Articles |
From the Department of Medicine (S.A.F., F.B.), Division of Cardiology and Molecular Cardiovascular Research Center, and the Department of Physiology and Biophysics (S.A.F., M.I., F.B.), Case Western Reserve University School of Medicine, Cleveland, Ohio.
Correspondence to Steven A. Fisher, Division of Cardiology, University Hospitals, 11100 Euclid Ave, Cleveland, OH 44106-5038. E-mail saf9{at}po.cwru.edu
| Abstract |
|---|
|
|
|---|
Key Words: smooth muscle phenotype phasic and tonic contraction endothelin-1 myosin isoform development
| Introduction |
|---|
|
|
|---|
In the present study, we tested the hypothesis that the SMC phenotype is determined by peptide growth factors that are unique to the microenvironment in which the phenotype develops. We first identified that period during development in which the phenotypes arise, using the aorta and gizzard (intestine) as representative of tonic and phasic tissues, respectively, and MLC17 and MHC splice variant isoforms as molecular markers of the phenotypes. We then developed a system in which the embryonic aortic and intestinal SMCs display tonic and phasic contractile properties, respectively, in vitro. In this system, single factors could be tested in isolation for their ability to influence the SMC contractile phenotype. This overcame a long-standing obstacle to the study of the determinants of SMC phenotype, the dedifferentiation of SMCs to a proliferative phenotype in culture.5 We show that ET-1 is highly enriched in the developing aortic (tonic) tissues compared with the developing intestinal (phasic) tissues and that treatment of phasic SMCs with ET-1 in vitro converts them to the tonic type, suggesting a role for ET-1 in the development of the aortic (tonic) smooth muscle phenotype.
| Materials and Methods |
|---|
|
|
|---|
The following day, the medium containing unattached fragments was
removed and replaced with growth medium. Cells grew out from tissue
explants in 3 to 5 days, and they were rinsed with PBS, detached with
0.05% trypsin and 5 mmol/L EDTA, mixed with an equal volume of
growth medium, and pelleted by centrifugation. Cells
were resuspended in medium, counted, and plated at a density of
2x104 to 3x104 cells/cm2 either
on tissue culture plastic or coated dishes. When cells were to be grown
and repassaged, they were resuspended in DMEM/Ham's F-12+10% FCS.
Cells that were to be used for mechanical or growth studies were
resuspended in DMEM/Ham's F-12+0.5% FCS (growth-arrested medium).
Cells were studied between the first and third passages. More than 80%
of the cells were SMCs, as determined by
-smooth muscle actin
antibody (Sigma Chemical Co) staining (not shown). There was no
evidence of endothelial cell contamination in the
passaged SMC cultures, as evidenced by absence of staining with an
antibody against von Willebrand factor (Dako).
Treatment With Growth Factors
Cells were plated onto dishes or glass coverslips that were
coated with Matrigel (lot No. 905795,909785,909825, Becton-Dickinson),
diluted 1:2 with medium, and applied at 50 µL/cm2 as per
the manufacturer's recommendation. Ang II (Sigma) or ET-1 (American
Peptides Inc) was added to the medium the following day at
concentrations ranging from 10-6 to
10-8 mol/L for Ang II and
10-7 to 10-10 mol/L
for ET-1. ET-1 was added to the medium daily; Ang II was added either
daily or every 8 hours. The medium was changed every other day. ET-1 at
10-7 mol/L is equivalent to 249 ng/mL, and 24
hours after addition, the concentration was
2.5x10-10 mol/L (620 pg/mL). The ET-A
receptorspecific blocker BQ610 (American Peptides Inc) was added to a
final concentration of 2x10-7 mol/L either 5
minutes before the addition of ET-1 or alone the day after the cells
were plated. Under growth-arrested conditions,
5% of cells on
Matrigel were BrdU positive (proliferative) in a 24-hour period, and
the percentage did not change with ET-1 treatment.
Single-Cell Force Measurements
Individual coverslip fragments were removed from the culture
dishes, rinsed with physiological saline solution,
and placed in an experimental chamber mounted on the stage of an
inverted microscope (Nikon). The experimental setup has been described
in detail previously.6 To record force, the ends of
individual cells were tied onto pulled glass capillary tubes, one of
which was connected to a force transducer (Cambridge). After cell
attachment, the individual cells were lifted off of the matrix before
activation. To activate the cells, the solution bathing the
cells was changed by using a flow-through system. SMCs were stimulated
to contract with maximal depolarization (90 mmol/L KCl) or with
agonists: phenylephrine, 10-5
mol/L; Ang II, 10-6 mol/L; and ET-1,
10-7 mol/L. Force records were digitized
at 10 Hz with 12-bit resolution and stored on a Nicolet storage
oscilloscope (Nicolet Instruments) for later analysis.
Approximately 70% of the cells examined from gizzard and aortic
cultures at passages 1 to 3 contracted in response to either KCl or
agonist stimulation.
