This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gulick, J. Articles by Robbins, J. Search for Related Content PubMed PubMed Citation Articles by Gulick, J. Articles by Robbins, J.

(Circulation Research. 1997;80:655-664.)
© 1997 American Heart Association, Inc.

Articles

Transgenic Remodeling of the Regulatory Myosin Light Chains in the Mammalian Heart

James Gulick, Timothy E. Hewett, Raisa Klevitsky, Scott H. Buck, Richard L. Moss, , Jeffrey Robbins

From the Children's Hospital Research Foundation, Department of Pediatrics, Division of Molecular Cardiovascular Biology (J.G., T.E.H., R.K., J.R.), Cincinnati, Ohio, and the Departments of Physiology (R.L.M.) and Pediatrics (S.H.B.), University of Wisconsin, Madison.

Correspondence to J. Robbins, PhD, Division of Molecular Cardiovascular Biology, 3333 Burnet Ave, Cincinnati, OH 45229-3039. E-mail jeff.robbins{at}chmcc.org

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract The regulatory myosin light chain (MLC) regulates contraction in smooth muscle. However, its function in striated muscle remains obscure, and the different functional activities of the various isoforms that are expressed in the mammalian heart (ventricle- and atrium-specific MLC2) remain undefined. To begin to explore these issues, we used transgenesis to determine the feasibility of effecting a complete or partial replacement of the cardiac regulatory light chains with the isoform that is normally expressed in fast skeletal muscle fibers (fast muscle–specific MLC2). Multiple lines of transgenic mice were generated that expressed the transgene at varying levels in the heart in a copy number–dependent fashion. There is a major discordance in the manner in which the different cardiac compartments respond to high levels of overexpression of the transgene. In atria, isoform replacement with the skeletal protein was quite efficient, even at low copy number. The ventricle is much more refractory to replacement, and despite high levels of transgenic transcript, protein replacement was incomplete. Replacement could be further increased by breeding the transgenic lines with one another. Despite very high levels of transgenic transcript in these mice, the overall level of the regulatory light chain in both compartments remained essentially constant; only the protein isoform ratios were altered. The partial replacement of the ventricular with the skeletal isoform reduced both left ventricular contractility and relaxation, although the unloaded shortening velocity of isolated ventricular cardiomyocytes was not significantly different.

Key Words: transgene • myosin light chain • gene • muscle

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The conventional myosins, or myosin IIs, are the molecular motors that underlie the contractile properties of the different muscle types in general and cardiac muscle in particular. Myosin II is a hexameric protein made up of two heavy chains (molecular weight, 229 000) and four LCs (molecular weight, 18 000 to 27 000). The heavy chains (MyHCs) consist of two separate domains: a globular head region and a rod region that assumes an -helical coil. The ATPase activity that underlies muscle contraction is localized at the amino-terminal end, which corresponds to the globular head and neck of the molecule; also associated with the heavy chain domain are the LCs.^{1 2}

The vertebrate MLCs were originally divided into two classes based on differential solubilities; one class is soluble in DTNB, and the other is not. The other class is soluble in alkali; these are the alkali LCs. Striated muscle myosin contains one molecule of each class on each myosin head.^{3 4} The two DTNB-soluble LCs associated with a MyHC dimer are thought to be identical, and this LC is sometimes referred to as MLC2, or RLC, based on its ability in smooth muscle fibers to regulate contraction in response to varying Ca²⁺ levels in the myoplasm.⁵

MLC expression is controlled in a muscle type– and developmental stage–specific manner in the heart.⁶ Atrium- and ventricle-specific isoforms exist and are the products of different genes. In striated muscle, the data indicate that MLC2 plays a role in the rate of force production.⁷ In vitro motility assays have shown that removal of LC1 or LC2 from skeletal myosin results in a reduction of velocity as the myosin moves along the actin filaments, although ATPase activity is unaffected.^{8 9} Biochemical methods, including in vitro exchange of ectopic and mutated LCs, have been used to define important structural and functional domains.¹⁰ These studies have directly implicated the MLC2 isoforms as having distinct functional properties as well as playing critical roles in crossbridge cycling and the overall Ca²⁺ sensitivity of the myofilament to force development.^{11 12} However, the exact roles that MLC2 plays in striated muscle contraction in general and cardiac muscle function in particular and the differences in isoform functionality remain unclear.

The potential importance of understanding the roles of these proteins in cardiac function is underscored both by circumstantial and direct evidence that altered MLC2 populations can lead to cardiac abnormalities. Kumar et al¹³ first showed that the MLC2v levels in the atria of the spontaneously hypertensive rat were altered. Data showing that changes in the relative abundance of the different LCs are correlated with contractile failure in a more commonly observed form of heart failure, idiopathic dilated cardiomyopathy, have also been collected,¹⁴ and aberrant expression of an LC isoform in the heart has been correlated with a disease state and altered contractile parameters.^{13 15 16} Recently, mutations in either MLC2 or MLC1 have been linked to cardiac and skeletal myopathies.¹⁷ Taken together, these data present a compelling case for the potentially important functional role for LC2 and different functional profiles for the unique compartment-specific isoforms.¹⁸

