Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1996;79:1177-1187

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Southgate, K. M.
Right arrow Articles by Newby, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Southgate, K. M.
Right arrow Articles by Newby, A. C.
(Circulation Research. 1996;79:1177-1187.)
© 1996 American Heart Association, Inc.


Articles

Upregulation of Basement Membrane–Degrading Metalloproteinase Secretion After Balloon Injury of Pig Carotid Arteries

Kay M. Southgate, Michael Fisher, Adrian P. Banning, Valerie J. Thurston, Andrew H. Baker, Rosalind P. Fabunmi, Peter H. Groves, Malcolm Davies, Andrew C. Newby

the Bristol Heart Institute (K.M.S., A.H.B., A.C.N.), University of Bristol, Bristol (UK) Royal Infirmary, and the Departments of Pharmacology (M.F.) and Cardiology (A.P.B., V.J.T., R.P.F., P.H.G.) and the Institute of Nephrology (M.D.), University of Wales College of Medicine, Heath Park Cardiff.

Correspondence to Dr Kay Southgate, Bristol Heart Institute, University of Bristol, Bristol Royal Infirmary, Bristol BS2 8HW, UK.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Basement membrane–degrading metalloproteinases (gelatinases) appear necessary for vascular smooth muscle cell migration and proliferation in culture and for intimal migration of cells after balloon injury to the rat carotid artery. We investigated in the present study the secretion of gelatinases from pig carotid artery tissue after balloon injury. Segments of injured artery and segments proximal and distal to the area of injury were removed 3, 7, and 21 days after balloon dilatation. Medial explants from these segments were then cultured for 3 days, and the serum-free conditioned media were subjected to gelatin zymography. Production of 72- and 95-kD gelatinases was quantified by densitometry. Balloon-injured segments secreted significantly more 72- and 95-kD gelatinase than did paired distal segments at all time points. Release of both gelatinase activities was increased at 3 and 7 days relative to segments from uninjured arteries but declined again by 21 days after balloon injury. Similar results were found for gelatinase levels in extracts of arterial tissue. Consistent with the protein secretion data, in situ hybridization demonstrated that the mRNAs for both gelatinases were upregulated after balloon injury. Expression was prominent in medial smooth muscle cells, particularly around foci of necrosis, and in neointimal cells 3 and 7 days after balloon injury; 72-kD gelatinase mRNA persisted after 21 days and was prominent in regrown endothelial cells. The upregulation of gelatinase activity paralleled the time course of smooth muscle cell migration and proliferation in this model. We conclude that increased gelatinase production occurs in response to balloon injury and may play a role in permitting migration and proliferation of vascular smooth muscle cells.


Key Words: vascular smooth muscle • angioplasty • restenosis • cell proliferation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Migration of SMCs into the vascular intima and their subsequent proliferation are important events in the pathogenesis of restenosis after angioplasty.1 2 3 Growth factors such as PDGF and basic fibroblast growth factor stimulate SMC proliferation in culture4 5 and in previously injured vessels.6 7 In organ cultures8 9 or uninjured arteries in vivo,6 7 10 however, exposure to growth factors alone is insufficient to initiate migration and proliferation. One suggested explanation for these observations is that matrix remodeling is needed in concert with growth factor action11 to overcome the inhibitory effect exerted by the normal extracellular matrix.12 Consistent with this, our previous study11 showed that specific inhibitors of matrix-degrading MMPs inhibited outgrowth and proliferation of SMCs from rabbit aortic explants. More recently, a hydroxamic acid–based MMP inhibitor was shown to inhibit intimal migration of rat carotid artery SMCs in vivo.13 In SMCs proliferating from rabbit aortic explants, we further demonstrated production of 72- and 95-kD basement membrane–degrading MMPs (gelatinase A [MMP-2] and gelatinase B [MMP-9], respectively).11 We could not detect stromelysin (MMP-3) or interstitial collagenase (MMP-1) in these cells, although they are present in vascular SMCs from other species.14 15 16 17 18 In the balloon-injured rat carotid artery, increased tissue levels of gelatinase B and activation of gelatinase A were also demonstrated during neointimal formation.13 19 Taken together, these data imply that gelatinases play a role in initiating SMC migration and proliferation in cell culture.

In the present study, we investigated whether the production of gelatinases is increased after balloon injury to the pig carotid artery in vivo, a model in which medial tearing and dilatation injury occur. As further evidence for increased production, levels of mRNA expression and its localization to medial and intimal cells were studied by in situ hybridization.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Purified recombinant human stromelysin-1 and gelatinase B and antibodies to human gelatinase A (X670) and pig gelatinase B (A560) were generous gifts of Dr Gillian Murphy, Strangeways Research Laboratory, Cambridge, UK. The MMP inhibitors Ro 31-9790 and Ro 31-4724 were gifts from Roche Products Ltd; stock solutions in neat DMSO were diluted 200-fold immediately before use to give final concentrations in the range of 0.1 to 10 µmol/L and 0.5% DMSO. Acid-soluble collagen from calf skin (type III) and monoclonal antibodies to {alpha}-smooth muscle actin (clone 1A4) were obtained from Sigma Chemical Co. The plasmid containing partial cDNA for the 72-kD gelatinase A20 was obtained from Dr A. Docherty, Celltech Ltd, Berkshire, UK. The plasmid containing the partial cDNA for the 95-kD gelatinase B21 was a generous gift from Professor K. Tryggvason, Biocentre, University of Oulu, Linanmaa, Finland. The source of the other reagents used has been reported previously.11 22

Balloon Injury Protocol
The study was conducted in 30 Large White pigs 3 to 4 months old weighing {approx}30 kg obtained from a local farm. Carotid balloon injury was conducted essentially as described by Steele et al.23 Briefly, animals were sedated with 750 mg of intramuscular ketamine; anesthesia was induced by inhalation of 0.5% halothane and maintained by continuous intravenous infusion of fentanyl (0.01 mg·mL-1), etomidate (0.04 mg·mL-1), and ketamine (1 mg·mL-1). After surgical exposure, a 9F sheath was inserted into the right femoral artery. Mechanical ventilation and continuous monitoring of arterial blood pressure and the electrocardiogram were performed throughout the procedure.

All animals received a bolus of heparin (50 U·kg-1) followed by an intravenous heparin infusion of 50 U·kg-1·h-1. Balloon injury was performed using an 8F 8-mm Meditech balloon catheter. The catheter was advanced under fluoroscopic control into the left carotid artery and positioned at a level between the first and third cervical vertebrae. The balloon was inflated to 6 atm for 30 seconds five times at 60-second intervals. After the fifth inflation, the balloon catheter was pulled back into the common carotid artery and immediately advanced into the right carotid artery. The dilatation protocol was repeated in this artery at a level similar to that used for the left carotid. The balloon catheter was removed, the femoral artery was ligated, and the skin incision was closed. To avoid infection, all pigs received intramuscular gentamicin (60 mg) and penicillin (1 IU) at induction and at the end of the procedure. The animals were allowed to recover and fed a normal chow diet. Animals were subsequently killed by the intravenous injection of pentobarbital either 3, 7, or 21 days after balloon injury.

Tissue Culture
Both the right and left carotid arteries were carefully excised and immersed in a sterile dissecting medium at 25°C to 30°C. This medium consisted of DMEM buffered with 20 mmol/L HEPES and supplemented with 0.1 mmol/L nonessential amino acids, 1 mmol/L sodium pyruvate, 8 mmol/L L-glutamine, and penicillin-streptomycin (100 U·mL-1 and 100 µg·mL-1, respectively). Each artery was cleaned, and the area of balloon injury, which was easily identifiable by the localized arterial dilatation and vessel wall thickening, was divided into four segments. Segments proximal and distal to the injured area were also taken as controls. Ring sections were also obtained from the same end of each segment and wax-embedded for histological and in situ hybridization analysis. Medial explants were then prepared from each of the remaining segments according to the method described previously.22 To allow secretion of MMPs, explants were cultured individually in the wells of a 96-well microtiter plate for 3 days at 37°C in DMEM-HCO3 tissue culture medium supplemented as above but also containing 2.5 g·L-1 lactalbumin. Conditioned media were pooled from 24 explants for each segment, centrifuged at 1500g for 10 minutes to remove any cells and debris, and (after the addition of sodium azide to a final concentration of 0.1%) stored at -20°C until required. The 24 explants were then pooled and extracted with ice-cold 100 g·L-1 trichloroacetic acid,22 and the DNA concentration was measured as described previously.24

Extraction of Tissue
Segments of proximal, balloon injured, and distal carotid artery were removed. As much as possible of the adventitia was removed, and then the samples were frozen in liquid nitrogen until required for analysis. Preweighed frozen segments were crushed under liquid nitrogen, and the resultant powder was added to preweighed tubes containing 0.25 mL/100 mg of tissue of extraction medium containing 20 mmol/L NaCl, 100 mmol/L Tris-HCl, pH 7.6, 0.5 mmol/L PMSF, 10 µg/mL of aprotinin, and 1% SDS. The tubes were reweighed, and the values were used to calculate the wet weight of the tissue. After they were mixed well, the samples were left at 4°C for 10 minutes and then centrifuged at 13 500g for 3 minutes at 4°C. The supernatants were removed and stored at -20°C until needed for zymography.