RT-PCR of MHC and MLC17 Transcript Splice Variants As
Markers of Tonic and Phasic Phenotypes
Splice variants of MHC and MLC17 were examined in a
developmental embryonic chick series as well as in cultured cells. The
following sets of oligonucleotide primers, listed 5' to
3', were used in RT-PCR to assess species of mRNA: smooth muscle MHC,
+511 GACATGTACAAGGGAAAGAAGAGGCA and +840
AATCGGGAGGAGTTGTCATTCTTGAC, which generated 330-bp (aortic) or 351-bp
(gizzard) fragments, spanning a 21-bp exon present in the head of
the adult gizzard MHC transcript but not in adult aorta
transcript7 ; MLC17, +67
GAGTTCAAGGAGGCATTCCAGCTGT and +465 CGCTCAGCACCATCCGGACGAG, which
generated 422-bp (MLC17a, intestinal) and 461-bp
(MLC17b) fragments, spanning a 39-bp exon present in a
fraction of adult aorta transcripts but not in adult gizzard
transcripts.8 Total RNA was isolated, and 2.5 µg was
reverse-transcribed as previously described.9 The entire
RT reaction was subject to PCR, with melting at 95°C for 1 minute and
annealing and extension at 60°C for 1 minute for 35 cycles.
PCR products were separated on 2% agarose gels and visualized with
ethidium bromide. Bands were photographed at two different exposures
and quantified using NIH image 159 software. Gels were always run in
which splice-in and splice-out PCR products were present so
that each could be identified. Values were calculated for each band by
multiplying the intensity by the pixel number after background
subtraction. The standard deviation of intensity for each band was
always <10% of the mean intensity, thus excluding contamination from
adjacent brighter bands. Exon splice-in and splice-out variants are
expressed as the percentage of the total transcripts. To demonstrate
that the percentage of splice-in and splice-out transcripts could be
accurately measured by RT-PCR, the relationship of percent splice-in
and splice-out to input RNA was examined in two samples in which these
values were quite different, ie, ED8 and ED16 gizzard tissues. As can
be seen in Fig 1
, the ratios for MLC17 are
highly concordant over a large range of input RNA, thus demonstrating
that in this assay the ratios obtained are independent of the amount of
input RNA or the amount of PCR product loaded on the gel. The PCR
products were individually eluted from the agarose gels using a
Qiagen kit and directly sequenced with the primers used in the RT-PCR
reaction, on an automated sequencer (Applied Biosystems, Perkin-Elmer),
to confirm their identities.
|
ET-1 Assays
Tissues were removed from the chick embryos, immediately placed
into liquid N2, weighed, and homogenized in 1
mol/L acetic acid (1 mL/100 mg tissue) with 1 µg/mL pepstatin. The
samples were boiled for 10 minutes, placed on ice for 5 minutes,
ultracentrifuged at 100 000g, and then processed in
parallel with cell culture supernatant. For cultured cells, DMEM
(phenyl free)+0.5% FCS was added 6 to 12 hours after the cells were
passed, collected 2 to 18 hours later, and processed as recommended by
the manufacturer of the Parameter ET-1 assay kit (R+D
Systems). ET-1 values are normalized to wet weight of the tissue and,
in the culture system, to cell number, which was determined by
trypsinizing the cells and counting at the time of medium
collection.
Statistical Analysis
Differences between control and experimental groups were checked
for statistical significance (P<.05) with a two-way ANOVA
and Student's t test, using SigmaSTAT software (Jandel
Scientific). For multiple comparisons, a Bonferroni correction was
used, so that in the force measurements, in which six experimental
groups were present, P<.008 was considered
statistically significant. All values given in the text are
mean±SEM.
| Results |
|---|
|
|
|---|
80% of the transcripts are
MLC17b and 20% of the transcripts are
MLC17a.
|
A similar scenario is observed with MHC-head splicing. Intestinal
tissue at the earliest time point examined, ED6, expresses the MHC
splice-out variant (Fig 2B
). At ED10, the gizzard has shifted splicing
of MHC to splice-in (phasic) predominance, and by ED16 the adult
pattern7 10 11 of splice-in is nearly exclusively
observed. In aortic tissue, the splice-out isoform predominates at the
earliest time point examined (ED10). The splice-in pattern is briefly
observed in a minority of transcripts on ED10, ED14, and ED16, but by
ED19 the adult pattern of exclusive expression of the splice-out
isoform is observed. Thus, for both MLC17 and MHC, the
splicing pattern early in the development of aortic and intestinal
tissues most resembles the aortic (tonic) type, and the mature gizzard
(phasic) splicing pattern develops subsequently.