Previously, we explored the efficacy of transgenesis in modifying the protein complement of the sarcomere by using the -MyHC promoter to drive high levels of expression of the transgene, specifically in the murine heart.¹⁹ Surprisingly, high levels of the transgenic transcript did not always "translate" into a corresponding increase in protein. Ectopic LC expression (eg, transgenic MLC2v expressed in the atrium) led to the synthesis of the corresponding protein with a concomitant decrease in the endogenous protein, despite the fact that the steady state level of the endogenous transcript was not reduced. However, when the transgenic transcript encoded the endogenous isoform (eg, transgenic MLC2v expressed in the ventricle), the overall increase in transcript did not result in an increase in the level of the protein. Thus, it appears that the steady state levels of these sarcomeric proteins are rigorously controlled and that any "excess" protein is rapidly turned over.²⁰ In the present study, we extend the paradigm to ectopic expression in both cardiac compartments, explore whether LC expression is subject to gene dosage effects, and undertake an initial survey of MLC2 isoform function. A skeletal MLC2 isoform (MLC2f) that is normally found only in fast skeletal fibers was expressed at high levels in both the atria and ventricles. The data show that the level of replacement differs dramatically between the two cardiac compartments, despite uniformly high levels of steady state transcripts.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Construction of Transgenic Mice and Analyses of Transgene Expression
For the transgene encoding MLC2f, a full-length murine cDNA was synthesized using RT-PCR with poly(A)⁺ RNA isolated from the leg muscle of FVB/N mice as starting template. The resultant PCR product was sequenced, linked to the -MyHC promoter, and used to generate transgenic mice (Fig 1). The construct was digested free of vector sequence with Not I, purified from low-melting-point agarose, and used to generate transgenic mice as described previously.²⁰ The founder mice were identified by PCR and confirmed by genomic Southern blots using DNA obtained from tail clips. Stable transgenic lines were generated by breeding the founder mice with nontransgenic littermates. Subsequent offspring were screened by PCR. For the RNA analyses, Northern and dot blots were carried out²¹ using the following transcript-specific probes: ANF, 5'-AATGTGACCAAGCTGCGTGACACACCACAAGGGCTTAGGATCTTTTGCGATCTGCTCAAG; -cardiac actin, 5'-CGTACAATGACTGATGAGAGATGGGGAGGGGGCTCAGAGGATTCCAAGAAGCACAATAC; -skeletal actin, 5'-TGGAGCAAAACAGAATGGCTGGCTTTAATGCTTCAAGTTTTCCATTTCCTTTCCACAGGG;MLC2v, 5'-CACAGCCCTGGGATGGAGAGTGGGCTGTGGGTCACCTGAGGCTGTGGTTCAG; MLC2a, 5'-GAGGTGACCTCAGCCTGTCTACTCCTCTTTCTCATCCCCG;ELC1v, 5'-GGCTCAGCTCGCCATGAGATATGCTTCACAAACGCTTCATAGTTGATGCAC; ELC1a, 5'-CACCCTGGAGAAACGTGCTTTACCCAGACATGATGTGCTTGAC; GAPDH, 5'-GGAACATGTAGACCATGTAGTTGAGGTCAATGAAG; and -MyHC, 5'-CGAACGTTTATTGTGGATTGGCCACAGCGAGGGTCTGCTGGAGAG. All steady state transcript levels were normalized with respect to GAPDH signal intensity after correcting for background. Hybridization signals were quantified on a PhosphorImager (Molecular Dynamics).

View larger version (32K): [in this window] [in a new window]   Figure 1. Isolation of a murine MLC2f cDNA and transgene construction. The MLC2f cDNA was isolated using RT-PCR and sequenced, an open reading frame was confirmed, and the cDNA was subsequently linked to the -MyHC promoter, which was also sequenced in its entirety (5443 bp, GenBank accession No. U71441). Only the cDNA sequence is shown in the upper part of the panel, and the methionine initiator codon is bolded. Shown below are the comparisons with the amino acids of the isoforms whose replacements were targeted by transgenic overexpression. The bullets () denote identity at the amino acid level. The sequences are aligned so as to maximize homologies, and gaps are indicated (–).

Sarcomeric Protein Analyses
The atrial flaps and left ventricular apex were excised from adult transgenic and nontransgenic littermates. Protein was normally isolated using TriReagent (Molecular Research Center, Inc). Total protein was extracted from the phenol phase and interphase of the RNA extractions after removal of DNA by ethanol precipitation and quantified. In some cases, myofilament protein was extracted as described previously,²² and all washes were collected in order to obtain the entire complement of cardiac proteins. The protein preparations were electrophoresed on a 15% polyacrylamide gel in the presence of 0.1% SDS and stained with colloidal blue (Sigma Chemical Co). Proteins were quantified using NIH Image software (version 1.57).

Cardiomyocyte Isolation and Protein Electrophoresis
Ventricular cardiomyocytes were obtained by enzymatic digestion and mechanical disruption as described previously.²³ The resulting suspensions of cells and cell fragments were centrifuged, and pellets were then resuspended in 0.3% Triton X-100 for 6 minutes to permeabilize sarcolemmal, mitochondrial, and sarcoplasmic reticular membranes. After washing, myocytes were resuspended in relaxing solution (mmol/L): EGTA 7.0, free Mg²⁺ 1, free Mg²⁺-ATP 4, creatine phosphate 14.5, and imidazole 20, pH 7.00, at ionic strength 180 at 4°C until use.

SDS-PAGE and silver staining of cardiomyocyte proteins were performed according to methods described previously^{24 25} with only minor modifications. Myocytes were suspended in 5 to 10 µL of sample buffer containing (mol/L) urea 8, thiourea 2, Tris 0.05 (pH 6.8), and dithiothreitol 0.075, along with 3% SDS and 0.05% bromophenol blue, and heated at 100°C for 3 minutes. Samples were subjected to vertical SDS-PAGE in a Hoefer Tall Mighty Small gel electrophoresis unit (Hoefer) with an 18% acrylamide resolving gel (acrylamide/bis-acrylamide at 200:1) and 4.5% acrylamide stacking gel at 24-mA constant current for 2.5 hours. After 30 minutes of alcohol-acid fixation, the gel was fixed in 5% glutaraldehyde overnight and then silver-stained. The gel was then dried between Mylar sheets and scanned using an image densitometer (Molecular Analyst, BioRad).

Functional Analyses
The Langendorff²⁵ and working heart²⁶ preparations were performed as described previously, with the following modifications. The recording, amplification, and differentiation systems used were the DigiMed Systems analyzers BPA-2000, HPA-200, HPA-210, and LPA-200 from Micro-Med Inc. A Silastic fluid-filled catheter to the left ventricle was used. The venous return line feeding into the left atrium was completely water-jacketed for improved temperature (37.4°C) regulation of the Krebs-Henseleit solution that was returned to the left side of the heart for anterograde perfusion.

The unloaded shortening velocity of the ventricular cardiomyocytes was determined as previously described.²⁷ Working on the stage of an inverted microscope, single ventricular cardiomyocytes were attached with silicone adhesive (Dow Corning) to the active elements of a force transducer (model 403A, Cambridge Technology) and motor (model 6350, Cambridge Technology). After curing of the adhesive, myocytes were transferred to relaxing solution, and sarcomere length was adjusted to 2.3 µm using on-line videomicroscopy. Velocity of unloaded shortening was determined at 15°C in maximally activating Ca²⁺ solution (pCa 4.5) using the slack-test method. After steady tension was reached in maximally activating Ca²⁺ solution, the preparation was rapidly slackened; the time required to take up the imposed slack was measured as the interval between the beginning of the imposed slack length step and the onset of tension redevelopment. Plots of slack length versus duration of unloaded shortening were included in the summary results if slack test data were well fit by a straight line (r.95).

