Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1997;81:76-85

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marian, A. J.
Right arrow Articles by Yu, Q.-t.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marian, A. J.
Right arrow Articles by Yu, Q.-t.
(Circulation Research. 1997;81:76-85.)
© 1997 American Heart Association, Inc.


Articles

Expression of a Mutant (Arg92Gln) Human Cardiac Troponin T, Known to Cause Hypertrophic Cardiomyopathy, Impairs Adult Cardiac Myocyte Contractility

Ali J. Marian, Guiling Zhao, Yukihiro Seta, Robert Roberts, , Qun-tao Yu

From the Section of Cardiology, Department of Medicine, Baylor College of Medicine, Houston, Tex.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract The mechanism(s) by which mutations in sarcomeric proteins cause hypertrophic cardiomyopathy (HCM) remains unknown. A leading hypothesis proposes that mutant sarcomeric proteins impair cardiac myocyte contractility, providing an impetus for compensatory hypertrophy. To test this hypothesis, we determined the impact of expression of a mutant (Arg92Gln) human cardiac troponin T (cTnT), known to cause HCM in humans, on adult cardiac myocyte contractility. A full-length human cTnT cDNA was cloned, and the Arg92Gln mutation was induced. Recombinant adenoviruses Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln were generated through homologous recombination. Adult feline cardiac myocytes were infected with recombinant adenoviruses or a control viral vector (Ad5{Delta}E1) at a multiplicity of infection of 100. Expression levels of the full-length normal and mutant cTnT proteins were equal on Western blots. Expression of the exogenous cTnT proteins in cardiac myocytes was also shown by immunocytochemistry and immunofluorescence, and their incorporation into myofibrils was confirmed by Western blotting on myofibrillar extracts. Electron microscopy showed intact sarcomere structure in rod-shaped cardiac myocytes in all groups. Cell fractional shortening and the peak velocity of shortening were not significantly different among the groups 24 hours after transduction. However, 48 hours after transduction, both fractional shortening and the peak velocity of shortening were significantly reduced (24% [P<.001] and 26% [P<.001], respectively) in cardiac myocytes in the Ad5/CMV/cTnT-Arg92Gln compared with the Ad5/CMV/cTnT-N groups. The magnitude of the reductions was greater at 72 hours after transduction (45% and 39%, respectively; P<.001). Our results indicated that expression of the mutant (Arg92Gln) cTnT, known to cause HCM in humans, impaired intact adult cardiac myocyte contractility. Our data also show that both normal and mutant cTnT were incorporated into myofibrils. These results provide a potential mechanism by which mutations in sarcomeric proteins cause HCM.


Key Words: troponin T • hypertrophic cardiomyopathy • sarcomere • contractility • gene transfer


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Hypertrophic cardiomyopathy, a paradigm of cardiac hypertrophy and failure, is caused by mutations in genes coding for sarcomeric proteins.1 2 Thus far, mutations in six genes coding for the sarcomeric proteins, namely, ß-MyHC, cTnT, myosin binding protein-C, {alpha}-tropomyosin, and essential and regulatory light chains, in patients with HCM have been identified.1 2 3 4 5 6 The ß-MyHC and cTnT genes are the most common responsible genes, accounting for one third and one fourth of the HCM cases.1 Identification of mutations in six different sarcomeric proteins suggests that HCM is a disease of the sarcomeric proteins. Although the mechanism(s) by which mutations in the sarcomeric proteins cause HCM remains unknown, it is generally accepted that hypertrophy, the phenotypic hallmark of HCM, is a compensatory phenomenon.1 2 However, the primary defect that provides the impetus for the compensatory hypertrophy is not known.

We and others have postulated that a primary defect caused by mutations in the sarcomeric proteins is an impaired contractility, which provides the impetus for compensatory hypertrophy.1 2 3 The results of in vitro functional studies, showing an impaired ability of the isolated muscle fibers from patients with ß-MyHC mutations or the expressed mutant {alpha}-MyHC protein to displace the actin filaments, provide credence to this hypothesis.7 8 9 10 11 Additional support for this hypothesis is provided by the results of a recent study by Watkins et al12 showing that expression of a truncated cTnT protein in cultured quail myotubes impairs their contractile performance. It is intriguing, however, that despite an impaired actomyosin interaction in in vitro functional studies, the left ventricular ejection fraction, a measure of systolic function, is normal or increased in patients with HCM.13 Moreover, the surprising results of a recent in vitro motility study of a mutation in the 5' region of rat cTnT, showing an increased sliding speed of the mutant thin-filament movement over the heavy meromyosin,14 further emphasize the need to understand the direct influence of mutant sarcomeric proteins on intact adult cardiac myocyte function.

We have previously used the highly efficient recombinant adenoviruses to express a mutant sarcomeric protein, ß-MyHC, in adult cardiac myocytes and have shown that expression of the mutant ß-MyHC protein disrupts the sarcomere structure 5 days after transduction.11 However, the functional significance of the expression of mutant sarcomeric proteins in adult cardiac myocytes with preserved sarcomere structure has not been examined. Accordingly, in the present study, we constructed recombinant adenoviruses and expressed normal and mutant (Arg92Gln) human cardiac troponin T (the latter is known to cause HCM in humans) in adult feline cardiac myocytes. We then determined the impact of expression of the normal and mutant human cTnT proteins on adult cardiac myocyte contractility as measured by cell fractional shortening and the peak velocity of shortening.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cloning of a Full-Length Human cTnT cDNA
A full-length (1.1-kb) human cTnT cDNA was isolated as a single fragment from a normal human heart cDNA library (Stratagene) by a conventional library screening method.15 In brief, a human cTnT cDNA probe was synthesized by reverse-transcription PCR using an antisense oligonucleotide primer (5'AGATCTTTGGTGAAGGAGGCCAG3') specific to the 3' untranslated region per published protocols.16 The probe was radiolabeled to a specific activity of >109 cpm/µg with [32P]dCTP (Amersham) by the random primer procedure of Feinberg and Vogelstein.17 The positive clones were sequenced by cycle sequencing18 and compared with the published sequences of human cTnT cDNA.19 20

Mutagenesis
We chose to study the human cTnT-Arg92Gln mutation because it is associated with a high incidence of sudden cardiac death in patients with HCM and because the codon 92 appears to be a relatively hot spot for mutations.21 22 The Arg92Gln mutation was induced by oligonucleotide-mediated site-directed mutagenesis.23 In brief, two sets of mutagenic oligonucleotide primers, one with a G->A substitution in the antisense primer and a second with the corresponding C->T substitution in the sense primer, were designed and used to amplify two overlapping segments of cTnT cDNA encompassing exon 9 (the site of the mutation). The PCR products were denatured, reannealed, elongated, and amplified to produce a single cTnT cDNA fragment with the G287A mutation. The final PCR product was sequenced, and the presence of the G->A substitution was confirmed.