Zymography
Gelatinase activity was measured after electrophoresis of samples into 7.5% (wt/vol) polyacrylamide gels containing 2 g·L-1 SDS25 and 2 mg·mL-1 gelatin by the method of Heussen and Dowdle.26 Samples of conditioned media or tissue extracts (15 µL) were mixed at room temperature (23°C) with an equal volume of double-strength nonreducing sample buffer,25 and 20 µL of the mixture was then electrophoresed at 4°C. After electrophoresis, SDS was removed from the gels by two washes for 15 minutes each with an aqueous solution of 25 g·L-1 Triton X-100. The gels were then incubated at 37°C in a reaction buffer containing 50 mmol/L Tris-HCl, pH 8, 50 mmol/L NaCl, 10 mmol/L CaCl2, and 0.05% Brij 35 for 18 hours. Zones of lysis appeared as clear bands against the blue-stained background. The gels were calibrated with a high molecular mass standard mixture consisting of the following proteins: myosin (205 kD), ß-galactosidase (116 kD), phosphorylase b (97.4 kD), bovine albumin (66 kD), egg albumin (45 kD), and carbonic anhydrase (29 kD) (Sigma Chemical Co).

To study inhibition of the enzymes, the reaction buffer was supplemented with EDTA (20 mmol/L), PMSF (1 mmol/L), N-ethylmaleimide (5 mmol/L), pepstatin A (5 mmol/L), Ro 31-9790 (0.1 to 10 µmol/L), or Ro 31-4724 (10 µmol/L), as indicated in the text. The gels were then stained with a solution of 0.1% aqueous solution of Coomassie blue R250 (Merck Ltd).

To distinguish activated and pro-forms of gelatinase B in conditioned media, activation of progelatinase B was carried out using trypsin-activated stromelysin-1, as described previously.27 Stromelysin (5 µmol/L) was incubated for 30 minutes at 37°C with 5 µg·mL-1 of bovine trypsin followed by the addition of 50 µg·mL-1 of soybean trypsin inhibitor. Aliquots of the activated stromelysin solution (1 µL) were added to aliquots of conditioned media (50 µL) followed by 10 µL of 25 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, 10 mmol/L CaCl2, and 0.5% Brij 35. Incubation was conducted for 1 hour at 37°C, and then 15 µL of 5x concentrated Laemmli SDS sample buffer25 was added to terminate the reaction. The products (5 µL) were then analyzed by zymography. Purified human progelatinase B (0.2 µg·mL-1) was used in the same way as a positive control and was completely converted from a form of 95- to one of 88-kD molecular mass (results not shown).

For further identification, immunoprecipitation of gelatinase isoforms was conducted using purified immunoglobulins from anti-human gelatinase A, anti-pig gelatinase B, or nonimmune sheep sera. Aliquots of conditioned media (200 µL) were incubated with 10 µL of 1 mol/L Tris-HCl, pH 7.2, and 50 or 100 µg of immunoglobulin for 60 minutes at 37°C. Fifty microliters of a 1:4 (vol/vol) suspension of protein G–Sepharose (Sigma) in PBS was added, and the mixture was incubated with shaking for 2 hours at 4°C. The suspension was then centrifuged at 1000g for 2 minutes, and aliquots of the supernatant (10 µL) were then removed and subjected to zymography.

For some experiments, zymograms were subjected to densitometric analysis using a GS-690 imaging densitometer (Bio-Rad). Results were expressed as optical densityxmm2, and the means were calculated. To validate the method, a linear response of optical densityxmm2 versus dilution was obtained for each gelatinase band for five serial twofold dilutions on three separate samples (results not shown).

Cytochemical Staining
Rehydrated paraffin sections were incubated for 5 minutes with 3% H2O2 to inhibit endogenous peroxidases, rinsed in distilled water, and then treated in the following ways. Immunocytochemistry for {alpha}-smooth muscle actin was performed as described previously28 using a 1/200 dilution of the primary monoclonal antibody clone 1A4 (Sigma). Sections were then incubated with a 1:400 dilution of biotin-conjugated goat anti-mouse IgG (Sigma) followed by a 1:200 dilution of ExtrAvidin horseradish peroxidase (Sigma). The color was developed with a solution of 0.05% 3,3'-diaminobenzidine and 0.03% H2O2 in PBS (pH 7.3), and the sections were then counterstained with Harris hematoxylin. Cytochemical staining for endothelial cells was carried out using DBA lectin according to the method of Roussel and Dalion.29 Briefly, sections were incubated for 30 minutes at 23°C with a 5 µg·mL-1 solution of peroxidase-labeled DBA lectin (Sigma) in PBS. Color development and counterstaining were as described above. Proliferating cells were detected by immunocytochemistry for PCNA30 using a primary monoclonal antibody (PC10, Dako Ltd) at a 1:100 dilution. This was followed by a 1:50 dilution of biotinylated anti-mouse IgG (Dako) and avidin-biotin-peroxidase conjugate (Dako) according to the manufacturer's instructions. Color development and counterstaining were as described above. The PCNA index was determined by counting only those cells with strongly positive nuclear PCNA staining and expressing this as a percentage of the counterstained nuclei.

In Situ Hybridization
PCR was used to generate specific probes for the 72- and 95-kD gelatinases. Primers were designed within the hemopexin-like domain because this region shows extensive stretches of dyshomology between the two enzymes. An upstream clamp (CCAC) and T7 RNA polymerase site (5' CTAATACGACTCACTATAGGGAGA 3') were included on the 5' end of either the antisense primer to generate antisense RNA probe or sense primer to produce sense RNA control. Primer sequences were as follows: 72-kD antisense, 5' GGCATCTGCGATGA 3'; 72-kD sense, 5' ACATTGACCTTGGCACC 3'; 95-kD antisense, 5' ACTGCAAAGCAGGAC 3'; and 95-kD sense, 5' TGGGAACCAGCTGTAT 3'. These primers were used to generate PCR products from a vector containing the 72-kD cDNA sequence20 and the 95-kD cDNA sequence.21 One nanogram of template was amplified in a volume of 50 µL containing 1x reaction buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, and 1% Triton X-100), 2 mmol/L MgCl2, 0.2 mmol/L deoxynucleoside triphosphates, 1 µmol/L of each primer, and 5 U Taq DNA polymerase (Promega, Ltd). For the 72-kD gelatinase, 30 cycles of 1-minute denaturation at 94°C, annealing at 50°C for 1 minute, and extension at 72°C for 1 minute were applied. For the 95-kD gelatinase, 40 cycles of 1-minute denaturation at 94°C, annealing at 37°C for 1 minute, and extension at 72°C for 1 minute were used. The probes generated from the 72- and 95-kD gelatinase templates had the expected molecular sizes of 507 and 593 bp, respectively. The PCR products generated were then used directly as templates for in vitro transcription using [{alpha}-32P]CTP (Amersham International; specific activity, 400 Ci·mmol-1) as the label according to the manufacturer's instructions (Promega). The PCR products were then cloned into the pT7-blue vector (Novagen). The resulting clones were digested with Kpn I and Xba I restriction endonucleases to release the insert and fractionated by low melting gel electrophoresis. The bands were purified before labeling using Wizard PCR preps (Promega). The identity of the PCR products was confirmed by restriction enzyme mapping and partial sequence determination. Probes were used only when the incorporation of radioactivity was >40%.

