within 1 hour, before returning to preinduced levels after 4 hours. Levels of Sp1 in the nucleus were unchanged during this time. Gel-shift assays determined that FGF-1–induced Egr-1 binds to the proximal PDGF-A promoter in a specific and time-dependent manner. Finer deletions of the PDGF-A promoter localized the element mediating FGF-1 responsiveness to the Egr-1 binding site. These studies have defined a novel FGF-1 response element and a transacting factor, which together mediate inducible PDGF-A expression in endothelial cells exposed to FGF-1. That Egr-1 mediates FGF-1–inducible gene expression has hitherto not been described.

Immunohistochemical studies have localized FGF-1 and its receptors to endothelial cells lining microvessels in human atheroma.^{1 2} These neovascularized regions in the plaque have also been found to contain PDGF-A.⁶ Both growth factors have been implicated in the regulation of mesenchymal cell proliferation in this setting.^{2 6} On the basis of the present observations, FGF-1 may stimulate PDGF-A expression via Egr-1 in the developing atherosclerotic plaque. Although there are no published reports yet that have evaluated the spatial and temporal pattern with which Egr-1 is expressed in the developing atherosclerotic lesion, it will be interesting to determine whether Egr-1 can be localized to microvessels coincident with FGF-1 and PDGF-A. Egr-1 is, nevertheless, dramatically expressed at the endothelial wound edge in a rat model of arterial injury before the induction of PDGF-A.³⁴ The mechanism(s) with which FGF-1 is released from endothelial cells to act on host and neighboring cells is not entirely clear. Since FGF-1 lacks a consensus signal peptide for extracellular secretion,³⁷ its availability may depend on cell leakage or damage following injury to the vessel wall. It could also be released from the extracellular matrix by platelet- or neutrophil-derived heparanase.³⁸

Our findings from 5' deletion analysis indicate that Egr-1 is necessary for FGF-1–inducible PDGF-A promoter–dependent expression in endothelial cells. While PDGF-A promoter–dependent reporter expression is induced in cells cotransfected with viral promoter–driven expression vector,²³ whether activation of Egr-1 is, by itself, sufficient to induce PDGF-A is not yet clear. Several transcription factors have been found to bind to, and functionally cooperate with, other nuclear factors over promoter elements to induce gene expression. The dimeric transcription factor, nuclear factor-B, for example, synergizes with high-mobility group protein I(Y),³⁹ Sp1,⁴⁰ activating transcription factor-2,⁴¹ CCAAT/enhancer-binding protein,⁴² activating protein-1,⁴³ interferon regulatory factor-1,⁴⁴ and p300.⁴⁵ Although regulatory factors interacting with Egr-1 in this context have not yet been described, the issue of cooperativity involving Egr-1 and the assembly of a FGF-1–inducible transcriptional activation complex requires further investigation.

The human FGF-1 gene spans over 100 kb and encodes multiple transcripts, which result from alternative exon splicing.^{46 47} FGF-1 can itself increase FGF-1–dependent reporter gene expression in certain nonendothelial cells⁴⁸ and induce endogenous FGF-1 expression in vascular smooth muscle cells.⁴⁹ The precise cis-acting elements that mediate this transcriptional response have not yet been defined, although a number of promoter elements with structural similarity to the Egr-1 consensus have been implicated.⁴⁸ Since FGF-1 stimulates the production and nuclear accumulation of Egr-1, its ability to induce its own synthesis may involve transactivation by Egr-1. Indeed, PMA and serum, which both induce FGF-1 gene expression in smooth muscle cells,⁵⁰ are potent inducers of Egr-1 in these cells²² (L.M. Khachigian, unpublished data, 1997). Thus, in addition to inducing PDGF-A expression, FGF-1 could stimulate its own synthesis in the developing atherosclerotic lesion. Together, these factors may play key roles in the chemotactic and mitogenic events associated with vascular remodeling.

