Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1997;80:885-893

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fisher, S. A.
Right arrow Articles by Brozovich, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fisher, S. A.
Right arrow Articles by Brozovich, F.
(Circulation Research. 1997;80:885-893.)
© 1997 American Heart Association, Inc.


Articles

Endothelin-1 Alters the Contractile Phenotype of Cultured Embryonic Smooth Muscle Cells

Steven A. Fisher, Mitsuo Ikebe, , Frank Brozovich

From the Department of Medicine (S.A.F., F.B.), Division of Cardiology and Molecular Cardiovascular Research Center, and the Department of Physiology and Biophysics (S.A.F., M.I., F.B.), Case Western Reserve University School of Medicine, Cleveland, Ohio.

Correspondence to Steven A. Fisher, Division of Cardiology, University Hospitals, 11100 Euclid Ave, Cleveland, OH 44106-5038. E-mail saf9{at}po.cwru.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Smooth muscle tissues may be classified into phasic (fast) or tonic (slow) contractile phenotypes. This study was initiated to examine the specification of these phenotypes during development and the role of growth factors in this process. We used myosin light chain 17 (MLC17) and myosin heavy chain transcript splice variants as markers of the tonic (aortic) and phasic (intestinal) smooth muscle phenotypes in chick embryos. By reverse transcription–polymerase chain reaction, we determined embryonic days 6 to 16 to be a critical period for the establishment of these phenotypes. During this period, endothelin-1 is present at 40-fold-higher levels in aortic compared with intestinal tissues. To test the hypothesis that endothelin-1 may be involved in establishing the aortic (tonic) phenotype, we developed a system in which embryonic smooth muscle cells exhibit phasic and tonic contractile properties in vitro. Single-cell force measurements showed that cultured embryonic gizzard (phasic) cells developed force more rapidly (8±2 seconds) and achieved greater force (3.0±0.7 µN) than did cultured embryonic aortic (tonic) cells (20±0.7 seconds, 0.76±0.01 µN; P<.05) in response to depolarization. Chronic exposure of the phasic (gizzard) cells to endothelin-1 prolonged the time to peak force (24±3 seconds) and reduced the peak force (1.0±0.1 µN), so that the contraction resembled the tonic type. This effect, mediated by the endothelin-A receptor, was associated with a shift in MLC17 splicing to the tonic pattern. These results demonstrate that endothelin-1 is highly enriched in developing aortic compared with intestinal tissues and can convert phasic smooth muscle cells to the tonic type in vitro, suggesting a role for this growth factor during development in determining the contractile phenotype of smooth muscle cells.


Key Words: smooth muscle phenotype • phasic and tonic contraction • endothelin-1 • myosin isoform • development


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Smooth muscle cell contraction generates force and movement in visceral organs and in vessels throughout the body. Visceral smooth muscle displays a phasic pattern of contraction, characterized by rapid force generation and relaxation. Large-vessel arterial smooth muscle exhibits a tonic pattern of contraction, in which force development and relaxation are slower events and a resting force is maintained.1 2 It is not known how these different smooth muscle contractile phenotypes arise during development. It has been suggested that smooth muscle diversity may be generated by complex local cues, based on the observation that SMCs arise from multiple ill-defined areas throughout the embryo, including neural crest and local mesenchyme within developing tissues.3 4

In the present study, we tested the hypothesis that the SMC phenotype is determined by peptide growth factors that are unique to the microenvironment in which the phenotype develops. We first identified that period during development in which the phenotypes arise, using the aorta and gizzard (intestine) as representative of tonic and phasic tissues, respectively, and MLC17 and MHC splice variant isoforms as molecular markers of the phenotypes. We then developed a system in which the embryonic aortic and intestinal SMCs display tonic and phasic contractile properties, respectively, in vitro. In this system, single factors could be tested in isolation for their ability to influence the SMC contractile phenotype. This overcame a long-standing obstacle to the study of the determinants of SMC phenotype, the dedifferentiation of SMCs to a proliferative phenotype in culture.5 We show that ET-1 is highly enriched in the developing aortic (tonic) tissues compared with the developing intestinal (phasic) tissues and that treatment of phasic SMCs with ET-1 in vitro converts them to the tonic type, suggesting a role for ET-1 in the development of the aortic (tonic) smooth muscle phenotype.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
SMC Culture
All tissue culture reagents were obtained from GIBCO-BRL, except where noted. Fertile white leghorn chicken eggs (Squire Valleevue Farm, Cleveland, Ohio) were incubated for 10 to 15 days (hatching occurs at 21 days) at 38°C in humidified air. Five to 12 embryos were removed from the egg and decapitated, after which the gizzards and thoracic aorta were removed and placed on ice in separate tubes containing growth medium (DMEM/Ham's F-12, 1:1 mix with 10% FCS and penicillin-streptomycin at 50 µg/mL). The gizzards were scraped with scalpel blades to remove epithelial cells, and gizzards and aorta were separately minced into fine fragments, resuspended in growth medium, and allowed to stand for several minutes. The smaller fragments that remained in suspension were pipetted onto tissue culture dishes; the sedimented larger fragments were reminced. This process was repeated for three to five cycles.

The following day, the medium containing unattached fragments was removed and replaced with growth medium. Cells grew out from tissue explants in 3 to 5 days, and they were rinsed with PBS, detached with 0.05% trypsin and 5 mmol/L EDTA, mixed with an equal volume of growth medium, and pelleted by centrifugation. Cells were resuspended in medium, counted, and plated at a density of 2x104 to 3x104 cells/cm2 either on tissue culture plastic or coated dishes. When cells were to be grown and repassaged, they were resuspended in DMEM/Ham's F-12+10% FCS. Cells that were to be used for mechanical or growth studies were resuspended in DMEM/Ham's F-12+0.5% FCS (growth-arrested medium). Cells were studied between the first and third passages. More than 80% of the cells were SMCs, as determined by {alpha}-smooth muscle actin antibody (Sigma Chemical Co) staining (not shown). There was no evidence of endothelial cell contamination in the passaged SMC cultures, as evidenced by absence of staining with an antibody against von Willebrand factor (Dako).