Generation of the Recombinant Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln Viruses
The techniques used for generation of the recombinant adenoviruses for the cTnT constructs were similar to those published previously, with the exception of using pJM17 (Microbix Biosystems Inc) in homologous recombination.11 The normal and the mutant cTnT cDNAs, described above, were placed downstream from a CMV promoter. The CMV/cTnT-N and CMV/cTnT-Arg92Gln inserts were subcloned into p{Delta}E1spIB1 (shuttle vector) and subsequently were rescued into pJM17 through homologous recombination in 293 cells.24 pJM17 carries the entire length of the adenovirus DNA, except for a deletion in the E3 region. Recombination of the homologous DNA sequences in pJM17 and p{Delta}E1spIB1/CMV/cTnT-N or p{Delta}E1spIB1/CMV/cTnT-Arg92Gln, after cotransfection of 293 cells, resulted in the production of recombinant replication-deficient viruses that carry the cTnT expression cassettes in place of the original E1 region (Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln). The recombinant viruses were propagated, titrated, purified in 293 cells according to the protocol published by Graham and Prevec,25 and stored in 1x PBS (GIBCO-BRL). The final titers of the adenoviral stocks were 3.8x1010, 7.6x109, and 4.9x109 plaque-forming units/mL for Ad5/{Delta}E1, Ad5/CMV/cTnT-N, and Ad5/CMV/cTnT-Arg92Gln, respectively.

Western Blotting
In the first set of experiments, we tested five different anti–troponin T antibodies in order to distinguish between human and feline cTnT proteins. Total protein was extracted from the explanted hearts (left ventricular myocardium) of cardiac transplant patients and from the feline left ventricular myocardium in a lysis buffer containing 50 mmol/L Tris, 2% Triton X-100, and 5 mmol/L BME. The concentration of the total protein in each extract was determined with a spectrophotometer by using a protein assay kit (Bio-Rad). A 10-µg aliquot of total protein extract was loaded onto each well in a 12% nondenaturing SDS-polyacrylamide gel and was subjected to electrophoresis. The separated proteins were transferred to polyvinylidene difluoride (Bio-Rad) membranes. Membranes were then incubated with a blocking buffer containing 0.1% Tween 20 and 1% nonfat dry milk in 1x PBS. The ability of five different anti–troponin T antibodies to distinguish between the exogenous (human) and the endogenous (feline) cTnT proteins was tested at serial dilution by Western blotting. These antibodies were as follows: purified mouse monoclonal anti–troponin T antibody IgG1–clone JLT-12 (No. CP05, Oncogene), anti-human cTnT Mab CR4037M (Cortex Biochemicals), anti-human cTnT affinity-purified polyclonal antibody CR4037GAP (Cortex Biochemicals), mouse anti–troponin T antibody MCA470 (Serotec Ltd), and a custom-made rabbit anti-human cTnT polyclonal antibody (Cocalico Biologicals, Inc).

After identification of an antibody that distinguished between the human and feline cTnT proteins, expression of the full-length normal and mutant human cTnT proteins, initially in 293 cells and subsequently in adult cardiac myocytes, was shown by Western blotting. The 293 cells were cultured to a confluence of {approx}70% and were then infected with recombinant Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln at an MOI of 1. After 48 hours, cells were collected and lysed, and the total protein concentration was measured as described above. A 10-µg aliquot of the total protein extract was loaded into each well in a 12% nondenaturing SDS-polyacrylamide gel, subjected to electrophoresis, and then transferred to a polyvinylidene difluoride membrane. After incubation with a blocking buffer (0.1% Tween 20 and 1% nonfat dry milk in 1x PBS), the membrane was incubated with 1:1000 dilution of anti–troponin T antibody JLT-12 at room temperature for 60 minutes.26 The membrane then was exposed to 1:10 000 dilution of goat anti-mouse alkaline phosphatase conjugate for 60 minutes, and the signals were detected by chemiluminescence, per recommendation of the manufacturer (Clontech).

To demonstrate expression of the exogenous cTnT proteins in adult cardiac myocytes, cells were isolated from adult feline ventricular myocardium and cultured in medium 199/0.1% human serum albumin (HSA) for 24 hours on 35-mm plates coated with laminin at a cell density of {approx}5x104 cells per plate.11 27 28 The cardiac myocytes were then infected with recombinant adenoviruses, including a vector virus alone for 4 hours at an MOI of 100, previously shown to confer 100% transduction efficiency.11 The viral solution was then removed, and cardiac myocytes were cultured for an additional 24, 48, or 72 hours. Cardiac myocytes were then lysed, and a 10-µg aliquot of each lysate was used in Western blotting as described above. To quantify the expression levels of the normal and mutant cTnT proteins, the experiments were repeated five times, and the density of the bands corresponding to the cTnT proteins was measured using an image digitizer/analyzer (Alpha Imager 2000, version 3.0, Alpha Inotech Corp).

The relative expression levels of the exogenous (human) and the endogenous (feline) cTnT proteins were determined by Western blotting using Mab CR4037M, which cross-reacts equally with human and feline cTnT proteins. Again, a 10-µg aliquot of each protein extract was loaded onto a polyacrylamide gel, and Western blotting was performed as described. The experiments were repeated three times, and the relative density of the corresponding bands was determined as described above.

Furthermore, the relative expression levels of two additional sarcomeric proteins, ie, troponin I and {alpha}-tropomyosin, in the experimental groups were determined by Western blotting. The former was detected using mouse anti-human troponin I antibody MCA1208 (Serotec, Ltd) and the latter using monoclonal mouse anti-tropomyosin (sarcomeric) antibody CH1 (Sigma Chemical Co). The expression levels were quantified as described above.

Indirect Immunofluorescence
Isolated adult cardiac myocytes were infected with recombinant adenoviruses at an MOI of 100 as described above. Cardiac myocytes were washed twice and incubated for 10 minutes with 4°C cold RS buffer containing (mmol/L) KCl 80, MgCl2 10, EDTA 1, ATP 5, and potassium phosphate 6.6 (pH 6.35), along with protease inhibitors aprotinin (1 µg/mL), pepstatin A (1 µg/mL), and phenylmethylsulfonyl fluoride (100 µg/mL). Cardiac myocytes were then incubated for 10 minutes in 4°C homogenization buffer containing 0.5 mol/L sucrose, 0.5% Triton X-100, and 1 mmol/L EDTA, after which cardiac myocytes were fixed with 4°C cold 3.7% formaldehyde for 10 minutes, washed with RS buffer, and permeabilized through incubation with gradients of ethanol concentration. Subsequently, cardiac myocytes were incubated with 10% goat serum in RS buffer for 1 hour, washed with RS buffer, and then incubated for 1 hour with JLT-12 Mab as the primary antibody at multiple serial dilution ranging from 1:10 to 1:100. This was followed by three washes in RS buffer, each time for 5 minutes. Cardiac myocytes were then incubated for 1 hour with a rhodamine-conjugate affinity-purified goat anti-mouse IgG [F(ab')2 fragment] (Boehringer Mannheim Co) as the secondary antibody at serial dilutions ranging from 1:100 to 1:10 000. After antibody treatment, samples were washed in RS buffer, including a final wash in water, dried, and mounted using FluorSave reagent (Calbiochem).