ET-1 Is Predominantly Detected in Developing Aortic (Tonic) Tissues
and Aortic SMC Culture
It has been speculated that local tissue factors are responsible
for the generation of smooth muscle diversity.12 Among
them, ET-1, a 21 amino acidsecreted protein, which was first
identified as an endothelium-derived contractile
agonist,13 14 15 is of particular interest. ET-1 has
subsequently been shown to be a growth regulator for a number of cell
types (reviewed in Reference 1616 ). Large-vessel SMCs mature adjacent to
the endothelium,17 the major source of
ET-1, whereas intestinal SMCs do not, suggesting that this protein
might play a role in determining these different phenotypes. We
measured ET-1 levels at the stages during which the smooth muscle
phenotypes are specified. ET-1 was detected at 1.0 pmol/g
tissue in ED10 to ED14 aortic tissue homogenates (Table 1
). It was barely detected in ED10 to ED14 intestinal
tissue (0.025 pmol/g tissue), at the time of its transition to the
phasic phenotype, as evidenced by the maturation of
MLC17 and MHC splicing.
|
Since an objective of the present study was to examine the
role of growth factors in specifying smooth muscle phenotypes,
the amount of ET-1 secreted into the media in cultured aortic and
gizzard SMCs (described below) was measured. ET-1 was detected at
higher concentrations in the aortic SMC cultures, although the
magnitude of the difference was less than that found in vivo. In three
separate experiments from two independent cell preparations, cultured
aortic cells secreted an average of 6-fold more ET-1 per
106 cells than did the cultured gizzard cells over a 2- to
18-hour period (Table 1
). This relationship was true of cells from
passages 1 to 2 and independent of whether cells were cultured on
plastic or Matrigel (data not shown). The concentration of ET-1 in the
aortic culture medium ranged from 20 to 80 pmol/L; in the gizzard
culture medium, the concentration ranged from 1 to 8 pmol/L. Both sets
of cultures did not stain with an antibody against the
endothelial cellspecific von Willebrand
factor, indicating that the SMCs were the source of the ET-1, as
previously reported for vascular SMCs in culture (reviewed in Reference
1616 ).
Embryonic SMCs Retain Their Phasic or Tonic Contractile Properties
In Vitro
In order to test the hypothesis that it is the presence of ET-1
that specifies the aortic (tonic) smooth muscle phenotype, an
SMC culture system was established in which the effects of the chronic
exposure of SMCs to ET-1 in isolation could be examined. Crucial to
testing this hypothesis was the development of a system in which the
aortic and intestinal SMCs in vitro displayed tonic and phasic
contractile properties, respectively, since it is generally believed
that SMCs revert to a proliferative noncontractile phenotype in
vitro.5 We cultured SMCs derived from ED10 to ED15 gizzard
and aorta, a period in development critical for the establishment of
the phenotypes. The cells were cultured on the complex
extracellular matrix Matrigel, because a previous study had suggested
that adult vascular SMCs are differentiated when cultured on this
substrate for up to five passages,18 although contractile
properties and molecular markers were not examined.
Embryonic gizzard and aortic SMCs derived from tissue explants
displayed phasic and tonic* contractile properties,
respectively, when cultured on Matrigel in low-serum (0.5% FCS)
medium. A typical data record for the force response of a cultured
gizzard cell to KCl depolarization is displayed in Fig 3A
. After activation, force rapidly increased to an
average maximum force of 3.0±0.7 µN (n=10, mean±SEM), with a time
to peak force of 8±2 seconds (Table 2
). The cultured
aortic cells contracted in response to KCl depolarization with an
average maximum force of 0.76±0.10 µN (n=9) and time to peak force
of 20±2 seconds (Fig 3D
and Table 2
). Both the rate of force
development and the absolute maximum force were significantly higher
for the gizzard SMCs compared with aortic SMCs (P=.0019 and
P=.0027, respectively). For each cell type, activation with
the agonists ET-1, Ang II, and phenylephrine gave
contractile responses similar to those seen with KCl depolarization
(Fig 4
). ET-1 also caused contractions in isolated
strips of ED7 and ED16 aortic tissue (data not shown), which, as in the
cultured cells, were blocked by pretreatment with the ET-A
receptorspecific antagonist BQ610, demonstrating that the
ET-A receptor was present in the cells in vivo and in vitro.