Treatment With Growth Factors
Cells were plated onto dishes or glass coverslips that were coated with Matrigel (lot No. 905795,909785,909825, Becton-Dickinson), diluted 1:2 with medium, and applied at 50 µL/cm2 as per the manufacturer's recommendation. Ang II (Sigma) or ET-1 (American Peptides Inc) was added to the medium the following day at concentrations ranging from 10-6 to 10-8 mol/L for Ang II and 10-7 to 10-10 mol/L for ET-1. ET-1 was added to the medium daily; Ang II was added either daily or every 8 hours. The medium was changed every other day. ET-1 at 10-7 mol/L is equivalent to 249 ng/mL, and 24 hours after addition, the concentration was {approx}2.5x10-10 mol/L (620 pg/mL). The ET-A receptor–specific blocker BQ610 (American Peptides Inc) was added to a final concentration of 2x10-7 mol/L either 5 minutes before the addition of ET-1 or alone the day after the cells were plated. Under growth-arrested conditions, {approx}5% of cells on Matrigel were BrdU positive (proliferative) in a 24-hour period, and the percentage did not change with ET-1 treatment.

Single-Cell Force Measurements
Individual coverslip fragments were removed from the culture dishes, rinsed with physiological saline solution, and placed in an experimental chamber mounted on the stage of an inverted microscope (Nikon). The experimental setup has been described in detail previously.6 To record force, the ends of individual cells were tied onto pulled glass capillary tubes, one of which was connected to a force transducer (Cambridge). After cell attachment, the individual cells were lifted off of the matrix before activation. To activate the cells, the solution bathing the cells was changed by using a flow-through system. SMCs were stimulated to contract with maximal depolarization (90 mmol/L KCl) or with agonists: phenylephrine, 10-5 mol/L; Ang II, 10-6 mol/L; and ET-1, 10-7 mol/L. Force records were digitized at 10 Hz with 12-bit resolution and stored on a Nicolet storage oscilloscope (Nicolet Instruments) for later analysis. Approximately 70% of the cells examined from gizzard and aortic cultures at passages 1 to 3 contracted in response to either KCl or agonist stimulation.

RT-PCR of MHC and MLC17 Transcript Splice Variants As Markers of Tonic and Phasic Phenotypes
Splice variants of MHC and MLC17 were examined in a developmental embryonic chick series as well as in cultured cells. The following sets of oligonucleotide primers, listed 5' to 3', were used in RT-PCR to assess species of mRNA: smooth muscle MHC, +511 GACATGTACAAGGGAAAGAAGAGGCA and +840 AATCGGGAGGAGTTGTCATTCTTGAC, which generated 330-bp (aortic) or 351-bp (gizzard) fragments, spanning a 21-bp exon present in the head of the adult gizzard MHC transcript but not in adult aorta transcript7 ; MLC17, +67 GAGTTCAAGGAGGCATTCCAGCTGT and +465 CGCTCAGCACCATCCGGACGAG, which generated 422-bp (MLC17a, intestinal) and 461-bp (MLC17b) fragments, spanning a 39-bp exon present in a fraction of adult aorta transcripts but not in adult gizzard transcripts.8 Total RNA was isolated, and 2.5 µg was reverse-transcribed as previously described.9 The entire RT reaction was subject to PCR, with melting at 95°C for 1 minute and annealing and extension at 60°C for 1 minute for 35 cycles.

PCR products were separated on 2% agarose gels and visualized with ethidium bromide. Bands were photographed at two different exposures and quantified using NIH image 159 software. Gels were always run in which splice-in and splice-out PCR products were present so that each could be identified. Values were calculated for each band by multiplying the intensity by the pixel number after background subtraction. The standard deviation of intensity for each band was always <10% of the mean intensity, thus excluding contamination from adjacent brighter bands. Exon splice-in and splice-out variants are expressed as the percentage of the total transcripts. To demonstrate that the percentage of splice-in and splice-out transcripts could be accurately measured by RT-PCR, the relationship of percent splice-in and splice-out to input RNA was examined in two samples in which these values were quite different, ie, ED8 and ED16 gizzard tissues. As can be seen in Fig 1Down, the ratios for MLC17 are highly concordant over a large range of input RNA, thus demonstrating that in this assay the ratios obtained are independent of the amount of input RNA or the amount of PCR product loaded on the gel. The PCR products were individually eluted from the agarose gels using a Qiagen kit and directly sequenced with the primers used in the RT-PCR reaction, on an automated sequencer (Applied Biosystems, Perkin-Elmer), to confirm their identities.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Quantification of splice variants by RT-PCR is independent of input RNA. RT-PCR for the MLC17 transcript was performed on incremental amounts of RNA from ED8 and ED16 gizzards. The measured ratio of MLC17b/MLC17a was independent of the amount of input RNA and total amount of PCR product in the gel, approximating 50:50 at ED8 and 20:80 at ED16. No product was visualized when 0.01 µg of ED8 gizzard RNA was used in the RT-PCR reaction.

ET-1 Assays
Tissues were removed from the chick embryos, immediately placed into liquid N2, weighed, and homogenized in 1 mol/L acetic acid (1 mL/100 mg tissue) with 1 µg/mL pepstatin. The samples were boiled for 10 minutes, placed on ice for 5 minutes, ultracentrifuged at 100 000g, and then processed in parallel with cell culture supernatant. For cultured cells, DMEM (phenyl free)+0.5% FCS was added 6 to 12 hours after the cells were passed, collected 2 to 18 hours later, and processed as recommended by the manufacturer of the Parameter ET-1 assay kit (R+D Systems). ET-1 values are normalized to wet weight of the tissue and, in the culture system, to cell number, which was determined by trypsinizing the cells and counting at the time of medium collection.