The maximum Ca²⁺-activated Mg²⁺-ATPase activity was measured in mouse left ventricular myofibrillar preparations²⁸ by the method of White.²⁹

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Construction of Multiple Lines of MLC2f Transgenic Mice
We initiated these analyses in order to explore the feasibility of ectopic replacement of an abundant sarcomeric protein in both cardiac compartments using transgenesis. We chose to replace the cardiac isoforms of MLC2a and MLC2v with the RLC that is expressed in the fast skeletal muscle fibers, MLC2f. No published murine clone or sequence could be found and so, using degenerate oligonucleotides for the other RLCs, RT-PCR was performed on poly(A)⁺ RNA isolated from murine leg skeletal muscle. Multiple clones were generated from the purified PCR fragment and completely sequenced. The identity of a full-length clone was confirmed by comparing it with a preexisting rat clone.³⁰ The rat and mouse sequences are very closely related, with only a single conservative amino acid substitution at (rat)Ala¹¹ to (mouse)Gly¹¹. This change was confirmed by genomic sequencing. The cDNA sequence was then inserted into a plasmid at a site between the -MyHC promoter, which is capable of high levels of cardiac expression,²⁰ and the human growth hormone polyadenylation signal (Fig 1). The DNA was freed of vector sequences and subsequently used to generate transgenic mice.

We have also isolated and sequenced cDNA clones that encode the murine MLC2a and MLC2v proteins; the comparisons (Fig 1) show that the skeletal isoform is more closely related to the latter. Of particular note is the sequence divergence clustered at the amino termini of MLC2f and MLC2a, which leads to significant differences in the overall charge of this region. Charge differences in this domain have significant effects on force production in striated muscle.^{7 31} The phosphorylatable serines (Ser¹⁵ and Ser¹⁶ in MLC2f) are, however, conserved. Therefore, we reasoned that it should be possible to effect a replacement in both cardiac compartments with no lethal effects, and depending on the differential functionality of the different isoforms, subtle phenotypic changes might present. Multiple transgenic lines were generated, and germ-line transmission was confirmed by analyses of the F1 generations. The copy numbers were determined by standard methods using Southern blot analyses, and five lines having copy numbers of 1, 3, 10, 20, and 34 (lines 2, 90, 75, 6, and 57, respectively) were selected for subsequent studies. Transgene expression was stable both within a line between transgenic littermates and throughout multiple generations (F1 to F8, data not shown).

Expression of a Transgene Encoding an Ectopic Contractile Protein Isoform in the Ventricular and Atrial Compartments
We tested the levels of transgenic overexpression in both compartments at the transcript level. Preliminary analyses using Northern blots showed that the transgenic transcript was the expected size (data not shown), and subsequently, dot blots were used to quantify RNA levels in the atria and ventricles of the transgenic lines (Fig 2A). For each of the five lines tested, there were significant levels of transgenic expression in both cardiac compartments. As was found previously for ectopic MLC2v expression in the atrium,¹⁹ endogenous gene expression, as determined by analysis of candidate transcripts that might undergo compensatory changes in response to the expression of the transgene, was unaffected. No significant changes in the steady state levels of the endogenous RLC transcripts could be detected, nor were molecular markers of hypertrophy (ANF and skeletal actin)^{32 33} upregulated. Even at the highest copy number (Fig 2, ventricle), no effect could be observed on the steady state levels of the endogenous -MyHC, indicating that no titration effects on the transcriptional apparatus had occurred.

View larger version (37K): [in this window] [in a new window]   Figure 2. Overexpression of MLC2f RNA in transgenic mice. A, MLC2f RNA overexpression in the atrium and ventricle. RNAs were isolated from the cardiac compartments of five transgenic lines carrying the indicated copy numbers of the transgenic construct, and the relative RNA abundance of the transgene, MLC2f, as well as MLC2a, ELC1a (in the atrium) or MLC2v, ELC1v, -MyHC, ANF, cardiac actin (C. actin), and skeletal actin (Sk. actin) (in the ventricle) were determined by dot blot analyses as described in "Materials and Methods." In the transgenic RNAs, MLC2f transcript is significantly overexpressed in both the atria and ventricles with no apparent downregulation of the endogenous (eg, MLC2a or MLC2v) genes. ntg indicates nontransgenic. B, Quantification of cardiac transcripts. RNA blot intensities were quantified on a PhosphorImager and corrected for any differences in loading by comparison with the GAPDH signals, and the values in arbitrary units were plotted against transgene copy number. Copy number dependence of steady state transcript levels is apparent in both cardiac compartments.

A definite dose-response effect was observed between the transgenic lines; MLC2f transcript levels increased with increasing copy number (Fig 2B). Previously, the number of lines available for analyses were insufficient to conclude that, in general, the -MyHC promoter yielded transgenic lines that were subject to copy number effects.^{19 20 34 35} Although there were subtle modulations in the trends between the two cardiac compartments, the relationship between increasing copy number and higher levels of MLC2f RNA in both compartments is clear (Fig 2).

Replacement of Atrial and Ventricular RLCs
The sarcomeric and total protein pools in the transgenic hearts were analyzed by electrophoresis to examine the effects of transgene expression on the polypeptide profile of the myofilament. Although under normal circumstances the amount of protein correlates quite well with the level of its cognate mRNA,³⁶ we showed previously that transgenic overexpression perturbs this relationship significantly by effecting a complete MLC2 isoform switch (MLC2aMLC2v) in the atria even though MLC2a transcript levels were unaffected.^{19 20} The MLC2f overexpression recapitulates this observation, albeit with some subtleties that were not previously apparent. First, as was the case at the transcript level, MLC2f protein accumulation in the atria is consistent with copy number dependence (Fig 3), although the relationship is difficult to quantify because of the high degree of expression and replacement even at relatively low copy number. Four of the lines demonstrate almost complete replacement of the atrial isoform with the skeletal form, despite the maintenance of normal MLC2a transcript levels. Interestingly, there is a significant difference between the abilities of the transgenic peptide to effect replacement in the atria versus the ventricles. For example, lines 3, 57, and 90 show roughly equivalent levels of transgenic transcripts in both compartments; this leads to >90% replacement in the atria but only to 5% to 35% in the ventricles. Although replacement was less complete in the ventricles, this cardiac compartment also displayed a copy number dependence, although the relationship is obviously not exactly linear. We ascribe this lack of exact correspondence to position-dependent effects, which can also influence the expression patterns of the myosin promoters in transgenic animals.³⁷

View larger version (51K): [in this window] [in a new window]   Figure 3. Effects in myocardial protein composition due to MLC2f overexpression. A, Myofilament proteins were extracted from tissues of adult (>8-week-old) nontransgenic (ntg) mice as well as the different lines of transgenic mice, subjected to SDS-PAGE as described in "Materials and Methods," and stained with colloidal blue. Thick- and thin-filament proteins are indicated. Depending on the relative level of transgenic overexpression in the atria, an essentially complete replacement of MLC2a with the MLC2f isoform could be effected. In the ventricles, MLC2f overexpression was much less effective in replacing the endogenous MLC2v protein, even in line 57, which contains 34 copies of the transgene. In neither cardiac compartment could an overt effect on the myofilament stoichiometry of the other contractile proteins be detected. B, Quantification of the degree of replacement in the ventricles and atria of transgenic mice is shown. The stained gels were scanned, and the signal intensities quantified using NIH Image software (version 1.57). The corresponding levels of the endogenous MLC2 isoform (endogenous) and MLC2f were determined for each line in the separate cardiac compartments. The high degree of replacement at relatively low copy number is apparent in the atria.