|
|
|
The cultured SMCs could be seen to shorten toward the fixed end when depolarized with one end fixed and one end free. This is the first demonstration of the preservation of the usual contractile properties, ie, fast and slow force production and shortening of SMCs in vitro. Cells from passages 1 to 3 showed full contractile responses, whereas force was undetectable after KCl depolarization or agonist stimulation of passage-5 cells (not shown). The force tracings obtained upon stimulation of the cultured embryonic SMCs were similar to those of freshly isolated adult SMCs.19
Chronic Exposure of Cultured Aortic and Gizzard SMCs to ET-1 and
Ang II Has Distinct Effects on Their Contractile Properties
Since gizzard SMCs develop the phasic phenotype in a
microenvironment in which ET-1 is barely detected, whereas aortic cells
display the tonic phenotype in the presence of significant
amounts of ET-1, we examined whether ET-1 may specify the tonic
properties. Chronic exposure of cultured gizzard SMCs to
10-7 mol/L ET-1 for 2 to 5 days resulted in
cells that generated one third of the force developed in control cells
in response to KCl depolarization (P=.0024; Fig 3B
, Table 2
). The rate of force development was slowed 3-fold
(P=.0008); thus, the contractile response resembled that of
the aortic (tonic) SMCs. This modulation of the contractile properties
was blocked by chronic pretreatment with the ET-Aspecific receptor
antagonist BQ610 (2x10-7 mol/L),
indicating that the ET-1 effect was mediated via the ET-A receptor. In
contrast, chronic exposure of gizzard SMCs to Ang II
(10-6 mol/L) modestly prolonged time to peak
force without altering peak force (P>.05; Fig 3C
, Table 2
),
demonstrating the specificity of the effect of ET-1. Treatment of the
gizzard SMCs with an alternative Ang II regimen,
10-7 or 10-8 mol/L
every 8 hours for 24 to 48 hours, also produced no significant effect.
With Ang II treatment at 10-7 mol/L (n=3),
peak force was 3.8±0.7 µN, and time to peak force was 6±2 seconds;
at 10-8 mol/L (n=4), peak force was 3.5±0.3
µN, and time to peak force was 10±4 seconds (all P>.05
compared with control).
The effect of ET-1 was observed at a minimum initial concentration of
10-9 mol/L (2.5 ng/mL) and required 24 hours
of exposure (data not shown). The minimum concentration of exogenous
ET-1 required to achieve this effect, 10-9
mol/L, is within range of the concentrations of endogenous
ET-1 observed in the cultured aortic SMCs
(2x10-11 to 8x10-11
mol/L) when taking into consideration the catabolism of exogenously
added ET-1 in the culture (
400-fold decrease in concentration over
24 hours). This minimum effective concentration of ET-1 is considerably
higher than the maximum concentration of ET-1 observed in the cultured
gizzard SMC supernatants (8x10-12 mol/L).
Chronic exposure of the aortic SMCs to ET-1
(10-7 mol/L) or Ang II
(10-6 mol/L) did not decrease but rather
increased force in response to KCl depolarization, although these
differences did not reach statistical significance when corrected for
multiple comparisons (P=.035 and P=.026 [not
significant]). There was no significant change in time to peak force
with ET-1 or Ang II treatment (Fig 3D
through 3F, Table 2
). Since the
cultured aortic SMCs secreted significant amounts of ET-1, in agreement
with previous reports,16 we also examined the effect that
the ET-A blocker BQ610 would have on these cells in the absence of
exogenous ET-1. Treatment with the ET-A blocker BQ610 at a
concentration of 2x10-7 mol/L for 24 hours,
which blocked the ET-1mediated alterations in force
production of gizzard SMCs described above, did not
significantly change force production of the cultured aortic
SMCs. These results show that ET-1 specifically modulates SMC
contractile properties from the phasic to that of the tonic type and
that the absence of ET-1mediated ET-A receptor stimulation by itself
is not sufficient to convert tonic SMCs to the phasic phenotype
in vitro. In addition, when the gizzard SMCs were treated for 48 hours
with ET-1, washed, and returned to control medium for an additional 48
hours, their contractile properties remained tonic (peak force,
0.6±0.1 µN; time to peak force, 16±1 seconds; n=3), also
demonstrating that at least in the short term the continued presence of
ET-1 is not required to maintain the tonic phenotype.
Correlation of MHC and MLC17 Isoforms With SMC
Contractile Properties
To identify molecular correlates of the tonic and phasic
contractile properties, the splice variants of MLC17 and
MHC were examined. Gizzard SMCs derived from ED14 to ED15 embryos in
vitro displayed the MLC17 splice pattern of an earlier
(ED10) stage, in which the MLC17b/MLC17a ratio
approximated 60:40 (Fig 5
). In two separate experiments,
gizzard cells treated with 10-7 mol/L ET-1 for
24 hours exhibited a shift to the aortic splice pattern, in which the
MLC17b/MLC17a ratio was between 80:20 and 90:10
(n=3, Fig 5
). In contrast, when embryonic gizzard SMCs mature in vivo
in a low ET-1 environment, the reverse occurs: the
MLC17b/MLC17a ratio shifts from 60:40 to 30:70.
