© 1997 American Heart Association, Inc.
Articles |
Transgenic Remodeling of the Regulatory Myosin Light Chains in the Mammalian Heart
From the Children's Hospital Research Foundation, Department of Pediatrics, Division of Molecular Cardiovascular Biology (J.G., T.E.H., R.K., J.R.), Cincinnati, Ohio, and the Departments of Physiology (R.L.M.) and Pediatrics (S.H.B.), University of Wisconsin, Madison.
Correspondence to J. Robbins, PhD, Division of Molecular Cardiovascular Biology, 3333 Burnet Ave, Cincinnati, OH 45229-3039. E-mail jeff.robbins{at}chmcc.org
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract The regulatory myosin light chain (MLC) regulates contraction in smooth muscle. However, its function in striated muscle remains obscure, and the different functional activities of the various isoforms that are expressed in the mammalian heart (ventricle- and atrium-specific MLC2) remain undefined. To begin to explore these issues, we used transgenesis to determine the feasibility of effecting a complete or partial replacement of the cardiac regulatory light chains with the isoform that is normally expressed in fast skeletal muscle fibers (fast muscle–specific MLC2). Multiple lines of transgenic mice were generated that expressed the transgene at varying levels in the heart in a copy number–dependent fashion. There is a major discordance in the manner in which the different cardiac compartments respond to high levels of overexpression of the transgene. In atria, isoform replacement with the skeletal protein was quite efficient, even at low copy number. The ventricle is much more refractory to replacement, and despite high levels of transgenic transcript, protein replacement was incomplete. Replacement could be further increased by breeding the transgenic lines with one another. Despite very high levels of transgenic transcript in these mice, the overall level of the regulatory light chain in both compartments remained essentially constant; only the protein isoform ratios were altered. The partial replacement of the ventricular with the skeletal isoform reduced both left ventricular contractility and relaxation, although the unloaded shortening velocity of isolated ventricular cardiomyocytes was not significantly different.
Key Words: transgene • myosin light chain • gene • muscle
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The conventional myosins, or myosin IIs, are the molecular motors that underlie the contractile properties of the different muscle types in general and cardiac muscle in particular. Myosin II is a hexameric protein made up of two heavy chains (molecular weight,
229 000) and four LCs
(molecular weight, 18 000 to 27 000). The heavy chains (MyHCs)
consist of two separate domains: a globular head region and a rod
region that assumes an 
-helical coil. The ATPase activity that
underlies muscle contraction is localized at the amino-terminal end,
which corresponds to the globular head and neck of the molecule; also
associated with the heavy chain domain are the LCs.1 2 The vertebrate MLCs were originally divided into two classes based on differential solubilities; one class is soluble in DTNB, and the other is not. The other class is soluble in alkali; these are the alkali LCs. Striated muscle myosin contains one molecule of each class on each myosin head.3 4 The two DTNB-soluble LCs associated with a MyHC dimer are thought to be identical, and this LC is sometimes referred to as MLC2, or RLC, based on its ability in smooth muscle fibers to regulate contraction in response to varying Ca2+ levels in the myoplasm.5
MLC expression is controlled in a muscle type– and developmental stage–specific manner in the heart.6 Atrium- and ventricle-specific isoforms exist and are the products of different genes. In striated muscle, the data indicate that MLC2 plays a role in the rate of force production.7 In vitro motility assays have shown that removal of LC1 or LC2 from skeletal myosin results in a reduction of velocity as the myosin moves along the actin filaments, although ATPase activity is unaffected.8 9 Biochemical methods, including in vitro exchange of ectopic and mutated LCs, have been used to define important structural and functional domains.10 These studies have directly implicated the MLC2 isoforms as having distinct functional properties as well as playing critical roles in crossbridge cycling and the overall Ca2+ sensitivity of the myofilament to force development.11 12 However, the exact roles that MLC2 plays in striated muscle contraction in general and cardiac muscle function in particular and the differences in isoform functionality remain unclear.
The potential importance of understanding the roles of these proteins in cardiac function is underscored both by circumstantial and direct evidence that altered MLC2 populations can lead to cardiac abnormalities. Kumar et al13 first showed that the MLC2v levels in the atria of the spontaneously hypertensive rat were altered. Data showing that changes in the relative abundance of the different LCs are correlated with contractile failure in a more commonly observed form of heart failure, idiopathic dilated cardiomyopathy, have also been collected,14 and aberrant expression of an LC isoform in the heart has been correlated with a disease state and altered contractile parameters.13 15 16 Recently, mutations in either MLC2 or MLC1 have been linked to cardiac and skeletal myopathies.17 Taken together, these data present a compelling case for the potentially important functional role for LC2 and different functional profiles for the unique compartment-specific isoforms.18
Previously, we explored the efficacy of transgenesis in modifying the
protein complement of the sarcomere by using the -MyHC promoter to
drive high levels of expression of the transgene, specifically in the
murine heart.19 Surprisingly, high levels of the
transgenic transcript did not always "translate" into a
corresponding increase in protein. Ectopic LC expression (eg,
transgenic MLC2v expressed in the atrium) led to the synthesis of the
corresponding protein with a concomitant decrease in the
endogenous protein, despite the fact that the steady state
level of the endogenous transcript was not reduced.
However, when the transgenic transcript encoded the
endogenous isoform (eg, transgenic MLC2v expressed in the
ventricle), the overall increase in transcript did not result in an
increase in the level of the protein. Thus, it appears that the steady
state levels of these sarcomeric proteins are rigorously controlled and
that any "excess" protein is rapidly turned over.20
In the present study, we extend the paradigm to ectopic expression
in both cardiac compartments, explore whether LC expression is subject
to gene dosage effects, and undertake an initial survey of MLC2 isoform
function. A skeletal MLC2 isoform (MLC2f) that is normally found only
in fast skeletal fibers was expressed at high levels in both the atria
and ventricles. The data show that the level of replacement differs
dramatically between the two cardiac compartments, despite uniformly
high levels of steady state transcripts.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Construction of Transgenic Mice and Analyses of Transgene Expression
For the transgene encoding MLC2f, a full-length murine cDNA was synthesized using RT-PCR with poly(A)+ RNA isolated from the leg muscle of FVB/N mice as starting template. The resultant PCR product was sequenced, linked to the
-MyHC promoter, and used to
generate transgenic mice (Fig 1
). The construct was
digested free of vector sequence with Not I, purified from
low-melting-point agarose, and used to generate transgenic mice as
described previously.20 The founder mice were identified
by PCR and confirmed by genomic Southern blots using DNA obtained from
tail clips. Stable transgenic lines were generated by breeding the
founder mice with nontransgenic littermates. Subsequent offspring were
screened by PCR. For the RNA analyses, Northern and dot blots
were carried out21 using the following transcript-specific
probes: ANF,
5'-AATGTGACCAAGCTGCGTGACACACCACAAGGGCTTAGGATCTTTTGCGATCTGCTCAAG;
-cardiac actin,
5'-CGTACAATGACTGATGAGAGATGGGGAGGGGGCTCAGAGGATTCCAAGAAGCACAATAC;
-skeletal actin,
5'-TGGAGCAAAACAGAATGGCTGGCTTTAATGCTTCAAGTTTTCCATTTCCTTTCCACAGGG;MLC2v,
5'-CACAGCCCTGGGATGGAGAGTGGGCTGTGGGTCACCTGAGGCTGTGGTTCAG;
MLC2a,
5'-GAGGTGACCTCAGCCTGTCTACTCCTCTTTCTCATCCCCG;ELC1v,
5'-GGCTCAGCTCGCCATGAGATATGCTTCACAAACGCTTCATAGTTGATGCAC; ELC1a,
5'-CACCCTGGAGAAACGTGCTTTACCCAGACATGATGTGCTTGAC; GAPDH,
5'-GGAACATGTAGACCATGTAGTTGAGGTCAATGAAG; and -MyHC,
5'-CGAACGTTTATTGTGGATTGGCCACAGCGAGGGTCTGCTGGAGAG. All steady state
transcript levels were normalized with respect to GAPDH signal
intensity after correcting for background. Hybridization signals were
quantified on a PhosphorImager (Molecular Dynamics).