Statistical Analysis
Differences between control and experimental groups were checked for statistical significance (P<.05) with a two-way ANOVA and Student's t test, using SigmaSTAT software (Jandel Scientific). For multiple comparisons, a Bonferroni correction was used, so that in the force measurements, in which six experimental groups were present, P<.008 was considered statistically significant. All values given in the text are mean±SEM.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
MLC17 and MHC Splice Variants Define Embryonic Days 6 to 16 As the Period When Smooth Muscle Tonic and Phasic Phenotypes Are Established
In order to define that period in development in which phasic and tonic characteristics of SMCs are determined, two molecular markers that are selectively expressed and have been suggested to confer tonic and phasic properties to adult aortic and intestinal tissues, respectively, were examined. The markers are (1) a 39-nt splice variant of the essential MLC transcript (MLC17)8 and (2) a 21-nt splice variant of the smooth muscle MHC transcript.7 RT-PCR demonstrated that embryonic chicken intestinal (gizzard) and aortic tissues early in development (ED10) each express slightly more of the MLC17b (splice-in) than the MLC17a (splice-out) transcript (Fig 2ADown). Over the subsequent 6 days of development, the gizzard tissue MLC17 splicing matures toward the adult pattern,8 in which the MLC17a splice-out isoform is predominant. In the aortic tissue over this same time period, the splice-in process is enhanced so that by ED16 the adult aortic pattern is evident, in which {approx}80% of the transcripts are MLC17b and 20% of the transcripts are MLC17a.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. MLC17 (A) and MHC (B) mRNA splice variants in embryonic and adult (AD) chicken tissues. RT-PCR was used to assess species of mRNA as described in "Materials and Methods." RT-PCR of MLC17 transcripts generated 422-bp (MLC17a, intestinal) and 461-bp (MLC17b) fragments, which span a 39-bp exon, which is present in the AD aorta transcript but not in AD gizzard.8 RT-PCR of MHC transcripts generate a 330-bp (aortic) or 351-bp (gizzard) fragment of smooth muscle MHC, which spans a 21-bp exon present in AD gizzard but not in AD aorta.7 Pictures of the gels with contrasts inverted are shown and demonstrate the maturation in the splicing of these transcripts to the adult forms characteristic of tonic (aortic) and phasic (gizzard) smooth muscle. Also shown are controls (CON), in which RT was not included in the reaction, and a 100-bp DNA ladder (MWM), with the heavy band equal to 500 bp. Quantification of the MLC and MHC bands is shown below each gel. Bands were quantified by using NIH image 159 software. Splice-in and splice-out variants are expressed as the percentage of the total transcripts.

A similar scenario is observed with MHC-head splicing. Intestinal tissue at the earliest time point examined, ED6, expresses the MHC splice-out variant (Fig 2BUp). At ED10, the gizzard has shifted splicing of MHC to splice-in (phasic) predominance, and by ED16 the adult pattern7 10 11 of splice-in is nearly exclusively observed. In aortic tissue, the splice-out isoform predominates at the earliest time point examined (ED10). The splice-in pattern is briefly observed in a minority of transcripts on ED10, ED14, and ED16, but by ED19 the adult pattern of exclusive expression of the splice-out isoform is observed. Thus, for both MLC17 and MHC, the splicing pattern early in the development of aortic and intestinal tissues most resembles the aortic (tonic) type, and the mature gizzard (phasic) splicing pattern develops subsequently.

ET-1 Is Predominantly Detected in Developing Aortic (Tonic) Tissues and Aortic SMC Culture
It has been speculated that local tissue factors are responsible for the generation of smooth muscle diversity.12 Among them, ET-1, a 21 amino acid–secreted protein, which was first identified as an endothelium-derived contractile agonist,13 14 15 is of particular interest. ET-1 has subsequently been shown to be a growth regulator for a number of cell types (reviewed in Reference 1616 ). Large-vessel SMCs mature adjacent to the endothelium,17 the major source of ET-1, whereas intestinal SMCs do not, suggesting that this protein might play a role in determining these different phenotypes. We measured ET-1 levels at the stages during which the smooth muscle phenotypes are specified. ET-1 was detected at 1.0 pmol/g tissue in ED10 to ED14 aortic tissue homogenates (Table 1Down). It was barely detected in ED10 to ED14 intestinal tissue (0.025 pmol/g tissue), at the time of its transition to the phasic phenotype, as evidenced by the maturation of MLC17 and MHC splicing.


View this table:
[in this window]
[in a new window]
 
Table 1. Measurements of ET-1

Since an objective of the present study was to examine the role of growth factors in specifying smooth muscle phenotypes, the amount of ET-1 secreted into the media in cultured aortic and gizzard SMCs (described below) was measured. ET-1 was detected at higher concentrations in the aortic SMC cultures, although the magnitude of the difference was less than that found in vivo. In three separate experiments from two independent cell preparations, cultured aortic cells secreted an average of 6-fold more ET-1 per 106 cells than did the cultured gizzard cells over a 2- to 18-hour period (Table 1Up). This relationship was true of cells from passages 1 to 2 and independent of whether cells were cultured on plastic or Matrigel (data not shown). The concentration of ET-1 in the aortic culture medium ranged from 20 to 80 pmol/L; in the gizzard culture medium, the concentration ranged from 1 to 8 pmol/L. Both sets of cultures did not stain with an antibody against the endothelial cell–specific von Willebrand factor, indicating that the SMCs were the source of the ET-1, as previously reported for vascular SMCs in culture (reviewed in Reference 1616 ).

Embryonic SMCs Retain Their Phasic or Tonic Contractile Properties In Vitro
In order to test the hypothesis that it is the presence of ET-1 that specifies the aortic (tonic) smooth muscle phenotype, an SMC culture system was established in which the effects of the chronic exposure of SMCs to ET-1 in isolation could be examined. Crucial to testing this hypothesis was the development of a system in which the aortic and intestinal SMCs in vitro displayed tonic and phasic contractile properties, respectively, since it is generally believed that SMCs revert to a proliferative noncontractile phenotype in vitro.5 We cultured SMCs derived from ED10 to ED15 gizzard and aorta, a period in development critical for the establishment of the phenotypes. The cells were cultured on the complex extracellular matrix Matrigel, because a previous study had suggested that adult vascular SMCs are differentiated when cultured on this substrate for up to five passages,18 although contractile properties and molecular markers were not examined.