In cultured aortic SMCs, the MLC17b/MLC17a
ratio approximated the adult pattern (80:20) and was not affected by
ET-1 treatment (Fig 5
).
|
The MHC-head splicing pattern in cultured control gizzard SMCs was, like that of MLC17 splicing, the more embryonic (splice-out) type. Unlike MLC17 splicing, the MHC-head splicing pattern in cultured gizzard SMCs was not affected by ET-1 treatment (data not shown), indicating that the change in the contractile properties of cultured gizzard SMCs is not due to a change in MHC-head splice isoforms. The cultured aortic SMCs also exclusively expressed the MHC splice-out variant. Telokin, a transcript that is highly enriched in intestinal smooth muscle in vivo but the function of which is unknown,20 21 22 was always present in the cultured gizzard SMCs and absent from the aortic SMCs (data not shown), distinguishing these two cell populations.
| Discussion |
|---|
|
|
|---|
Identification of That Period in Development in Which the
Tonic and Phasic Phenotypes Are Specified
A developmental series was performed to determine when the diverse
smooth muscle phenotypes are specified. MHC and
MLC17 splice variants were chosen as markers of the tonic
and phasic phenotypes because several studies had suggested
that isoforms of these proteins may confer tonic or phasic
properties,7 23 24 although this has yet to be directly
proven. In this series, the tonic pattern of splicing appeared to be
the more embryonic or default type, because it is at one point in
development present in both tonic and phasic tissues. This
observation, ie, that the tonic phenotype is the more embryonic
or default type, has also been suggested to be the case in other
species, such as rabbits.11 The present study defines
ED6 to ED16 as that period when the gizzard develops the phasic
phenotype, as defined by MHC and MLC17 splice
variants, although there are other isoform switches that occur later in
development (References 9 and 259 25 and data not shown) and presumably are
under different controls.
Establishment of a Cell Culture System in Which SMCs
Display Usual Contractile Properties
Critical to this study of the determinants of smooth muscle
contractile phenotypes was the development of a cell culture
system in which SMCs retain their usual contractile properties.
Although previous studies had demonstrated that cultured SMCs respond
to contractile agonists with various components necessary for
contraction (eg, calcium release or MLC20
phosphorylation26 27 ) or with changes in
the borders of attached cells,18 28 it was not clear
whether these cells maintain their in vivo contractile properties (ie,
force and shortening characteristics). We selected embryonic SMCs as a
model system for several reasons. First, SMCs, like
cardiomyocytes and distinct from skeletal myocytes, during
embryonic development are both proliferative and express markers of
differentiation,29 30 suggesting that embryonic SMCs would
be competent to both proliferate and contract in vitro. To our
knowledge, this is the first demonstration that these embryonic
proliferative SMCs are also fully contractile. The SMCs displayed
identical contractile properties on denatured collagen (data not shown)
and Matrigel, excluding the possibility that a component of the complex
extracellular matrix Matrigel was inducing these properties. Second, we
desired to test factors in isolation for their ability to specify tonic
or phasic contractile phenotypes. These phenotypes
develop between ED6 and ED16, so the study of embryonic SMCs derived
from this period of development would enable us to identify factors
responsible for this specification.
ET-1 and Tonic and Phasic Smooth Muscle Phenotypes
It has been suggested that factors unique to each tissue mediate
the development of smooth muscle phenotypes.12
ET-1 satisfied two criteria of any potential mediator: (1) it is highly
enriched in the tonic tissue relative to phasic tissue at the time at
which the phenotypes develop, and (2) treatment of the phasic
SMCs in vitro with ET-1 converted them to the tonic type. This suggests
that this protein might play a role in the specification of the tonic
aortic phenotype, consistent with the report of
maldevelopment of the neural crestderived proximal aorta and aortic
arch in mice in which the ET-1 gene was
inactivated.31 In that study, as in the
present study, the effects of ET-1 were mediated by the ET-A
receptor. Studies of other cell types, such as fat cells, have also
shown ET-1 to be a phenotypic determinant.32 33 Whether
ET-1 plays a role in the development of other portions of the
vasculature, especially those that do not display a pure tonic
phenotype or those that reside outside of the proximal aorta
and are of mesenchymal origin,34 is not known.
The results of the present study would support a hypothetical model in which (1) exposure of SMCs to ET-1 commits SMCs to the "tonic" phenotype, in which case, continued exposure to ET-1, at least in the short term, may not be necessary for maintenance of this phenotype, and (2) development of the "phasic" SMC phenotype from a default tonic phenotype requires the absence of ET-1, under which conditions additional unknown factors can operate. This model derives from the study of two smooth muscle tissues, aorta and gizzard, and two molecular markers, MHC and MLC17; whether it could be generalized to other smooth muscle tissues and other molecular markers is not known. The signaling pathway by which ET-1 converts phasic SMCs to the tonic type remains to be determined.
Molecular Determinants of SMC Tonic and Phasic
Properties
Although physiological and molecular
differences between phasic and tonic tissues have been described
previously,2 it is not currently clear which are the
molecular determinants and which are coincidental. The ability to
measure force from cultured single SMCs, as well as to change their
contractile properties with growth factor treatment, enabled us to
examine this issue. Because the speed of contraction in cardiac and
skeletal muscles is largely a function of the myofibrillar protein
isoforms that are present (reviewed in Reference 3535 ), it is
reasonable to examine MHC and MLC isoforms in smooth muscle as well.