|
) denote identity at the
amino acid level. The sequences are aligned so as to maximize
homologies, and gaps are indicated (–).
Sarcomeric Protein Analyses
The atrial flaps and left ventricular apex were
excised from adult transgenic and nontransgenic littermates. Protein
was normally isolated using TriReagent (Molecular Research
Center, Inc). Total protein was extracted from the phenol phase and
interphase of the RNA extractions after removal of DNA by ethanol
precipitation and quantified. In some cases, myofilament protein was
extracted as described previously,22 and all washes were
collected in order to obtain the entire complement of cardiac proteins.
The protein preparations were electrophoresed on a 15%
polyacrylamide gel in the presence of 0.1% SDS and stained
with colloidal blue (Sigma Chemical Co). Proteins were quantified using
NIH Image software (version 1.57).
Cardiomyocyte Isolation and Protein Electrophoresis
Ventricular cardiomyocytes were obtained
by enzymatic digestion and mechanical disruption as described
previously.23 The resulting suspensions of cells and cell
fragments were centrifuged, and pellets were then resuspended
in 0.3% Triton X-100 for 6 minutes to permeabilize
sarcolemmal, mitochondrial, and sarcoplasmic reticular membranes. After
washing, myocytes were resuspended in relaxing solution (mmol/L): EGTA
7.0, free Mg2+ 1, free Mg2+-ATP 4, creatine
phosphate 14.5, and imidazole 20, pH 7.00, at ionic strength 180 at
4°C until use.
SDS-PAGE and silver staining of cardiomyocyte proteins were performed according to methods described previously24 25 with only minor modifications. Myocytes were suspended in 5 to 10 µL of sample buffer containing (mol/L) urea 8, thiourea 2, Tris 0.05 (pH 6.8), and dithiothreitol 0.075, along with 3% SDS and 0.05% bromophenol blue, and heated at 100°C for 3 minutes. Samples were subjected to vertical SDS-PAGE in a Hoefer Tall Mighty Small gel electrophoresis unit (Hoefer) with an 18% acrylamide resolving gel (acrylamide/bis-acrylamide at 200:1) and 4.5% acrylamide stacking gel at 24-mA constant current for 2.5 hours. After 30 minutes of alcohol-acid fixation, the gel was fixed in 5% glutaraldehyde overnight and then silver-stained. The gel was then dried between Mylar sheets and scanned using an image densitometer (Molecular Analyst, BioRad).
Functional Analyses
The Langendorff25 and working heart26
preparations were performed as described previously, with the following
modifications. The recording, amplification, and
differentiation systems used were the DigiMed Systems analyzers
BPA-2000, HPA-200, HPA-210, and LPA-200 from Micro-Med Inc. A Silastic
fluid-filled catheter to the left ventricle was used. The venous return
line feeding into the left atrium was completely water-jacketed for
improved temperature (37.4°C) regulation of the Krebs-Henseleit
solution that was returned to the left side of the heart for
anterograde perfusion.
The unloaded shortening velocity of the ventricular
cardiomyocytes was determined as previously
described.27 Working on the stage of an inverted
microscope, single ventricular cardiomyocytes
were attached with silicone adhesive (Dow Corning) to the active
elements of a force transducer (model 403A, Cambridge Technology) and
motor (model 6350, Cambridge Technology). After curing of the adhesive,
myocytes were transferred to relaxing solution, and sarcomere length
was adjusted to 2.3 µm using on-line videomicroscopy. Velocity
of unloaded shortening was determined at 15°C in maximally activating
Ca2+ solution (pCa 4.5) using the slack-test method. After
steady tension was reached in maximally activating Ca2+
solution, the preparation was rapidly slackened; the time required to
take up the imposed slack was measured as the interval between the
beginning of the imposed slack length step and the onset of tension
redevelopment. Plots of slack length versus duration of unloaded
shortening were included in the summary results if slack test data were
well fit by a straight line (r
.95).
The maximum Ca2+-activated Mg2+-ATPase activity was measured in mouse left ventricular myofibrillar preparations28 by the method of White.29
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Construction of Multiple Lines of MLC2f Transgenic Mice
We initiated these analyses in order to explore the feasibility of ectopic replacement of an abundant sarcomeric protein in both cardiac compartments using transgenesis. We chose to replace the cardiac isoforms of MLC2a and MLC2v with the RLC that is expressed in the fast skeletal muscle fibers, MLC2f. No published murine clone or sequence could be found and so, using degenerate oligonucleotides for the other RLCs, RT-PCR was performed on poly(A)+ RNA isolated from murine leg skeletal muscle. Multiple clones were generated from the purified PCR fragment and completely sequenced. The identity of a full-length clone was confirmed by comparing it with a preexisting rat clone.30 The rat and mouse sequences are very closely related, with only a single conservative amino acid substitution at (rat)Ala11 to (mouse)Gly11. This change was confirmed by genomic sequencing. The cDNA sequence was then inserted into a plasmid at a site between the
-MyHC promoter, which is capable of high levels of
cardiac expression,20 and the human growth hormone
polyadenylation signal (Fig 1
). The DNA was freed of vector sequences
and subsequently used to generate transgenic mice.
We have also isolated and sequenced cDNA clones that encode the murine
MLC2a and MLC2v proteins; the comparisons (Fig 1) show that the
skeletal isoform is more closely related to the latter. Of particular
note is the sequence divergence clustered at the amino termini of MLC2f
and MLC2a, which leads to significant differences in the overall charge
of this region. Charge differences in this domain have significant
effects on force production in striated
muscle.7 31 The phosphorylatable serines
(Ser15 and Ser16 in MLC2f) are, however,
conserved. Therefore, we reasoned that it should be possible to effect
a replacement in both cardiac compartments with no lethal effects, and
depending on the differential functionality of the different isoforms,
subtle phenotypic changes might present. Multiple transgenic lines
were generated, and germ-line transmission was confirmed by
analyses of the F1 generations. The copy numbers were
determined by standard methods using Southern blot analyses,
and five lines having copy numbers of 1, 3, 10, 20, and 34 (lines 2,
90, 75, 6, and 57, respectively) were selected for subsequent studies.