Immunocytochemistry
After transduction with recombinant adenoviruses, isolated cardiac myocytes were fixed in 3.7% paraformaldehyde and 0.1% Triton X-100 for 5 minutes and permeabilized in 100% acetone at -20°C for 15 minutes. After they were washed with PBS, cardiac myocytes were then incubated with the JLT-12 Mab at a concentration of 1:25 for 2 hours. The primary antibody was removed through washing with PBS three times. Cardiac myocytes were then incubated with an alkaline phosphatase–conjugate goat anti-mouse IgG antibody at a concentration of 1:500. Cardiac myocytes were then treated with an alkaline phosphatase enhancer and exposed to Fast Red chromogen (Biomeda) per instructions of the manufacturer. Cardiac myocytes were then examined under direct light microscopy.

Isolation of Myofibrillar and Soluble cTnT Protein
Myofibrils were isolated according to published protocols, with minor modifications.29 Cardiac myocytes, 48 hours after transduction with recombinant adenoviruses, were washed twice with RS buffer (described earlier). Cardiac myocytes were then homogenized for 10 minutes at 4°C in RS buffer to which 0.5 mol/L sucrose, 0.5% Triton X-100, and 1 mmol/L dithiothreitol were added. Subsequently, cardiac myocytes were collected and centrifuged at 15 000g for 30 minutes at 4°C to precipitate the myofibrils. The supernatant (soluble component) was carefully removed and saved for analysis. The pellet (myofibrils) was then lysed in a buffer containing 2% Triton X-100, 50 mmol/L Tris, and 5 mmol/L BME for 10 minutes at 4°C. After determination of the concentration of the protein in the soluble and myofibrillar components, {approx}10-µg aliquots of the proteins were loaded onto a 12% polyacrylamide gel, and Western blotting was performed with JLT-12 Mab as described above.

Electron Microscopy
Electron microscopy was performed as previously described.11 In brief, cultured cardiac myocytes, 48 hours after transduction with adenoviruses, were fixed with 3% glutaraldehyde in 0.1 mol/L sodium cacodylate buffer (pH 7.2) overnight and postfixed in 0.1 mol/L sodium cacodylate buffered with 1% osmium tetroxide. Cardiac myocytes were dehydrated in graded concentrations of ethanol and were flat-embedded by using a Spurr kit according to the method of Brinkley et al.30 After polymerization for 24 hours at 60°C, cardiac myocytes were examined with a phase microscope, and selected cells were marked, bored out of the disk, and glued to the top of a blank epoxy resin peg. Thin sections of the selected cardiac myocytes were cut on an RMC/MT6000 ultramicrotome (Research and Manufacturing Company) using a diamond knife. Sections were picked up on collodion-coated slotted grids and stained with alcoholic uranyl acetate, followed by lead citrate. The sections were then examined and photographed on a Philips EM410 electron microscope. A total of 20 cardiac myocytes per experimental group were examined at magnifications of x3000, x10 000, and x24 000.

Cardiac Myocyte Contractile Indexes
The cardiac myocyte fractional shortening and peak velocity of shortening were measured as previously described.27 28 In brief, isolated cardiac myocytes were cultured in medium 199/0.1% HSA and were allowed to attach to a laminin substrate coated on glass coverslips overnight. Then the cells were infected with recombinant adenoviruses carrying normal or mutant cTnT constructs at an MOI of 100 for 4 hours, after which viruses were removed and cardiac myocytes were cultured (quiescent) for an additional 24, 48, or 72 hours. Cell motion was studied at 37.0°C, at a frequency of 0.25 Hz, with 100-mA DC pulses of alternating polarity in order to minimize electrolysis. Only isolated cardiac myocytes that had maintained rod-shaped morphology, had intact cross striation, were attached to laminin on glass coverslips, and had clear sharp edges were examined by a video-edge detection system. A minimum of 10 cycles for each cardiac myocyte was recorded, and the mean±SD values were calculated to represent each cardiac myocyte. A total of 80 rod-shaped cardiac myocytes per experimental group (20 cells per group per set of experiments and four different sets of experiments) were examined at 48 hours for percentage of cell length shortening (fractional cell shortening) and peak velocity of shortening. In addition, contractile indexes were measured in a total of 30 rod-shaped cardiac myocytes per group at 24 and 72 hours after transduction.

Statistical Methods
The differences in the mean±SD values of fractional shortening between multiple groups were compared by ANOVA, and the homogeneity of variances was analyzed by Bartlett's test. The differences in the mean values between two groups were compared by the Bonferroni multiple-comparison test. The sample size for contractility measurements was calculated to provide >80% power to detect a 20% difference in fractional cell shortening at a value of P<=.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Generation of the Recombinant Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln Adenoviruses
The size of the full-length cTnT clone was 1.1 kb, which encoded for the full-length cTnT protein composed of 288 amino acids and a molecular mass of 35 kD. The sequence of the cTnT protein was completely identical to that of the adult cTnT protein published by Townsend et al19 and differed from the sequence published by Mesnard et al20 at amino acid positions 129 (R instead of K) and 239 (T instead of S).

The maps of the final recombinant adenoviral constructs carrying the cTnT-N and cTnT-Arg92Gln cDNA inserts are shown in Fig 1ADown. The successful homologous recombination and rescue of the cTnT inserts into the E1 region were confirmed by PCR and direct sequencing, as shown in Fig 1BDown. The normal and mutant cTnT constructs differed only in a G->A nucleotide substitution that resulted in replacement of glutamine (Gln) for arginine (Arg) at position 92 of the cTnT protein.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. A, Schematic structure of the recombinant adenoviral constructs. B, Sequence of the final constructs confirming the presence of a G->A mutation (Arg92Gln) in the Ad5/CMV/cTnT-M construct.

Western Blotting
JLT-12 Mab was able to distinguish between human and feline cTnT proteins extracted from explanted human and feline hearts, respectively. As shown in Fig 2Down, a 35-kD band was present only in the lane representing the protein extract from an explanted human heart. Expression of the constructs into full-length cTnT in 293 cells (figure not shown) and adult feline cardiac myocytes was confirmed by the presence of a 35-kD band corresponding to the size of the expected full-length cTnT protein (Fig 3Down). At 48 hours after transduction, the expected 35-kD bands were present in lanes representing the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups, indicating expression of the full-length human cTnT proteins. No signal was detected in lanes representing the control cardiac myocytes or Ad5/{Delta}E1 groups, further evidence of the ability of the JLT-12 Mab to distinguish between the exogenous (human) and the endogenous (feline) cTnT. The mean densities of the bands corresponding to the normal and the mutant cTnT proteins, derived from five independent Western blots, were not significantly different (relative mean±SD densities, 1.0±0.12 versus 1.08±0.15, respectively; P=.38).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Western blot showing the ability of the JLT-12 Mab to distinguish between human and feline cTnT proteins. Aliquots (10 µg) of the total protein extracts from an explanted human heart (left ventricle) and cat left ventricular myocardium were loaded onto the corresponding lanes. After treatment with the JLT-12 monoclonal antibody, a 35-kD band, corresponding to the size of the full-length human cTnT protein, was detected only in the lane representing the human heart protein extract.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 3. Western blot showing expression of the full-length human cTnT protein in adult feline cardiac myocytes. One 10-µg aliquot of the total protein extracts was loaded per lane. The first lane represents the protein extract from an explanted human heart as a positive control. The remaining four lanes represent the four experimental groups. No protein was detected in lanes representing feline cardiac myocytes (control) and Ad5/{Delta}E (vector virus alone). In contrast, a 35-kD band, corresponding to the full-length human cTnT protein, was detected in lanes representing the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln constructs. The expression levels of the mutant and normal cTnT proteins were equal, as measured by a densitometer.