Embryonic gizzard and aortic SMCs derived from tissue explants displayed phasic and tonic* contractile properties, respectively, when cultured on Matrigel in low-serum (0.5% FCS) medium. A typical data record for the force response of a cultured gizzard cell to KCl depolarization is displayed in Fig 3ADown. After activation, force rapidly increased to an average maximum force of 3.0±0.7 µN (n=10, mean±SEM), with a time to peak force of 8±2 seconds (Table 2Down). The cultured aortic cells contracted in response to KCl depolarization with an average maximum force of 0.76±0.10 µN (n=9) and time to peak force of 20±2 seconds (Fig 3DDown and Table 2Down). Both the rate of force development and the absolute maximum force were significantly higher for the gizzard SMCs compared with aortic SMCs (P=.0019 and P=.0027, respectively). For each cell type, activation with the agonists ET-1, Ang II, and phenylephrine gave contractile responses similar to those seen with KCl depolarization (Fig 4Down). ET-1 also caused contractions in isolated strips of ED7 and ED16 aortic tissue (data not shown), which, as in the cultured cells, were blocked by pretreatment with the ET-A receptor–specific antagonist BQ610, demonstrating that the ET-A receptor was present in the cells in vivo and in vitro.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 3. Force records of single cultured cells stimulated to contract with maximal KCl depolarization (90 mmol/L). Representative force tracings of control or chronic growth factor–treated SMCs activated with KCl depolarization are shown. At the top, tracings for gizzard SMCs are shown: A, control; B, ET-1 treated; and C, Ang II treated. At the bottom, tracings for aortic SMCs are shown: D, control; E, ET-1 treated; and F, Ang II treated. The addition of 90 mmol/L KCl is indicated above the data tracings.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of Contractile Responses



View larger version (9K):
[in this window]
[in a new window]
 
Figure 4. Force records of single cultured control SMCs stimulated to contract with agonists. Tracings for gizzard (A) and aortic (B) SMCs are as follows: 1, phenylephrine (PE, 10-5 mol/L); 2, Ang II (AII, 10-6 mol/L); 3, ET-1 (10-7 mol/L); and 4, ET-1 (10-7 mol/L) plus pretreatment with the ET-A receptor blocker BQ610 (5x10-7 mol/L).

The cultured SMCs could be seen to shorten toward the fixed end when depolarized with one end fixed and one end free. This is the first demonstration of the preservation of the usual contractile properties, ie, fast and slow force production and shortening of SMCs in vitro. Cells from passages 1 to 3 showed full contractile responses, whereas force was undetectable after KCl depolarization or agonist stimulation of passage-5 cells (not shown). The force tracings obtained upon stimulation of the cultured embryonic SMCs were similar to those of freshly isolated adult SMCs.19

Chronic Exposure of Cultured Aortic and Gizzard SMCs to ET-1 and Ang II Has Distinct Effects on Their Contractile Properties
Since gizzard SMCs develop the phasic phenotype in a microenvironment in which ET-1 is barely detected, whereas aortic cells display the tonic phenotype in the presence of significant amounts of ET-1, we examined whether ET-1 may specify the tonic properties. Chronic exposure of cultured gizzard SMCs to 10-7 mol/L ET-1 for 2 to 5 days resulted in cells that generated one third of the force developed in control cells in response to KCl depolarization (P=.0024; Fig 3BUp, Table 2Up). The rate of force development was slowed 3-fold (P=.0008); thus, the contractile response resembled that of the aortic (tonic) SMCs. This modulation of the contractile properties was blocked by chronic pretreatment with the ET-A–specific receptor antagonist BQ610 (2x10-7 mol/L), indicating that the ET-1 effect was mediated via the ET-A receptor. In contrast, chronic exposure of gizzard SMCs to Ang II (10-6 mol/L) modestly prolonged time to peak force without altering peak force (P>.05; Fig 3CUp, Table 2Up), demonstrating the specificity of the effect of ET-1. Treatment of the gizzard SMCs with an alternative Ang II regimen, 10-7 or 10-8 mol/L every 8 hours for 24 to 48 hours, also produced no significant effect. With Ang II treatment at 10-7 mol/L (n=3), peak force was 3.8±0.7 µN, and time to peak force was 6±2 seconds; at 10-8 mol/L (n=4), peak force was 3.5±0.3 µN, and time to peak force was 10±4 seconds (all P>.05 compared with control).

The effect of ET-1 was observed at a minimum initial concentration of 10-9 mol/L (2.5 ng/mL) and required 24 hours of exposure (data not shown). The minimum concentration of exogenous ET-1 required to achieve this effect, 10-9 mol/L, is within range of the concentrations of endogenous ET-1 observed in the cultured aortic SMCs (2x10-11 to 8x10-11 mol/L) when taking into consideration the catabolism of exogenously added ET-1 in the culture ({approx}400-fold decrease in concentration over 24 hours). This minimum effective concentration of ET-1 is considerably higher than the maximum concentration of ET-1 observed in the cultured gizzard SMC supernatants (8x10-12 mol/L).

Chronic exposure of the aortic SMCs to ET-1 (10-7 mol/L) or Ang II (10-6 mol/L) did not decrease but rather increased force in response to KCl depolarization, although these differences did not reach statistical significance when corrected for multiple comparisons (P=.035 and P=.026 [not significant]). There was no significant change in time to peak force with ET-1 or Ang II treatment (Fig 3DUp through 3F, Table 2Up). Since the cultured aortic SMCs secreted significant amounts of ET-1, in agreement with previous reports,16 we also examined the effect that the ET-A blocker BQ610 would have on these cells in the absence of exogenous ET-1. Treatment with the ET-A blocker BQ610 at a concentration of 2x10-7 mol/L for 24 hours, which blocked the ET-1–mediated alterations in force production of gizzard SMCs described above, did not significantly change force production of the cultured aortic SMCs. These results show that ET-1 specifically modulates SMC contractile properties from the phasic to that of the tonic type and that the absence of ET-1–mediated ET-A receptor stimulation by itself is not sufficient to convert tonic SMCs to the phasic phenotype in vitro. In addition, when the gizzard SMCs were treated for 48 hours with ET-1, washed, and returned to control medium for an additional 48 hours, their contractile properties remained tonic (peak force, 0.6±0.1 µN; time to peak force, 16±1 seconds; n=3), also demonstrating that at least in the short term the continued presence of ET-1 is not required to maintain the tonic phenotype.