Transgene expression was stable both within a line between transgenic
littermates and throughout multiple generations (F1 to F8, data not
shown).
Expression of a Transgene Encoding an Ectopic Contractile Protein
Isoform in the Ventricular and Atrial Compartments
We tested the levels of transgenic overexpression in both
compartments at the transcript level. Preliminary analyses
using Northern blots showed that the transgenic transcript was the
expected size (data not shown), and subsequently, dot blots were used
to quantify RNA levels in the atria and ventricles of the transgenic
lines (Fig 2A). For each of the five lines tested, there
were significant levels of transgenic expression in both cardiac
compartments. As was found previously for ectopic MLC2v expression in
the atrium,19 endogenous gene expression, as
determined by analysis of candidate transcripts that might
undergo compensatory changes in response to the expression of the
transgene, was unaffected. No significant changes in the steady state
levels of the endogenous RLC transcripts could be detected,
nor were molecular markers of hypertrophy (ANF and skeletal
actin)32 33 upregulated. Even at the highest copy number
(Fig 2, ventricle), no effect could be observed on the steady state
levels of the endogenous -MyHC, indicating that no
titration effects on the transcriptional apparatus had
occurred.
|
A definite dose-response effect was observed between the transgenic
lines; MLC2f transcript levels increased with increasing copy number
(Fig 2B). Previously, the number of lines available for
analyses were insufficient to conclude that, in general, the
-MyHC promoter yielded transgenic lines that were subject to copy
number effects.19 20 34 35 Although there were subtle
modulations in the trends between the two cardiac compartments, the
relationship between increasing copy number and higher levels of MLC2f
RNA in both compartments is clear (Fig 2).
Replacement of Atrial and Ventricular RLCs
The sarcomeric and total protein pools in the transgenic hearts
were analyzed by electrophoresis to examine the effects of
transgene expression on the polypeptide profile of the myofilament.
Although under normal circumstances the amount of protein correlates
quite well with the level of its cognate mRNA,36 we showed
previously that transgenic overexpression perturbs this relationship
significantly by effecting a complete MLC2 isoform switch
(MLC2a
MLC2v) in the atria even though MLC2a transcript levels were
unaffected.19 20 The MLC2f overexpression recapitulates
this observation, albeit with some subtleties that were not previously
apparent. First, as was the case at the transcript level, MLC2f protein
accumulation in the atria is consistent with copy number
dependence (Fig 3), although the relationship is
difficult to quantify because of the high degree of expression and
replacement even at relatively low copy number. Four of the lines
demonstrate almost complete replacement of the atrial isoform with the
skeletal form, despite the maintenance of normal MLC2a
transcript levels. Interestingly, there is a significant difference
between the abilities of the transgenic peptide to effect replacement
in the atria versus the ventricles. For example, lines 3, 57, and 90
show roughly equivalent levels of transgenic transcripts in both
compartments; this leads to >90% replacement in the atria but only to
5% to 35% in the ventricles. Although replacement was less complete
in the ventricles, this cardiac compartment also displayed a copy
number dependence, although the relationship is obviously not exactly
linear. We ascribe this lack of exact correspondence to
position-dependent effects, which can also influence the expression
patterns of the myosin promoters in transgenic
animals.37
|
We showed previously that transgenic expression was uniform throughout
the atria and ventricles.35 However, the lack of apparent
replacement in the ventricles raises the possibility that
heterogeneous expression could occur within the
cardiomyocyte pool; this has been inferred from
physiological studies carried out on
cardiomyocyte populations derived from transgenic animals
expressing cardiac troponin C, in which individual
cardiomyocytes derived from these hearts reacted quite
differently to Sr2+ activation.38 39 Thus, we
considered it possible that the lack of apparent replacement was due to
two pools of cardiomyocytes, one that expressed the
transgene and one that did not. Preliminary experiments showed that no
significant pools of MLC2f could be detected in the nonmyofilament
protein pool or in the soluble or insoluble fractions (data not shown),
consistent with our previous observations.19 20
Therefore, we determined directly the myofilament protein composition
in individual ventricular myocytes using
acrylamide gel electrophoresis followed by silver staining.
This technique is capable of detecting the myofilament protein
population from a single cardiomyocyte. However, for the
sake of clarity, the proteins were isolated and analyzed from
10 pools, each pool consisting of two ventricular
cardiomyocytes isolated from line 57 (Fig 4). All 10 groups display both the
ventricular and skeletal isoforms, in roughly equivalent
proportions, indicating that transgenic expression occurs throughout
the cardiomyocyte population. Since no pool of
non–myofilament-associated protein could be detected, either by
standard means or Western analyses, we think it likely that the
differential replacement observed between the two cardiac compartments
is due to the different affinities of the RLC isoforms for their
respective contractile assemblies (see "Discussion").
|
Protein Replacement in Double Transgenic Heterozygotes
If the degree of replacement is simply a straightforward function
of gene dosage and the affinity, relative to the endogenous
protein species, of the transgenic LC for the "foreign"
contractile apparatus, then by increasing the effective
concentration of MLC2f, it should be possible to increase the degree of
replacement. To test this hypothesis, we attempted to increase
penetrance of MLC2f replacement in the ventricle by increasing the
effective copy number and steady state level of MLC2f RNA. This was
done by breeding line 57 (34 copies) with line 6 (20 copies) and
analyzing the resultant offspring for the double heterozygotes.
Preliminary analyses showed that the expected increase in MLC2f
RNA levels in both the ventricles and atria occurred (data not shown),
and subsequent litters of these animals were then analyzed,
both for the relative levels of MLC2f transcript and for the degree of
protein replacement in the ventricle (Fig 5). The data
confirm that transgenic expression within a line is quite stable. The
seven animals used from line 57 (Fig 5A) were derived from mice
spanning at least three breeding generations, yet the standard
deviation (Fig 5B) is 
11%. Similarly, four animals from line 6 show
little variation in transgenic expression. Shown also are typical RNA
levels from individual offspring derived from a cross between line 57
and line 6. The single heterozygotes are easily distinguished by their
relative RNA levels, although it is not possible, unambiguously, to
tell from the RNA quantifications to which line they belong. As
expected, a cross between two single heterozygotes yields animals that
lack either transgenic allele
(tg57-/tg6-; Fig 5, sample c).