The relative expression levels of the endogenous (feline) and the exogenous (human) cTnT proteins were assessed by Western blotting using the anti–troponin T antibody CR4037M at a concentration of 1:1000. The results are shown in Fig 4ADown. The density of the cTnT bands in lanes representing Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln was greater than that in lanes representing the noninfected control cardiac myocytes or those infected with the Ad5/{Delta}E1 virus alone. The expression levels of the total cTnT protein (endogenous feline+exogenous human) in cardiac myocytes in the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups were 122±9% and 128±8% (mean±SD), respectively, of the level in the control cardiac myocytes.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. Western blots showing expression of the endogenous cTnT, troponin I, and {alpha}-tropomyosin proteins. One 10-µg aliquot of the total protein extracts was loaded per lane. Lanes are labeled as described in Fig 3Up. A, Expression of the total cTnT protein in the experimental groups detected using the monoclonal anti–troponin T antibody CR4037M. This antibody cross-reacts with human and feline cTnT proteins. As shown, the density of the 35-kD bands was greater in lanes representing the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups than in the control cardiac myocytes (22% and 28% greater, respectively) or those transduced with Ad5/{Delta}E1 alone. B, Expression levels of the endogenous cardiac troponin I protein in the experimental groups detected using the mouse anti-human troponin I antibody MCA1208. There were no significant differences in the expression levels of endogenous cardiac troponin I in the experimental groups. C, Expression levels of the endogenous {alpha}-tropomyosin protein in the experimental groups detected using the monoclonal mouse anti-tropomyosin (sarcomeric) antibody CH1. Again, no significant differences in the expression levels of {alpha}-tropomyosin were detected.

Expression levels of the endogenous troponin I and {alpha}-tropomyosin proteins in the experimental groups were examined by Western blotting using a mouse anti-human troponin I antibody, MCA1208 (Serotec, Ltd), and a monoclonal mouse anti-tropomyosin (sarcomeric) antibody, CH1 (Sigma), at a dilution of 1:1000, respectively. The results are shown in Fig 4BUp and 4CUp, respectively. Overall, the results of five independent sets of experiments showed no significant change in the expression levels of troponin I and {alpha}-tropomyosin proteins in the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups compared with those in the control cardiac myocytes.

Indirect Immunofluorescence
A final dilution of 1:100 of the JLT-12 Mab and 1:5000 of the rhodamine-conjugate goat anti-mouse IgG as the primary and secondary antibodies, respectively, were used in indirect immunofluorescence studies. Minimal background staining was present in the control cardiac myocytes or those transduced with the Ad5/{Delta}E vector virus alone (Fig 5ADown and 5BDown). Diffuse staining of the myofibrillar structures was observed in >95% of the cardiac myocytes transduced with the normal or mutant cTnT constructs (Fig 5ADown and 5BDown). There were no significant differences in the immunofluorescence staining patterns of the myofibrillar structure of cultured rod-shaped adult cardiac myocytes expressing the normal or mutant exogenous (human) cTnT proteins. The diffuse staining of the cardiac myocytes transduced with the recombinant adenoviruses is probably reflective of the abundance of the exogenous cTnT in the soluble (unincorporated) form in the transduced cells.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Indirect immunofluorescence using JLT-12 Mab. A, Control nontransduced cardiac myocytes. B, Cardiac myocytes transduced with vector virus alone. C and D, Cardiac myocytes transduced with Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln, respectively. No significant fluorescence activity was detected in the control cardiac myocytes or those infected with Ad5/{Delta}E (vector virus alone) as shown in panels A and B. In contrast, diffuse fluorescence activity was detected in >95% of the cardiac myocytes in the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups, respectively (C and D). The diffuse staining of the adult cardiac myocytes after transduction with the recombinant adenoviral constructs is probably due to the presence of the exogenous cTnT protein in the soluble (unincorporated) form as well.

Immunocytochemistry
Immunocytochemistry was used to detect expression of the exogenous cTnT proteins in adult cardiac myocytes, and the result is shown in Fig 6Down. The JLT-12 Mab used for immunocytochemistry did not cross-react with the endogenous (feline) cTnT, as evidenced by the lack of staining for red chromogen in the control cardiac myocytes (Fig 6ADown) and by cardiac myocytes infected with Ad5/{Delta}E1 vector alone (Fig 6BDown). In contrast, expression of the exogenous (human) cTnT in the cardiac myocytes infected with recombinant adenoviruses expressing normal (Fig 6CDown) and mutant (Fig 6DDown) was demonstrated by the presence of red chromogen. Diffuse staining of the cardiac myocytes was observed in both the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups.



View larger version (114K):
[in this window]
[in a new window]
 
Figure 6. Immunocytochemistry using JLT-12 Mab. A, Control nontransduced cardiac myocytes. B, Cardiac myocytes transduced with vector virus alone. C, Cardiac myocytes transduced with Ad5/CMV/cTnT-N. D, Cardiac myocytes transduced with Ad5/CMV/cTnT-Arg92Gln. Although no exogenous cTnT expression was detected in panels A and B (control groups), diffuse red staining of the cardiac myocytes was present in cardiac myocytes in the Ad5/CMV/cTnT-N and Ad5/CMV/cTnT-Arg92Gln groups (C and D, respectively).

The gross morphology (ball-shaped versus rod-shaped cells) of 200 cardiac myocytes exhibiting expression of the exogenous cTnT, as evidenced by red staining, was determined. Thirty-nine percent of the cardiac myocytes staining positive for cTnT-Arg92Gln expression were ball-shaped, and the remainder (61%) were rod-shaped. In contrast, the majority (78%) of cardiac myocytes that stained positive for the normal cTnT had rod-shaped morphology (P<.0001).