Correlation of MHC and MLC17 Isoforms With SMC Contractile Properties
To identify molecular correlates of the tonic and phasic contractile properties, the splice variants of MLC17 and MHC were examined. Gizzard SMCs derived from ED14 to ED15 embryos in vitro displayed the MLC17 splice pattern of an earlier (ED10) stage, in which the MLC17b/MLC17a ratio approximated 60:40 (Fig 5Down). In two separate experiments, gizzard cells treated with 10-7 mol/L ET-1 for 24 hours exhibited a shift to the aortic splice pattern, in which the MLC17b/MLC17a ratio was between 80:20 and 90:10 (n=3, Fig 5Down). In contrast, when embryonic gizzard SMCs mature in vivo in a low ET-1 environment, the reverse occurs: the MLC17b/MLC17a ratio shifts from 60:40 to 30:70. In cultured aortic SMCs, the MLC17b/MLC17a ratio approximated the adult pattern (80:20) and was not affected by ET-1 treatment (Fig 5Down).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. MLC17 splice variants in control and ET-1–treated cultured aortic and gizzard SMCs. The bands are as described in Fig 2Up and are the result of two separate experiments (EXPT 1 and 2) from two different cell preparations. Quantification of the bands was as described in Fig. 2Up. The control (CON) gizzard cells demonstrate the ED10 pattern of MLC17 splicing. Treatment with ET-1 (10-7 mol/L) shifts the splicing pattern to that of the aortic type. CON aortic SMCs display the tonic splice pattern, which is unaffected by ET-1 treatment. ED14TIS indicates ED14 gizzard tissue.

The MHC-head splicing pattern in cultured control gizzard SMCs was, like that of MLC17 splicing, the more embryonic (splice-out) type. Unlike MLC17 splicing, the MHC-head splicing pattern in cultured gizzard SMCs was not affected by ET-1 treatment (data not shown), indicating that the change in the contractile properties of cultured gizzard SMCs is not due to a change in MHC-head splice isoforms. The cultured aortic SMCs also exclusively expressed the MHC splice-out variant. Telokin, a transcript that is highly enriched in intestinal smooth muscle in vivo but the function of which is unknown,20 21 22 was always present in the cultured gizzard SMCs and absent from the aortic SMCs (data not shown), distinguishing these two cell populations.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we tested the hypothesis that growth factors unique to a given microenvironment play a role in determining the development of the various smooth muscle contractile phenotypes. The strategy was to use two molecular markers of tonic and phasic phenotypes to identify the period in development during which they arise and then to use an in vitro system to examine the ability of growth factors to influence the phenotype. We have demonstrated that (1) the tonic (aortic) and phasic (gizzard) SMC phenotypes arise during a defined period of chicken embryogenesis, (2) the protein ET-1 is predominantly present in the tonic tissue during this period, (3) for the first time, embryonic SMCs in culture will display their usual tonic or phasic contractile properties through multiple passages, (4) ET-1 confers tonic contractile properties to phasic SMCs in vitro, and (5) shifts in the splice variants of MLC17 correlate with the conversion of SMC contractile properties from phasic to tonic.

Identification of That Period in Development in Which the Tonic and Phasic Phenotypes Are Specified
A developmental series was performed to determine when the diverse smooth muscle phenotypes are specified. MHC and MLC17 splice variants were chosen as markers of the tonic and phasic phenotypes because several studies had suggested that isoforms of these proteins may confer tonic or phasic properties,7 23 24 although this has yet to be directly proven. In this series, the tonic pattern of splicing appeared to be the more embryonic or default type, because it is at one point in development present in both tonic and phasic tissues. This observation, ie, that the tonic phenotype is the more embryonic or default type, has also been suggested to be the case in other species, such as rabbits.11 The present study defines ED6 to ED16 as that period when the gizzard develops the phasic phenotype, as defined by MHC and MLC17 splice variants, although there are other isoform switches that occur later in development (References 9 and 259 25 and data not shown) and presumably are under different controls.

Establishment of a Cell Culture System in Which SMCs Display Usual Contractile Properties
Critical to this study of the determinants of smooth muscle contractile phenotypes was the development of a cell culture system in which SMCs retain their usual contractile properties. Although previous studies had demonstrated that cultured SMCs respond to contractile agonists with various components necessary for contraction (eg, calcium release or MLC20 phosphorylation26 27 ) or with changes in the borders of attached cells,18 28 it was not clear whether these cells maintain their in vivo contractile properties (ie, force and shortening characteristics). We selected embryonic SMCs as a model system for several reasons. First, SMCs, like cardiomyocytes and distinct from skeletal myocytes, during embryonic development are both proliferative and express markers of differentiation,29 30 suggesting that embryonic SMCs would be competent to both proliferate and contract in vitro. To our knowledge, this is the first demonstration that these embryonic proliferative SMCs are also fully contractile. The SMCs displayed identical contractile properties on denatured collagen (data not shown) and Matrigel, excluding the possibility that a component of the complex extracellular matrix Matrigel was inducing these properties. Second, we desired to test factors in isolation for their ability to specify tonic or phasic contractile phenotypes. These phenotypes develop between ED6 and ED16, so the study of embryonic SMCs derived from this period of development would enable us to identify factors responsible for this specification.