Strikingly, the double heterozygote (a single animal out of the six;
tg57+/tg6+; Fig 5, sample d) shows
an RNA level that is essentially additive between the two lines
(23 777 versus 10 863±1007 [line 6] and 13 422±1469 [line 57]
arbitrary units). The data (Fig 5C and 5D) also show that,
consistent with the prediction, the double heterozygote does
indeed show an increased degree of protein replacement in the
ventricle, indicating that as the relative level of the ectopic
protein increases in the cardiomyocyte, the degree of
replacement also increases.
|
Functional and Histological Analyses of
Transgenic and Control Hearts
Although the major objective of the present study was to
determine whether transgenesis could be used to remodel both cardiac
compartments simultaneously, we wished to determine if
partial replacement of the cardiac RLCs with the skeletal isoform
altered contractile function. To determine if functional differences
might be present at the whole-organ level, groups of strain-, age-,
and sex-matched transgenic and control animals were subjected to
physiological analyses using both the
isolated Langendorff (retrograde, nonworking)25 and
working heart26 preparations. To determine to what extent
the line 57 transgenic hearts could be loaded with increasing volume
(venous return) loads, cardiac minute work was varied from 200 to
600 mm HgxmL per minute. Under identical loading conditions, the
transgenic hearts produced maximal rates of pressure development that
were significantly reduced relative to the control hearts, with
+dP/dt reduced by 14% and -dP/dt reduced by
12% (Table). The decreased +dP/dt indicates
that replacement of MLC2a and partial replacement of MLC2v with MLC2f
led to significantly reduced contractility (longer time
to develop peak ventricular pressure), as well as
perturbations in relaxation.
|
As we have shown previously,26 the normal (wild-type)
hearts showed a strong correlation of +dP/dt to increased
left ventricular minute work, exhibiting a Starling
response. However, there was significant animal-to-animal variation
among the line 57 transgenics: seven hearts demonstrated a response to
increased workload that approximated the response of the normal hearts,
and three displayed severely impaired cardiac function and could not be
workloaded without failure. The remaining seven transgenic hearts that
could be loaded did demonstrate Starling function despite statistically
lower cardiac parameters. To examine function in all 10
transgenic hearts, Langendorff preparations were used. When
+dP/dt and -dP/dt were examined under Langendorff
anterograde non–work-producing conditions, much greater
deficits in +dP/dt, and -dP/dt were observed relative to the control
hearts (Table): +dP/dt was reduced by 62%, and -dP/dt was
reduced by 52%. We also measured the maximum
Ca2+-activated Mg2+-ATPase activity of
left ventricular myofibrillar preparations from these same
hearts. The actomyosin enzymatic activity of transgenic preparations
relative to the controls was reduced by 22% (Table),
consistent with the decreased contractility
displayed by these hearts.
Despite the reduced contractility of these hearts, no
obvious pathologies developed in the line 57 adult animals (Fig 6). No significant changes in chamber size, weight, or
architecture could be discerned between the control and transgenic
adult hearts (Fig 6A and 6B, respectively). Trichrome staining revealed
that no significant fibrosis had developed (Fig 6C and 6D) and that the
overall myocyte organization and structure were well preserved in the
transgenic animals (Fig 6E and 6F).
|
As a preliminary study to characterize the basis for the alterations in
contractility, single ventricular
cardiomyocytes in which isoform replacement was 30% to
35% were isolated from line 57 adults, and the unloaded shortening
velocity was determined27 for control (n=7) and transgenic
(n=10) cells. The unloaded shortening velocity of transgenic cells
(2.40±0.55 muscle lengths/s) was not significantly different from that
of control cells (2.86±0.47 muscle lengths/s), although there was a
trend for unloaded shortening velocity of transgenic cells to be less
than that of control cells. In addition, the series elasticity, ie, the
length change required to just lower tension to zero, was not different
when comparing transgenic cells (15.1±1.5%) with the control cells
(14.6±1.1%).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present study both confirms and extends our previous data19 20 concerning transgenic-driven LC replacement in the heart in which the ventricular LC2 replaced the atrium-specific isoform. In those studies, ventricular replacement was not attempted, nor was a sufficient number of lines generated such that any conclusions about copy number–dependent expression levels could be made. The data did show, however, that transgenic overexpression led to a discordance between the overall LC RNA levels and the absolute amount of LC protein in the cardiomyocyte: absolute LC RNA levels could be increased dramatically without any increase in the steady state LC protein pool. The data for the MLC2f transgenic mice underscore this point and extend the transgenic paradigm to ectopic replacement in both cardiac compartments.
These experiments also show that the -MyHC promoter exhibits copy
number dependence, in that as copy number of the transgene increases,
there is an increase in the steady state level of the encoded mRNA. A
similar conclusion was reached for the full-length ß-MyHC promoter
constructs we have tested, although this property was lost if the
distal upstream regions were deleted.37 This is an
important consideration for transgenic modification of the heart. Copy
number dependence of the promoter-cDNA constructs is critical if one
wishes to carry out a dose-response curve in the whole animal. With
copy number dependence, by studying multiple lines carrying different
numbers of the transgene, one can obtain the
physiological correlates at different dosages of
the biological agent to help ascertain the consequences of transgenic
modification. The additional flexibility of the system is illustrated
by the crosses, which result in the production of the double
heterozygotes: if only a limited number of lines are obtained
initially, any increase in transgene expression that is needed can be
generated by crossbreeding the different lines with one another. The
disadvantage, of course, is that only a limited number of double
heterozygotes will be obtained in each litter, assuming that the
alleles display normal mendelian segregation patterns. Even this
shortcoming could, in theory, be circumvented by breeding one or both
of the transgenic alleles to homozygosity. However, this is an
experimental route that is normally avoided. During the process of
pronuclear injection, the DNA is inserted randomly, usually at a single
point, into the genome, and the integrity of the flanking sequences may
be seriously compromised. If the DNA inserts at a critical point in the
coding sequence of an important gene or disrupts the regulatory
sequences, a mutation resulting in a visible phenotype may be
created.40 41 The founder or heterozygotic offspring often
do not exhibit any phenotype because the mutation is recessive
and the one remaining wild-type allele provides normal gene
function. However, when the line is bred to homozygosity, the trait
manifests itself and can seriously distort or even mask completely the
trait that is actually under study. Thus, if this experimental path is
chosen, a rigorous longitudinal analysis of the homozygous
phenotype must precede any concerted breeding program.
Ectopic expression of the transgene in both cardiac compartments resulted in a disparity of isoform replacement between the atrial and ventricular compartments, although the MLC2f mRNA levels were similar. We have not been able to detect changes at the translational level; transgenic expression does not affect the polysome loading of the endogenous message, and the transgenic message is efficiently translated (J. Robbins, unpublished data, 1996), nor have we been able to detect a significant pool of nonmyofilament transgenic protein (J. Gulick and J. Robbins, unpublished data, 1996).19 20 Thus, the data in this report point to a potential limitation for the transgenic approach, in that replacement is sometimes not complete and is not always a simple function of the levels of the transgenic transcript. A working hypothesis that accounts for this discrepancy is that the different MLC2 isoforms have different affinities for the contractile apparatus. There are no data that deal directly with the relative affinities of the MLC2a, MLC2v, and MLC2f for the atrial and ventricular contractile assemblies. However, in a series of in vitro experiments in which exogenous RLCs were exchanged for wild-type smooth muscle LCs on the smooth muscle myosin, Yang and Sweeney42 noted the relatively low affinity of the skeletal RLC for the contractile apparatus. Their usual conditions of exchange resulted in a minor replacement, and they were able to achieve an 80% replacement only by flooding the system with a 70- to 80-fold molar excess of skeletal RLC. Trybus and Chatman43 also noted that the relative affinities of the smooth and skeletal RLCs for the smooth muscle myosin were quite different and that the domains mediating the differential affinities resided in the carboxy termini.