Myofibrillar and Soluble cTnT
The presence of exogenous (human) normal and mutant cTnT proteins in the soluble and myofibrillar protein extracts was detected by Western blotting, as shown in Fig 7Down. As shown, the normal and the mutant cTnT proteins were present in the soluble as well as myofibrillar extracts. Thus, the presence of the exogenous (human) cTnT proteins (normal and mutant) in the myofibrillar protein extracts indicated incorporation of these proteins into myofibrils in adult cardiac myocytes.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Western blot performed on myofibrillar protein extracts using JLT-12 Mab. Myofibrillar proteins were extracted, and 10-µg aliquots of the soluble (top) and myofibrillar (bottom) extracts were loaded onto the corresponding lanes. JLT-12 was used to detect the presence of the exogenous human cTnT. Lanes are labeled as described in Fig 3Up. As shown, a 35-kD protein was detected in lanes representing the human heart protein extract (positive control), Ad5/CMV/cTnT-N, and Ad5/CMV/cTnT-Arg92Gln groups. The cTnT proteins were detected both in the soluble and the myofibrillar protein extracts.

Electron Microscopy
The structure of the sarcomeres was intact in the rod-shaped cardiac myocytes in all experimental groups, including those in the Ad5/CMV/cTnT-Arg92Gln group (Fig 8Down). Orderly organization of the Z bands and thick and thin filaments was observed in all rod-shaped cardiac myocytes at 48 hours after transduction in all experimental groups.



View larger version (117K):
[in this window]
[in a new window]
 
Figure 8. Sarcomere structure. Adult cardiac myocytes were examined under electron microscopy at magnifications of x3000, x10 000, and x24 000. Only the x10 000 magnifications are shown. A, Control nontransduced cardiac myocytes. B, Cardiac myocytes transduced with vector virus alone. C, Cardiac myocytes transduced with Ad5/CMV/cTnT-N. D, Cardiac myocytes transduced with Ad5/CMV/cTnT-Arg92Gln. The orderly alignment of the sarcomere structure, thin and thick filaments, and registration of the Z bands were present in all four groups.

Cardiac Myocyte Contractile Indexes
Cell fractional shortening and the peak velocity of shortening were measured only in adult cardiac myocytes that were rod-shaped, had intact cross striation, were attached to laminin on glass coverslips, and had clear sharp edges (necessary for edge detection). Cardiac myocytes showing any evidence of structural abnormalities, such as loss of cross striation and fraying of edges, were not used for measurement. In addition, cardiac myocytes showing <2% fractional shortening were not included in the analysis because of the inherent limitation of the video-edge detection method. Fractional cell shortening and the peak velocity of shortening, as measures of cardiac myocyte contractile function, were measured in 80 cells per group at 48 hours and in 30 cells per group at 24 and 72 hours after transduction, and the mean±SD values were compared. The results are shown in Fig 9Down. As shown, there was no significant difference in the fractional cell shortening or peak velocity of contraction among groups at 24 hours after transduction. However, 48 hours after transduction, the peak velocity of shortening and the fractional cell shortening were significantly reduced in cardiac myocytes in the Ad5/CMV/cTnT-Arg92Gln group compared with those in the Ad5/CMV/cTnT-N group (26% and 24% reductions, respectively; P<.001). The magnitude of these reductions was greater at 72 hours after transduction (45% and 39%, respectively; P<.001), as shown in Fig 9Down. Of note, there was no significant difference in the fractional shortening or the peak velocity of shortening of cardiac myocytes in the Ad5/CMV/cTnT-N group compared with the control group (noninfected cardiac myocytes or Ad5/{Delta}E1).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 9. Cardiac myocyte contractile indexes. Cell fractional shortening (percentage) and peak velocity of shortening were measured 24, 48, and 72 hours after transduction with the recombinant adenoviruses. As shown, cell fractional shortening and the peak velocity of shortening were not significantly different at 24 hours after transduction. However, when measured at 48 and 72 hours after transduction, both indexes of contractile performance of the cardiac myocytes were significantly reduced in only the cTnT-Arg92Gln group.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We have expressed normal and mutant (Arg92Gln) human cTnT proteins in adult feline cardiac myocytes and have shown that expression of the mutant cTnT-Arg92Gln protein impaired the contractile performance of intact adult cardiac myocytes in a time-dependent manner. Impairment of the contractile indexes occurs in the absence of a significant disruption in the sarcomere structure. Our data also suggest that both normal and mutant cTnT proteins were incorporated into myofibrils in adult cardiac myocytes. The present study is the first to show that expression of a mutant cTnT protein impairs adult cardiac myocyte function, and the results support the hypothesis that a primary defect induced by mutations in the sarcomeric proteins is an impaired cardiac myocyte contractile performance. Impaired cardiac myocyte contractility could provide the impetus for compensatory hypertrophy in HCM.

The results of the present study showing an impaired cardiac myocyte contractile performance are consistent with the results of a recent study by Watkins et al,12 who expressed a truncated human cTnT in quail myotubes and showed an impaired force of contraction. In addition, Watkins et al demonstrated incorporation of the truncated protein into myofibrils and subsequent focal disruption of the myofibrillar structure. However, our results are in apparent contrast to the results of a recent study by Lin et al,14 who reported an increased velocity of displacement of the thin filament with a mutation in the 5' end of cTnT over the heavy meromyosin in an in vitro motility assay. Differences in the nature of the mutations studied and in the design of the experiments, ie, in vitro motility assay of isolated protein versus fractional cell shortening and the peak velocity of shortening of adult cardiac myocytes, could account for the apparent contrasting results. The Arg92Gln mutation studied by us is located within a major binding site for {alpha}-tropomyosin,31 32 33 34 whereas the murine cTnT-Ile91Asn, reported by Lin et al (corresponding to the human cTnT-Ile79Asn mutation), is located outside of the {alpha}-tropomyosin binding site.14 The significance of the topography of cTnT mutations in influencing sarcomere structure and function has been documented through studies of cTnT mutation in Drosophila melanogaster.35 Mutations in the 5' end of the troponin T gene may not have a major influence on muscle function on unloaded conditions, as shown for the upheld101 and indented thorax mutations in D melanogaster.35 Moreover, Fisher et al36 also have shown that truncation of the NH2 terminal of skeletal muscle troponin T had no significant influence on Ca2+ sensitivity of thin-filament assembly. In addition, the results of functional studies of mutations in the troponin T gene (mup-2) of Caenorhabditis elegans, showing a defective muscle contraction and an inability to develop coordinated rolling, corroborate our findings.37 Therefore, given the differences in the design of experiments, it is conceivable that different mutations induce the HCM phenotype through different mechanisms. Thus, it is also possible that the ultimate phenotype of hypertrophy could occur as a result of an unfavorable metabolic state in which myofibrillar function is actually enhanced by the underlying mutations.