We showed previously that transgenic expression was uniform throughout the atria and ventricles.³⁵ However, the lack of apparent replacement in the ventricles raises the possibility that heterogeneous expression could occur within the cardiomyocyte pool; this has been inferred from physiological studies carried out on cardiomyocyte populations derived from transgenic animals expressing cardiac troponin C, in which individual cardiomyocytes derived from these hearts reacted quite differently to Sr²⁺ activation.^{38 39} Thus, we considered it possible that the lack of apparent replacement was due to two pools of cardiomyocytes, one that expressed the transgene and one that did not. Preliminary experiments showed that no significant pools of MLC2f could be detected in the nonmyofilament protein pool or in the soluble or insoluble fractions (data not shown), consistent with our previous observations.^{19 20} Therefore, we determined directly the myofilament protein composition in individual ventricular myocytes using acrylamide gel electrophoresis followed by silver staining. This technique is capable of detecting the myofilament protein population from a single cardiomyocyte. However, for the sake of clarity, the proteins were isolated and analyzed from 10 pools, each pool consisting of two ventricular cardiomyocytes isolated from line 57 (Fig 4). All 10 groups display both the ventricular and skeletal isoforms, in roughly equivalent proportions, indicating that transgenic expression occurs throughout the cardiomyocyte population. Since no pool of non–myofilament-associated protein could be detected, either by standard means or Western analyses, we think it likely that the differential replacement observed between the two cardiac compartments is due to the different affinities of the RLC isoforms for their respective contractile assemblies (see "Discussion").

View larger version (72K): [in this window] [in a new window]   Figure 4. MLC2f is expressed throughout the cardiomyocyte population. Silver-stained SDS-PAGE of ventricular myocyte proteins was performed for the following: ntg, heavily loaded lane of pooled control (nontransgenic) ventricular cardiomyocytes; tg, heavily loaded lane of pooled transgenic ventricular cardiomyocytes; psoas, psoas muscle (MLC2f control); and lanes 1 to 10, transgenic ventricular cardiomyocytes (from line 57: two cardiomyocytes per lane). The region of the gel containing the MLC2v and MLC2f species was scanned (as indicated in the figure) such that the relative proportions of the two proteins could be determined. Shown for the sake of clarity are the scans from alternate lanes as indicated. Note that the relative content of MLC2f and MLC2v showed little variation among the samples. The areas under the peaks were quantified using NIH Image software (version 1.59), and the data were grouped: MLC2v, 89.4±14.7; MLC2f, 137.0±20.1.

Protein Replacement in Double Transgenic Heterozygotes
If the degree of replacement is simply a straightforward function of gene dosage and the affinity, relative to the endogenous protein species, of the transgenic LC for the "foreign" contractile apparatus, then by increasing the effective concentration of MLC2f, it should be possible to increase the degree of replacement. To test this hypothesis, we attempted to increase penetrance of MLC2f replacement in the ventricle by increasing the effective copy number and steady state level of MLC2f RNA. This was done by breeding line 57 (34 copies) with line 6 (20 copies) and analyzing the resultant offspring for the double heterozygotes. Preliminary analyses showed that the expected increase in MLC2f RNA levels in both the ventricles and atria occurred (data not shown), and subsequent litters of these animals were then analyzed, both for the relative levels of MLC2f transcript and for the degree of protein replacement in the ventricle (Fig 5). The data confirm that transgenic expression within a line is quite stable. The seven animals used from line 57 (Fig 5A) were derived from mice spanning at least three breeding generations, yet the standard deviation (Fig 5B) is 11%. Similarly, four animals from line 6 show little variation in transgenic expression. Shown also are typical RNA levels from individual offspring derived from a cross between line 57 and line 6. The single heterozygotes are easily distinguished by their relative RNA levels, although it is not possible, unambiguously, to tell from the RNA quantifications to which line they belong. As expected, a cross between two single heterozygotes yields animals that lack either transgenic allele (tg57^-/tg6^-; Fig 5, sample c). Strikingly, the double heterozygote (a single animal out of the six; tg57⁺/tg6⁺; Fig 5, sample d) shows an RNA level that is essentially additive between the two lines (23 777 versus 10 863±1007 [line 6] and 13 422±1469 [line 57] arbitrary units). The data (Fig 5C and 5D) also show that, consistent with the prediction, the double heterozygote does indeed show an increased degree of protein replacement in the ventricle, indicating that as the relative level of the ectopic protein increases in the cardiomyocyte, the degree of replacement also increases.

View larger version (44K): [in this window] [in a new window]   Figure 5. Transgene expression levels in a double transgenic heterozygote. A, MLC2f RNA levels were determined in ventricles derived from either seven line 57 animals, four line 6 animals, or individual offspring from a 57x6 cross. A nontransgenic mouse (ntg) was included as a negative control. B, Histograms derived from the quantification of the RNA are shown. The double heterozygote (tg57+/tg6+, sample d) and nontransgenic (tg57-/tg6-, sample c) offspring are easily distinguished from the more frequent single heterozygotes. C, Myofibril protein complements of the single and double transgenic heterozygotes are shown. Myofilament preparations were electrophoresed in 15% polyacrylamide as described previously.19 D, The degree of replacement in the double heterozygote (sample d) is increased relative to either of the single transgenic lines.