The specificity of the probes was established by dot blot hybridization against serial 10-fold dilutions of the vectors used as templates. As expected, both antisense and sense probes detected the same quantity of the double-stranded parent vector, but there was no detectable hybridization to the same quantity of the vector for the other gelatinase. The 72-kD antisense probes for the 72- and 95-kD gelatinases detected mRNAs of 3.1 and 2.8 kb, respectively, in Northern blots of extracts of HT1080 fibrosarcoma cells, corresponding to the known sizes of the mRNAs.21

To prepare sections for hybridization, carotid artery rings were rinsed with PBS, fixed in 10% buffered formal saline, dehydrated, and paraffin wax–embedded; then sections were cut as described previously.31 Briefly, serial 5-µm sections were cut onto RNase-free glass slides previously coated with 3-aminopropyltriethoxysilane (Sigma) to maximize section adhesion32 and were dried slowly at 37°C for a minimum of 24 hours. Before hybridization, sections were dehydrated through a graded series of alcohol and dipped successively in PBS (twice for 3 minutes each), 0.1 mol/L glycine in PBS (5 minutes), 0.3% Triton X-100 in PBS (15 minutes), and PBS (twice for 3 minutes each) and then treated with proteinase K (1 µg·mL-1) in 10 mmol/L Tris-HCl, pH 8.0, with 1 mmol/L EDTA at 37°C for 10 minutes. Slides were then immersed in 4% paraformaldehyde (5 minutes) and washed in PBS (twice for 1 minute each) and then in 2x SSC (three times for 1 minute each). Slides were not prehybridized because this was found not to influence the end result. Hybridization buffer contained 50% deionized formamide, 2x SSC, 1x Denhardt's solution, 25 µg·mL-1 salmon sperm DNA, and 0.5% SDS. Hybridization was started by adding 1x106 cpm of labeled probe or sense control RNA in 50 µL hybridization buffer to each section. Sections were then covered with autoclaved diethyl pyrocarbonate-treated glass coverslips and placed in a hybridization chamber humidified with 10 mL of 2x SSC overnight at 42°C. After hybridization, the coverslips were removed by soaking in 2x SSC for 30 minutes. Slides were then washed twice for 15 minutes in 2x SSC at 42°C, followed by a further four washes for 5 minutes in 2x SSC at room temperature. Sections were then dipped in graded alcohols (twice) for 5 minutes each and air-dried at 37°C. Finally, slides were coated with LM-1 emulsion (Amersham), air-dried, and placed in a light-tight box with desiccant at 4°C for between 2 and 3 weeks. After developing and fixing, sections were lightly counterstained with hematoxylin and mounted.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Response to Balloon Injury in the Pig Carotid Artery
As described previously,23 balloon inflation caused dilatation in all arteries and focal deep medial tears with superimposed thrombus in approximately three quarters. We confirmed by immunocytochemistry with DBA lectin that balloon inflation resulted in endothelial denudation that persisted for at least 7 days but showed partial restoration after 21 days (see below). As shown previously in this model,33 immunocytochemistry for PCNA identified few positive cells (0.68±0.4%, n=7) in the media of uninjured arteries, but these were increased to 5.6±0.6% (n=8) 3 days after balloon injury and to 4.5±0.5% (n=8) after 7 days and declined again to 2.1±0.5% (n=12) after 21 days. Where the internal elastic lamina remained intact, vascular SMCs first appeared in the intima 3 days after balloon injury (see below), achieved a PCNA index of 8±2% (n=5) 7 days after balloon injury, and then showed a decline to 2.5±0.5% (n=10) after 21 days. In areas underlying a rupture of the internal elastic lamina, the PCNA index increased to 16±1% 7 days after balloon injury and declined to 4.5±1.5% (n=9) after 21 days. We chose to study gelatinase expression after 3 days (before most intimal migration), after 7 days (at the peak of intimal and medial proliferation),33 and after 21 days (when the response was diminishing).

Secretion of Gelatinases by Normal and Injured Carotid Artery Explants
To investigate whether balloon injury increased gelatinase secretion, we used the explant technique developed in our previous studies of rabbit aorta.11 Medial explants from uninjured or balloon-injured pig carotid arteries were cultured for 3 days in serum-free media, which were then subjected to gelatin zymography. Conditioned media from balloon-injured tissue revealed major bands of gelatinase activity with molecular masses of 68, 72, and 95 kD (Fig 1aDown) and minor bands of 116 and 205 kD. If the explants were heated to 60°C before incubation or treated throughout with 100 µmol/L cycloheximide, no bands of gelatinase activity were detected (data not shown), demonstrating that the gelatinolytic activities in the conditioned medium arose through new synthesis. These activities were inhibited by EDTA but not by N-ethylmaleimide, PMSF, or pepstatin-A (Fig 1aDown). They were also concentration-dependently inhibited by the specific synthetic inhibitors of MMPs, Ro 31-9790 and Ro 31-4724 (Fig 1bDown). These experiments identify the gelatinolytic activities observed by zymography as MMPs. Immunoprecipitation with antibodies to purified pig gelatinase B completely removed the 205-, 116-, and 95-kD bands without affecting the 72- or 68-kD bands (Fig 1cDown). To identify whether the gelatinase B activity resulted from the pro form or activated enzyme, samples of conditioned media were treated with activated human stromelysin, which in control experiments completely activated purified human progelatinase B but not progelatinase A (data not shown). This is in accordance with published data.27 Under the conditions chosen, incubation of explant-conditioned media with active stromelysin led to partial conversion of the 95-kD band to an 88-kD band but did not affect the 72- or 68-kD bands (Fig 1dDown). These experiments indicate clearly that the 95-kD band results from the pro form of gelatinase B. The 205- and 116-kD forms were not investigated further but clearly represent complexes containing gelatinase B. They were immunoprecipitated by antibodies to gelatinase B, their activity was observed under the same conditions that stimulated activity of the 95-kD gelatinase B band (see Fig 2Down), and they were also observed when an expression vector containing the gelatinase B sequence was transfected into COS cells (A.H. Baker and A.C. Newby, unpublished data, 1996). The 72- and 68-kD bands were progressively, although not completely, immunoprecipitated by increasing amounts of antibodies to human gelatinase A, whereas the 95-kD band was not affected (Fig 1cDown). A subsequent immunoprecipitation with antibodies to pig gelatinase B again removed the 95-kD band but did not affect the residual activity at 72- or 68-kD bands. These data show that the 68- and 72-kD bands are largely derived from the pro and active forms of gelatinase A (MMP-2). The residual activity after immunoprecipitation does not apparently derive from gelatinase B but probably results from the limited ability of anti-human gelatinase A antibodies to immunoprecipitate the homologous pig protein.





View larger version (182K):
[in this window]
[in a new window]
 
Figure 1. Characterization of gelatinase activities. Pooled serum-free conditioned media (10 µL) from explant cultures of balloon-injured segments were subjected to gelatin zymography. a, Class-specific protease inhibitors. Strips of gel were incubated with 0.5% DMSO vehicle and high molecular weight markers (lane 1), vehicle alone (lane 2), 5 mmol/L N-ethylmaleimide (lane 3), 1 mmol/L PMSF (lane 4), 5 mmol/L pepstatin A (lane 5), and 20 mmol/L EDTA (lane 6). b, Specific MMP inhibitors. Strips of gel were incubated with 0.5% DMSO vehicle and high molecular weight markers (lane 1), vehicle alone (lane 2), 0.1 µmol/L Ro 31-9790, 1.0 µmol/L Ro 31-9790 (lane 4), 10 µmol/L Ro 31-9790 (lane 5), and 10 µmol/L Ro 31-4724 (lane 6). c, Immunoprecipitation. To identify the gelatinases positively, the same pooled samples shown in panel a were immunoprecipitated with anti-gelatinase antibodies or nonimmune globulin, and the supernatants were subjected to zymography. Lanes 1 through 5 show the 3-day pool: 1, 50 µg nonimmune globulin; 2, 50 µg anti–gelatinase B; 3, 50 µg anti–gelatinase A; 4, 100 µg anti–gelatinase A; and 5, 50 µg anti–gelatinase A plus 50 µg anti–gelatinase B. Lanes 6 through 10 show the same conditions for the 7-day pool. d, Identification of progelatinase B. Pooled samples of conditioned medium from injured tissue obtained 3 or 7 days after balloon injury were incubated with or without activated stromelysin-1 so as to activate the pro form of gelatinase B. Lanes are as follows: 1, 3-day pool with stromelysin; 2, 3-day pool without stromelysin; 3, 7-day pool with stromelysin; and 4, 7-day pool without stromelysin. Each panel shows a representative of three similar experiments.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 2. Measurement of gelatinase activity in conditioned media using zymography. In pigs, both carotid arteries were subjected to balloon injury. Segments proximal to, within, and distal to the balloon-injured area were taken 3 days (n=6) (a), 7 days (n=8) (b), or 21 days (n=6) (c) later; balloon-injured segments were further divided into four equal portions. Segments were also taken from uninjured vessels (n=7) of other pigs that had not been subjected to balloon injury. Medial explants were prepared from each segment as described in "Materials and Methods" and cultured in serum-free medium for 3 days. Conditioned media were subjected to gelatin zymography. Samples (10 µL) of conditioned media from medial explants were applied as follows: lane 1, proximal control; lanes 2 to 5, balloon-injured tissue; lane 6, distal control; and lane 7, uninjured control tissue. Each panel shows a representative of six to eight similar experiments.