	Selected Abbreviations and Acronyms

 

BAEC = bovine aortic endothelial cell CAT = chloramphenicol acetyltransferase DTT = dithiothreitol Egr-1 = early growth response factor-1 EMSA = electrophoretic mobility shift assay FGF = fibroblast growth factor PCR = polymerase chain reaction PDGF = platelet-derived growth factor PDGF-A = PDGF-A chain PMA = phorbol 12-myristate 13-acetate PMSF = phenylmethylsulfonyl fluoride RT-PCR = reverse-transcription PCR WT-1 = Wilms' tumor suppressor gene product

	Acknowledgments

 
This study was supported in part by grants from the Merck Sharp & Dohme Foundation and the National Health and Medical Research Council of Australia. Dr Khachigian was supported by an R. Douglas Wright Award from the National Health and Medical Research Council of Australia. We would like to acknowledge Dr Tucker Collins (Brigham and Women's Hospital and Harvard Medical School, Boston, Mass) for his generous gift of PDGF-A promoter-reporter constructs and helpful discussions.

Received March 7, 1997; accepted June 16, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Brogi E, Winkles JA, Underwood R, Clinton SK, Alberts GF, Libby P. Distinct patterns of expression of fibroblast growth factors and their receptors in human atheroma and nonatherosclerotic arteries. J Clin Invest. 1993;92:2408-2418.

2. Hughes SE, Crossman D, Hall PA. Expression of basic and acidic fibroblast growth factors and their receptor in normal and atherosclerotic human arteries. Cardiovasc Res. 1993;27:1214-1219.[Abstract/Free Full Text]

3. Flugelman MY. Inhibition of intravascular thrombosis and vascular smooth muscle proliferation by gene therapy. Thromb Haemost. 1995;74:406-410.[Medline] [Order article via Infotrieve]

4. Barrett TB, Benditt EW. Platelet-derived growth factor gene expression in human atherosclerotic plaques and normal artery wall. Proc Natl Acad Sci U S A. 1988;85:2810-2814.[Abstract/Free Full Text]

5. Murry CE, Bartosek T, Giachelli CM, Alpers CE, Schwartz SM. Platelet-derived growth factor–A mRNA expression in fetal, normal adult, and atherosclerotic human aortas: analysis by competitive polymerase chain reaction. Circulation. 1996;93:1095-1106.[Abstract/Free Full Text]

6. Rekhter M, Gordon D. Does platelet-derived growth factor-A chain stimulate proliferation of arterial mesenchymal cells in human atherosclerostic plaques? Circ Res. 1994;75:410-417.[Abstract/Free Full Text]

7. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809.[Medline] [Order article via Infotrieve]

8. Heldin C-H, Backstrom G, Ostman A, Hammacher A, Ronnstrand L, Rubin K, Nister M, Westermark B. Binding of different dimeric forms of PDGF to human fibroblasts: evidence for two separate receptor types. EMBO J. 1988;7:1387-1393.[Medline] [Order article via Infotrieve]

9. Claesson-Welsh L, Eriksson A, Westermark B, Heldin C-H. cDNA cloning and expression of the human A-type platelet-derived growth factor (PDGF) receptor establishes structural similarity to the B-type receptor. Proc Natl Acad Sci U S A. 1989;86:4917-4921.[Abstract/Free Full Text]

10. Claesson-Welsh L, Eriksson A, Moren A, Severinsson L, Ek B, Ostman A, Betsholtz C, Heldin C-H. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for a B-chain-containing PDGF molecule. Mol Cell Biol. 1988;8:3476-3486.[Abstract/Free Full Text]

11. Escobedo JA, Navanakasatussas S, Coussens LS, Coughlin SR, Bell GI, Williams LT. A common PDGF receptor is activated by homodimeric A and B forms of PDGF. Science. 1988;240:1532-1535.[Abstract/Free Full Text]

12. Gronwald RGK, Grant EJ, Haldeman BA, Hart CE, O'Hara PJ, Hagen FS, Ross R, Bowen-Pope DF, Murray MJ. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: evidence for more than one receptor class. Proc Natl Acad Sci U S A. 1988;85:3435-3439.[Abstract/Free Full Text]

13. Yoyote K, Mori S, Siegbahn A, Ronnstrand L, Wernstedt C, Heldin C-H, Claesson-Welsh L. Structural determinants in the platelet-derived growth factor alpha-receptor implicated in modulation of chemotaxis. J Biol Chem. 1996;271:5101-5111.[Abstract/Free Full Text]

14. Burgess WH, Maciag T. The heparin-binding (fibroblast) growth factor family of proteins. Annu Rev Biochem. 1989;58:575-606.[Medline] [Order article via Infotrieve]

15. van der Geer P, Hunter T, Lindberg RA. Receptor protein-tyrosine kinases and their signal transduction pathways. Annu Rev Cell Biol. 1994;10:251-337.