Functional and Histological Analyses of Transgenic and Control Hearts
Although the major objective of the present study was to determine whether transgenesis could be used to remodel both cardiac compartments simultaneously, we wished to determine if partial replacement of the cardiac RLCs with the skeletal isoform altered contractile function. To determine if functional differences might be present at the whole-organ level, groups of strain-, age-, and sex-matched transgenic and control animals were subjected to physiological analyses using both the isolated Langendorff (retrograde, nonworking)²⁵ and working heart²⁶ preparations. To determine to what extent the line 57 transgenic hearts could be loaded with increasing volume (venous return) loads, cardiac minute work was varied from 200 to 600 mm HgxmL per minute. Under identical loading conditions, the transgenic hearts produced maximal rates of pressure development that were significantly reduced relative to the control hearts, with +dP/dt reduced by 14% and -dP/dt reduced by 12% (Table). The decreased +dP/dt indicates that replacement of MLC2a and partial replacement of MLC2v with MLC2f led to significantly reduced contractility (longer time to develop peak ventricular pressure), as well as perturbations in relaxation.

View this table: [in this window] [in a new window]   Table 1. Measured Cardiac Parameters

As we have shown previously,²⁶ the normal (wild-type) hearts showed a strong correlation of +dP/dt to increased left ventricular minute work, exhibiting a Starling response. However, there was significant animal-to-animal variation among the line 57 transgenics: seven hearts demonstrated a response to increased workload that approximated the response of the normal hearts, and three displayed severely impaired cardiac function and could not be workloaded without failure. The remaining seven transgenic hearts that could be loaded did demonstrate Starling function despite statistically lower cardiac parameters. To examine function in all 10 transgenic hearts, Langendorff preparations were used. When +dP/dt and -dP/dt were examined under Langendorff anterograde non–work-producing conditions, much greater deficits in +dP/dt, and -dP/dt were observed relative to the control hearts (Table): +dP/dt was reduced by 62%, and -dP/dt was reduced by 52%. We also measured the maximum Ca²⁺-activated Mg²⁺-ATPase activity of left ventricular myofibrillar preparations from these same hearts. The actomyosin enzymatic activity of transgenic preparations relative to the controls was reduced by 22% (Table), consistent with the decreased contractility displayed by these hearts.

Despite the reduced contractility of these hearts, no obvious pathologies developed in the line 57 adult animals (Fig 6). No significant changes in chamber size, weight, or architecture could be discerned between the control and transgenic adult hearts (Fig 6A and 6B, respectively). Trichrome staining revealed that no significant fibrosis had developed (Fig 6C and 6D) and that the overall myocyte organization and structure were well preserved in the transgenic animals (Fig 6E and 6F).

View larger version (137K): [in this window] [in a new window]   Figure 6. Histological examination of the MLC2f-overexpressing hearts. Fixation and histological analyses were carried out essentially as described previously.26 Shown are sections of hearts from control (A, C, and E) and transgenic (B, D, and F) adult (16- to 20-week-old) animals. The hearts were cut in half longitudinally, preserved in Bouin's fixative, and embedded in paraffin, and 4-µm sections were cut. Shown are serial sections from a single set of hearts stained with either hematoxylin and eosin (A and B) to show overall structure or with trichrome (C and D) to reveal any fibrosis that might have developed (magnification x4 in A, B, C, and D). Hematoxylin and eosin–stained sections (E and F) taken from the left ventricles were photographed at higher magnification (x67) in order to reveal the readily apparent striations in the cardiomyocytes from both the control (E) and transgenic (F) samples. No hypertrophy could be detected, a result consistent with the lack of activation of the hypertrophic markers observed in Fig 2. LV and RV indicate left and right ventricle, respectively.

As a preliminary study to characterize the basis for the alterations in contractility, single ventricular cardiomyocytes in which isoform replacement was 30% to 35% were isolated from line 57 adults, and the unloaded shortening velocity was determined²⁷ for control (n=7) and transgenic (n=10) cells. The unloaded shortening velocity of transgenic cells (2.40±0.55 muscle lengths/s) was not significantly different from that of control cells (2.86±0.47 muscle lengths/s), although there was a trend for unloaded shortening velocity of transgenic cells to be less than that of control cells. In addition, the series elasticity, ie, the length change required to just lower tension to zero, was not different when comparing transgenic cells (15.1±1.5%) with the control cells (14.6±1.1%).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The present study both confirms and extends our previous data^{19 20} concerning transgenic-driven LC replacement in the heart in which the ventricular LC2 replaced the atrium-specific isoform. In those studies, ventricular replacement was not attempted, nor was a sufficient number of lines generated such that any conclusions about copy number–dependent expression levels could be made. The data did show, however, that transgenic overexpression led to a discordance between the overall LC RNA levels and the absolute amount of LC protein in the cardiomyocyte: absolute LC RNA levels could be increased dramatically without any increase in the steady state LC protein pool. The data for the MLC2f transgenic mice underscore this point and extend the transgenic paradigm to ectopic replacement in both cardiac compartments.

These experiments also show that the -MyHC promoter exhibits copy number dependence, in that as copy number of the transgene increases, there is an increase in the steady state level of the encoded mRNA. A similar conclusion was reached for the full-length ß-MyHC promoter constructs we have tested, although this property was lost if the distal upstream regions were deleted.³⁷ This is an important consideration for transgenic modification of the heart. Copy number dependence of the promoter-cDNA constructs is critical if one wishes to carry out a dose-response curve in the whole animal. With copy number dependence, by studying multiple lines carrying different numbers of the transgene, one can obtain the physiological correlates at different dosages of the biological agent to help ascertain the consequences of transgenic modification. The additional flexibility of the system is illustrated by the crosses, which result in the production of the double heterozygotes: if only a limited number of lines are obtained initially, any increase in transgene expression that is needed can be generated by crossbreeding the different lines with one another. The disadvantage, of course, is that only a limited number of double heterozygotes will be obtained in each litter, assuming that the alleles display normal mendelian segregation patterns. Even this shortcoming could, in theory, be circumvented by breeding one or both of the transgenic alleles to homozygosity. However, this is an experimental route that is normally avoided. During the process of pronuclear injection, the DNA is inserted randomly, usually at a single point, into the genome, and the integrity of the flanking sequences may be seriously compromised. If the DNA inserts at a critical point in the coding sequence of an important gene or disrupts the regulatory sequences, a mutation resulting in a visible phenotype may be created.^{40 41} The founder or heterozygotic offspring often do not exhibit any phenotype because the mutation is recessive and the one remaining wild-type allele provides normal gene function. However, when the line is bred to homozygosity, the trait manifests itself and can seriously distort or even mask completely the trait that is actually under study. Thus, if this experimental path is chosen, a rigorous longitudinal analysis of the homozygous phenotype must precede any concerted breeding program.