An important aspect of our experimental design was that secretion of gelatinases was compared directly in explants from proximal, balloon-injured, and distal tissue from the same arteries, thereby allowing paired statistical analysis of the data obtained. Conditioned media of explants from segments of the same carotid artery proximal to, within, and distal to the site of balloon injury were subjected to zymography in the same gels (Fig 2Up). The activity of both gelatinase A and B was increased in the balloon-injured segments compared with distal uninjured segments (Fig 2Up). These differences were found to be significant by paired analysis of densitometric scans 3, 7, or 21 days after balloon injury (Fig 3Down). Balloon-injured segments also secreted greater gelatinase A and B activity than did paired proximal segments 3 and 21 days after injury. However, proximal segments secreted gelatinase A and B activity similar to that of paired injury segments after 7 days (Fig 3Down), possibly as a result of response to injury caused by passage of the uninflated balloon. Histological examination confirmed that these segments had suffered partial endothelial denudation and occasional medial injury (results not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Densitometry of zymograms for conditioned media. The zymograms referred to in Fig 2Up were subjected to densitometry. Proximal, balloon-injured, and distal samples from the same vessel at 3, 7, or 21 days after balloon injury were always compared on the same zymograms, which also usually contained a day 0 (uninjured) control sample. Units for transmission were optical densityxmm2. The mean value for the four injured segments was used for statistical analysis. The data from six to eight different vessels were then subjected to statistical analysis using the Wilcoxon signed rank test for pairs. Unpaired data for different time points were compared by use of the Wilcoxon test and by ANOVA, both of which yielded similar conclusions. *P<.05 vs distal on the same day. {dagger}P<.05 proximal vs injury on the same day.

We also conducted less powerful unpaired analysis of samples taken from within the site of balloon injury of different animals killed 3, 7, and 21 days later. Both gelatinase activities were elevated at 3 and 7 days after injury and then declined significantly (P<.05) by 21 days (Fig 3Up). The gelatinase activities in distal segments after 21 days actually fell significantly (P<.05) below those for uninjured tissue (Fig 3Up). Gelatinase activities released from segments 7 days after balloon injury were significantly (P<.05) greater than from samples of uninjured arteries taken from animals that had not been subjected to balloon catheterization (Fig 3Up).

The DNA concentration was measured to control for differences in cell numbers within the explants. DNA concentrations in explants from vessels subjected to angioplasty were not significantly different from values in explants from uninjured arteries (23±5 µg/24 explants) or between paired proximal, balloon-injured, and distal segments for any time point (data not shown). Therefore, the differences in gelatinase activity observed represent differences in the level of secretion per cell. DNA concentrations were significantly increased after 21 days in the injured segments (49±3 µg/24 explants, P<.001), possibly because of neointimal formation. These differences amplify the fall in gelatinase secretion per cell between 7 and 21 days after balloon injury.

Levels of Gelatinases in Carotid Artery Tissue
A similar pattern of changes in gelatinase levels was observed in extracts of carotid artery tissues (Fig 4Down). Densitometric scanning of these zymograms revealed that gelatinase B activity was significantly greater in the injury segments compared with either paired distal or paired proximal segments 3, 7, and 21 days after balloon injury (Fig 5aDown). Increased levels of gelatinase B activity compared with normal carotid artery tissue were observed by unpaired analysis 3 days after balloon injury (P<.025) (Fig 5aDown). Gelatinase B activity declined in all segments 21 days after angioplasty (Fig 5aDown). These data corroborate the findings for gelatinase B secretion in the explant model.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. Measurement of gelatinase activity in tissue extracts using zymography. In pigs, both carotid arteries were subjected to balloon injury. Segments proximal to, within, and distal to the balloon-injured area were taken 3, 7, or 21 days later (n=6 each). Gelatinase activity was extracted by homogenization in a buffer, as described in "Materials and Methods." Extracts equivalent to 1 mg wet weight of tissues were subjected to gelatin zymography as follows: lanes 1 through 3, 3 days for proximal, balloon-injured, and distal, respectively; lanes 4 through 6, 7 days for proximal, balloon-injured, and distal, respectively; lanes 7 through 9, 21 days for proximal, balloon-injured, and distal, respectively; and lane 10, uninjured control tissue. Each panel shows a representative of six similar experiments.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Densitometry of zymograms for tissue extracts. The zymograms referred to in Fig 4Up were subjected to densitometry. Proximal, balloon-injured, and distal samples from the same vessel at either 3, 7, or 21 days after balloon injury were always compared on the same zymograms, which also usually contained a day 0 (uninjured) control sample. Units for transmission were optical densityxmm2. The data from six different vessels were then subjected to statistical analysis using the Wilcoxon signed rank test for pairs. Unpaired data for different time points were compared by use of the Wilcoxon test and by ANOVA, both of which yielded similar conclusions. *P<.05 vs distal on the same day. {dagger}P<.05 proximal vs injury on the same day.

Paired analysis also revealed significant increases in gelatinase A levels in injury versus distal segments 7 and 21 days after angioplasty, with a similar trend on day 3 (Fig 5bUp). When less powerful unpaired analysis was used, the increased levels of gelatinase A observed in the injured tissues 3, 7, and 21 days after angioplasty were not significant compared with levels in uninjured arteries taken from animals that had not been subjected to balloon angioplasty (Fig 5bUp). In addition, as observed with the conditioned media, the levels of gelatinase A from the tissue extracts of distal segments after 21 days also declined below those for uninjured tissues. In conclusion, the data from extracted tissue closely corresponded to that from the conditioned media, although the statistical fluctuations were greater in the extracts.

Expression and Location of Gelatinase mRNA
The expression and cellular source of gelatinase synthesis was analyzed by in situ hybridization. mRNAs for gelatinase A and B were not detectable in sections from seven uninjured vessels (Figs 6aDown and 7a) but were detected in the neointima and media of every vessel segment obtained 3 or 7 days after balloon injury (Figs 6, 7b, and 7cDownDownDown). To demonstrate specificity of hybridization, pretreatment with ribonuclease or unlabeled probe was found to abolish the labeling (results not shown), whereas use of the corresponding sense sequences failed to yield hybridization (Fig 8Down). At 3 and 7 days after balloon injury, all of the intimal cells and most of the medial cells were identified by immunocytochemistry as SMCs (Fig 9cDown). Gelatinase A and B mRNAs were expressed throughout the medial and neointimal SMCs (Fig 9a and 9bDownDown compared with 9c). Gelatinase B mRNA expression became undetectable in any of six segments analyzed 21 days after balloon injury (Fig 7dDown). In contrast, gelatinase A mRNA expression remained evident in the intimal and medial SMCs of all segments (Fig 6dDown). In Fig 6dDown, which shows an area of deep medial tearing and repair, gelatinase A expression was high in a population of surface cells (identified as endothelial cells by immunocytochemistry; see below), less prominent in the inner media, and more highly expressed in the deep media. A similar pattern was seen where neointimal formation took place over an intact internal elastic lamina (Fig 9d through 9fDown). Regenerated luminal endothelial cells (stained by DBA lectin [Fig 9eDown] but not by {alpha}-actin [Fig 9fDown]) highly expressed gelatinase A (Fig 9dDown). Neointimal SMCs, stained by {alpha}-actin, showed considerably less gelatinase A mRNA expression.



View larger version (122K):
[in this window]
[in a new window]
 
Figure 6. In situ hybridization for the 72-kD gelatinase A. Representative sections from four blocks, each taken from six to eight uninjured carotid arteries (a) or arteries obtained 3 days (b), 7 days (c), or 21 days (d) after balloon injury. The white arrows delineate the internal elastic lamina; the black arrow in panel d, a discontinuity in the internal elastic lamina; and n, area of necrosis within the media. The scale bar applies to all panels and represents 100 µm.



View larger version (108K):
[in this window]
[in a new window]
 
Figure 7. In situ hybridization for the 95-kD gelatinase B. Representative sections from four blocks, each taken from six to eight uninjured carotid arteries (a) or arteries obtained 3 days (b), 7 days (c), or 21 days (d) after balloon injury. The white arrows delineate the internal elastic lamina; the black arrow in panel d, a discontinuity in the internal elastic lamina; and n, area of necrosis within the media. The scale bar applies to all panels and represents 50 µm.



View larger version (124K):
[in this window]
[in a new window]
 
Figure 8. Controls for in situ hybridization. Sections of a carotid artery harvested 7 days after balloon injury were hybridized with 106 cpm of gelatinase B antisense RNA (a) gelatinase A antisense RNA (b), gelatinase B sense RNA (c), and gelatinase A sense RNA (d). Note that in the sense strand, control (c and d) hematoxylin-counterstained nuclei are prominent in the media and neointima. The white arrows delineate the internal elastic lamina. The scale bar applies to all panels and represents 50 µm.