ET-1 and Tonic and Phasic Smooth Muscle Phenotypes
It has been suggested that factors unique to each tissue mediate the development of smooth muscle phenotypes.12 ET-1 satisfied two criteria of any potential mediator: (1) it is highly enriched in the tonic tissue relative to phasic tissue at the time at which the phenotypes develop, and (2) treatment of the phasic SMCs in vitro with ET-1 converted them to the tonic type. This suggests that this protein might play a role in the specification of the tonic aortic phenotype, consistent with the report of maldevelopment of the neural crest–derived proximal aorta and aortic arch in mice in which the ET-1 gene was inactivated.31 In that study, as in the present study, the effects of ET-1 were mediated by the ET-A receptor. Studies of other cell types, such as fat cells, have also shown ET-1 to be a phenotypic determinant.32 33 Whether ET-1 plays a role in the development of other portions of the vasculature, especially those that do not display a pure tonic phenotype or those that reside outside of the proximal aorta and are of mesenchymal origin,34 is not known.

The results of the present study would support a hypothetical model in which (1) exposure of SMCs to ET-1 commits SMCs to the "tonic" phenotype, in which case, continued exposure to ET-1, at least in the short term, may not be necessary for maintenance of this phenotype, and (2) development of the "phasic" SMC phenotype from a default tonic phenotype requires the absence of ET-1, under which conditions additional unknown factors can operate. This model derives from the study of two smooth muscle tissues, aorta and gizzard, and two molecular markers, MHC and MLC17; whether it could be generalized to other smooth muscle tissues and other molecular markers is not known. The signaling pathway by which ET-1 converts phasic SMCs to the tonic type remains to be determined.

Molecular Determinants of SMC Tonic and Phasic Properties
Although physiological and molecular differences between phasic and tonic tissues have been described previously,2 it is not currently clear which are the molecular determinants and which are coincidental. The ability to measure force from cultured single SMCs, as well as to change their contractile properties with growth factor treatment, enabled us to examine this issue. Because the speed of contraction in cardiac and skeletal muscles is largely a function of the myofibrillar protein isoforms that are present (reviewed in Reference 3535 ), it is reasonable to examine MHC and MLC isoforms in smooth muscle as well. Kelley et al7 have reported that the MHC isoform with a 21-bp exon in the head of the molecule, near the ATP binding site, has increased in vitro actin translocating and ATPase activity when compared with the splice-out isoform. However, the embryonic aortic and gizzard SMCs in culture each expressed the MHC splice-out isoform, yet the former showed tonic and the latter showed phasic contractile properties, suggesting that under the conditions used in the present study, the splice-in isoform is not necessary for rapid SMC contraction. Although the MHC splice-in isoform does not appear to be necessary for the phasic phenotype, it still may contribute to the phasic properties of smooth muscle tissues in vivo.

It has also been shown that the relative MLC17b (splice-in) content of myosin inversely correlates with both its actin-activated ATPase activity (Vmax) and actin affinity (Km).23 Across species, the relative content of MLC17 splice-in inversely correlates with the velocity of shortening of smooth muscle tissues.36 37 The present study demonstrates a difference in the relative proportion of MLC17 splice-in and splice-out transcripts between cultured aortic and gizzard SMCs, as well as a shift in the splicing pattern to the tonic type (MLC17b predominance) in phasic SMCs treated with ET-1. This is the first study to demonstrate that an alteration in the contractile properties of SMCs from phasic to tonic is associated with a shift in MLC17 isoforms. Although the study by Kelley et al7 found no effect on the velocity of actin filament movement in an in vitro motility assay in which the gizzard MLC17 had been exchanged onto the aortic MHC, the applicability of this result to the mechanical properties of SMCs is uncertain. Proof that the MLC17 isoforms confer phasic or tonic properties will require experiments in which expression of the isoforms is forced within fast or slow contracting SMCs. It is also possible that other components of excitation-contraction coupling contribute to the contractile differences of phasic and tonic smooth muscle.


*    Selected Abbreviations and Acronyms
 
Ang II = angiotensin II
ED = embryonic day
ET = endothelin
MHC = myosin heavy chain
MLC = myosin light chain
PCR = polymerase chain reaction
RT = reverse transcription
SMC = smooth muscle cell


*    Acknowledgments
 
This study was supported by National Institutes of Health grants HL-03275 (Dr Fisher), HL-47530 (Dr Ikebe), and HL-44181 (Dr Brozovich). We thank Dr Michael Simonson for providing BQ610 and for critical reading of this manuscript.


*    Footnotes
 
Presented in part at the 69th Scientific Sessions of the American Heart Association, New Orleans, La, November 10-13, 1996.

1 The present study examined force generation in SMCs derived from tissues that are traditionally classified as phasic and tonic.2 Force maintenance, relaxation, and the maximum velocity of muscle shortening were not examined. Back

Received December 27, 1996; accepted April 4, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Hartshorne DJ. Biochemistry of the contractile process in smooth muscle. In Johnson LR, ed. Physiology of the Gastrointestinal Tract. 2nd ed. New York, NY: Raven Press Publishers; 1987:423-482.

2. Somlyo AP, Somlyo AV. Signal transduction and regulation in smooth muscle. Nature. 1994;372:231-236.[Medline] [Order article via Infotrieve]

3. Kirby ML, Gale TF, Stewart DE. Neural crest cells contribute to normal aorticopulmonary septation. Science. 1983;220:1059-1061.[Abstract/Free Full Text]

4. Cunha GR, Battle E, Young P, Brody J, Donjacour A, Hayashi N, Kinbara H. Role of epithelial-mesenchymal interactions in the differentiation and spatial organization of visceral smooth muscle. Epithelial Cell Biol. 1992;1:76-83.[Medline] [Order article via Infotrieve]

5. Chamley-Campell J, Campbell GR, Ross R. The smooth muscle cell in culture. Physiol Rev. 1979;59:1-61.[Free Full Text]

6. Brozovich FV, Yamakawa M. Agonist activation modulates cross-bridge states in single vascular smooth muscle cells. Am J Physiol. 1993;264:C103-C108.[Abstract/Free Full Text]