Although not proven by the data in the present study, we think it a
reasonable hypothesis that MLC2a has a rather low affinity for even its
endogenous contractile apparatus. At copy
numbers that result in approximately equal amounts of transgenic mRNA
and endogenous MLC2a transcript (Fig 2A), there is
substantial replacement at the protein level (Fig 3, line 90; three
copies). If this hypothesis is correct, it implies that MLC2v, on the
other hand, has a higher affinity for its contractile
apparatus than does MLC2f (or MLC2f has a higher affinity
for the atrial sarcomere than it does for the contractile
apparatus of the ventricle). The data obtained in the line
57xline 6 cross (Fig 5) are consistent with the hypothesis.
The degree of protein replacement appears to be a simple function of
message (and, presumably, nascent protein) levels; by merely increasing
the molar ratio of MLC2f/MLC2v RNA, one drives protein replacement
further. Conceivably, it should be possible to effect, for any protein
that assembles into the contractile apparatus, essentially
complete replacement by identifying the particular domain that mediates
high affinity43 44 and making the appropriate chimeric
cDNA for subsequent transgenic expression.
Transgenic mosaicism is an important consideration for replacement
strategies. "Patchy" transgene expression, for example, has been
observed when the lacZ reporter system is
used35 and can confound the subsequent analyses.
Metzger et al38 and McDonald et al39
concluded that cardiac transgenic expression of the skeletal troponin
C, when driven by a short (650-bp) -MyHC promoter, was apparently
heterogeneous in the cardiomyocyte population.
We have noted, however, some anomalies with the "short" -MyHC
promoter.45 46 An additional unknown variable in the
troponin C studies was that the rat promoter was used. We were
interested in determining whether the "full-length" mouse
promoter that is now widely used is homogeneously expressed
throughout the cardiomyocyte preparation. The data indicate
that transgenic expression does occur throughout the general
cardiomyocyte preparation: 10 separate pools, each pool
consisting of the myofilament proteins from two randomly chosen
cardiomyocytes, displayed approximately equal amounts of
the transgenic MLC2f.
There is a paucity of data for LC function in cardiac muscle. Studies carried out in skeletal muscle point to the importance of the role(s) of RLCs in mediating the kinetics of crossbridge cycling,7 8 11 but such studies have not been extended to the cardiac system. We previously reported that transgenically mediated atrial replacement of MLC2a with MLC2v led to subtle changes in cardiac functional parameters.19 Similarly, a determination of LV function in the MLC2f-overexpressing hearts shows that contractility and relaxation are significantly impaired and that maximal ATPase activity is decreased. These data are consistent with the different MLC2 isoforms having different functional profiles in their unique muscle types and illustrate the potential of making a defined genetic change that leads to a change in function at the whole-organ level. Future studies can thus address the function of the different isoforms and the mechanistic roles the different domains play in cardiac contractility.
The present study confirms the general usefulness of the transgenic paradigm in remodeling the motor proteins in both cardiac compartments. Transgenic expression is copy number dependent, so that a dose-response curve can be obtained. Expression is stable throughout the generations obtained from the different lines; we have not observed any diminution of expression in any of the lines as the breeding programs proceed. Finally, expression appears to be homogeneous within the cardiomyocyte pool, and incomplete replacement is probably due not to heterogeneous expression patterns but to the relative affinity of the transgenically encoded protein for the particular contractile apparatus with which it interacts. Transgenic replacement using an endogenous protein carrying directed single-site mutations, which leave intact the domains that determine the affinity of the protein for the contractile apparatus, should allow essentially complete replacement. Analyses of multiple lines of the resultant animals, displaying different degrees of replacement, should be valuable in establishing aspects of isoform functionality and determining the structure/function relationships of the motor proteins.
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
This study was supported by National Institutes of Health grants HL-56370, HL-41496, HL-52318, and HL-56620, by the Marion Merrell-Dow foundation (to Dr Robbins), and by National Institutes of Health grant KO8 HL-03134 (Dr Buck). We thank Lisa Murray and Patrick Konyn for excellent technical assistance.
Received November 12, 1996; accepted February 12, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Rayment I, Holden HM. The three-dimensional structure of a molecular motor. Trends Biochem Sci. 1994;19:129-134.[Medline] [Order article via Infotrieve]
2.
Rayment I, Holden HM, Whittaker M, Yohn CB, Lorenz M,
Holmes KC, Milligan RA. Structure of the actin-myosin complex
and its implications for muscle contraction.
Science. 1993;261:58-65.
3.
Sarkar S, Sreter FA, Gergely J. Light chains of
myosin from white, red and cardiac muscles. Proc Natl
Acad Sci U S A. 1971;68:946-950.
4. Lowey S, Risby D. Light chains from fast and slow muscle myosins. Nature. 1971;234:81-85.[Medline] [Order article via Infotrieve]
5.
Swynghedauw B. Developmental and functional
adaptation of contractile proteins in cardiac and skeletal
muscles. Physiol Rev. 1986;66:710-771.
6. Cummins P, Russell G. A comparison of myosin light chain subunits in the atria and ventricles of mammals. Comp Biochem Physiol [B]. 1986;84:343-348.[Medline] [Order article via Infotrieve]
7.
Sweeney HL, Stull JT. Alteration of
cross-bridge kinetics by myosin light chain
phosphorylation in rabbit skeletal muscle: implications
for regulation of actin-myosin interaction. Proc Natl
Acad Sci U S A. 1990;87:414-418.
8. Lowey S, Waller GS, Trybus KM. Skeletal muscle myosin light chains are essential for physiological speeds of shortening. Nature. 1993;365:454-456.[Medline] [Order article via Infotrieve]
9.
Lowey S, Waller GS, Trybus KM. Function of
skeletal muscle myosin heavy and light chain isoforms by an in vitro
motility assay. J Biol Chem. 1993;268:20414-20418.
10.
Moss RL. Ca2+ regulation of
mechanical properties of striated muscle: mechanistic studies using
extraction and replacement of regulatory proteins. Circ
Res. 1992;70:865-884.
11.
Szczesna D, Zhao J, Potter JD. The regulatory
light chains of myosin modulate cross-bridge cycling in skeletal
muscle. J Biol Chem. 1996;271:5246-5250.
12. Metzger JM, Moss RL. Myosin light chain 2 modulates calcium-sensitive cross-bridge transitions in vertebrate skeletal muscle. Biophys J. 1992;63:460-468.[Medline] [Order article via Infotrieve]
13.