Ectopic expression of the transgene in both cardiac compartments resulted in a disparity of isoform replacement between the atrial and ventricular compartments, although the MLC2f mRNA levels were similar. We have not been able to detect changes at the translational level; transgenic expression does not affect the polysome loading of the endogenous message, and the transgenic message is efficiently translated (J. Robbins, unpublished data, 1996), nor have we been able to detect a significant pool of nonmyofilament transgenic protein (J. Gulick and J. Robbins, unpublished data, 1996).^{19 20} Thus, the data in this report point to a potential limitation for the transgenic approach, in that replacement is sometimes not complete and is not always a simple function of the levels of the transgenic transcript. A working hypothesis that accounts for this discrepancy is that the different MLC2 isoforms have different affinities for the contractile apparatus. There are no data that deal directly with the relative affinities of the MLC2a, MLC2v, and MLC2f for the atrial and ventricular contractile assemblies. However, in a series of in vitro experiments in which exogenous RLCs were exchanged for wild-type smooth muscle LCs on the smooth muscle myosin, Yang and Sweeney⁴² noted the relatively low affinity of the skeletal RLC for the contractile apparatus. Their usual conditions of exchange resulted in a minor replacement, and they were able to achieve an 80% replacement only by flooding the system with a 70- to 80-fold molar excess of skeletal RLC. Trybus and Chatman⁴³ also noted that the relative affinities of the smooth and skeletal RLCs for the smooth muscle myosin were quite different and that the domains mediating the differential affinities resided in the carboxy termini.

Although not proven by the data in the present study, we think it a reasonable hypothesis that MLC2a has a rather low affinity for even its endogenous contractile apparatus. At copy numbers that result in approximately equal amounts of transgenic mRNA and endogenous MLC2a transcript (Fig 2A), there is substantial replacement at the protein level (Fig 3, line 90; three copies). If this hypothesis is correct, it implies that MLC2v, on the other hand, has a higher affinity for its contractile apparatus than does MLC2f (or MLC2f has a higher affinity for the atrial sarcomere than it does for the contractile apparatus of the ventricle). The data obtained in the line 57xline 6 cross (Fig 5) are consistent with the hypothesis. The degree of protein replacement appears to be a simple function of message (and, presumably, nascent protein) levels; by merely increasing the molar ratio of MLC2f/MLC2v RNA, one drives protein replacement further. Conceivably, it should be possible to effect, for any protein that assembles into the contractile apparatus, essentially complete replacement by identifying the particular domain that mediates high affinity^{43 44} and making the appropriate chimeric cDNA for subsequent transgenic expression.

Transgenic mosaicism is an important consideration for replacement strategies. "Patchy" transgene expression, for example, has been observed when the lacZ reporter system is used³⁵ and can confound the subsequent analyses. Metzger et al³⁸ and McDonald et al³⁹ concluded that cardiac transgenic expression of the skeletal troponin C, when driven by a short (650-bp) -MyHC promoter, was apparently heterogeneous in the cardiomyocyte population. We have noted, however, some anomalies with the "short" -MyHC promoter.^{45 46} An additional unknown variable in the troponin C studies was that the rat promoter was used. We were interested in determining whether the "full-length" mouse promoter that is now widely used is homogeneously expressed throughout the cardiomyocyte preparation. The data indicate that transgenic expression does occur throughout the general cardiomyocyte preparation: 10 separate pools, each pool consisting of the myofilament proteins from two randomly chosen cardiomyocytes, displayed approximately equal amounts of the transgenic MLC2f.

There is a paucity of data for LC function in cardiac muscle. Studies carried out in skeletal muscle point to the importance of the role(s) of RLCs in mediating the kinetics of crossbridge cycling,^{7 8 11} but such studies have not been extended to the cardiac system. We previously reported that transgenically mediated atrial replacement of MLC2a with MLC2v led to subtle changes in cardiac functional parameters.¹⁹ Similarly, a determination of LV function in the MLC2f-overexpressing hearts shows that contractility and relaxation are significantly impaired and that maximal ATPase activity is decreased. These data are consistent with the different MLC2 isoforms having different functional profiles in their unique muscle types and illustrate the potential of making a defined genetic change that leads to a change in function at the whole-organ level. Future studies can thus address the function of the different isoforms and the mechanistic roles the different domains play in cardiac contractility.

The present study confirms the general usefulness of the transgenic paradigm in remodeling the motor proteins in both cardiac compartments. Transgenic expression is copy number dependent, so that a dose-response curve can be obtained. Expression is stable throughout the generations obtained from the different lines; we have not observed any diminution of expression in any of the lines as the breeding programs proceed. Finally, expression appears to be homogeneous within the cardiomyocyte pool, and incomplete replacement is probably due not to heterogeneous expression patterns but to the relative affinity of the transgenically encoded protein for the particular contractile apparatus with which it interacts. Transgenic replacement using an endogenous protein carrying directed single-site mutations, which leave intact the domains that determine the affinity of the protein for the contractile apparatus, should allow essentially complete replacement. Analyses of multiple lines of the resultant animals, displaying different degrees of replacement, should be valuable in establishing aspects of isoform functionality and determining the structure/function relationships of the motor proteins.

	Selected Abbreviations and Acronyms

 

ANF = atrial natriuretic factor DTNB = 5,5'-dithio-bis(2-nitrobenzoic acid) ELC1a, ELC1v = essential MLC1 atrial and ventricular isoforms LC = light chain MLC = myosin LC MLC2a, MLC2v, MLC2f = atrium-, ventricle-, and fast skeletal muscle–specific MLC2 isoforms MyHC = myosin heavy chain PCR = polymerase chain reaction RLC = regulatory LC RT-PCR = reverse-transcriptase PCR

	Acknowledgments

 
This study was supported by National Institutes of Health grants HL-56370, HL-41496, HL-52318, and HL-56620, by the Marion Merrell-Dow foundation (to Dr Robbins), and by National Institutes of Health grant KO8 HL-03134 (Dr Buck). We thank Lisa Murray and Patrick Konyn for excellent technical assistance.