View larger version (110K):
[in this window]
[in a new window]
 
Figure 9. Identification of cell types labeled by in situ hybridization. Sections of a carotid artery harvested 3 days after balloon injury (a through c) were hybridized with gelatinase B antisense RNA (a) or gelatinase A antisense RNA (b) or subjected to immunocytochemistry for smooth muscle {alpha}-actin (c). Sections of a carotid artery harvested 21 days after balloon injury (d through f) were hybridized with gelatinase A antisense RNA (d) or a cytochemical stain with DBA lectin for endothelium (e) or subjected to immunocytochemistry for smooth muscle {alpha}-actin (f). In all panels, the smaller arrows indicate the position of intimal SMCs, and the larger arrows indicate the position of endothelial cells. The white arrows delineate the internal elastic lamina. The scale bar applies to all panels and represents 50 µm.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Experiments in tissue culture using hydroxamic and phosphinic acid–based inhibitors show that MMPs are necessary for both maximal proliferation and migration of rabbit aortic SMCs.11 Furthermore, MMP inhibitors also prevent intimal migration of rat carotid artery SMCs after balloon injury in vivo.13 In rabbit SMCs, only gelatinases A and B are expressed in measurable quantities,11 which emphasize their role in modulating migration and proliferation in this model, which contains only SMCs. In the rat carotid artery, injury increases tissue levels of gelatinase B and activates gelatinase A,13 19 further implicating gelatinases in the response to injury. In the present study, we also investigated the expression of gelatinases after balloon injury, but in this case, a pig carotid artery model in which both deep medial tears and stretch-induced injury occur was used. Both types of injury are thought to be important in angioplasty restenosis in humans.34 Furthermore, we sought to investigate whether balloon injury led to an increased secretion of gelatinases as well as to confirm the effects on tissue levels. To do this, we used the model developed for the rabbit aorta, in which explants are allowed to condition medium, which was then analyzed by zymography.

On the basis of the kinetics of cell proliferation in the pig carotid model,33 we chose to study gelatinase secretion 3, 7, and 21 days after balloon injury. As in the rat, SMCs initially proliferate in the media and begin to migrate into the intima only after 3 days.33 The rates of medial and intimal cell proliferation judged by PCNA expression are maximum on day 7 and decline by 21 days after balloon injury.33 An important aspect of our experimental design was that secretion and tissue levels of gelatinases were compared directly in segments from proximal, balloon-injured, and distal tissue from the same arteries, thereby allowing paired statistical analysis of the data obtained. Comparison between different days or with uninjured vessels inevitably involved different animals and hence less powerful unpaired analysis. Our results demonstrate that balloon injury upregulated the secretion and tissue levels of both gelatinase A and B relative to paired distal segments. Upregulation of secretion was also apparent relative to paired proximal segments, except on day 7, when increased secretion also occurred in proximal tissue, accompanied by histological evidence of injury. Gelatinase A and B secretion from balloon-injured tissue was greater at 7 than at 21 days after balloon injury, coinciding with the time course of intimal PCNA labeling.

Tissue levels of gelatinase B showed the same pattern of changes in gelatinase B secretion as seen in the conditioned media from explants. This implies that increased synthesis is the main determinant of the accumulation of this protein. Allowing gelatinases to accumulate over 3 days using the explant method greatly increased their sensitivity of detection (compare Figs 3 and 5UpUp). However, the additional injury caused by the preparation of the explants, which we have documented previously,22 appeared to amplify both the basal level and stimulated levels of gelatinase B relative to gelatinase A (compare Figs 3 and 5UpUp). To allow for the influence of preparing explants, our experimental design involved direct comparison of explants from balloon-injured and uninjured tissues. The detection of increased gelatinase B mRNA by in situ hybridization also confirmed that balloon injury increased new synthesis of gelatinase B. Gelatinase B mRNA was expressed by intimal and medial SMCs 3 and 7 days after balloon injury but declined by 21 days, closely following the time course of cell proliferation and neointimal formation.

By paired analysis, significant increases in tissue gelatinase A levels were seen in injured versus distal portions on days 7 and 21, confirming the explant data. With the inevitably less powerful unpaired analysis, the increases in tissue gelatinase A levels 3 and 7 days after angioplasty were not significantly different from levels in uninjured tissues, although the decline in injured tissue at 21 days was confirmed (P<.05). The differences with the explant data most likely result from the greater variability of the tissue levels.

Expression of mRNA for gelatinase B became undetectable in injured vessels 21 days after balloon injury, despite the persistence of lower but detectable protein secretion. This probably results from differences in sensitivity of the two methods. Expression of mRNA for gelatinase A remained detectable by in situ hybridization in injured vessels 21 days after balloon injury, consistent with the continued high levels of protein secretion.

Our data show important similarities but also several apparent differences with data published for the rat carotid model. In both models, gelatinase B expression was extremely low in uninjured tissue but was increased after injury. Differing data has been presented for the time course of gelatinase B elevation in the rat, which was shown from representative examples to be prolonged for either only 1 day19 or for 14 days.13 Our quantitative comparisons in the pig showed that the increase in gelatinase B expression was prolonged for at least 7 days. We found the same 95-kD gelatinase B species in tissue extracts and conditioned media, where activation studies showed it to be progelatinase B. In contrast, gelatinase B species in the rat tissue extracts was said to be the active enzyme, although this was not directly demonstrated and there are differences in the molecular weights reported in the two published studies.13 19 This discrepancy and the possibility that the enzyme might become activated during extraction need to be clarified in the rat system before the apparent difference with the present study can be resolved. Our in situ hybridization studies of gelatinase B mRNA closely agreed with the time course of gelatinase B mRNA expression published for the rat model.13 Using human probes against pig RNA, we were unable to obtain sufficiently strong signals from Northern blots to confirm these data directly. Our probes do, however, produce the appropriate signals in Northern blots from human cells.35

We showed constitutive activity of gelatinase A in tissue extracts and conditioned media from uninjured pig carotid arteries, in agreement with data for the rat.13 19 In addition, we showed quantitative increases in the levels of gelatinase A after balloon angioplasty, which were not evident in the representative data shown for the rat carotid artery.13 19 Without quantitative comparisons for the rat, it is difficult to know whether the twofold change observed in our tissue extracts truly represents a discrepancy between the two models. However, there is agreement that a proportion of the gelatinase A is present in the active form. One of the further novel findings of the present study is that high levels of gelatinase A mRNA expression occur after balloon injury in endothelial cells. Indeed, regenerated endothelial cells showed higher levels of expression than neointimal SMCs. Previous studies have shown high levels of gelatinase A expression in cultured endothelial cells.36 In comparing the results of zymography and in situ hybridization, it is important to remember that these endothelial cells were removed during preparation of the explants.

Another novel feature of the present study is that we have localized gelatinase expression throughout the thickness of the media. Both gelatinases were highly expressed in the media at 3 days (especially around foci of cell necrosis), when few SMCs had yet migrated into the intima. Nevertheless, the highest levels of expression of either gelatinase A or B mRNA were in the few neointimal SMCs. At 7 days, gelatinase A and B mRNA was still highest in neointimal SMCs and around foci of medial necrosis. This implies that gelatinase expression was high both in cells migrating into the neointima and in cells migrating to repair the areas of medial necrosis. This conclusion is consistent with the finding that the tissue levels of gelatinases B are not increased by filament loop injury to the rat carotid artery,13 which causes less medial injury than balloon inflation.

The agents responsible for upregulating gelatinase activity after balloon injury are not defined. These might be derived from the circulation or from cells within the tissue. The secretion of gelatinase B from pig carotid artery explants that we report here directly demonstrates the presence of endogenous regulators within the injured tissue. The secretion of gelatinase B in cultured SMCs is inducible by agents including PDGF and interleukin-1,15 16 18 35 especially in combination.35 37 Increased expression of PDGF, in particular, has been associated with angioplasty38 and also with atherosclerosis39 and vein grafting.40 41 The patterns of gelatinase B induction observed after injury therefore probably reflect high local concentrations of growth factors and/or cytokines. Negative control of gelatinase B production, in particular by heparin,17 has also been described. We observed a decline in gelatinase B expression to below the values in uninjured arteries in distal segments of vessels 21 days after balloon injury. This implies the presence of negative regulators of gelatinase expression, which might include heparin.

The significant upregulation of gelatinase A secretion from explants and tissue extracts of balloon injured tissue was confirmed by in situ hybridization studies. These showed significant gelatinase A mRNA in all sections of injured arteries but no detectable mRNA in seven different uninjured carotid arteries. These results were unexpected because constitutive secretion of gelatinase A has been observed in cultures of rabbit and primate SMCs.11 17 18 However, such cultures lack glucocorticoids, which are natural repressors of gelatinase expression in vivo. Upregulation of gelatinase A can occur in response to transforming growth factor-ß, interleukin-1, and tumor necrosis factor-{alpha} in fibroblasts42 43 and renal mesangial cells.44 In any event, posttranslational activation of the pro form of gelatinase A is thought to be of greater importance in regulating the activity of this isoenzyme.45 Significant amounts of the active 68-kD form of the enzyme were demonstrated in the present study (Figs 3 and 5UpUp) as well as in the balloon-injured rat carotid artery.13 19

In conclusion, our results shows that secretion of gelatinase A and B was upregulated after balloon injury to the pig carotid artery. The majority of gelatinase B remained as the pro form, whereas active gelatinase A was readily detected. Increased expression of gelatinase A and B messages were found both in intimal SMCs and in medial cells, particularly around foci of medial necrosis. The time course of gelatinase expression paralleled that of medial cell proliferation and neointimal formation. These results are consistent with the hypothesis that gelatinases play a role in the migration and/or proliferation of SMCs that mediate neointimal formation after balloon injury.