The model used in the present study has several strengths and weaknesses. The use of recombinant adenoviruses provides for a high efficiency of gene transfer into adult cardiac myocytes, reaching {approx}100% at an MOI of 100.11 38 This provides for the ability to perform functional studies of mutations in the sarcomeric proteins in a model (feline adult ventricular myocytes) that is more likely to be reflective of HCM in humans, since cats are also known to develop HCM with a phenotypic expression that is similar to that in humans.39 Feline cardiac myocytes are also known to form and maintain stable orderly sarcomere structure in culture at least for 2 weeks.40 The high efficiency of transduction of adult cardiac myocytes also reduces the chance of data contamination as a result of admixture of transduced and nontransduced cells. In the present study, equal expression levels of the full-length normal and mutant cTnT proteins were documented in adult cardiac myocytes as well as in myofibrils. The relatively slow turnover of the sarcomeric proteins in cardiac myocytes limits the ability of the forced, expressed, exogenous proteins to displace the endogenous protein and exert an effect.41 Despite the relatively long half-life of the endogenous cTnT protein in cardiac myocytes and only a 20% to 30% increase in the total cTnT protein level in adult cardiac myocytes, the mutant cTnT-Arg92Gln impaired the cardiac myocyte contractile performance. The time-dependent reduction in the contractile performance of adult cardiac myocytes is reflective of a greater chance for the mutant cTnT protein to displace the normal endogenous cTnT. These data suggest that altered cardiac myocyte contractile function is due to incorporation of the mutant cTnT-Arg92Gln into the myofibrils. However, it is also possible that the presence of the mutant cTnT-Arg92Gln in the soluble form, rather than the myofibrillar incorporation, was indeed responsible for altering cardiac myocyte contractile performance.

It is intriguing that expression of normal human cTnT protein in the background of feline cTnT, under these experimental conditions, did not alter cardiac myocyte contractile properties. This may be reflective of a relatively modest change in the expression levels of the total cTnT protein and the absence of significant changes in the expression levels of other sarcomeric proteins, such as cardiac troponin I and {alpha}-tropomyosin. The preserved function of the adult feline cardiac myocytes after expression and incorporation of the normal human cTnT also suggests that the differences in the sequence of human and feline cTnT proteins do not carry any major functional significance. This observation further supports the notion that mutations that cause human HCM involve the highly conserved amino acids. Mutations involving nonconserved amino acids may not induce a clinical phenotype in humans.

These experiments do not address the mechanism by which the mutant cTnT protein leads to the impairment of adult cardiac myocyte contractility. The present data suggest that the normal and mutant human cTnT proteins were incorporated into myofibrils in adult cardiac myocytes. However, the interaction of the mutant cTnT-Arg92Gln, after incorporation into myofibrils, with other sarcomeric proteins, such as troponin I, troponin C, and {alpha}-tropomyosin, remains to be studied. The topography of the Arg92Gln mutation, located within a major binding site for {alpha}-tropomyosin protein,31 32 33 34 raises the possibility of impaired cTnT–{alpha}-tropomyosin interaction during the cardiac cycle. However, many other possibilities, such as the influence of cTnT-Arg92Gln on intracellular Ca2+ homeostasis, remain unexplored.

In summary, the results of the present study show the following: (1) Expression of the mutant human cTnT-Arg92Gln impairs adult cardiac myocyte contractility. (2) The mutant cTnT-Arg92Gln is incorporated into myofibrils in adult cardiac myocytes. (3) Impairment of the contractile performance of the adult cardiac myocytes occurs in the absence of sarcomere disruption. The results of these studies provide for a potential mechanism by which mutations in cTnT protein induce human HCM, a major cause of sudden cardiac death and heart failure in the young.42


*    Selected Abbreviations and Acronyms
 
BME = bromomercaptoethanol
CMV = cytomegalovirus
cTnT = cardiac troponin T
HCM = hypertrophic cardiomyopathy
Mab = monoclonal antibody
MOI = multiplicity of infection
MyHC = myosin heavy chain
PCR = polymerase chain reaction
RS buffer = relaxing buffer


*    Acknowledgments
 
This study was supported in part by grants from the National Heart, Lung, and Blood Institute, Specialized Centers of Research (P50-HL-42267-01); the American Heart Association, Texas Affiliate, Inc (93G-1191); and an Established Investigator Award (9640133N) from the American Heart Association. We would like to express our gratitude to Dr Douglas L. Mann for providing the facilities for isolation of feline cardiac myocytes and measurement of cardiac myocyte contractile indexes.


*    Footnotes
 
Reprint requests to A.J. Marian, MD, Assistant Professor of Medicine, Section of Cardiology, One Baylor Plaza, 543E, Houston, TX 77030.

Received December 18, 1996; accepted May 5, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg H-P, Seidman JG, Seidman CE. {alpha}-Tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701-712.[Medline] [Order article via Infotrieve]

2. Marian AJ, Roberts R. Recent advances in the molecular genetics of hypertrophic cardiomyopathy. Circulation. 1995;92:1336-1347.[Free Full Text]

3. Geisterfer-Lowrance AA, Kass S, Tanigawa G, Vosberg H-P, McKenna W, Seidman CE, Seidman JG. A molecular basis for familial hypertrophic cardiomyopathy: a ß-cardiac myosin heavy chain gene missense mutation. Cell. 1990;62:999-1006.[Medline] [Order article via Infotrieve]

4. Watkins H, Conner D, Thierfelder L, Jarcho JA, MacRae C, McKenna WJ, Maron BJ, Seidman JG, Seidman CE. Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. Nat Genet. 1995;11:434-437.[Medline] [Order article via Infotrieve]

5. Bonne G, Carrier L, Bercovici J, Cruaud C, Richard P, Hainque B, Gautel M, Labeit S, James M, Beckmann J, Weissenbach J, Vosberg H-P, Fiszman M, Komajda M, Schwartz K. Cardiac myosin binding protein-C gene splice acceptor site mutation is associated with familial hypertrophic cardiomyopathy. Nat Genet. 1995;11:438-440.[Medline] [Order article via Infotrieve]

6. Poetter K, Jiang H, Hassanzadeh S, Master S, Chang A, Dalakas MC, Rayment I, Sellers JR, Fananapazir L, Epstein ND. Mutations in either the essential or regulatory light chains of myosin are associated with a rate myopathy in human heart and skeletal muscle. Nat Genet. 1996;13:63-69.[Medline] [Order article via Infotrieve]

7. Cuda G, Fananapazir L, Zhu W, Sellers JR, Epstein ND. Skeletal muscle expression and abnormal function of beta myosin in hypertrophic cardiomyopathy. J Clin Invest. 1993;91:2861-2865.

8. Lankford EB, Epstein ND, Fananapazir L, Sweeney HL. Abnormal contractile properties of muscle fibers expressing ß-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy. J Clin Invest. 1995;95:1409-1414.

9. Sweeney HL, Straceski AJ, Leinwand LA, Tikunov BA, Faust L. Heterologous expression of a cardiomyopathic myosin that is defective in its actin interaction. J Biol Chem. 1994;269:1603-1605.[Abstract/Free Full Text]

10. Straceski AJ, Geisterfer-Lowrance A, Seidman CE, Seidman JG, Leinwand LA. Functional analysis of myosin missense mutations in familial hypertrophic cardiomyopathy. Proc Natl Acad Sci U S A. 1994;91:589-593.[Abstract/Free Full Text]

11. Marian AJ, Yu Q-T, Mann DL, Graham FL, Roberts R. Expression of a mutation causing hypertrophic cardiomyopathy disrupts sarcomere assembly in adult feline cardiac myocytes. Circ Res. 1995;77:98-106.[Abstract/Free Full Text]

12. Watkins H, Seidman CE, Seidman JG, Feng HS, Sweeney HL. Expression and functional assessment of a truncated cardiac troponin T that causes hypertrophic cardiomyopathy: evidence for a dominant negative action. J Clin Invest. 1996;98:2456-2461.[Medline] [Order article via Infotrieve]

13. Wynne J, Braunwald E. The cardiomyopathies and myocarditides: toxic, chemical, and physical damage to the heart. In: Braunwald E, ed. Heart Disease: A Textbook of Cardiovascular Medicine. Philadelphia, Pa: WB Saunders Co; 1992:1394-1450.