16. Weiner HL, Swain JL. Acidic fibroblast growth factor mRNA is expressed by cardiac myocytes in culture and the protein is localized to the extracellular matrix. Proc Natl Acad Sci U S A. 1989;86:2683-2687.[Abstract/Free Full Text]

17. Bonthron DT, Morton CC, Orkin SH, Collins T. Platelet-derived growth factor A chain: gene structure, chromosomal location, and basis for alternative mRNA splicing. Proc Natl Acad Sci U S A. 1988;85:1492-1496.[Abstract/Free Full Text]

18. Rorsman F, Bywater M, Knott TJ, Scott J, Betsholtz C. Structural characterization of the human platelet-derived growth factor A-chain cDNA and gene: alternative exon usage predicts two different precursor proteins. Mol Cell Biol. 1988;8:571-577.[Abstract/Free Full Text]

19. Takimoto Y, Wang ZY, Kobler K, Deuel TF. Promoter region of the human platelet-derived growth factor A-chain gene. Proc Natl Acad Sci U S A. 1991;88:1686-1690.[Abstract/Free Full Text]

20. Lin X, Wang Z, Gu L, Deuel TF. Functional analysis of the human platelet-derived growth factor A-chain promoter region. J Biol Chem. 1992;267:25614-25619.[Abstract/Free Full Text]

21. Bhandari B, Wenzel UO, Marra F, Abboud HE. A nuclear protein in mesangial cells that binds to the promoter of the platelet-derived growth factor A-chain gene. J Biol Chem. 1995;270:5541-5548.[Abstract/Free Full Text]

22. Silverman ES, Khachigian LM, Lindner V, Williams AJ, Collins T. Inducible PDGF A-chain transcription in vascular smooth muscle cells is mediated by Egr-1 displacement of Sp1 and Sp3. Am J Physiol. In press.

23. Khachigian LM, Williams AJ, Collins T. Interplay of Sp1 and Egr-1 in the proximal PDGF-A promoter in cultured vascular endothelial cells. J Biol Chem. 1995;270:27679-27686.[Abstract/Free Full Text]

24. Kaetzel DM, Maul RS, Liu B, Bonthron D, Fenstermaker RA, Coyne DW. Platelet-derived growth factor A-chain transcription is mediated by positive and negative regulatory regions in the promoter. Biochem J. 1994;301:321-327.

25. Wang Z, Lin X-H, Qiu Q-Q, Deuel TF. Modulation of transcription of the platelet-derived growth factor A-chain gene by a promoter region sensitive to S1 nuclease. J Biol Chem. 1992;267:17022-17031.[Abstract/Free Full Text]

26. Dynan WS, Tjian R. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell. 1983;35:79-87.[Medline] [Order article via Infotrieve]

27. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell. 1987;51:1079-1090.[Medline] [Order article via Infotrieve]

28. Sukhatme VP, Cao X, Chang LL, Tsai-Morris C-H, Stamenkovich D, Ferreira PCP, Cohen DR, Edwards SA, Shows TB, Curran T, Le Beau MM, Adamson ED. A zinc-finger encoding gene coregulated with c-Fos during growth and differentiation and after depolarization. Cell. 1988;53:37-43.[Medline] [Order article via Infotrieve]

29. Rauscher FJ III, Morris JF, Tournay OE, Cook DM, Curran T. Binding of the Wilms' tumor locus zinc finger protein to the EGR-1 consensus sequence. Science. 1990;250:1259-1262.[Abstract/Free Full Text]

30. Wang ZY, Madden SL, Deuel TF, Rauscher FJ III. The Wilms' tumor gene product, WT-1, represses transcription of the platelet-derived growth factor A-chain gene. J Biol Chem. 1992;267:21999-22002.[Abstract/Free Full Text]

31. Gay CG, Winkles JA. Heparin-binding growth factor-1 stimulation of human endothelial cells induces platelet-derived growth factor A-chain gene expression. J Biol Chem. 1990;265:3284-3292.[Abstract/Free Full Text]

32. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.