*    Selected Abbreviations and Acronyms
 
DBA = Dolichos biflorous agglutinin
DMSO = dimethyl sulfoxide
MMP = metalloproteinase
PCNA = proliferating cell nuclear antigen
PCR = polymerase chain reaction
PDGF = platelet-derived growth factor
PMSF = phenylmethylsulfonyl fluoride
SMC = smooth muscle cell


*    Acknowledgments
 
This study was supported by grants from the Medical Research Council and the British Heart Foundation. We would like to acknowledge Mrs A. Williams for expert histological analysis and Mrs H.A. Cheadle for technical assistance with the animal work.

Received December 7, 1995; accepted September 18, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Clowes AW, Reidy MA, Clowes MM. Kinetics of cellular proliferation after arterial injury: smooth muscle growth in the absence of endothelium. Lab Invest.. 1983;49:327-333.[Medline] [Order article via Infotrieve]

2. Clowes AW, Clowes MM, Reidy MA. Kinetics of cellular proliferation after arterial injury, III: endothelial and smooth muscle growth in chronically denuded vessels. Lab Invest.. 1986;54:295-303.[Medline] [Order article via Infotrieve]

3. Waller BF, Pinkerton CA, Orr CM, Slack JD, VanTassel JW, Peters T. Restenosis 1 to 24 months after clinically successful coronary balloon angioplasty: a necropsy study of 20 patients. J Am Coll Cardiol. 1991;17(suppl B):58B-70B.

4. Ross R. Growth factors in the pathogenesis of atherosclerosis. Acta Med Scand. 1987;715(suppl):33-38.

5. Newby AC, George SJ. Proposed roles for growth factors in mediating smooth muscle proliferation in vascular pathologies. Cardiovasc Res.. 1993;27:1173-1183.[Free Full Text]

6. Lindner V, Lappi DA, Baird A, Majack RA, Reidy MA. Role of basic fibroblast growth factor in vascular lesion formation. Circ Res.. 1991;68:106-113.[Abstract/Free Full Text]

7. Jawien A, Bowen-Pope DF, Lindner V, Schwartz SM, Clowes AW. Platelet-derived growth factor promotes smooth muscle migration and intimal thickening in a rat model of balloon angioplasty. J Clin Invest.. 1992;89:507-511.

8. Fingerle J, Kraft T. The induction of smooth muscle cell proliferation in vitro using an organ culture system. Int Angiol.. 1987;6:65-72.[Medline] [Order article via Infotrieve]

9. Soyombo AA, Angelini GD, Bryan AJ, Newby AC. Surgical preparation induces injury and promotes smooth muscle cell proliferation in a culture of human saphenous vein. Cardiovasc Res.. 1993;27:1961-1967.[Abstract/Free Full Text]

10. Reidy MA, Silver M. Endothelial regeneration: lack of intimal proliferation after defined injury to rat aortas. Am J Pathol.. 1985;118:173-177.[Abstract]

11. Southgate KM, Davies M, Booth RFG, Newby AC. Involvement of extracellular matrix degrading metalloproteinases in rabbit aortic smooth muscle cell proliferation. Biochem J.. 1992;288:93-99.

12. Campbell JH, Black MJ, Campbell GR. Replication of smooth muscle cells in atherosclerosis and hypertension. In: Meyer P, Marche P, eds. Blood Cells and Arteries in Hypertension and Atherosclerosis. New York, NY: Raven Press Publishers; 1989:15-33.

13. Bendeck MP, Zempo N, Clowes AW, Gelardy RE, Reidy MA. Smooth muscle cell migration and matrix metalloproteinase expression after arterial injury in the rat. Circ Res.. 1994;75:539-545.[Abstract/Free Full Text]

14. Kishi J, Hayakawa T. Synthesis of latent collagenase and collagenase inhibitor by bovine aortic medial explants and cultured medial smooth muscle cells. Connect Tissue Res.. 1989;19:63-76.[Medline] [Order article via Infotrieve]

15. Yanagi H, Sasaguri Y, Sugama K, Morimatsu M, Nagasi H. Production of tissue collagenase (matrix metalloproteinase 1) by human aortic smooth muscle cells in response to platelet-derived growth factor. Atherosclerosis.. 1991;91:207-216.[Medline] [Order article via Infotrieve]

16. Evans CE, Georgescu HI, Lin C, Mendelow D, Steed DL, Webster MW. Inducible synthesis of collagenase and other neutral metalloproteinases by cells of aortic origin. J Surg Res.. 1991;51:399-404.[Medline] [Order article via Infotrieve]

17. Kenagy RD, Nikarri ST, Welgus HG, Clowes AW. Heparin inhibits the induction of three matrix metalloproteinases (stromelysin, 92-kDa gelatinase, and collagenase) in primate arterial smooth muscle cells. J Clin Invest.. 1994;93:1987-1993.

18. Galis ZS, Muszynski M, Sukhova GK, Simon-Morrissey E, Unemori EN, Lark MW, Amento E, Libby P. Cytokine-stimulated human vascular smooth muscle cells synthesize a complement of extracellular enzymes required for extracellular matrix degradation. Circ Res.. 1994;75:181-189.[Abstract/Free Full Text]

19. Zempo N, Kenagy RD, Au T, Bendeck M, Clowes MM, Reidy MA, Clowes AW. Matrix metalloproteinases of vascular wall cells are increased in balloon-injured rat carotid artery. J Vasc Surg.. 1994;20:209-217.[Medline] [Order article via Infotrieve]

20. Collier IE, Wilhelm SM, Eisen AZ, Marmer BL, Grant GA, Seltzer JL, Kronberger A, He C, Bauer EA, Goldberg GI. H-ras oncogene-transformed human bronchial epithelial cells (TBE-1) secrete a single metalloprotease capable of degrading basement membrane collagen. J Biol Chem.. 1988;263:6579-6587.[Abstract/Free Full Text]

21. Huhtala P, Tuuttila A, Chow LT, Lohi J, Keski-Oja J, Tryggvason K. Complete structure of human gene for 92-kDa type IV collagenase: divergent regulation of expression for the 92- and 72-kilodalton enzyme genes in HT-1080 cells. J Biol Chem.. 1991;266:16485-16490.[Abstract/Free Full Text]

22. Southgate KM, Newby AC. Serum-induced proliferation of rabbit aortic smooth muscle cells from the contractile state is inhibited by 8-Br-cAMP but not 8-Br-cGMP. Atherosclerosis.. 1990;82:113-123.[Medline] [Order article via Infotrieve]

23. Steele PM, Chesebro JH, Stanson AW, Holmes JRJ, DeWanjee MK, Badimon L, Fuster V. Balloon angioplasty: Natural history of the response to injury in a pig model. Circ Res.. 1985;57:105-112.[Abstract/Free Full Text]

24. Kissane JM, Robins E. The fluorimetric measurement of deoxyribonucleic acid in animal tissues with special reference to the central nervous system. J Biol Chem.. 1958;233:184-188.[Free Full Text]

25. Laemmli UK. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature.. 1970;227:680-685.[Medline] [Order article via Infotrieve]

26. Heussen C, Dowdle EB. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal Biochem.. 1980;102:196-202.[Medline] [Order article via Infotrieve]

27. O'Connell JP, Willenbrock F, Docherty AJP, Eaton D, Murphy G. Analysis of the role of the COOH-terminal domain in the activation, proteolytic activity and tissue inhibitor of metalloproteinase interactions of gelatinase B. J Biol Chem.. 1994;269:14961-14973.

28. Soyombo AA, Angelini GD, Bryan AJ, Jasani B, Newby AC. Intimal proliferation in an organ culture of human saphenous vein. Am J Pathol.. 1990;137:1401-1410.[Abstract]

29. Roussel F, Dalion J. Lectins as markers of endothelial cells: comparative study between human and animal cells. Lab Animals.. 1988;22:135-140.[Abstract/Free Full Text]

30. Galand P, Degraef C. Cyclin/PCNA immunostaining as an alternative to tritiated thymidine pulse labelling for marking S-phase cells in paraffin sections from animal and human tissues. Cell Tissue Kinet.. 1989;22:383-392.[Medline] [Order article via Infotrieve]

31. Soyombo AA, Thurston VJ, Newby AC. Endothelial control of vascular smooth muscle proliferation in an organ culture of human saphenous vein. Eur Heart J. 1993;14(suppl I):201-206.