14. Lin D, Bobkova A, Homsher E, Tobacman LS. Altered cardiac troponin T in vitro function in the presence of a mutation implicated in familial hypertrophic cardiomyopathy. J Clin Invest. 1996;97:2842-2848.[Medline] [Order article via Infotrieve]

15. Sambrook J, Fritsch EF, Maniatis T. Identification of cDNA clones of interest. In: Molecular Cloning: A Laboratory Manual. New York, NY: Cold Spring Harbor; 1989:8.46-8.51.

16. Marian AJ, Yu Q-T, Mares A Jr, Hill R, Roberts R, Perryman MB. Detection of a new mutation in the beta myosin heavy chain gene in an individual with hypertrophic cardiomyopathy. J Clin Invest. 1992;90:2156-2165.

17. Feinberg AP, Vogelstein B. A technique for radiolabelling DNA restriction nuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13.[Medline] [Order article via Infotrieve]

18. Lee J-S. Alternative dideoxy sequencing of double stranded DNA by cyclic reaction with Taq DNA polymerase. DNA Cell Biol. 1991;10:67-73.[Medline] [Order article via Infotrieve]

19. Townsend PJ, Farza H, MacGeoch C, Spur NK, Wade R, Gahlmann R, Yacoub MH, Barton PJR. Human cardiac troponin T: identification of fetal isoforms and assignment of the TNNT2 locus to chromosome 1q. Genomics. 1994;21:311-316.[Medline] [Order article via Infotrieve]

20. Mesnard L, Samson F, Espinasse I, Durand J, Neveux J, Mercadier JJ. Molecular cloning and developmental expression of human cardiac troponin T. FEBS Lett. 1993;328:139-144.[Medline] [Order article via Infotrieve]

21. Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, Spirito P, Matsumori A, Moravec C, Seidman JG, Seidman CE. Mutations in the genes for cardiac troponin T and {alpha}-tropomyosin in hypertrophic cardiomyopathy. N Engl J Med. 1995;332:1058-1064.[Abstract/Free Full Text]

22. Forissier J-F, Carrier L, Farza H, Bonne G, Bercovici J, Richard P, Hainque B, Townsend PJ, Yacoub MH, Faure S, Dubourg O, Millaire A, Hagege AA, Desnos M, Komajda M, Schwartz K. Codon 102 of the cardiac troponin T gene is a putative hot spot for mutations in familial hypertrophic cardiomyopathy. Circulation. 1996;94:3069-3073.[Abstract/Free Full Text]

23. Nelson RM, Long GL. A general method of site-specific mutagenesis using a modification of the Thermus aquaticus polymerase chain reaction. Anal Biochem. 1989;180:147-151.[Medline] [Order article via Infotrieve]

24. Bett AJ, Haddara W, Prevec L, Graham FL. An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc Natl Acad Sci U S A. 1994;91:8802-8806.[Abstract/Free Full Text]

25. Graham FL, Prevec L. Manipulation of adenovirus vectors. In: Murray EJ, ed. Methods in Molecular Biology, Volume 7: Gene Transfer and Expression Protocols. Clifton, NJ: Humana Press Inc; 1991.

26. Jin JP, Lin JJ. Rapid purification of mammalian cardiac troponin T and its isoform switching in rat heart during development. J Biol Chem. 1988;263:7309-7315.[Abstract/Free Full Text]

27. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:2308-2312.

28. Kapadia S, Lee J, Torre-Amione G, Birdsall HH, Ma T, Mann DL. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042-1052.

29. Deitiker PR, Epstein HF. Thick filament substructures in Caenorhabditis elegans: evidence for two populations of paramyosin. J Cell Biol. 1993;123:303-311.[Abstract/Free Full Text]

30. Brinkley BR, Murphy P, Richardson LC. Procedure for embedding in situ selected cells in vitro. J Cell Biol. 1967;35:279-283.[Free Full Text]

31. Ishii Y, Lehrer SS. Two-site attachment of troponin-T fragments to pyrene-labelled tropomyosin. J Biol Chem. 1991;266:6894-6903.[Abstract/Free Full Text]

32. Morris EP, Lehrer SS. Troponin-tropomyosin interactions: fluorescence studies of the binding of troponin, troponin T, and chymotryptic troponin T fragments to specifically labeled tropomyosin. Biochemistry. 1984;23:2214-2220.[Medline] [Order article via Infotrieve]

33. Mak AS, Smillie LB. Structural interpretation of the two-site binding of troponin on the muscle thin filament. J Mol Biol. 1981;93:331-337.

34. White SP, Cohen C, Phillips GN Jr. Structure of co-crystals of tropomyosin and troponin. Nature. 1987;325:826-828.[Medline] [Order article via Infotrieve]

35. Fyrberg E, Fyrberg CC, Beall C, Saville DL. Drosophila melanogaster troponin-T mutations engender three distinct syndromes of myofibrillar abnormalities. J Mol Biol. 1990;216:657-675.[Medline] [Order article via Infotrieve]

36. Fisher D, Wang G, Tobacman LS. NH2-terminal truncation of skeletal muscle troponin T does not alter the Ca2+ sensitivity of thin filament assembly. J Biol Chem. 1995;270:25455-25460.[Abstract/Free Full Text]

37. Myers CD, Goh PY, Allen TS, Bucher EA, Bogaert T. Developmental genetic analysis of troponin T mutations in striated and nonstriated muscle cells of Caenorhabditis elegans. J Cell Biol. 1996;132:1061-1077.[Abstract/Free Full Text]

38. Kirshenbaum LA, MacLellan WR, French BA, Schneider MD. Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus. J Clin Invest. 1993;90:381-387.