Received November 12, 1996; accepted February 12, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Rayment I, Holden HM. The three-dimensional structure of a molecular motor. Trends Biochem Sci. 1994;19:129-134.[Medline] [Order article via Infotrieve]
2. Rayment I, Holden HM, Whittaker M, Yohn CB, Lorenz M, Holmes KC, Milligan RA. Structure of the actin-myosin complex and its implications for muscle contraction. Science. 1993;261:58-65.[Abstract/Free Full Text]
3. Sarkar S, Sreter FA, Gergely J. Light chains of myosin from white, red and cardiac muscles. Proc Natl Acad Sci U S A. 1971;68:946-950.[Abstract/Free Full Text]
4. Lowey S, Risby D. Light chains from fast and slow muscle myosins. Nature. 1971;234:81-85.[Medline] [Order article via Infotrieve]
5. Swynghedauw B. Developmental and functional adaptation of contractile proteins in cardiac and skeletal muscles. Physiol Rev. 1986;66:710-771.[Abstract/Free Full Text]
6. Cummins P, Russell G. A comparison of myosin light chain subunits in the atria and ventricles of mammals. Comp Biochem Physiol [B]. 1986;84:343-348.[Medline] [Order article via Infotrieve]
7. Sweeney HL, Stull JT. Alteration of cross-bridge kinetics by myosin light chain phosphorylation in rabbit skeletal muscle: implications for regulation of actin-myosin interaction. Proc Natl Acad Sci U S A. 1990;87:414-418.[Abstract/Free Full Text]
8. Lowey S, Waller GS, Trybus KM. Skeletal muscle myosin light chains are essential for physiological speeds of shortening. Nature. 1993;365:454-456.[Medline] [Order article via Infotrieve]
9. Lowey S, Waller GS, Trybus KM. Function of skeletal muscle myosin heavy and light chain isoforms by an in vitro motility assay. J Biol Chem. 1993;268:20414-20418.[Abstract/Free Full Text]
10. Moss RL. Ca²⁺ regulation of mechanical properties of striated muscle: mechanistic studies using extraction and replacement of regulatory proteins. Circ Res. 1992;70:865-884.[Abstract/Free Full Text]
11. Szczesna D, Zhao J, Potter JD. The regulatory light chains of myosin modulate cross-bridge cycling in skeletal muscle. J Biol Chem. 1996;271:5246-5250.[Abstract/Free Full Text]
12. Metzger JM, Moss RL. Myosin light chain 2 modulates calcium-sensitive cross-bridge transitions in vertebrate skeletal muscle. Biophys J. 1992;63:460-468.[Abstract/Free Full Text]
13. Kumar C, Saidapet C, Delaney P, Mendola C, Siddiqui MAQ. Expression of ventricular-type myosin light chain messenger RNA in spontaneously hypertensive rat atria. Circ Res. 1988;62:1093-1097.[Abstract/Free Full Text]
14. Margossian SS, White HD, Caulfield JB, Norton P, Taylor S, Slayter HS. Light chain 2 profile and activity of human ventricular myosin during dilated cardiomyopathy: identification of a causal agent for impaired myocardial function. Circulation. 1992;85:1720-1733.[Abstract/Free Full Text]
15. Shi Q, Danilczyk U, Wang J, See YP, Williams WG, Trusler GA, Beaulieu R, Rose V, Jackowski G. Expression of ventricular myosin subunits in the atria of children with congenital heart malformations. Circ Res. 1991;69:1601-1607.[Abstract/Free Full Text]
16. Henkel RD, Kammerer CM, Escobedo LV, Vandeberg JL, Walsh RA. Correlated expression of atrial myosin heavy chain and regulatory light chain isoforms with pressure overload hypertrophy in the non-human primate. Cardiovasc Res. 1993;27:416-422.[Abstract/Free Full Text]
17. Poetter K, Jiang H, Hassanzadeh S, Master SR, Chang A, Dalakas MC, Rayment I, Sellers JR, Fananapazir L, Epstein ND. Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat Genet. 1996;13:63-69.[Medline] [Order article via Infotrieve]
18. Solaro RJ. Myosin and why hearts fail. Circulation. 1992;85:1945-1947.[Free Full Text]
19. Palermo J, Gulick J, Ng WA, Grupp IL, Grupp G, Robbins J. Remodeling the heart using transgenesis. Cell Mol Biol Res. 1995;41:501-509.[Medline] [Order article via Infotrieve]
20. Palermo J, Gulick J, Colbert M, Fewell J, Robbins J. Transgenic remodeling of the contractile apparatus in the mammalian heart. Circ Res. 1996;78:504-509.[Abstract/Free Full Text]
21. Robbins J, Gulick J, Sanchez A, Howles P, Doetschman T. Mouse embryonic stem cells express the cardiac myosin heavy chain genes during development in vitro. J Biol Chem. 1990;265:11905-11909.[Abstract/Free Full Text]
22. McAuliffe JJ, Gao L, Solaro RJ. Changes in myofibrillar activation and troponin C Ca²⁺ binding associated with troponin T isoform switching in developing rabbit heart. Circ Res. 1990;66:1204-1216.[Abstract/Free Full Text]
23. Sweitzer NK, Moss RL. The effect of altered temperature on Ca²⁽⁺⁾-sensitive force in permeabilized myocardium and skeletal muscle: evidence for force dependence of thin filament activation. J Gen Physiol. 1990;96:1221-1245.[Abstract/Free Full Text]
24. Giulian GG, Moss RL, Greaser ML. Improved methodology for analysis and quantitation of proteins on one-dimensional silver-stained slab gels. Anal Biochem. 1983;129:277-287.[Medline] [Order article via Infotrieve]
25. Ng W, Grupp IL, Subramaniam A, Robbins J. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ Res. 1991;68:1742-1750.[Abstract/Free Full Text]
26. Jones WK, Grupp IL, Doetschman TD, Grupp G, Hewett T, Osinska H, Boivin G, Gulick J, Ng W, Robbins J. Ablation of the murine myosin heavy chain gene leads to functional deficits in the heart. J Clin Invest. 1996;68:1906-1917.
27. Strang KT, Sweitzer NK, Greaser ML, Moss RL. ß-Adrenergic receptor stimulation increases unloaded shortening velocity of skinned single ventricular myocytes from rats. Circ Res. 1994;74:542-549.[Abstract/Free Full Text]
28. Pagani ED, Solaro RJ, Schwartz A, ed. Methods in Pharmacology. New York, NY: Plenum Publishing Corp; 1984:49-61.
29. White HD. Special instrumentation and techniques for kinetic studies of contractile systems. Methods Enzymol. 1982;85:698-708.
30. Nudel U, Calvo JM, Shani M, Levy Z. The nucleotide sequence of a rat myosin light chain 2 gene. Nucleic Acids Res. 1984;12:7175-7186.[Abstract/Free Full Text]
31. Metzger JM, Greaser ML, Moss RL. Variations in cross-bridge attachment rate and tension with phosphorylation of myosin in mammalian skinned skeletal muscle fibers: implications for twitch potentiation in intact muscle. J Gen Physiol. 1989;93:855-883.[Abstract/Free Full Text]
32. Younes A, Boluyt MO, O'Neill L, Meredith AL, Crow MT, Lakatta EG. Age-associated increase in rat ventricular ANP gene expression correlates with cardiac hypertrophy. Am J Physiol. 1995;269:H1003-H1008.[Abstract/Free Full Text]
33. Schwartz K, Carrier L, Chassagne C, Wisnewsky C, Boheler KR. Regulation of myosin heavy chain and actin isogenes during cardiac growth and hypertrophy. Symp Soc Exp Biol. 1992;46:265-272.[Medline] [Order article via Infotrieve]
34. Milano CA, Dolber PC, Rockman HA, Bond RA, Venable ME, Allen LF, Lefkowitz RJ. Myocardial expression of a constitutively active alpha 1ß-adrenergic receptor in transgenic mice induces cardiac hypertrophy. Proc Natl Acad Sci U S A. 1994;91:10109-10113.[Abstract/Free Full Text]
35. Colbert MC, Kirby ML, Robbins J. Endogenous retinoic acid signaling colocalizes with advanced expression of the adult smooth muscle myosin heavy chain isoform during development of the ductus arteriosus. Circ Res. 1996;78:790-798.[Abstract/Free Full Text]
36. Boheler KR, Carrier L, Chassagne C, de la Bastie D, Mercadier JJ, Schwartz K. Regulation of myosin heavy chain and actin isogenes expression during cardiac growth. Mol Cell Biochem. 1991;104:101-107.[Medline] [Order article via Infotrieve]
37. Knotts S, Rindt H, Robbins J. Position independent expression and developmental regulation is directed by the beta myosin heavy chain gene 5' upstream region in transgenic mice. Nucleic Acids Res. 1995;23:3301-3309.[Abstract/Free Full Text]
38. Metzger JM, Parmacek MS, Barr E, Pasyk K, Lin WI, Cochrane KL, Field LJ, Leiden JM. Skeletal troponin C reduces contractile sensitivity to acidosis in cardiac myocytes from transgenic mice. Proc Natl Acad Sci U S A. 1993;90:9036-9040.[Abstract/Free Full Text]
39. McDonald KS, Field LJ, Parmacek MS, Soonpaa M, Leiden JM, Moss RL. Length dependence of Ca²⁺ sensitivity of tension in mouse cardiac myocytes expressing skeletal troponin C. J Physiol (Lond). 1995;483:131-139.[Medline] [Order article via Infotrieve]
40. Babinet C, Morello D, Renard JP. Transgenic mice. Genome. 1989;31:938-949.[Medline] [Order article via Infotrieve]
41. Ratty AK, Fitzgerald LW, Titeler M, Glick SD, Mullins JJ, Gross KW. Circling behavior exhibited by a transgenic insertional mutant. Mol Brain Res. 1990;8:355-358.[Medline] [Order article via Infotrieve]
42. Yang Z, Sweeney HL. Restoration of phosphorylation-dependent regulation to the skeletal muscle myosin regulatory light chain. J Biol Chem. 1995;270:24646-24649.[Abstract/Free Full Text]
43. Trybus KM, Chatman TA. Chimeric regulatory light chains as probes of smooth muscle myosin function. J Biol Chem. 1993;268:4412-4419.[Abstract/Free Full Text]
44. Perriard JC, Von AP, Bantle S, Eppenberger HM, Eppenberger EM, Messerli M, Soldati T. Molecular analysis of protein sorting during biogenesis of muscle cytoarchitecture. Symp Soc Exp Biol. 1992;46:219-235.[Medline] [Order article via Infotrieve]
45. Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J, Robbins J. Tissue-specific regulation of the alpha-myosin heavy chain gene promoter in transgenic mice. J Biol Chem. 1991;266:24613-24620.[Abstract/Free Full Text]
46. Subramaniam A, Gulick J, Neumann J, Knotts S, Robbins J. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter. J Biol Chem. 1993;268:4331-4336.[Abstract/Free Full Text]