32. Maddox PH, Jenkins D. 3-Aminopropyltriethoxysilane (APES): a new advance for section adhesion. J Clin Pathol.. 1987;40:1256-1260.[Free Full Text]

33. Groves P, Banning AP, Penny WJ, Lewis MJ, Cheadle HA, Newby AC. Kinetics of smooth muscle cell proliferation and intimal thickening in a pig model of balloon injury. Atherosclerosis.. 1995;117:83-96.[Medline] [Order article via Infotrieve]

34. Waller BF, Pinkerton CA, Orr CM, Slack JD, VanTassel JW, Peters T. Morphological observations late (>30 days) after clinically successful coronary balloon angioplasty. Circulation. 1991;83(suppl I):I-28-I-41.

35. Fabunmi RP, Bakjer AH, Murray EJ, Booth RFG, Newby AC. Divergent regulation by growth factors and cytokines of 95 kDa and 72 kDa gelatinases and tissue inhibitors of metalloproteinases-1, -2 and -3 in rabbit aortic smooth muscle cells. Biochem J.. 1996;315:335-342.

36. Hanemaaijer R, Koolwijk P, Le Clercq L, de Vrie WJA, van Hinsbergh VWM. Regulation of matrix metalloproteinase expression in human vein and microvascular endothelial cells: effects of tumour necrosis factor {alpha}, interleukin 1 and phorbol ester. Biochem J.. 1993;296:803-809.

37. Newby AC, Fabunmi RP, George SJ, Southgate KM, Banning AP, Thurston VJ, Williams A. Neointimal fibrosis in vascular pathologies: role of growth factors and metalloproteinases in vascular smooth muscle proliferation. J Exp Nephrol.. 1995;3:108-113.

38. Majesky MW, Reidy MA, Bowen-Pope DF, Hart CE, Wilcox JN, Schwartz SM. PDGF ligand and receptor gene expression during repair of arterial injury. J Cell Biol.. 1990;111:2149-2158.[Abstract/Free Full Text]

39. Ross R, Masuda J, Raines EW, Gown AM, Katsuda S, Sasahara M, Malden LT, Masuko H, Sato H. Localization of PDGF-B protein in macrophages in all phases of atherogenesis. Science.. 1990;248:1009-1012.[Abstract/Free Full Text]

40. Golden MA, Au YPT, Kirkman TR, Wilcox JN, Raines EW, Ross R, Clowes AW. Platelet-derived growth factor activity and mRNA expression in healing vascular grafts in baboons. J Clin Invest.. 1991;87:406-414.

41. Francis SE, Hunter S, Holt CM, Gadsdon PA, Rogers S, Duff GW, Newby AC, Angelini G. Release of platelet derived growth factor activity from arteriovenous by-pass grafts. J Thorac Cardiovasc Surg.. 1994;108:540-548.[Abstract/Free Full Text]

42. Overall CM, Wrana JL, Sodek J. Independent regulation of collagenase, 72-kDa progelatinase and metalloendoprotease inhibitor expression in human fibroblasts by transforming growth factor-ß. J Biol Chem.. 1989;264:1860-1869.[Abstract/Free Full Text]

43. Unemori E, Ehsani N, Wang M, Lee S, McGuire J, Amento EP. Interleukin-1 and transforming growth factor-{alpha}: synergistic stimulation of metalloproteinases, PGE2 and proliferation in human fibroblasts. Exp Cell Res.. 1994;210:166-171.[Medline] [Order article via Infotrieve]

44. Marti HP, McNeil L, Davies M, Martin J, Lovett DH. Homology cloning of rat 72 kDa type IV collagenase: cytokine and second messenger inducibility in glomerular mesangial cells. Biochem J.. 1993;291:441-446.

45. Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ, Birkedal-Hansen B, DeCarlo A, Engler JA. Matrix metalloproteinases: a review. Crit Rev Oral Biol Med.. 1993;4:197-250.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
A. Dwivedi, S. C. Slater, and S. J. George
MMP-9 and -12 cause N-cadherin shedding and thereby {beta}-catenin signalling and vascular smooth muscle cell proliferation
Cardiovasc Res, January 1, 2009; 81(1): 178 - 186.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Liang, E. Liu, Y. Yu, S. Kitajima, T. Koike, Y. Jin, M. Morimoto, K. Hatakeyama, Y. Asada, T. Watanabe, et al.
Macrophage Metalloelastase Accelerates the Progression of Atherosclerosis in Transgenic Rabbits
Circulation, April 25, 2006; 113(16): 1993 - 2001.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. C. Newby
Matrix metalloproteinases regulate migration, proliferation, and death of vascular smooth muscle cells by degrading matrix and non-matrix substrates
Cardiovasc Res, February 15, 2006; 69(3): 614 - 624.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. S. Perlstein and R. T. Lee
Smoking, Metalloproteinases, and Vascular Disease
Arterioscler. Thromb. Vasc. Biol., February 1, 2006; 26(2): 250 - 256.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y.-N. Liu, S.-L. Pan, C.-Y. Peng, J.-H. Guh, D.-M. Huang, Y.-L. Chang, C.-H. Lin, H.-C. Pai, S.-C. Kuo, F.-Y. Lee, et al.
YC-1 [3-(5'-Hydroxymethyl-2'-furyl)-1-benzyl Indazole] Inhibits Neointima Formation in Balloon-Injured Rat Carotid through Suppression of Expressions and Activities of Matrix Metalloproteinases 2 and 9
J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 35 - 41.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. C. Newby
Dual Role of Matrix Metalloproteinases (Matrixins) in Intimal Thickening and Atherosclerotic Plaque Rupture
Physiol Rev, January 1, 2005; 85(1): 1 - 31.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Zahradka, G. Harding, B. Litchie, S. Thomas, J. P. Werner, D. P. Wilson, and N. Yurkova
Activation of MMP-2 in response to vascular injury is mediated by phosphatidylinositol 3-kinase-dependent expression of MT1-MMP
Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2861 - H2870.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. Ferri, N. O. Carragher, and E. W. Raines
Role of Discoidin Domain Receptors 1 and 2 in Human Smooth Muscle Cell-Mediated Collagen Remodeling: Potential Implications in Atherosclerosis and Lymphangioleiomyomatosis
Am. J. Pathol., May 1, 2004; 164(5): 1575 - 1585.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. S. Haque, J. T. Fallon, J. J. Pan, M. B. Taubman, and P. C. Harpel
Chemokine receptor-8 (CCR8) mediates human vascular smooth muscle cell chemotaxis and metalloproteinase-2 secretion
Blood, February 15, 2004; 103(4): 1296 - 1304.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Jarvelainen, R. B. Vernon, M. D. Gooden, A. Francki, S. Lara, P. Y. Johnson, M. G. Kinsella, E. H. Sage, and T. N. Wight
Overexpression of Decorin by Rat Arterial Smooth Muscle Cells Enhances Contraction of Type I Collagen In Vitro
Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 67 - 72.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. B Jones, D. C Sane, and D. M Herrington
Matrix metalloproteinases: A review of their structure and role in acute coronary syndrome
Cardiovasc Res, October 1, 2003; 59(4): 812 - 823.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. M Aguilera, S. J George, J. L Johnson, and A. C Newby
Relationship between type IV collagen degradation, metalloproteinase activity and smooth muscle cell migration and proliferation in cultured human saphenous vein
Cardiovasc Res, June 1, 2003; 58(3): 679 - 688.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Asanuma, R. Magid, C. Johnson, R. M. Nerem, and Z. S. Galis
Uniaxial strain upregulates matrix-degrading enzymes produced by human vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1778 - H1784.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. N. Babapulle and M. J. Eisenberg
Coated Stents for the Prevention of Restenosis: Part I
Circulation, November 19, 2002; 106(21): 2734 - 2740.
[Full Text] [PDF]


Home page
Circ. Res.Home page
M.L.M. Lamfers, J.M. Grimbergen, M.C. Aalders, M.J. Havenga, M.R. de Vries, L.G.M. Huisman, V.W.M. van Hinsbergh, and P.H.A. Quax
Gene Transfer of the Urokinase-Type Plasminogen Activator Receptor-Targeted Matrix Metalloproteinase Inhibitor TIMP-1.ATF Suppresses Neointima Formation More Efficiently Than Tissue Inhibitor of Metalloproteinase-1
Circ. Res., November 15, 2002; 91(10): 945 - 952.
[Abstract] [Full Text] [PDF]


Home page
Vasc MedHome page
I. Loftus and M. Thompson
The role of matrix metalloproteinases in vascular disease
Vascular Medicine, May 1, 2002; 7(2): 117 - 133.
[Abstract] [PDF]