Kelley et al7 have reported that the MHC isoform with a
21-bp exon in the head of the molecule, near the ATP binding site, has
increased in vitro actin translocating and ATPase activity when
compared with the splice-out isoform. However, the embryonic aortic and
gizzard SMCs in culture each expressed the MHC splice-out isoform, yet
the former showed tonic and the latter showed phasic contractile
properties, suggesting that under the conditions used in the
present study, the splice-in isoform is not necessary for rapid SMC
contraction. Although the MHC splice-in isoform does not appear to be
necessary for the phasic phenotype, it still may contribute to
the phasic properties of smooth muscle tissues in vivo.
It has also been shown that the relative MLC17b (splice-in) content of myosin inversely correlates with both its actin-activated ATPase activity (Vmax) and actin affinity (Km).23 Across species, the relative content of MLC17 splice-in inversely correlates with the velocity of shortening of smooth muscle tissues.36 37 The present study demonstrates a difference in the relative proportion of MLC17 splice-in and splice-out transcripts between cultured aortic and gizzard SMCs, as well as a shift in the splicing pattern to the tonic type (MLC17b predominance) in phasic SMCs treated with ET-1. This is the first study to demonstrate that an alteration in the contractile properties of SMCs from phasic to tonic is associated with a shift in MLC17 isoforms. Although the study by Kelley et al7 found no effect on the velocity of actin filament movement in an in vitro motility assay in which the gizzard MLC17 had been exchanged onto the aortic MHC, the applicability of this result to the mechanical properties of SMCs is uncertain. Proof that the MLC17 isoforms confer phasic or tonic properties will require experiments in which expression of the isoforms is forced within fast or slow contracting SMCs. It is also possible that other components of excitation-contraction coupling contribute to the contractile differences of phasic and tonic smooth muscle.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
1 The present study examined force generation in SMCs derived from tissues that are traditionally classified as phasic and tonic.2 Force maintenance, relaxation, and the maximum velocity of muscle shortening were not examined. ![]()
Received December 27, 1996; accepted April 4, 1997.
| References |
|---|
|
|
|---|
2. Somlyo AP, Somlyo AV. Signal transduction and regulation in smooth muscle. Nature. 1994;372:231-236.[Medline] [Order article via Infotrieve]
3.
Kirby ML, Gale TF, Stewart DE. Neural crest
cells contribute to normal aorticopulmonary septation.
Science. 1983;220:1059-1061.
4. Cunha GR, Battle E, Young P, Brody J, Donjacour A, Hayashi N, Kinbara H. Role of epithelial-mesenchymal interactions in the differentiation and spatial organization of visceral smooth muscle. Epithelial Cell Biol. 1992;1:76-83.[Medline] [Order article via Infotrieve]
5.
Chamley-Campell J, Campbell GR, Ross R. The
smooth muscle cell in culture. Physiol Rev. 1979;59:1-61.
6.
Brozovich FV, Yamakawa M. Agonist activation
modulates cross-bridge states in single vascular smooth muscle
cells. Am J Physiol. 1993;264:C103-C108.
7.
Kelley CA, Takahashi M, Yu JH, Adelstein RS. An insert
of seven amino acids confers functional differences between smooth
muscle myosins from the intestines and vasculature. J Biol
Chem. 1993;268:12848-12854.
8.
Nabeshima Y, Nonomura Y, Fujii-Kuriyama Y.
Nonmuscle and smooth muscle myosin light chain mRNAs are generated from
a single gene by the tissue-specific alternative RNA splicing.
J Biol Chem. 1987;262:10608-10612.
9. Fisher SA, Ikebe M. Developmental and tissue distribution of expression of nonmuscle and smooth muscle isoforms of myosin light chain kinase. Biochem Biophys Res Commun. 1995;217:696-703.[Medline] [Order article via Infotrieve]
10.
White S, Martin AF, Periasamy M. Identification
of a novel smooth muscle myosin heavy chain cDNA: isoform diversity in
the S1 head region. Am J Physiol. 1993;264:C1252-C1258.
11.
Babij P. Tissue-specific and developmentally
regulated alternative splicing of a visceral isoform of smooth muscle
myosin heavy chain. Nucleic Acids Res.. 1993;21:1467-1471.
12.
Miano JM, Cserjesi P, Ligon KL, Periasamy M, Olson
EN. Smooth muscle myosin heavy chain exclusively marks the
smooth muscle lineage during mouse embryogenesis. Circ
Res. 1994;75:803-812.
13.
Rubanyi GM, Vanhoutte PM. Hypoxia
releases a vasoconstrictor substance from the canine vascular
endothelium. J Physiol (Lond). 1985;364:45-56.
14. O'Brien RF, Robbins RJ, McMurtry IF. Endothelial cells in culture produce a vasoconstrictor substance. J Cell Physiol. 1987;132:263-270.[Medline] [Order article via Infotrieve]
15. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki Y. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415.[Medline] [Order article via Infotrieve]
16. Rubanyi GM, Polokoff MA. Endothelins: molecular biology, biochemistry, pharmacology, physiology, pathophysiology. Pharmacol Rev. 1994;46:325-415.[Medline] [Order article via Infotrieve]
17.