33. Khachigian LM, Fries JWU, Benz MW, Bonthron DT, Collins T. Novel cis-acting elements in the human platelet-derived growth factor B-chain core promoter that mediate gene expression in cultured vascular endothelial cells. J Biol Chem. 1994;269:22647-22656.[Abstract/Free Full Text]

34. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: a common theme in vascular injury. Science. 1996;271:1427-1431.[Abstract]

35. Starksen NF, Harsh GR, Gibbs VC, Williams LT. Regulated expression of the platelet-derived growth factor A chain gene in microvascular endothelial cells. J Biol Chem. 1987;262:14381-14384.[Abstract/Free Full Text]

36. Kavanaugh WM, Harsh GR IV, Starksen NF, Rocco CM, Williams LT. Transcriptional regulation of the A and B chain genes of platelet-derived growth factor in microvascular endothelial cells. J Biol Chem. 1988;263:8470-8472.[Abstract/Free Full Text]

37. Jaye M, Howk R, Burgess W, Ricca GA, Chiu IM, Ravera MW, O'Brien SJ, Modi WS, Maciag T, Drohan WN. Human endothelial cell growth factor: cloning, nucleotide sequence, and chromosomal localization. Science. 1986;233:541-545.[Abstract/Free Full Text]

38. Vlodavsky I, Korner G, Ishai-Michaeli R, Bar-Shavit R, Fuks Z. Extracellular matrix-resident growth factors and enzymes: possible involvement in tumor metastasis and angiogenesis. Cancer Metastasis Rev. 1990;9:203-226.[Medline] [Order article via Infotrieve]

39. Thanos D, Maniatis T. The high mobility group protein HMGI(Y) is required for NF-kappaB-dependent virus induction of the human IFN-beta gene. Cell. 1992;71:777-789.[Medline] [Order article via Infotrieve]

40. Perkins ND, Edward NL, Duckett CS, Agranoff AB. A cooperative interaction between NF-kappaB and Sp1 is required for HIV-1 enhancer activation. EMBO J. 1993;12:3551-3558.[Medline] [Order article via Infotrieve]

41. Du W, Thanos D, Maniatis T. Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements. Cell. 1993;74:887-898.[Medline] [Order article via Infotrieve]

42. Stein B, Baldwin AS. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappaB. Mol Cell Biol. 1993;13:7191-7198.[Abstract/Free Full Text]

43. Stein B, Baldwin AS Jr, Ballard DW, Greene WC, Angel P, Herrlich P. Cross-coupling of the NF-kappaB p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J. 1993;12:3879-3891.[Medline] [Order article via Infotrieve]

44. Neish AS, Read MA, Thanos D, Pine R, Maniatis T, Collins T. Endothelial interferon regulatory factor 1 cooperates with NF-kappaB as a transcriptional activator of vascular cell adhesion molecule 1. Mol Cell Biol. 1995;15:2558-2569.[Abstract]

45. Gerritsen ME, Williams AJ, Neish AS, Moore S, Shi Y, Collins T. CBP/p300 are transcriptional coactivators of p65. Proc Natl Acad Sci U S A. In press.

46. Myers RL, Payson RA, Chotani MA, Deavan LL, Chiu I-M. Gene structure and differential expression of acidic fibroblast growth factor mRNA: identification and distribution of four different transcripts. Oncogene. 1993;8:341-349.[Medline] [Order article via Infotrieve]

47. Chotani MA, Payson RA, Winkles JA, Chiu I-M. Human fibroblast growth factor 1 gene expression in vascular smooth muscle cells is modulated via an alternate promoter in response to serum and phorbol ester. Nucleic Acids Res. 1995;23:434-441.[Abstract/Free Full Text]

48. Hall JA, Harris MA, Intres R, Harris SE. Acidic fibroblast growth factor gene 5' non-coding exon and flanking region from hamster DDT1 cells: identification of the promoter region and transcriptional regulation by testosterone and aFGF protein. J Cell Biochem. 1993;51:116-127.[Medline] [Order article via Infotrieve]

49. Alberts GF, Hsu DKW, Peifley KA, Winkles JA. Differential regulation of acidic and basic fibroblast growth factor gene expression in fibroblast growth factor–treated rat aortic smooth muscle cells. Circ Res. 1994;75:261-267.[Abstract/Free Full Text]