Kumar C, Saidapet C, Delaney P, Mendola C, Siddiqui
MAQ. Expression of ventricular-type myosin light
chain messenger RNA in spontaneously hypertensive rat atria.
Circ Res. 1988;62:1093-1097.
14.
Margossian SS, White HD, Caulfield JB, Norton P, Taylor
S, Slayter HS. Light chain 2 profile and activity of human
ventricular myosin during dilated
cardiomyopathy: identification of a causal agent
for impaired myocardial function. Circulation. 1992;85:1720-1733.
15.
Shi Q, Danilczyk U, Wang J, See YP, Williams WG,
Trusler GA, Beaulieu R, Rose V, Jackowski G. Expression of
ventricular myosin subunits in the atria of children with
congenital heart malformations. Circ Res. 1991;69:1601-1607.
16.
Henkel RD, Kammerer CM, Escobedo LV, Vandeberg JL,
Walsh RA. Correlated expression of atrial myosin heavy chain and
regulatory light chain isoforms with pressure overload
hypertrophy in the non-human primate.
Cardiovasc Res. 1993;27:416-422.
17. Poetter K, Jiang H, Hassanzadeh S, Master SR, Chang A, Dalakas MC, Rayment I, Sellers JR, Fananapazir L, Epstein ND. Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat Genet. 1996;13:63-69.[Medline] [Order article via Infotrieve]
18.
Solaro RJ. Myosin and why hearts fail.
Circulation. 1992;85:1945-1947.
19. Palermo J, Gulick J, Ng WA, Grupp IL, Grupp G, Robbins J. Remodeling the heart using transgenesis. Cell Mol Biol Res. 1995;41:501-509.[Medline] [Order article via Infotrieve]
20.
Palermo J, Gulick J, Colbert M, Fewell J, Robbins
J. Transgenic remodeling of the contractile
apparatus in the mammalian heart. Circ
Res. 1996;78:504-509.
21.
Robbins J, Gulick J, Sanchez A, Howles P, Doetschman
T. Mouse embryonic stem cells express the cardiac myosin heavy
chain genes during development in vitro. J Biol
Chem. 1990;265:11905-11909.
22.
McAuliffe JJ, Gao L, Solaro RJ. Changes in
myofibrillar activation and troponin C Ca2+ binding
associated with troponin T isoform switching in developing rabbit
heart. Circ Res. 1990;66:1204-1216.
23.
Sweitzer NK, Moss RL. The effect of altered
temperature on Ca2(+)-sensitive force in
permeabilized myocardium and skeletal
muscle: evidence for force dependence of thin filament
activation. J Gen Physiol. 1990;96:1221-1245.
24. Giulian GG, Moss RL, Greaser ML. Improved methodology for analysis and quantitation of proteins on one-dimensional silver-stained slab gels. Anal Biochem. 1983;129:277-287.[Medline] [Order article via Infotrieve]
25.
Ng W, Grupp IL, Subramaniam A, Robbins J.
Cardiac myosin heavy chain mRNA expression and myocardial function in
the mouse heart. Circ Res. 1991;68:1742-1750.
26.
Jones WK, Grupp IL, Doetschman TD, Grupp G, Hewett T,
Osinska H, Boivin G, Gulick J, Ng W, Robbins J. Ablation of the
murine myosin heavy chain gene leads to functional deficits in the
heart. J Clin Invest. 1996;68:1906-1917.
27.
Strang KT, Sweitzer NK, Greaser ML, Moss RL.
ß-Adrenergic receptor stimulation increases unloaded shortening
velocity of skinned single ventricular myocytes from
rats. Circ Res. 1994;74:542-549.
28. Pagani ED, Solaro RJ, Schwartz A, ed. Methods in Pharmacology. New York, NY: Plenum Publishing Corp; 1984:49-61.
29. White HD. Special instrumentation and techniques for kinetic studies of contractile systems. Methods Enzymol. 1982;85:698-708.
30.
Nudel U, Calvo JM, Shani M, Levy Z. The
nucleotide sequence of a rat myosin light chain 2
gene. Nucleic Acids Res. 1984;12:7175-7186.
31.
Metzger JM, Greaser ML, Moss RL. Variations in
cross-bridge attachment rate and tension with
phosphorylation of myosin in mammalian skinned skeletal
muscle fibers: implications for twitch potentiation in intact
muscle. J Gen Physiol. 1989;93:855-883.
32.
Younes A, Boluyt MO, O'Neill L, Meredith AL, Crow MT,
Lakatta EG. Age-associated increase in rat
ventricular ANP gene expression correlates with cardiac
hypertrophy. Am J Physiol. 1995;269:H1003-H1008.
33. Schwartz K, Carrier L, Chassagne C, Wisnewsky C, Boheler KR. Regulation of myosin heavy chain and actin isogenes during cardiac growth and hypertrophy. Symp Soc Exp Biol. 1992;46:265-272.[Medline] [Order article via Infotrieve]
34.
Milano CA, Dolber PC, Rockman HA, Bond RA,
Venable ME, Allen LF, Lefkowitz RJ. Myocardial expression of a
constitutively active alpha 1ß-adrenergic receptor in transgenic mice
induces cardiac hypertrophy. Proc Natl Acad
Sci U S A. 1994;91:10109-10113.
35.
Colbert MC, Kirby ML, Robbins J.
Endogenous retinoic acid signaling colocalizes with
advanced expression of the adult smooth muscle myosin heavy chain
isoform during development of the ductus arteriosus. Circ
Res. 1996;78:790-798.
36. Boheler KR, Carrier L, Chassagne C, de la Bastie D, Mercadier JJ, Schwartz K. Regulation of myosin heavy chain and actin isogenes expression during cardiac growth. Mol Cell Biochem. 1991;104:101-107.[Medline] [Order article via Infotrieve]
37.
Knotts S, Rindt H, Robbins J. Position
independent expression and developmental regulation is directed by the
beta myosin heavy chain gene 5' upstream region in transgenic
mice. Nucleic Acids Res. 1995;23:3301-3309.
38.
Metzger JM, Parmacek MS, Barr E, Pasyk K, Lin WI,
Cochrane KL, Field LJ, Leiden JM. Skeletal troponin C reduces
contractile sensitivity to acidosis in cardiac myocytes from transgenic
mice. Proc Natl Acad Sci U S A. 1993;90:9036-9040.
39.
McDonald KS, Field LJ, Parmacek MS, Soonpaa M, Leiden
JM, Moss RL. Length dependence of Ca2+ sensitivity
of tension in mouse cardiac myocytes expressing skeletal troponin
C. J Physiol (Lond). 1995;483:131-139.
40. Babinet C, Morello D, Renard JP. Transgenic mice. Genome. 1989;31:938-949.[Medline] [Order article via Infotrieve]
41. Ratty AK, Fitzgerald LW, Titeler M, Glick SD, Mullins JJ, Gross KW. Circling behavior exhibited by a transgenic insertional mutant. Mol Brain Res. 1990;8:355-358.[Medline] [Order article via Infotrieve]
42.