7. Kelley CA, Takahashi M, Yu JH, Adelstein RS. An insert of seven amino acids confers functional differences between smooth muscle myosins from the intestines and vasculature. J Biol Chem. 1993;268:12848-12854.[Abstract/Free Full Text]

8. Nabeshima Y, Nonomura Y, Fujii-Kuriyama Y. Nonmuscle and smooth muscle myosin light chain mRNAs are generated from a single gene by the tissue-specific alternative RNA splicing. J Biol Chem. 1987;262:10608-10612.[Abstract/Free Full Text]

9. Fisher SA, Ikebe M. Developmental and tissue distribution of expression of nonmuscle and smooth muscle isoforms of myosin light chain kinase. Biochem Biophys Res Commun. 1995;217:696-703.[Medline] [Order article via Infotrieve]

10. White S, Martin AF, Periasamy M. Identification of a novel smooth muscle myosin heavy chain cDNA: isoform diversity in the S1 head region. Am J Physiol. 1993;264:C1252-C1258.[Abstract/Free Full Text]

11. Babij P. Tissue-specific and developmentally regulated alternative splicing of a visceral isoform of smooth muscle myosin heavy chain. Nucleic Acids Res.. 1993;21:1467-1471.[Abstract/Free Full Text]

12. Miano JM, Cserjesi P, Ligon KL, Periasamy M, Olson EN. Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis. Circ Res. 1994;75:803-812.[Abstract/Free Full Text]

13. Rubanyi GM, Vanhoutte PM. Hypoxia releases a vasoconstrictor substance from the canine vascular endothelium. J Physiol (Lond). 1985;364:45-56.[Abstract/Free Full Text]

14. O'Brien RF, Robbins RJ, McMurtry IF. Endothelial cells in culture produce a vasoconstrictor substance. J Cell Physiol. 1987;132:263-270.[Medline] [Order article via Infotrieve]

15. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki Y. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415.[Medline] [Order article via Infotrieve]

16. Rubanyi GM, Polokoff MA. Endothelins: molecular biology, biochemistry, pharmacology, physiology, pathophysiology. Pharmacol Rev. 1994;46:325-415.[Medline] [Order article via Infotrieve]

17. Giuriato L, Scatena M, Chiavegato A, Tonello M, Scannapieco G, Pauletto P, Sartore S. Non-muscle myosin isoforms and cell heterogeneity in developing rabbit vascular smooth muscle. J Cell Sci. 1992;101:233-246.[Abstract/Free Full Text]

18. Li X, Tsai P, Wieder ED, Kribben A, Van Putten V, Schrier RW, Nemenoff RA. Vascular smooth muscle cells grown on Matrigel: a model of the contractile phenotype with decreased activation of mitogen activated protein kinase. J Biol Chem. 1994;269:19653-19658.[Abstract/Free Full Text]

19. Brozovich FV. PKC regulates agonist-induced force enhancement in single {alpha}-toxin-permeabilized vascular smooth muscle cells. Am J Physiol. 1995;268:C1202-C1206.[Abstract/Free Full Text]

20. Ito M, Dabrowska R, Guerrerio VJ, Hartshorne DJ. Identification in turkey gizzard of an acidic protein related to the C-terminal portion of smooth muscle myosin light chain kinase. J Biol Chem. 1989;264:13971-13974.[Abstract/Free Full Text]

21. Gallagher PJ, Herring BP. The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, Telokin. J Biol Chem. 1991;266:23945-23952.[Abstract/Free Full Text]

22. Yoshikai S, Ikebe M. Molecular cloning of the chicken gizzard Telokin gene and cDNA. Arch Biochem Biophys. 1992;299:242-247.[Medline] [Order article via Infotrieve]

23. Hasegawa Y, Morita F. Role of 17-kDa essential light chain isoforms of aorta smooth muscle myosin. J Biochem. 1992;111:804-809.[Abstract/Free Full Text]

24. Malmqvist U, Arner A, Uvelius B. Contractile and cytoskeletal proteins in smooth muscle during hypertrophy and its reversal. Am J Physiol. 1991;260:C1085-C1093.[Abstract/Free Full Text]

25. Aikawa M, Sivam PN, Kuro-o M, Kimura K, Nakahara K, Takewaki S, Ueda M, Yamaguchi H, Yazaki Y, Periasamy M, Nagai R. Human smooth muscle myosin heavy chain isoforms as molecular markers for vascular development and atherosclerosis. Circ Res. 1993;73:1000-1012.[Abstract/Free Full Text]

26. Taylor DA, Stull JT. Calcium dependence of myosin light chain phosphorylation in smooth muscle cells. Biol Chem. 1988;263:14456-14462.[Abstract/Free Full Text]

27. Monical PL, Owens GK, Murphy RA. Expression of myosin regulatory light-chain isoforms and regulation of phosphorylation in smooth muscle. Am J Physiol. 1993;264:C1466-C1472.[Abstract/Free Full Text]

28. Bowers CW, Dahm LM. Maintenance of contractility in dissociated smooth muscle: low density cultures in a defined medium. Am J Physiol. 1993;264:C229-C236.[Abstract/Free Full Text]

29. Katoh Y, Periasamy M. Growth and differentiation of smooth muscle cells during vascular development. Trends Cardiovasc Med. 1996;6:100-107.

30. Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev. 1995;75:487-517.[Abstract/Free Full Text]

31. Kurihara Y, Kurihara H, Oda H, Maemura K, Nagai R, Ishikawa T, Yazaki Y. Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J Clin Invest. 1995;96:293-300.