50. Winkles JA, Gay CG. Serum, phorbol ester, and polypeptide mitogens increase class 1 and 2 heparin-binding (acidic and basic fibroblast) growth factor gene expression in human vascular smooth muscle cells. Cell Growth Differ. 1991;2:531-540.[Abstract]

This article has been cited by other articles:

				N. Zhang and L. M. Khachigian Injury-induced Platelet-derived Growth Factor Receptor-{alpha} Expression Mediated by Interleukin-1{beta} (IL-1{beta}) Release and Cooperative Transactivation by NF-{kappa}B and ATF-4: IL-1{beta} FACILITATES HDAC-1/2 DISSOCIATION FROM PROMOTER J. Biol. Chem., October 9, 2009; 284(41): 27933 - 27943. [Abstract] [Full Text] [PDF]

				N. Y. Tan, J.-M. Li, R. Stocker, and L. M. Khachigian Angiotensin II-Inducible Smooth Muscle Cell Apoptosis Involves the Angiotensin II Type 2 Receptor, GATA-6 Activation, and FasL-Fas Engagement Circ. Res., August 28, 2009; 105(5): 422 - 430. [Abstract] [Full Text] [PDF]

				N. Y. Tan and L. M. Khachigian Sp1 Phosphorylation and Its Regulation of Gene Transcription Mol. Cell. Biol., May 15, 2009; 29(10): 2483 - 2488. [Full Text] [PDF]

				K. P. Malabanan, P. Kanellakis, A. Bobik, and L. M. Khachigian Activation Transcription Factor-4 Induced by Fibroblast Growth Factor-2 Regulates Vascular Endothelial Growth Factor-A Transcription in Vascular Smooth Muscle Cells and Mediates Intimal Thickening in Rat Arteries Following Balloon Injury Circ. Res., August 15, 2008; 103(4): 378 - 387. [Abstract] [Full Text] [PDF]

				E. Sanchez-Guerrero, V. C. Midgley, and L. M. Khachigian Angiotensin II induction of PDGF-C expression is mediated by AT1 receptor-dependent Egr-1 transactivation Nucleic Acids Res., April 1, 2008; 36(6): 1941 - 1951. [Abstract] [Full Text] [PDF]

				N. Y. Tan, V. C. Midgley, M. M. Kavurma, F. S. Santiago, X. Luo, R. Peden, R. G. Fahmy, M. C. Berndt, M. P. Molloy, and L. M. Khachigian Angiotensin II-Inducible Platelet-Derived Growth Factor-D Transcription Requires Specific Ser/Thr Residues in the Second Zinc Finger Region of Sp1 Circ. Res., February 29, 2008; 102(4): e38 - e51. [Abstract] [Full Text] [PDF]

				S.-J. Chen, H. Ning, W. Ishida, S. Sodin-Semrl, S. Takagawa, Y. Mori, and J. Varga The Early-Immediate Gene EGR-1 Is Induced by Transforming Growth Factor-beta and Mediates Stimulation of Collagen Gene Expression J. Biol. Chem., July 28, 2006; 281(30): 21183 - 21197. [Abstract] [Full Text] [PDF]

				L. M. Khachigian Early Growth Response-1 in Cardiovascular Pathobiology Circ. Res., February 3, 2006; 98(2): 186 - 191. [Abstract] [Full Text] [PDF]

				M. Stapelberg, N. Gellert, E. Swettenham, M. Tomasetti, P. K. Witting, A. Procopio, and J. Neuzil {alpha}-Tocopheryl Succinate Inhibits Malignant Mesothelioma by Disrupting the Fibroblast Growth Factor Autocrine Loop: MECHANISM AND THE ROLE OF OXIDATIVE STRESS J. Biol. Chem., July 8, 2005; 280(27): 25369 - 25376. [Abstract] [Full Text] [PDF]

				V. C. Midgley and L. M. Khachigian Fibroblast Growth Factor-2 Induction of Platelet-derived Growth Factor-C Chain Transcription in Vascular Smooth Muscle Cells Is ERK-dependent but Not JNK-dependent and Mediated by Egr-1 J. Biol. Chem., September 24, 2004; 279(39): 40289 - 40295. [Abstract] [Full Text] [PDF]