39. Atkins CE, Gallo AM, Kurzman ID, Cowan P. Risk factors, clinical signs and survival in cats with a clinical diagnosis of idiopathic hypertrophic cardiomyopathy: 74 cases (1985-1989). J Am Vet Med Assoc.. 1992;201:613-618.[Medline] [Order article via Infotrieve]

40. Cooper G, Mercer WE, Hoober JK, Gordon PR, Kent RL, Laurke IK, Marino TA. Load regulation of the properties of adult feline cardiocytes. Circ Res. 1986;58:692-705.[Abstract/Free Full Text]

41. Martin AF. Turnover of cardiac troponin subunits: kinetic evidence for a precursor pool of troponin-I. J Biol Chem. 1981;256:964-968.[Abstract/Free Full Text]

42. Maron BJ, Epstein SE, Roberts WC. Causes of sudden cardiac death in competitive athletes. J Am Coll Cardiol. 1986;7:204-214.[Abstract]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
J. Davis, M. V. Westfall, D. Townsend, M. Blankinship, T. J. Herron, G. Guerrero-Serna, W. Wang, E. Devaney, and J. M. Metzger
Designing Heart Performance by Gene Transfer
Physiol Rev, October 1, 2008; 88(4): 1567 - 1651.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Morimoto
Sarcomeric proteins and inherited cardiomyopathies
Cardiovasc Res, March 1, 2008; 77(4): 659 - 666.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
J. Ganame, L. Mertens, B. W. Eidem, P. Claus, J. D'hooge, L. M. Havemann, C. J. McMahon, M. A. A. Elayda, W. K. Vaughn, J. A. Towbin, et al.
Regional myocardial deformation in children with hypertrophic cardiomyopathy: morphological and clinical correlations
Eur. Heart J., December 1, 2007; 28(23): 2886 - 2894.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Roberts and U. Sigwart
Current Concepts of the Pathogenesis and Treatment of Hypertrophic Cardiomyopathy
Circulation, July 12, 2005; 112(2): 293 - 296.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Grey, A. Mery, and M. Puceat
Fine-tuning in Ca2+ homeostasis underlies progression of cardiomyopathy in myocytes derived from genetically modified embryonic stem cells
Hum. Mol. Genet., May 15, 2005; 14(10): 1367 - 1377.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. Konno, M. Shimizu, H. Ino, T. Matsuyama, M. Yamaguchi, H. Terai, K. Hayashi, T. Mabuchi, M. Kiyama, K. Sakata, et al.
A novel missense mutation in the myosin binding protein-C gene is responsible for hypertrophic cardiomyopathy with left ventricular dysfunction and dilation in elderly patients
J. Am. Coll. Cardiol., March 5, 2003; 41(5): 781 - 786.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. Fatkin and R. M. Graham
Molecular Mechanisms of Inherited Cardiomyopathies
Physiol Rev, October 1, 2002; 82(4): 945 - 980.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Roberts and U. Sigwart
New Concepts in Hypertrophic Cardiomyopathies, Part I
Circulation, October 23, 2001; 104(17): 2113 - 2116.
[Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
O. M. Hernandez, P. R. Housmans, and J. D. Potter
Plasticity in Skeletal, Cardiac, and Smooth Muscle: Invited Review: Pathophysiology of cardiac muscle contraction and relaxation as a result of alterations in thin filament regulation
J Appl Physiol, March 1, 2001; 90(3): 1125 - 1136.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. F. Nagueh, H. A. Kopelen, D.-S. Lim, W. A. Zoghbi, M. A. Quinones, R. Roberts, and A. J. Marian
Tissue Doppler Imaging Consistently Detects Myocardial Contraction and Relaxation Abnormalities, Irrespective of Cardiac Hypertrophy, in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy
Circulation, September 19, 2000; 102(12): 1346 - 1350.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Frey, W. M. Franz, K. Gloeckner, M. Degenhardt, M. Muller, O. Muller, H. Merz, and H. A. Katus
Transgenic rat hearts expressing a human cardiac troponin T deletion reveal diastolic dysfunction and ventricular arrhythmias
Cardiovasc Res, August 1, 2000; 47(2): 254 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Szczesna, R. Zhang, J. Zhao, M. Jones, G. Guzman, and J. D. Potter
Altered Regulation of Cardiac Muscle Contraction by Troponin T Mutations That Cause Familial Hypertrophic Cardiomyopathy
J. Biol. Chem., January 7, 2000; 275(1): 624 - 630.
[Abstract] [Full Text] [PDF]


Home page
EuropaceHome page
P. Sorajja, P.M. Elliott, and W.J. Mckenna
The molecular genetics of hypertrophic cardiomyopathy: prognostic implications
Europace, January 1, 2000; 2(1): 4 - 14.
[PDF]


Home page
Cardiovasc ResHome page
C. S. Redwood, J. C. Moolman-Smook, and H. Watkins
Properties of mutant contractile proteins that cause hypertrophic cardiomyopathy
Cardiovasc Res, October 1, 1999; 44(1): 20 - 36.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. He, M. Meyer, J. L. Martin, P. M. McDonough, P. Ho, X. Lou, W. Y. W. Lew, R. Hilal-Dandan, and W. H. Dillmann
Effects of Mutant and Antisense RNA of Phospholamban on SR Ca2+-ATPase Activity and Cardiac Myocyte Contractility
Circulation, August 31, 1999; 100(9): 974 - 980.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S.-J. Kim, K. Iizuka, R. A. Kelly, Y.-J. Geng, S. P. Bishop, G. Yang, A. Kudej, B. K. McConnell, C. E. Seidman, J. G. Seidman, et al.
An alpha -cardiac myosin heavy chain gene mutation impairs contraction and relaxation function of cardiac myocytes
Am J Physiol Heart Circ Physiol, May 1, 1999; 276(5): H1780 - H1787.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yanaga, S. Morimoto, and I. Ohtsuki
Ca2+ Sensitization and Potentiation of the Maximum Level of Myofibrillar ATPase Activity Caused by Mutations of Troponin T Found in Familial Hypertrophic Cardiomyopathy
J. Biol. Chem., March 26, 1999; 274(13): 8806 - 8812.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Meyer, W. F. Bluhm, H. He, S. R. Post, F. J. Giordano, W. Y. W. Lew, and W. H. Dillmann
Phospholamban-to-SERCA2 ratio controls the force-frequency relationship
Am J Physiol Heart Circ Physiol, March 1, 1999; 276(3): H779 - H785.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Bonne, L. Carrier, P. Richard, B. Hainque, and K. Schwartz
Familial Hypertrophic Cardiomyopathy : From Mutations to Functional Defects
Circ. Res., September 21, 1998; 83(6): 580 - 593.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Anan, H. Shono, A. Kisanuki, S. Arima, S. Nakao, and H. Tanaka
Patients With Familial Hypertrophic Cardiomyopathy Caused by a Phe110Ile Missense Mutation in the Cardiac Troponin T Gene Have Variable Cardiac Morphologies and a Favorable Prognosis
Circulation, August 4, 1998; 98(5): 391 - 397.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Morimoto, F. Yanaga, R. Minakami, and I. Ohtsuki
Ca2+-sensitizing effects of the mutations at Ile-79 and Arg-92 of troponin T in hypertrophic cardiomyopathy
Am J Physiol Cell Physiol, July 1, 1998; 275(1): C200 - C207.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. St. J. Sutton and J. A. Epstein
Hypertrophic Cardiomyopathy -- Beyond the Sarcomere
N. Engl. J. Med., April 30, 1998; 338(18): 1303 - 1304.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marian, A. J.
Right arrow Articles by Yu, Q.-t.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marian, A. J.
Right arrow Articles by Yu, Q.-t.