Home page
Circ. Res.Home page
Z. S. Galis and J. J. Khatri
Matrix Metalloproteinases in Vascular Remodeling and Atherogenesis: The Good, the Bad, and the Ugly
Circ. Res., February 22, 2002; 90(3): 251 - 262.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. H. Baker, D. R. Edwards, and G. Murphy
Metalloproteinase inhibitors: biological actions and therapeutic opportunities
J. Cell Sci., January 10, 2002; 115(19): 3719 - 3727.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. S. Cherr, S. J. Motew, J. A. Travis, J. Fingerle, L. Fisher, M. Brandl, J. K. Williams, and R. L. Geary
Metalloproteinase Inhibition and the Response to Angioplasty and Stenting in Atherosclerotic Primates
Arterioscler. Thromb. Vasc. Biol., January 1, 2002; 22(1): 161 - 166.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Sartore, A. Chiavegato, E. Faggin, R. Franch, M. Puato, S. Ausoni, and P. Pauletto
Contribution of Adventitial Fibroblasts to Neointima Formation and Vascular Remodeling: From Innocent Bystander to Active Participant
Circ. Res., December 7, 2001; 89(12): 1111 - 1121.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. A. Kingston, S. Sinha, A. David, M. G. Castro, P. R. Lowenstein, and A. M. Heagerty
Adenovirus-Mediated Gene Transfer of a Secreted Transforming Growth Factor-{beta} Type II Receptor Inhibits Luminal Loss and Constrictive Remodeling After Coronary Angioplasty and Enhances Adventitial Collagen Deposition
Circulation, November 20, 2001; 104(21): 2595 - 2601.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Bond, A. J Chase, A. H Baker, and A. C Newby
Inhibition of transcription factor NF-{kappa}B reduces matrix metalloproteinase-1, -3 and -9 production by vascular smooth muscle cells
Cardiovasc Res, June 1, 2001; 50(3): 556 - 565.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Vieillard-Baron, E. Frisdal, S. Eddahibi, I. Deprez, A. H. Baker, A. C. Newby, P. Berger, M. Levame, B. Raffestin, S. Adnot, et al.
Inhibition of Matrix Metalloproteinases by Lung TIMP-1 Gene Transfer or Doxycycline Aggravates Pulmonary Hypertension in Rats
Circ. Res., September 1, 2000; 87(5): 418 - 425.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Mavromatis, T. Fukai, M. Tate, N. Chesler, D. N. Ku, and Z. S. Galis
Early Effects of Arterial Hemodynamic Conditions on Human Saphenous Veins Perfused Ex Vivo
Arterioscler. Thromb. Vasc. Biol., August 1, 2000; 20(8): 1889 - 1895.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B. J. G. L. de Smet, D. de Kleijn, R. Hanemaaijer, J. H. Verheijen, L. Robertus, Y. J. M. van der Helm, C. Borst, and M. J. Post
Metalloproteinase Inhibition Reduces Constrictive Arterial Remodeling After Balloon Angioplasty : A Study in the Atherosclerotic Yucatan Micropig
Circulation, June 27, 2000; 101(25): 2962 - 2967.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. L. Song, J. W. Ford, D. Gordon, and C. J. Shanley
Regulation of Lysyl Oxidase by Interferon-{gamma} in Rat Aortic Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., April 1, 2000; 20(4): 982 - 988.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Hou, D. Mulholland, M. A. Gronska, and M. P. Bendeck
Type VIII Collagen Stimulates Smooth Muscle Cell Migration and Matrix Metalloproteinase Synthesis after Arterial Injury
Am. J. Pathol., February 1, 2000; 156(2): 467 - 476.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. J. George, C. T. Lloyd, G. D. Angelini, A. C. Newby, and A. H. Baker
Inhibition of Late Vein Graft Neointima Formation in Human and Porcine Models by Adenovirus-Mediated Overexpression of Tissue Inhibitor of Metalloproteinase-3
Circulation, January 25, 2000; 101(3): 296 - 304.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. R. Lijnen, P. Soloway, and D. Collen
Tissue Inhibitor of Matrix Metalloproteinases-1 Impairs Arterial Neointima Formation After Vascular Injury in Mice
Circ. Res., December 3, 1999; 85(12): 1186 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Johnson and A. Knox
Autocrine production of matrix metalloproteinase-2 is required for human airway smooth muscle proliferation
Am J Physiol Lung Cell Mol Physiol, December 1, 1999; 277(6): L1109 - L1117.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. M. Southgate, D. Mehta, M. B. Izzat, A. C. Newby, and G. D. Angelini
Increased Secretion of Basement Membrane–Degrading Metalloproteinases in Pig Saphenous Vein Into Carotid Artery Interposition Grafts
Arterioscler. Thromb. Vasc. Biol., July 1, 1999; 19(7): 1640 - 1649.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. B. Rajavashisth, X.-P. Xu, S. Jovinge, S. Meisel, X.-O. Xu, N.-N. Chai, M. C. Fishbein, S. Kaul, B. Cercek, B. Sharifi, et al.
Membrane Type 1 Matrix Metalloproteinase Expression in Human Atherosclerotic Plaques : Evidence for Activation by Proinflammatory Mediators
Circulation, June 22, 1999; 99(24): 3103 - 3109.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. M. Dollery, S. E. Humphries, A. McClelland, D. S. Latchman, and J. R. McEwan
Expression of Tissue Inhibitor of Matrix Metalloproteinases 1 by Use of an Adenoviral Vector Inhibits Smooth Muscle Cell Migration and Reduces Neointimal Hyperplasia in the Rat Model of Vascular Balloon Injury
Circulation, June 22, 1999; 99(24): 3199 - 3205.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Shi, S. Patel, R. Niculescu, W. Chung, P. Desrochers, and A. Zalewski
Role of Matrix Metalloproteinases and Their Tissue Inhibitors in the Regulation of Coronary Cell Migration
Arterioscler. Thromb. Vasc. Biol., May 1, 1999; 19(5): 1150 - 1155.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. M. Dollery, J. R. McEwan, M. Wang, Q. A. Sang, Y. E. Liu, and Y. E. Shi
TIMP-4 Is Regulated by Vascular Injury in Rats
Circ. Res., March 19, 1999; 84(5): 498 - 504.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Kranzhofer, A. H. Baker, S. J. George, and A. C. Newby
Expression of Tissue Inhibitor of Metalloproteinase-1, -2, and -3 During Neointima Formation in Organ Cultures of Human Saphenous Vein
Arterioscler. Thromb. Vasc. Biol., February 1, 1999; 19(2): 255 - 265.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. C Newby and A. B Zaltsman
Fibrous cap formation or destruction -- the critical importance of vascular smooth muscle cell proliferation, migration and matrix formation
Cardiovasc Res, February 1, 1999; 41(2): 345 - 360.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Cheng, G. Mantile, R. Pauly, C. Nater, A. Felici, R. Monticone, C. Bilato, Y. A. Gluzband, M. T. Crow, W. Stetler-Stevenson, et al.
Adenovirus-Mediated Gene Transfer of the Human Tissue Inhibitor of Metalloproteinase-2 Blocks Vascular Smooth Muscle Cell Invasiveness In Vitro and Modulates Neointimal Development In Vivo
Circulation, November 17, 1998; 98(20): 2195 - 2201.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. P. Fabunmi, G. K. Sukhova, S. Sugiyama, and P. Libby
Expression of Tissue Inhibitor of Metalloproteinases-3 in Human Atheroma and Regulation in Lesion-Associated Cells : A Potential Protective Mechanism in Plaque Stability
Circ. Res., August 10, 1998; 83(3): 270 - 278.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. S. Bassiouny, R. H. Song, X. F. Hong, A. Singh, H. Kocharyan, and S. Glagov
Flow Regulation of 72-kD Collagenase IV (MMP-2) After Experimental Arterial Injury
Circulation, July 14, 1998; 98(2): 157 - 163.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. M. Jenkins, M. T. Crow, C. Bilato, Y. Gluzband, W.-S. Ryu, Z. Li, W. Stetler-Stevenson, C. Nater, J. P. Froehlich, E. G. Lakatta, et al.
Increased Expression of Membrane-Type Matrix Metalloproteinase and Preferential Localization of Matrix Metalloproteinase-2 to the Neointima of Balloon-Injured Rat Carotid Arteries
Circulation, January 13, 1998; 97(1): 82 - 90.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. J. George, J. L. Johnson, G. D. Angelini, and J. Y. Jeremy
Short-term Exposure to Thapsigargin Inhibits Neointima Formation in Human Saphenous Vein
Arterioscler. Thromb. Vasc. Biol., November 1, 1997; 17(11): 2500 - 2506.
[Abstract] [Full Text]


Home page
Cardiovasc ResHome page
A. H Baker, D. Mehta, S. J George, and G. D Angelini
Prevention of vein graft failure: potential applications for gene therapy
Cardiovasc Res, September 1, 1997; 35(3): 442 - 450.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Southgate, K. M.
Right arrow Articles by Newby, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Southgate, K. M.
Right arrow Articles by Newby, A. C.