				F. S. Santiago and L. M. Khachigian Ets-1 Stimulates Platelet-Derived Growth Factor A-Chain Gene Transcription and Vascular Smooth Muscle Cell Growth via Cooperative Interactions With Sp1 Circ. Res., September 3, 2004; 95(5): 479 - 487. [Abstract] [Full Text] [PDF]

				T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF]

				R. N. Hasan, S. Phukan, and S. Harada Differential Regulation of Early Growth Response Gene-1 Expression by Insulin and Glucose in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, June 1, 2003; 23(6): 988 - 993. [Abstract] [Full Text] [PDF]

				S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells Blood, December 15, 2002; 100(13): 4454 - 4461. [Abstract] [Full Text] [PDF]

				J. C. Tsai, L. Liu, J. Zhang, K. C. Spokes, J. N. Topper, and W. C. Aird Epidermal growth factor induces Egr-1 promoter activity in hepatocytes in vitro and in vivo Am J Physiol Gastrointest Liver Physiol, November 1, 2001; 281(5): G1271 - G1278. [Abstract] [Full Text] [PDF]

				M. Morimoto, N. Kume, S. Miyamoto, Y. Ueno, H. Kataoka, M. Minami, K. Hayashida, N. Hashimoto, and T. Kita Lysophosphatidylcholine Induces Early Growth Response Factor-1 Expression and Activates the Core Promoter of PDGF-A Chain in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2001; 21(5): 771 - 776. [Abstract] [Full Text] [PDF]

				J. C. Tsai, L. Liu, J. Guan, and W. C. Aird The Egr-1 gene is induced by epidermal growth factor in ECV304 cells and primary endothelial cells Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1414 - C1424. [Abstract] [Full Text] [PDF]

				L. Liu, J. C. Tsai, and W. C. Aird Egr-1 gene is induced by the systemic administration of the vascular endothelial growth factor and the epidermal growth factor Blood, September 1, 2000; 96(5): 1772 - 1781. [Abstract] [Full Text] [PDF]

				E. S. Silverman, L. M. Khachigian, F. S. Santiago, A. J. Williams, V. Lindner, and T. Collins Vascular Smooth Muscle Cells Express the Transcriptional Corepressor NAB2 in Response to Injury Am. J. Pathol., October 1, 1999; 155(4): 1311 - 1317. [Abstract] [Full Text] [PDF]

				F. S. Santiago, D. G. Atkins, and L. M. Khachigian Vascular Smooth Muscle Cell Proliferation and Regrowth after Mechanical Injury in Vitro Are Egr-1/NGFI-A-Dependent Am. J. Pathol., September 1, 1999; 155(3): 897 - 905. [Abstract] [Full Text] [PDF]

				F. L. Day, L. A. Rafty, C. N. Chesterman, and L. M. Khachigian Angiotensin II (ATII)-inducible Platelet-derived Growth Factor A-chain Gene Expression Is p42/44 Extracellular Signal-regulated Kinase-1/2 and Egr-1-dependent and Mediated via the ATII Type 1 but Not Type 2 Receptor. INDUCTION BY ATII ANTAGONIZED BY NITRIC OXIDE J. Biol. Chem., August 20, 1999; 274(34): 23726 - 23733. [Abstract] [Full Text] [PDF]

				L. M. Khachigian, F. S. Santiago, L. A. Rafty, O. L.-W. Chan, G. J. Delbridge, A. Bobik, T. Collins, and A. C. Johnson GC Factor 2 Represses Platelet-Derived Growth Factor A-Chain Gene Transcription and Is Itself Induced by Arterial Injury Circ. Res., June 11, 1999; 84(11): 1258 - 1267. [Abstract] [Full Text] [PDF]

				E. S. Silverman and T. Collins Pathways of Egr-1-Mediated Gene Transcription in Vascular Biology Am. J. Pathol., March 1, 1999; 154(3): 665 - 670. [Full Text] [PDF]

				F. S. Santiago, H. C. Lowe, F. L. Day, C. N. Chesterman, and L. M. Khachigian Early Growth Response Factor-1 Induction by Injury Is Triggered by Release and Paracrine Activation by Fibroblast Growth Factor-2 Am. J. Pathol., March 1, 1999; 154(3): 937 - 944. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delbridge, G. J. Articles by Khachigian, L. M. Search for Related Content PubMed PubMed Citation Articles by Delbridge, G. J. Articles by Khachigian, L. M.