This article has been cited by other articles:

				E. Bovill, S. Westaby, S. Reji, R. Sayeed, A. Crisp, and T. Shaw Induction by left ventricular overload and left ventricular failure of the human Jumonji gene (JARID2) encoding a protein that regulates transcription and reexpression of a protective fetal program J. Thorac. Cardiovasc. Surg., September 1, 2008; 136(3): 709 - 716. [Abstract] [Full Text] [PDF]

				G. Schevzov, T. Fath, B. Vrhovski, N. Vlahovich, S. Rajan, J. Hook, J. E. Joya, F. Lemckert, F. Puttur, J. J.-C. Lin, et al. Divergent Regulation of the Sarcomere and the Cytoskeleton J. Biol. Chem., January 4, 2008; 283(1): 275 - 283. [Abstract] [Full Text] [PDF]

				T. Bupha-Intr, J. W. Holmes, and P. M. L. Janssen Induction of hypertrophy in vitro by mechanical loading in adult rabbit myocardium Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3759 - H3767. [Abstract] [Full Text] [PDF]

				T. J. Herron, R. Vandenboom, E. Fomicheva, L. Mundada, T. Edwards, and J. M. Metzger Calcium-Independent Negative Inotropy by {beta}-Myosin Heavy Chain Gene Transfer in Cardiac Myocytes Circ. Res., April 27, 2007; 100(8): 1182 - 1190. [Abstract] [Full Text] [PDF]

				M. Hambleton, H. Hahn, S. T. Pleger, M. C. Kuhn, R. Klevitsky, A. N. Carr, T. F. Kimball, T. E. Hewett, G. W. Dorn II, W. J. Koch, et al. Pharmacological- and Gene Therapy-Based Inhibition of Protein Kinase C{alpha}/{beta} Enhances Cardiac Contractility and Attenuates Heart Failure Circulation, August 8, 2006; 114(6): 574 - 582. [Abstract] [Full Text] [PDF]

				R. D. Gaffin, K. Gokulan, J. C. Sacchettini, T. E. Hewett, R. Klevitsky, J. Robbins, V. Sarin, D. C. Zawieja, G. A. Meininger, and M. Muthuchamy Changes in end-to-end interactions of tropomyosin affect mouse cardiac muscle dynamics Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H552 - H563. [Abstract] [Full Text] [PDF]

				J. Xu, T. R. Kimball, J. N. Lorenz, D. A. Brown, A. R. Bauskin, R. Klevitsky, T. E. Hewett, S. N. Breit, and J. D. Molkentin GDF15/MIC-1 Functions As a Protective and Antihypertrophic Factor Released From the Myocardium in Association With SMAD Protein Activation Circ. Res., February 17, 2006; 98(3): 342 - 350. [Abstract] [Full Text] [PDF]

R. A. Kaiser, Q. Liang, O.