Giuriato L, Scatena M, Chiavegato A, Tonello M,
Scannapieco G, Pauletto P, Sartore S. Non-muscle myosin isoforms
and cell heterogeneity in developing rabbit vascular
smooth muscle. J Cell Sci. 1992;101:233-246.
18.
Li X, Tsai P, Wieder ED, Kribben A, Van Putten V,
Schrier RW, Nemenoff RA. Vascular smooth muscle cells grown on
Matrigel: a model of the contractile phenotype with decreased
activation of mitogen activated protein kinase.
J Biol Chem. 1994;269:19653-19658.
19.
Brozovich FV. PKC regulates agonist-induced
force enhancement in single
-toxin-permeabilized
vascular smooth muscle cells. Am J Physiol. 1995;268:C1202-C1206.
20.
Ito M, Dabrowska R, Guerrerio VJ, Hartshorne DJ.
Identification in turkey gizzard of an acidic protein related to the
C-terminal portion of smooth muscle myosin light chain kinase.
J Biol Chem. 1989;264:13971-13974.
21.
Gallagher PJ, Herring BP. The carboxyl terminus
of the smooth muscle myosin light chain kinase is expressed as an
independent protein, Telokin. J Biol Chem. 1991;266:23945-23952.
22. Yoshikai S, Ikebe M. Molecular cloning of the chicken gizzard Telokin gene and cDNA. Arch Biochem Biophys. 1992;299:242-247.[Medline] [Order article via Infotrieve]
23.
Hasegawa Y, Morita F. Role of 17-kDa essential
light chain isoforms of aorta smooth muscle myosin.
J Biochem. 1992;111:804-809.
24.
Malmqvist U, Arner A, Uvelius B. Contractile and
cytoskeletal proteins in smooth muscle during hypertrophy
and its reversal. Am J Physiol. 1991;260:C1085-C1093.
25.
Aikawa M, Sivam PN, Kuro-o M, Kimura K, Nakahara K,
Takewaki S, Ueda M, Yamaguchi H, Yazaki Y, Periasamy M, Nagai R.
Human smooth muscle myosin heavy chain isoforms as molecular markers
for vascular development and atherosclerosis.
Circ Res. 1993;73:1000-1012.
26.
Taylor DA, Stull JT. Calcium dependence of
myosin light chain phosphorylation in smooth muscle
cells. Biol Chem. 1988;263:14456-14462.
27.
Monical PL, Owens GK, Murphy RA. Expression of
myosin regulatory light-chain isoforms and regulation of
phosphorylation in smooth muscle. Am
J Physiol. 1993;264:C1466-C1472.
28.
Bowers CW, Dahm LM. Maintenance of
contractility in dissociated smooth muscle: low density
cultures in a defined medium. Am J Physiol. 1993;264:C229-C236.
29. Katoh Y, Periasamy M. Growth and differentiation of smooth muscle cells during vascular development. Trends Cardiovasc Med. 1996;6:100-107.
30.
Owens GK. Regulation of differentiation of
vascular smooth muscle cells. Physiol Rev. 1995;75:487-517.
31. Kurihara Y, Kurihara H, Oda H, Maemura K, Nagai R, Ishikawa T, Yazaki Y. Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J Clin Invest. 1995;96:293-300.
32. Tanahashi T, Yamaguchi K, Ishikawa S, Kusuhara M, Adachi I, Abe O. Endothelin-1 inhibits adipogenic differentiation of 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 1991;177:854-860.[Medline] [Order article via Infotrieve]
33.
Shinohara O, Murata YI, Shimizu M. Endothelin-1
suppression of rat adipocyte precursor cell differentiation in
serum-free culture. Endocrinology. 1992;130:2031-2036.
34. LeLievre C, Le Dourain NM. Mesenchymal derivatives of the neural crest: analysis of chimeric quail and chick embryos. J Embryol Exp Morphol. 1975;34:125-154.[Medline] [Order article via Infotrieve]
35. Schwartz K, Chassagne C, Boheler KR. The molecular biology of heart failure. J Am Coll Cardiol. 1993;22:30A-33A.
36. Malmqvist U, Arner A. Correlation between isoform composition of the 17 kDa myosin light chain and maximal shortening velocity in smooth muscle. Pflugers Arch. 1991;418:523-530.[Medline] [Order article via Infotrieve]
37.
Helper DJ, Lash JA, Hathaway DR. Distribution of
isoelectric variants of the 17,000-dalton myosin light chain in
mammalian smooth muscle. J Biol Chem. 1988;263:15748-15753.