32. Tanahashi T, Yamaguchi K, Ishikawa S, Kusuhara M, Adachi I, Abe O. Endothelin-1 inhibits adipogenic differentiation of 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 1991;177:854-860.[Medline] [Order article via Infotrieve]

33. Shinohara O, Murata YI, Shimizu M. Endothelin-1 suppression of rat adipocyte precursor cell differentiation in serum-free culture. Endocrinology. 1992;130:2031-2036.[Abstract/Free Full Text]

34. LeLievre C, Le Dourain NM. Mesenchymal derivatives of the neural crest: analysis of chimeric quail and chick embryos. J Embryol Exp Morphol. 1975;34:125-154.[Medline] [Order article via Infotrieve]

35. Schwartz K, Chassagne C, Boheler KR. The molecular biology of heart failure. J Am Coll Cardiol. 1993;22:30A-33A.

36. Malmqvist U, Arner A. Correlation between isoform composition of the 17 kDa myosin light chain and maximal shortening velocity in smooth muscle. Pflugers Arch. 1991;418:523-530.[Medline] [Order article via Infotrieve]

37. Helper DJ, Lash JA, Hathaway DR. Distribution of isoelectric variants of the 17,000-dalton myosin light chain in mammalian smooth muscle. J Biol Chem. 1988;263:15748-15753.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
N. Sandbo, S. Taurin, D. M. Yau, S. Kregel, R. Mitchell, and N. O. Dulin
Downregulation of smooth muscle {alpha}-actin expression by bacterial lipopolysaccharide
Cardiovasc Res, May 1, 2007; 74(2): 262 - 269.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
S. SHUKLA, F. DEL GATTO-KONCZAK, R. BREATHNACH, and S. A. FISHER
Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1
RNA, November 1, 2005; 11(11): 1725 - 1736.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
M. Ekman, K. Fagher, M. Wede, K. Stakeberg, and A. Arner
Decreased Phosphatase Activity, Increased Ca2+ Sensitivity, and Myosin Light Chain Phosphorylation in Urinary Bladder Smooth Muscle of Newborn Mice
J. Gen. Physiol., January 31, 2005; 125(2): 187 - 196.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. M. Karim, A. Y. Rhee, A. M. Given, M. D. Faulx, B. D. Hoit, and F. V. Brozovich
Vascular Reactivity in Heart Failure: Role of Myosin Light Chain Phosphatase
Circ. Res., September 17, 2004; 95(6): 612 - 618.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. C. Payne, H.-Y. Zhang, Y. Shirasawa, Y. Koga, M. Ikebe, J. N. Benoit, and S. A. Fisher
Dynamic changes in expression of myosin phosphatase in a model of portal hypertension
Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1801 - H1810.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Shukla, W. P. Dirksen, K. M. Joyce, C. Le Guiner-Blanvillain, R. Breathnach, and S. A. Fisher
TIA Proteins Are Necessary but Not Sufficient for the Tissue-specific Splicing of the Myosin Phosphatase Targeting Subunit 1
J. Biol. Chem., April 2, 2004; 279(14): 13668 - 13676.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. P. Dirksen, S. A. Mohamed, and S. A. Fisher
Splicing of a Myosin Phosphatase Targeting Subunit 1 Alternative Exon Is Regulated by Intronic Cis-elements and a Novel Bipartite Exonic Enhancer/Silencer Element
J. Biol. Chem., March 7, 2003; 278(11): 9722 - 9732.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. Karagiannis, G. J Babu, M. Periasamy, and F. V Brozovich
The Smooth Muscle Myosin Seven Amino Acid Heavy Chain Insert's Kinetic Role in the Crossbridge Cycle for Mouse Bladder
J. Physiol., March 1, 2003; 547(2): 463 - 473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Takizawa, D. J. Schmidt, K. Mabuchi, E. Villa-Moruzzi, R. A. Tuft, and M. Ikebe
M20, the small subunit of PP1M, binds to microtubules
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C250 - C262.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Lofgren, K. Fagher, O. K. Wede, and A. Arner
Decreased shortening velocity and altered myosin isoforms in guinea-pig hypertrophic intestinal smooth muscle
J. Physiol., November 1, 2002; 544(3): 707 - 714.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C.-M. Hai, G. Sadowska, L. Francois, and B. S. Stonestreet
Maternal dexamethasone treatment alters myosin isoform expression and contractile dynamics in fetal arteries
Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1743 - H1749.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Lofgren, K. Fagher, G. Woodard, and A. Arner
Effects of thyroxine on myosin isoform expression and mechanical properties in guinea-pig smooth muscle
J. Physiol., September 15, 2002; 543(3): 757 - 766.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
O. Ogut and F. V. Brozovich
Determinants of the contractile properties in the embryonic chicken gizzard and aorta
Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1722 - C1732.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
P. G. Smith, C. Roy, S. Fisher, Q.-Q. Huang, and F. Brozovich
Cellular Responses to Mechanical Stress: Selected Contribution: Mechanical strain increases force production and calcium sensitivity in cultured airway smooth muscle cells
J Appl Physiol, November 1, 2000; 89(5): 2092 - 2098.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. P. Dirksen, F. Vladic, and S. A. Fisher
A myosin phosphatase targeting subunit isoform transition defines a smooth muscle developmental phenotypic switch
Am J Physiol Cell Physiol, March 1, 2000; 278(3): C589 - C600.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q.-Q. Huang, S. A. Fisher, and F. V. Brozovich
Forced Expression of Essential Myosin Light Chain Isoforms Demonstrates Their Role in Smooth Muscle Force Production
J. Biol. Chem., December 3, 1999; 274(49): 35095 - 35098.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. L. White, M. Y. Zhou, R. B. Low, and M. Periasamy
Myosin heavy chain isoform expression in rat smooth muscle development
Am J Physiol Cell Physiol, August 1, 1998; 275(2): C581 - C589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Khatri, K. M. Joyce, F. V. Brozovich, and S. A. Fisher
Role of Myosin Phosphatase Isoforms in cGMP-mediated Smooth Muscle Relaxation
J. Biol. Chem., September 28, 2001; 276(40): 37250 - 37257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. T. Richards, O. Ogut, and F. V. Brozovich
Agonist-induced Force Enhancement. THE ROLE OF ISOFORMS AND PHOSPHORYLATION OF THE MYOSIN-TARGETING SUBUNIT OF MYOSIN LIGHT CHAIN PHOSPHATASE
J. Biol. Chem., February 1, 2002; 277(6): 4422 - 4427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fisher, S. A.
Right arrow Articles by Brozovich, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fisher, S. A.
Right arrow Articles by Brozovich, F.