Yang Z, Sweeney HL. Restoration of
phosphorylation-dependent regulation to the skeletal
muscle myosin regulatory light chain. J Biol
Chem. 1995;270:24646-24649.
43.
Trybus KM, Chatman TA. Chimeric regulatory light
chains as probes of smooth muscle myosin function. J
Biol Chem. 1993;268:4412-4419.
44. Perriard JC, Von AP, Bantle S, Eppenberger HM, Eppenberger EM, Messerli M, Soldati T. Molecular analysis of protein sorting during biogenesis of muscle cytoarchitecture. Symp Soc Exp Biol. 1992;46:219-235.[Medline] [Order article via Infotrieve]
45.
Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J,
Robbins J. Tissue-specific regulation of the alpha-myosin heavy
chain gene promoter in transgenic mice. J Biol
Chem. 1991;266:24613-24620.
46.
Subramaniam A, Gulick J, Neumann J, Knotts S, Robbins
J. Transgenic analysis of the thyroid-responsive
elements in the alpha-cardiac myosin heavy chain gene promoter.
J Biol Chem. 1993;268:4331-4336.
This article has been cited by other articles:
 |
|
 |
|
  E. Bovill, S. Westaby, S. Reji, R. Sayeed, A. Crisp, and T. Shaw Induction by left ventricular overload and left ventricular failure of the human Jumonji gene (JARID2) encoding a protein that regulates transcription and reexpression of a protective fetal program J. Thorac. Cardiovasc. Surg., September 1, 2008; 136(3): 709 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Schevzov, T. Fath, B. Vrhovski, N. Vlahovich, S. Rajan, J. Hook, J. E. Joya, F. Lemckert, F. Puttur, J. J.-C. Lin, et al. Divergent Regulation of the Sarcomere and the Cytoskeleton J. Biol. Chem., January 4, 2008; 283(1): 275 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Bupha-Intr, J. W. Holmes, and P. M. L. Janssen Induction of hypertrophy in vitro by mechanical loading in adult rabbit myocardium Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3759 - H3767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Herron, R. Vandenboom, E. Fomicheva, L. Mundada, T. Edwards, and J. M. Metzger Calcium-Independent Negative Inotropy by {beta}-Myosin Heavy Chain Gene Transfer in Cardiac Myocytes Circ. Res., April 27, 2007; 100(8): 1182 - 1190. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hambleton, H. Hahn, S. T. Pleger, M. C. Kuhn, R. Klevitsky, A. N. Carr, T. F. Kimball, T. E. Hewett, G. W. Dorn II, W. J. Koch, et al. Pharmacological- and Gene Therapy-Based Inhibition of Protein Kinase C{alpha}/{beta} Enhances Cardiac Contractility and Attenuates Heart Failure Circulation, August 8, 2006; 114(6): 574 - 582. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Gaffin, K. Gokulan, J. C. Sacchettini, T. E. Hewett, R. Klevitsky, J. Robbins, V. Sarin, D. C. Zawieja, G. A. Meininger, and M. Muthuchamy Changes in end-to-end interactions of tropomyosin affect mouse cardiac muscle dynamics Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H552 - H563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Xu, T. R. Kimball, J. N. Lorenz, D. A. Brown, A. R. Bauskin, R. Klevitsky, T. E. Hewett, S. N. Breit, and J. D. Molkentin GDF15/MIC-1 Functions As a Protective and Antihypertrophic Factor Released From the Myocardium in Association With SMAD Protein Activation Circ. Res., February 17, 2006; 98(3): 342 - 350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Kaiser, Q. Liang, O. Bueno, Y. Huang, T. Lackey, R. Klevitsky, T. E. Hewett, and J. D. Molkentin Genetic Inhibition or Activation of JNK1/2 Protects the Myocardium from Ischemia-Reperfusion-induced Cell Death in Vivo J. Biol. Chem., September 23, 2005; 280(38): 32602 - 32608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. James, L. Martin, M. Krenz, C. Quatman, F. Jones, R. Klevitsky, J. Gulick, and J. Robbins Forced Expression of {alpha}-Myosin Heavy Chain in the Rabbit Ventricle Results in Cardioprotection Under Cardiomyopathic Conditions Circulation, May 10, 2005; 111(18): 2339 - 2346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Krenz and J. Robbins Impact of beta-myosin heavy chain expression on cardiac function during stress J. Am. Coll. Cardiol., December 21, 2004; 44(12): 2390 - 2397. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D Gaffin, C. W Tong, D. C Zawieja, T. E Hewett, R. Klevitsky, J. Robbins, and M. Muthuchamy Charged residue alterations in the inner-core domain and carboxy-terminus of {alpha}-tropomyosin differentially affect mouse cardiac muscle contractility J. Physiol., December 15, 2004; 561(3): 777 - 791. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Gaffin, K. Gokulan, J. C. Sacchettini, T. Hewett, R. Klevitsky, J. Robbins, and M. Muthuchamy Charged residue changes in the carboxy-terminus of {alpha}-tropomyosin alter mouse cardiac muscle contractility J. Physiol., April 15, 2004; 556(2): 531 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Szczesna-Cordary, G. Guzman, S.-S. Ng, and J. Zhao Familial Hypertrophic Cardiomyopathy-linked Alterations in Ca2+ Binding of Human Cardiac Myosin Regulatory Light Chain Affect Cardiac Muscle Contraction J. Biol. Chem., January 30, 2004; 279(5): 3535 - 3542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. F. Bueno, D. J. Lips, R. A. Kaiser, B. J. Wilkins, Y.-S. Dai, B. J. Glascock, R. Klevitsky, T. E. Hewett, T. R. Kimball, B. J. Aronow, et al. Calcineurin A{beta} Gene Targeting Predisposes the Myocardium to Acute Ischemia-Induced Apoptosis and Dysfunction Circ. Res., January 9, 2004; 94(1): 91 - 99. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Krenz, A. Sanbe, F. Bouyer-Dalloz, J. Gulick, R. Klevitsky, T. E. Hewett, H. E. Osinska, J. N. Lorenz, C. Brosseau, A. Federico, et al. Analysis of Myosin Heavy Chain Functionality in the Heart J. Biol. Chem., May 2, 2003; 278(19): 17466 - 17474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sanbe, J. Gulick, M. C. Hanks, Q. Liang, H. Osinska, and J. Robbins Reengineering Inducible Cardiac-Specific Transgenesis With an Attenuated Myosin Heavy Chain Promoter Circ. Res., April 4, 2003; 92(6): 609 - 616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Haase, M. H. Lehmann, M. M. Korner, R. Korfer, H. H. Sigusch, and H. R. Figulla Identification and validation of selective upregulation of ventricular myosin light chain type 2 mRNA in idiopathic dilated cardiomyopathy Eur J Heart Fail, January 1, 2002; 4(1): 23 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Lacour-Gayet, D. Piot, J. Zoghbi, A. Serraf, P. Gruber, L. Mace, A. Touchot, and C. Planche Surgical management and indication of left ventricular retraining in arterial switch for transposition of the great arteries with intact ventricular septum Eur. J. Cardiothorac. Surg., October 1, 2001; 20(4): 824 - 829. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Yang, T. E. Hewett, R. Klevitsky, A. Sanbe, X. Wang, and J. Robbins PKA-dependent phosphorylation of cardiac myosin binding protein C in transgenic mice Cardiovasc Res, July 1, 2001; 51(1): 80 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, H. Osinska, G. W. Dorn II, M. Nieman, J. N. Lorenz, A. M. Gerdes, S. Witt, T. Kimball, J. Gulick, and J. Robbins Mouse Model of Desmin-Related Cardiomyopathy Circulation, May 15, 2001; 103(19): 2402 - 2407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. James, Y. Zhang, H. Osinska, A. Sanbe, R. Klevitsky, T. E. Hewett, and J. Robbins Transgenic Modeling of a Cardiac Troponin I Mutation Linked to Familial Hypertrophic Cardiomyopathy Circ. Res., October 27, 2000; 87(9): 805 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. James, A. Sanbe, K. Yager, L. Martin, R. Klevitsky, and J. Robbins Genetic Manipulation of the Rabbit Heart via Transgenesis Circulation, April 11, 2000; 101(14): 1715 - 1721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Sussman, S. Welch, A. Walker, R. Klevitsky, T. E. Hewett, S. A. Witt, T. R. Kimball, R. Price, H. W. Lim, and J. D. Molkentin Hypertrophic defect unmasked by calcineurin expression in asymptomatic tropomodulin overexpressing transgenic mice Cardiovasc Res, April 1, 2000; 46(1): 90 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Tardiff, T. E. Hewett, S. M. Factor, K. L. Vikstrom, J. Robbins, and L. A. Leinwand Expression of the beta (slow)-isoform of MHC in the adult mouse heart causes dominant-negative functional effects Am J Physiol Heart Circ Physiol, February 1, 2000; 278(2): H412 - H419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R.-P. Xiao, H. Cheng, Y.-Y. Zhou, M. Kuschel, and E. G. Lakatta Recent Advances in Cardiac {beta}2-Adrenergic Signal Transduction Circ. Res., November 26, 1999; 85(11): 1092 - 1100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Yang, A. Sanbe, H. Osinska, T. E. Hewett, R. Klevitsky, and J. Robbins In Vivo Modeling of Myosin Binding Protein C Familial Hypertrophic Cardiomyopathy Circ. Res., October 29, 1999; 85(9): 841 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Lewis, Y. Xia, S. K. Datta, J. McMillin, and R. E. Kellems Combinatorial Interactions Regulate Cardiac Expression of the Murine Adenylosuccinate Synthetase 1 Gene J. Biol. Chem., May 14, 1999; 274(20): 14188 - 14197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Low, J. Mitchell, J. Woodcock-Mitchell, A. S. Rovner, and S. L. White Smooth-Muscle Myosin Heavy-Chain SM-B Isoform Expression in Developing and Adult Rat Lung Am. J. Respir. Cell Mol. Biol., April 1, 1999; 20(4): 651 - 657. [Abstract] [Full Text]
|
|
|
|
|
|
S. H. Buck, P. J. Konyn, J. Palermo, J. Robbins, and R. L. Moss Altered kinetics of contraction of mouse atrial myocytes expressing ventricular myosin regulatory light chain Am J Physiol Heart Circ Physiol, April 1, 1999; 276(4): H1167 - H1171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Loukianov, Y. Ji, I. L. Grupp, D. L. Kirkpatrick, D. L. Baker, T. Loukianova, G. Grupp, J. Lytton, R. A. Walsh, and M. Periasamy Enhanced Myocardial Contractility and Increased Ca2+ Transport Function in Transgenic Hearts Expressing the Fast-Twitch Skeletal Muscle Sarcoplasmic Reticulum Ca2+-ATPase Circ. Res., November 2, 1998; 83(9): 889 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sato, D. G. Ferguson, H. Sako, G. W. Dorn II, V. J. Kadambi, A. Yatani, B. D. Hoit, R. A. Walsh, and E. G. Kranias Cardiac-specific Overexpression of Mouse Cardiac Calsequestrin Is Associated with Depressed Cardiovascular Function and Hypertrophy in Transgenic Mice J. Biol. Chem., October 23, 1998; 273(43): 28470 - 28477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Bonne, L. Carrier, P. Richard, B. Hainque, and K. Schwartz Familial Hypertrophic Cardiomyopathy : From Mutations to Functional Defects Circ. Res., September 21, 1998; 83(6): 580 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. James, T. E. Hewett, and J. Robbins Cardiac Physiology in Transgenic Mice Circ. Res., March 9, 1998; 82(4): 407 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Schaub, M. A. Hefti, R. A. Zuellig, and I. Morano Modulation of contractility in human cardiac hypertrophy by myosin essential light chain isoforms Cardiovasc Res, February 1, 1998; 37(2): 381 - 404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Rethinasamy, M. Muthuchamy, T. Hewett, G. Boivin, B. M. Wolska, C. Evans, R. J. Solaro, and D. F. Wieczorek Molecular and Physiological Effects of {alpha}-Tropomyosin Ablation in the Mouse Circ. Res., January 23, 1998; 82(1): 116 - 123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Robbins {alpha}-Tropomyosin Knockouts : A Blow Against Transcriptional Chauvinism Circ. Res., January 23, 1998; 82(1): 134 - 136. [Full Text] [PDF]
|
|
|
|
 |
|
 P. Gruber, S. Kubalak, and K. Chien Downregulation of atrial markers during cardiac chamber morphogenesis is irreversible in murine embryos Development, January 11, 1998; 125(22): 4427 - 4438. [Abstract] [PDF]
|
|
|
|
|
|
J. James and J. Robbins Molecular remodeling of cardiac contractile function Am J Physiol Heart Circ Physiol, November 1, 1997; 273(5): H2105 - H2118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Kelly and M. Buckingham Manipulating Myosin Light Chain 2 Isoforms In Vivo : A Transgenic Approach to Understanding Contractile Protein Diversity Circ. Res., May 19, 1997; 80(5): 751 - 753. [Full Text]
|
|
|
|
|
|
J. S.'A. Pereira, D. Pavlov, M. Nili, M. Greaser, E. Homsher, and R. L. Moss Kinetic Differences in Cardiac Myosins with Identical Loop 1 Sequences J. Biol. Chem., February 2, 2001; 276(6): 4409 - 4415. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, H. Osinska, R. Klevitsky, A. M. Gerdes, M. Nieman, J. Lorenz, T. Hewett, and J. Robbins Expression of R120G-{alpha}B-Crystallin Causes Aberrant Desmin and {alpha}B-Crystallin Aggregation and Cardiomyopathy in Mice Circ. Res., July 6, 2001; 89(1): 84 - 91. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||