This article has been cited by other articles:
![]() |
N. Sandbo, S. Taurin, D. M. Yau, S. Kregel, R. Mitchell, and N. O. Dulin Downregulation of smooth muscle {alpha}-actin expression by bacterial lipopolysaccharide Cardiovasc Res, May 1, 2007; 74(2): 262 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. SHUKLA, F. DEL GATTO-KONCZAK, R. BREATHNACH, and S. A. FISHER Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1 RNA, November 1, 2005; 11(11): 1725 - 1736. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ekman, K. Fagher, M. Wede, K. Stakeberg, and A. Arner Decreased Phosphatase Activity, Increased Ca2+ Sensitivity, and Myosin Light Chain Phosphorylation in Urinary Bladder Smooth Muscle of Newborn Mice J. Gen. Physiol., January 31, 2005; 125(2): 187 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Karim, A. Y. Rhee, A. M. Given, M. D. Faulx, B. D. Hoit, and F. V. Brozovich Vascular Reactivity in Heart Failure: Role of Myosin Light Chain Phosphatase Circ. Res., September 17, 2004; 95(6): 612 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Payne, H.-Y. Zhang, Y. Shirasawa, Y. Koga, M. Ikebe, J. N. Benoit, and S. A. Fisher Dynamic changes in expression of myosin phosphatase in a model of portal hypertension Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1801 - H1810. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shukla, W. P. Dirksen, K. M. Joyce, C. Le Guiner-Blanvillain, R. Breathnach, and S. A. Fisher TIA Proteins Are Necessary but Not Sufficient for the Tissue-specific Splicing of the Myosin Phosphatase Targeting Subunit 1 J. Biol. Chem., April 2, 2004; 279(14): 13668 - 13676. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Dirksen, S. A. Mohamed, and S. A. Fisher Splicing of a Myosin Phosphatase Targeting Subunit 1 Alternative Exon Is Regulated by Intronic Cis-elements and a Novel Bipartite Exonic Enhancer/Silencer Element J. Biol. Chem., March 7, 2003; 278(11): 9722 - 9732. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Karagiannis, G. J Babu, M. Periasamy, and F. V Brozovich The Smooth Muscle Myosin Seven Amino Acid Heavy Chain Insert's Kinetic Role in the Crossbridge Cycle for Mouse Bladder J. Physiol., March 1, 2003; 547(2): 463 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Takizawa, D. J. Schmidt, K. Mabuchi, E. Villa-Moruzzi, R. A. Tuft, and M. Ikebe M20, the small subunit of PP1M, binds to microtubules Am J Physiol Cell Physiol, February 1, 2003; 284(2): C250 - C262. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lofgren, K. Fagher, O. K. Wede, and A. Arner Decreased shortening velocity and altered myosin isoforms in guinea-pig hypertrophic intestinal smooth muscle J. Physiol., November 1, 2002; 544(3): 707 - 714. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Hai, G. Sadowska, L. Francois, and B. S. Stonestreet Maternal dexamethasone treatment alters myosin isoform expression and contractile dynamics in fetal arteries Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1743 - H1749. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lofgren, K. Fagher, G. Woodard, and A. Arner Effects of thyroxine on myosin isoform expression and mechanical properties in guinea-pig smooth muscle J. Physiol., September 15, 2002; 543(3): 757 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Ogut and F. V. Brozovich Determinants of the contractile properties in the embryonic chicken gizzard and aorta Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1722 - C1732. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Smith, C. Roy, S. Fisher, Q.-Q. Huang, and F. Brozovich Cellular Responses to Mechanical Stress: Selected Contribution: Mechanical strain increases force production and calcium sensitivity in cultured airway smooth muscle cells J Appl Physiol, November 1, 2000; 89(5): 2092 - 2098. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Dirksen, F. Vladic, and S. A. Fisher A myosin phosphatase targeting subunit isoform transition defines a smooth muscle developmental phenotypic switch Am J Physiol Cell Physiol, March 1, 2000; 278(3): C589 - C600. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q.-Q. Huang, S. A. Fisher, and F. V. Brozovich Forced Expression of Essential Myosin Light Chain Isoforms Demonstrates Their Role in Smooth Muscle Force Production J. Biol. Chem., December 3, 1999; 274(49): 35095 - 35098. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. White, M. Y. Zhou, R. B. Low, and M. Periasamy Myosin heavy chain isoform expression in rat smooth muscle development Am J Physiol Cell Physiol, August 1, 1998; 275(2): C581 - C589. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Khatri, K. M. Joyce, F. V. Brozovich, and S. A. Fisher Role of Myosin Phosphatase Isoforms in cGMP-mediated Smooth Muscle Relaxation J. Biol. Chem., September 28, 2001; 276(40): 37250 - 37257. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Richards, O. Ogut, and F. V. Brozovich Agonist-induced Force Enhancement. THE ROLE OF ISOFORMS AND PHOSPHORYLATION OF THE MYOSIN-TARGETING SUBUNIT OF MYOSIN LIGHT CHAIN PHOSPHATASE J. Biol. Chem., February 1, 2002; 277(6): 4422 - 4427. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |