Articles |
the Departments of Pharmacology and Cell Biophysics (G.C., W.L., J.P.S., C.T., M.A.M., I.L.G., E.G.K.) and Pathology & Laboratory Medicine (G.P.B.), University of Cincinnati (Ohio); the Center for Anesthesiology Research (W.E.S., C.S.M.), Cleveland (Ohio) Clinic Foundation; and the NMR Laboratory for Physiological Chemistry (M.S., K.W.S., J.S.I.), Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Mass.
Correspondence to Evangelia G. Kranias, PhD, Department of Pharmacology & Cell Biophysics, University of Cincinnati College of Medicine, PO Box 670575, Cincinnati, OH 45267-0575.
| Abstract |
|---|
|
|
|---|
Key Words: phospholamban sarcoplasmic reticulum Ca2+ stores nuclear magnetic resonance mitochondrial enzymes
| Introduction |
|---|
|
|
|---|
Although the physiological role of phospholamban is highly suggestive from the gene-targeting studies, it is not presently clear whether cardiac compensatory mechanisms accompanied phospholamban ablation to accommodate the enhanced SR Ca2+-ATPase activity. Such underlining compensatory mechanisms could play an important role in the phenotype observed and compromise or contribute to the biochemical and physiological effects of phospholamban ablation on SR function and myocardial contractility. Thus, the present study was designed to investigate whether molecular cross talk among genes or cellular compartments occurred in the phospholamban-deficient mouse hearts in order to accommodate the functional consequences of the missing gene product and maintain Ca2+ homeostasis in the cardiomyocyte. The contraction and relaxation cycle of the myocardium is regulated by the intracellular free Ca2+ concentration, which, in turn, is controlled primarily by the release and reuptake of Ca2+ by the SR. Therefore, the primary candidates for compensatory changes upon ablation of phospholamban could involve the SR Ca2+-cycling proteins, such as the Ca2+-ATPase, which transports Ca2+ into the SR lumen during muscle relaxation,6 calsequestrin, which acts as a Ca2+ buffer or store in the lumen of the SR,7 and the ryanodine receptor, which releases Ca2+ from the SR during muscle contraction.6 8 Other important candidates in the regulation of Ca2+ cycling in the myocardium are the sarcolemmal Na+-Ca2+ exchanger, which also participates in the regulation of cytosolic Ca2+ levels during excitation-contraction coupling.9 10 Besides the Ca2+-cycling proteins, the contractile proteins, myosin and actin, are known to play a major role in controlling muscle contractile properties. Thus, alterations in the expression levels of their genes could potentially contribute to the functional changes observed in phospholamban-deficient hearts. In addition, alterations in myocardial energetics and the activities of key enzymes involved in the regulation of ATP synthesis may also serve as important compensatory mechanisms for supporting the enhanced SR Ca2+-ATPase in these hyperdynamic hearts. Therefore, the phospholamban-deficient heart provides a unique model for examining chronic compensatory adaptations in ATP content and turnover to meet increases in contractility and energy demand.
| Materials and Methods |
|---|
|
|
|---|
Morphological Studies
Histological evaluation was performed on the heart and aorta of two control and two phospholamban-deficient mice. The tissues were fixed in 10% formalin, dehydrated through graded alcohols, and embedded in paraffin.11 Longitudinal sections (5 µm) of the heart (cut at 50-µm intervals) were stained with hematoxylin and eosin. Longitudinal sections were made to demonstrate all four heart chambers and valves. Hearts were examined for hypertrophy, hyperplasia, inflammation, septal defects, necrosis, mineralization, fibrosis, and milder changes, such as nuclear pyknosis, cytoplasmic vacuolization, and altered cell orientation.
Northern Blot Analysis
Total RNA was prepared from whole hearts by the use of the guanidinium thiocyanate extraction procedure, based on the single-step method developed by Chomczynski and Sacchi.12 Total RNA was analyzed by either Northern blot or dot blot hybridization assays. Total RNA (10 µg) was heated at 60°C for 5 minutes, size-fractionated on 0.8% agarose gels containing 2.2 mol/L formaldehyde, and transferred onto gene screen membranes according to the method described by Sambrook et al.13 The membranes were baked at 80°C under vacuum for 2 hours. Baked membranes were prehybridized for 2 hours and then hybridized overnight at 42°C with either random-primed cDNA probes or synthetic oligonucleotide probes, which were end-labeled using [
-32P]ATP (Amersham) and T4 polynucleotide kinase. After hybridization, the membranes were washed with 0.5x SSC and 1% SDS at 60°C for 30 minutes. Washed membranes were then exposed in cassettes to a PhosphorImager screen (Molecular Dynamics) and to x-ray film for autoradiography. Northern blot analysis was used to confirm the specificities of the synthesized oligonucleotide and cDNA probes used in this study and to determine the relative levels of Na+-Ca2+ exchanger mRNA.
Dot Blot Analysis
For dot blot analysis, 10 µg total RNA was heated at 60°C for 5 minutes and rapidly cooled on ice. Twofold serial dilutions of the RNAs were applied to gene screen membranes using a Bio-Rad dot blot filtration apparatus. The membranes were subsequently baked at 80°C for 2 hours under vacuum. Baked membranes were sequentially prehybridized for 1 to 2 hours at 42°C and then hybridized to specific oligonucleotide probes at 42°C for 16 hours. Hybridizations were performed in 5x SSPE, 1% SDS, 100 µg/mL denatured salmon sperm DNA, 50% deionized formamide, and 5x Denhardt's solution. The membranes were washed three times for 10 minutes each, sealed in plastic, and exposed to x-ray film and to a PhosphorImager screen as described above for Northern blots. The final washing conditions were as follows: 1% SDS and 0.5x SSC at 60°C for
-myosin heavy chain, ß-myosin heavy chain,
-cardiac actin,
-skeletal actin, and SR Ca2+-ATPase; 1% SDS and 0.5x SSC at 45°C for cardiac troponin I; and 0.1% SDS and 1x SSC at 45°C for calsequestrin. The probes were end-labeled using [
-32P]ATP and T4 polynucleotide kinase. Radiolabeling by this method was used for quantification, since it ensured that each molecule of probe carried only a single label. 18S mRNA was also used as an internal standard to correct for variations in RNA sample loading and blotting efficiency. The hybridized blots were subsequently rehybridized by identical methodology with a
-32P end-labeled 60-base oligonucleotide, antisense to a portion of the murine 18S gene. The radiolabeled 18S probe was used as a tracer mixed with excess cold 18S oligonucleotide. 18S hybridized blots were washed and exposed to both PhosphorImager screen and autoradiography. In all cases, the relative mRNA levels were quantified by laser densitometry using a PhosphorImager, and the densitometric scores of specific mRNAs were normalized to those of 18S mRNA. The autoradiographs were exposed to Kodak X-Omat film using an intensifying screen at -80°C.
Synthesis of Oligonucleotide Probes
The probes for
-myosin heavy chain, ß-myosin heavy chain,
-cardiac actin,
-skeletal actin, and the 18S ribosomal RNA were end-labeled synthetic oligonucleotides as previously described.14 15 The probe for cardiac troponin I was a 60-mer synthetic end-labeled oligonucleotide based on the mouse troponin I cDNA sequence (a generous gift from Dr R.J. Solaro, University of Illinois at Chicago): 5'CACTCTTCGGAGGGTGGGCCGCTTAAACTTGCCACGGAGGTCATAGATCTTCTGGGTCAG3'.
The probe for the SR Ca2+-ATPase was generated using polymerase chain reaction methodology and was based on a cDNA fragment of the murine SERCA2a gene corresponding to its unique 3'-untranslated region. Previous findings16 have demonstrated that SERCA2a differs from SERCA2b through alternative splicing of exons encoding the C-terminal and 3'-untranslated regions. This alternative splicing results in the addition of four amino acids at the C-terminal of SERCA2a, which are subsequently replaced with 50 amino acids to generate SERCA2b. Thus, we designed an oligonucleotide specific for SERCA2a based on the DNA sequence for the rat isoform,16 which corresponds to the splicing junction. This oligonucleotide (5'GAGCCTGCATACTGGAG3') was used in conjunction with an oligonucleotide dT (15 bases) as primers to amplify a cDNA fragment encoding the C-terminal and 3'-untranslated region of the mouse SERCA2a isoform, using polymerase chain reaction methodology. Briefly, first-strand synthesis was carried out as previously described17 using 10 µg of adult cardiac total RNA and 0.5 µg of the oligonucleotide dT primer. The polymerase chain reaction product was gel-purified, cloned into pBluescript SK(-), and transformed into XL-1 Blue cells. Double-stranded DNA sequence analysis was performed. After verification of clone identity, a 60-mer oligonucleotide (5'AGGTGTGTTGCTAACAACGCAGATGCACGCACCCGAACACCCTTATATTTCTGCAAATGG3') corresponding to the proximal 3'-untranslated region of the mouse SERCA2a gene was synthesized, end-labeled, and used to quantify SR Ca2+-ATPase mRNA levels in the present study. Northern blot analysis of total RNA from cardiac (Fig 1
) and soleus tissues revealed the presence of a single mRNA species that migrated at 4.5 kb, consistent with the findings on SERCA2a in rat heart. This mRNA species was not detected in mouse liver, kidney, or stomach, which was consistent with previous findings involving the expression of the SERCA2b isoform in these tissues.16
|
The probe for cardiac calsequestrin was also a 60-mer synthetic oligonucleotide and was based on the rabbit cardiac calsequestrin cDNA sequence.18 The synthetic oligonucleotide had the following sequence: 5'AGCCGGCGTAGAGTGGGTCTCTGGTGCTCCTTCACAAACTCCACGAGCTCCTCTTCCGTG3'. This probe as well as the rabbit cardiac calsequestrin cDNA (a gift from Dr Muthu Periasamy, Department of Internal Medicine, University of Cincinnati College of Medicine) recognized a single
2.5-kb species on Northern blots of mouse cardiac RNA (Fig 1
).
The guinea pig cardiac Na+-Ca2+ exchanger cDNA (a gift from Dr Kenneth D. Philipson, Cardiovascular Research Laboratories, UCLA School of Medicine) also recognized a single mRNA species of
7 kb on Northern blots of mouse cardiac RNA (Fig 1
), and this cDNA was used to quantify the levels of Na+-Ca2+ exchanger expression in mouse hearts.
Quantitative Immunoblotting
Quantitative immunoblotting of cardiac homogenates from wild-type and phospholamban-deficient mice was used to determine the protein levels of the SR Ca2+-ATPase, ryanodine receptor, calsequestrin, myosin, actin, troponin T, and troponin I. Pooled homogenates of six hearts were prepared from either the wild-type or phospholamban-deficient mice and used for subsequent experiments. To determine protein levels for the SR Ca2+-ATPase, the homogenates (3, 6, 12, and 24 µg) were electrophoretically separated on a 13% SDS-polyacrylamide gel and blotted to a 0.22-µm nitrocellulose membrane (Schleicher & Schuell) as previously described.19 The membrane was incubated with polyclonal rabbit antibody to SERCA2 (1:500), washed, and then incubated with an alkaline phosphataseconjugated anti-rabbit secondary antibody (Cappel Division of Organon Teknika) at a 1:500 dilution. After they were washed, the membranes were developed using nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (GIBCO-BRL Life Technologies) and quantified using ImageQuant software (Molecular Dynamics). To determine protein levels for the ryanodine receptor, the homogenates (15, 20, 25, 30, and 35 µg) were diluted 1:1 in SDS sample buffer (100 mmol/L Tris-HCl, pH 6.8, 40% glycerol, 2% ß-mercaptoethanol, and a trace of bromophenol blue) and incubated on ice for 1 to 2 hours before electrophoresis. The homogenates were separated by SDS-PAGE on 6% gels and transferred to 0.45-µm nitrocellulose membranes (Bio-Rad Laboratories). Transfer was performed at 4°C overnight at 253 mA in 192 mmol/L glycine, 25 mmol/L Tris, 0.0006% SDS, and 0.5% methanol with a buffer change after 4 to 5 hours. After transfer, the membranes were blocked in a solution of 5% nonfat dried milk dissolved in PBS-T for 1 hour at room temperature. After they were washed three times in PBS-T at room temperature, the membranes were incubated overnight with an antiryanodine receptor monoclonal antibody (No. MA3-916, Affinity Bioreagents Inc) diluted 1:1000 in 1% milk PBS-T. After they were washed in PBS-T, the membranes were incubated for 2 hours with an alkaline phosphataseconjugated anti-mouse secondary antibody (1:500) (Cappel Division of Organon Teknika), washed again in PBS-T, developed, and quantified. To determine the calsequestrin levels, the cardiac homogenates (50 µg) were electrophoretically separated on an 8% SDSpolyacrylamide gel. Immunoblotting was performed using a 1:100 dilution of a polyclonal rabbit antibody to canine cardiac calsequestrin (a gift from Dr Larry R. Jones, Indiana University School of Medicine), as previously described.20 To determine the protein levels of myosin, the homogenates (2 to 5 µg) were separated by SDS-PAGE on 8% gels and transferred to 0.22-µm nitrocellulose membranes. Transfer was performed at 4°C overnight at 200 mA with a buffer change after 4 to 5 hours, and the membranes were incubated with a monoclonal antibody to cardiac myosin heavy chain (1:500 dilution, No. RBT76250, Accurate Chemical & Scientific Co). For quantitative immunoblotting of actin, cardiac troponin T, and troponin I, the homogenates (10 to 50 µg) were separated by SDS-PAGE on 13% gels. Samples were transferred to 0.22-µm nitrocellulose membranes by electrophoresis at 200 mA for 2 hours. The membranes were incubated with mouse monoclonal antibodies to actin (1:500 dilution, No. BYA6583, Accurate Chemical & Scientific Co) or cardiac troponin T or cardiac troponin I (1:1000 dilution, Nos. RDI-TRK-4T19-6G9 and RDI-TRK-4T21-C5, Research Diagnostics, Inc). After they were washed, the membranes were incubated with an alkaline phosphataseconjugated anti-mouse secondary antibody, developed, and quantified as described above.
Ryanodine Receptor Binding Assays
Whole cardiac homogenates were used for the ligand binding assays. Mouse hearts were excised, immediately rinsed in ice-cold saline, trimmed of fat and connective tissue, and frozen in liquid nitrogen. The frozen hearts were powdered and homogenized in 1 mL of 50 mmol/L Tris, pH 7.4. Radioligand binding assays were performed using 100 µg of the cardiac homogenate protein in a total volume of 1 mL HEPES buffer (10 mmol/L HEPES, 150 mmol/L KCl, 3 mmol/L AMP, and 0.3 mmol/L CaCl2) in the presence of the protease inhibitor cocktail. The protease inhibitor cocktail contained (in final concentrations) 75 nmol/L aprotinin, 0.23 µmol/L phenylmethylsulfonyl fluoride, 0.83 mmol/L benzamidine, 1 mmol/L iodoacetimide, 1.1 µmol/L leupeptin, and 0.7 µmol/L pepstatin A.21 Twelve concentrations (final concentration, 0.1 to 40 nmol/L) of [3H]ryanodine (84 Ci/mmol, DuPont New Research Products) were assayed with and without unlabeled ryanodine (17 µmol/L).22 Cold ryanodine was used to displace [3H]ryanodine and allow measurement of specific ryanodine binding. The nonspecific binding was <15% of total binding at 1 nmol/L [3H]ryanodine. Incubation was at 37°C, and the reaction reached equilibrium within 90 minutes. Thus, 90 minutes was selected as the reaction incubation time. All assays were performed in duplicate and terminated within seconds by rapid filtration through Whatman EF/C filters. Each filter was washed three times with 5 mL cold buffer (150 mmol/L KCl and 10 mmol/L Tris-HCl, pH 7.4), placed in 8 mL Budget-Solve (Research Products International Corp), and counted in a beta scintillation counter. All binding data were analyzed by the Radioligand binding analysis computer program by G.A. McPherson (Elsevier-BIOSOFT).
Rapid Freezing of Contracting Mouse Hearts
Isolated contracting hearts of wild-type and phospholamban-deficient mice were used for direct measurement of SR Ca2+ by EPMA on rapidly frozen heart tissue. Mice received an intraperitoneal injection of heparin (100 U) 30 minutes before they were killed and were anesthetized with intraperitoneal sodium pentobarbital (30 mg/kg body wt). The heart was removed, placed in a dish containing chilled Krebs-Henseleit buffer, and subsequently cannulated via the aorta for retrograde perfusion. Hearts were perfused at 37°C with a perfusion pressure of 50 mm Hg. Platinum electrodes were attached to the right atrium, and the heart was stimulated to contract at a frequency of 380 bpm. Left ventricular pressure and its first derivative (dP/dt) were recorded via a PE-50 cannula inserted into the left ventricle through the mitral valve and connected to a pressure transducer. Heart function was allowed to stabilize before rapid freezing.
A computerized rapid-freezing device was used to freeze-trap the hearts in diastole. Freezing was triggered by the stimulator, which activated a compressed air-driven solenoid to propel a beaker of supercooled (-185°C) ethane upward, immersing the heart in ethane and freezing the tissue at a rate rapid enough to prevent cellular ion redistribution, as previously described for papillary muscles.23 24 At a heart rate of 380 bpm, a stimulus occurred every 150 milliseconds. The freeze was programmed to occur at 140 milliseconds after the last stimulus and 10 milliseconds before the beginning of the next contraction. Immediately before freezing, heart perfusion was stopped, and the drop of remaining buffer was blotted from the apex of the heart using a wedge of filter paper. Verification that the heart had been freeze-trapped in diastole was obtained from the chart recording of heart function as well as a signal produced by a light sensor, which leaves a mark on the chart at the moment the heart enters the ethane. Once frozen, the heart was stored in liquid nitrogen until cryosectioned.
Cryosectioning
Cryoultramicrotomy and freeze-drying were performed as previously described.23 24 Ultrathin cryosections (100 to 150 nm thick) were cut from the epicardial surface of the left ventricle. The sections were transferred, within the chamber of the microtome, to Ca2+-free carbon-coated copper-mesh grids. Grids were freeze-dried overnight in a liquid nitrogenchilled brass block, which was placed into a vacuum evaporator. The next morning, the freeze-dried cryosections were carbon-coated and immediately stored under vacuum in a desiccator.
Electron Probe Microanalysis
X-ray spectra were collected in a Philips CM12 scanning transmission electron microscope, using an accelerating voltage of 80 keV and an LaB6 (Phillips) filament. The microscope was equipped with an Edax 30-mm2 Si(Li) energy-dispersive x-ray detector.
A Gatan temperature-regulated stage was used to transfer grids into the microscope and to maintain them at a temperature of -100°C in order to minimize mass loss under the electron beam. Spectra were collected in the scanning mode from the junctional SR, using an astigmated raster of average dimensions (100x30 nm). The junctional SR was identified morphologically as an electron-dense region surrounding a T tubule, at the level of the Z line, between mitochondria (Fig 2
). This was confirmed by the presence of an elevated phosphorous peak relative to the sulfur peak, as previously described.23
|
EPMA was performed on wild-type and phospholamban-deficient mouse hearts. Six cells were measured from each heart. Within each cell, one A band, one mitochondrion, and one junctional SR were measured, yielding a total of 30 measurements per group. Based on our previous studies using EPMA on rapidly frozen cardiac muscle, this sample size is more than adequate to detect a difference in SR Ca2+ content.23 25 26
X-ray spectra were analyzed by minimum least squares fit to stored reference spectra, according to the Hall thin-film quantification procedure. Corrections were made for a systematic error in sodium quantification that was due to the position of Na+ on the slope of the x-ray continuum, as previously described.23 Concentrations measured by EPMA are expressed in millimoles per kilogram of dry weight, since measurements were made on freeze-dried cryosections.
ATP
Cardiac ATP content was measured in frozen tissue samples as follows: After thoracotomy, the heart was removed, rinsed with ice-cold PBS, and frozen rapidly using clamps precooled in liquid nitrogen. Freezing of the heart occurred within seconds after the animal was killed. Frozen tissue samples were powdered finely using a mortar and pestle precooled in liquid nitrogen, and the powder was extracted with ice-cold 12% trichloroacetic acid. Aliquots of the acid extracts were then analyzed enzymatically for ATP using an assay kit (No. 366-UV, Sigma Chemical Co).
31P NMR Spectroscopy
31P NMR spectroscopy was performed on hearts from six wild-type and six phospholamban-deficient age-matched mice perfused in the Langendorff mode essentially as described for other rodent hearts.27 Hearts were perfused at 37°C with oxygenated, phosphate-free, modified Krebs-Henseleit buffer, pH 7.4, at a constant perfusion pressure of 85 mm Hg. The buffer contained the following (mmol/L): NaCl 143, KCl 5.3, CaCl2 2.5, MgSO4 1.2, EDTA tetrasodium 0.5, and NaHCO3 25. For carbon-based substrates, we used glucose (10 mmol/L) and sufficient pyruvate (0.5 or 2.5 mmol/L) to maximally activate PDH. A short PE-50 drain was placed in the apex of the left ventricle through a hole cut in the left atrium to drain effluent from the thebesian veins. To monitor isovolumic contractile performance, a water-filled balloon made of polyvinyl chloride film was connected to a Statham P23Db pressure transducer and inserted into the left ventricle through the left atrium. Balloon volume was set so that end-diastolic pressure was
10 mm Hg. The heart was placed in a glass NMR tube and surrounded by its own perfusate. The perfusate level was kept
1 cm above the aortic stump by continuous suction through a polyethylene tube. Coronary flow rate was measured by timed collection of this effluent. Contractile performance data were collected on-line at 200 Hz using a commercially available data acquisition system (MacLab).
31P NMR spectra were obtained using Nicolet-360 (8.4 T, 145.76 MHz) and GE-400 Omega (9.4 T, 161.94 MHz) NMR spectrometers. A 16-channel shim unit was used to homogenize the magnetic field by minimizing the width of the 1H signal. Each spectrum was obtained by averaging signals from 208 free induction decays collected during an 8-minute period with a 60° pulse angle and 2.14-second recycling time. Spectral widths of 2500 and 6800 Hz were used for the Nicolet and GE spectrometers, respectively. Spectra were analyzed using 20-Hz exponential multiplication and zero and first-order phase corrections. Resonance peaks were fitted to a lorentzian function, and areas under the peaks were calculated by commercially available software (NMR1). Relative saturation factors for each resonance were determined by comparison with fully relaxed spectra. The resonance areas of PCr and the gamma phosphate peak of ATP were used to determine the respective PCr and ATP concentrations. Myocardial ATP content was determined in a separate set of hearts by enzymatic analysis (see above). The amounts of PCr and Pi were calculated by multiplying the ratio of the resonance area to that of ATP determined by 31P NMR with the biochemically measured ATP content. pHi was determined from the chemical shift of the Pi resonance relative to the PCr resonance.
Cytosolic free ADP concentration was estimated using the equilibrium constant of the CK reaction, the ratio of ATP to PCr contents, pH obtained by 31P NMR spectroscopy, and free creatine:
![]() |
![]() |
AMP was calculated from the equilibrium equation for adenylate kinase:
![]() |
![]() |
31P magnetization transfer was used to measure the pseudo first-order unidirectional reaction velocity of the CK reaction, as described in detail elsewhere.29
After placing a heart in the spectrometer, a 30-minute stabilization period was used to tune and shim the magnet. After the stabilization period, three consecutive 8-minute 31P NMR spectra were recorded simultaneously with contractile performance measurements. Once these baseline data had been collected, magnetization transfer experiments were performed. Typically, the full magnetization transfer experiment took
90 minutes, whereas the two time point measurements took 26 minutes.
Oxygen Consumption in Work-Performing Hearts
Hearts from wild-type and phospholamban-deficient mice were perfused in a work-performing mode, as previously described.5 30 Coronary arterial perfusion buffer and venous effluent samples were collected anaerobically, and the PO2 and PCO2 values of these samples were measured using an automated blood gas analyzer (model 248, Ciba Corning Diagnostics Corp). Oxygen consumption (MVO2) by the perfused hearts was computed by multiplying the coronary flow by the arteriovenous difference in oxygen content and normalized per gram of tissue mass31 as follows:
![]() |
Mitochondrial Enzyme Activities
Mouse hearts were excised, frozen in liquid N2, and powdered in a porcelain mortar, which was cooled at liquid N2 temperature. The powder was transferred to a glass-polytetrafluoroethylene homogenizer (size A, Thomas Scientific) and homogenized in 5 mL buffer containing (mmol/L) KCl 180, EGTA 10, MOPS 20, and potassium phosphate buffer 2 (pH 7.4). The homogenates were used for CK, CO, and SCR activity measurements and protein assays. Three milliliters of homogenate was centrifuged at 200 000g for 45 minutes. The supernatants were collected, and the pellets were resuspended in 5 mL of the above-mentioned buffer. The CK activities in the supernatant and particulate fractions were determined. CK activity was measured by determining the formation of creatine from creatine phosphate using Sigma kit No. 520. CO activity was measured spectrophotometrically32 by following the rate of oxidation of reduced cytochrome c (50 µmol/L) in 3 mL of 10 mmol/L potassium phosphate buffer (pH 7.4) at 550 nm in an Aminco dual-beam dual-wavelength spectrophotometer (DW-2a UV/VIS, American Instrument Co). Reduced cytochrome c was prepared by reducing oxidized cytochrome c with a few solid crystals of Na2S2O4 in 10 mmol/L potassium phosphate buffer and dialyzing in 1000-fold volume of the same buffer to remove excess Na2S2O4. SCR activity was determined in the same assay cuvettes after complete oxidation of reduced cytochrome c by CO. To determine SCR, 10 mmol/L azide and 1 µmol/L rotenone were added after complete oxidation of reduced cytochrome c. The SCR activity was initiated by addition of 5 mmol/L succinate. The CO and SCR activities were calculated by using 19.2 as the millimolar extinction coefficient for reduced cytochrome c.
PDH activity was determined by a modification of a previously described method.33 Briefly, mouse hearts were frozen and powdered as described above. The powder was homogenized with a glass-polytetrafluoroethylene homogenizer in 3 mL of a medium containing (mmol/L) HEPES 50, dithiothreitol 1, and EDTA 5, pH 7.1. PDH complex activity was assayed by the indirect spectrophotometric method, based on the production of acetyl coenzyme A from pyruvate. The formation of acetyl coenzyme A was coupled with the acetylation of the dye AABS by arylamine N-acetyltransferase, with a resulting loss of absorbance at 460 nm. The assay was conducted in a 100 mmol/L Tris-HCl buffer (pH 7.8) containing (mmol/L) EDTA 0.5, MgCl2 1, ß-mercaptoethanol 5, thiamine pyrophosphate 1, ß-NAD 0.5, coenzyme A 0.1, and pyruvate 1, along with 20 µg/mL AABS and 40 mU of the arylamine N-acetyltransferase. The arylamine N-acetyltransferase was purified from pigeon liver acetone powder (Sigma) by the acetone fractionation method.34 PDHt was assayed after 600 µL tissue extract was incubated for 10 minutes at 30°C with 300 µL activation buffer (pH 7.1) containing (mmol/L) HEPES 100, MgCl2 2.5, CaCl2 0.5, and dithiothreitol 2.0, along with 240 µL bovine heart PDH phosphatase. PDH phosphatase was prepared from bovine heart as previously described.35 The assay for PDHt was similar to the one described above for PDHa. The ratio of PDH complex activity before and after the addition of PDH phosphatase (PDHa/PDHt) represents the fraction of active form of the complex.
Protein Determination
Protein concentration was determined by the Bio-Rad assay36 using bovine serum albumin as the standard.
Statistical Analysis
Results are expressed as mean±SEM. The number (n) of mice used is indicated. Comparisons were made between groups of wild-type and phospholamban-deficient mice using Student's t tests. Values were also tested by ANOVA. Values of P<.05 were considered statistically significant.
Elemental concentrations measured by EPMA were subjected to a nested ANOVA, using cells nested within the heart and the hearts nested within the treatment group. This allows for the distinction of group-dependent differences in SR elemental concentration versus within-heart and between-heart components of variability. If the ANOVA revealed a significant F statistic, linear contrasts of means from the nested ANOVA were used to compare the wild-type with the phospholamban-deficient mice.
| Results |
|---|
|
|
|---|
|
Ca2+-Cycling Proteins
To determine whether phospholamban ablation and the enhanced SR Ca2+ transport were associated with any alterations in the expression levels of the Ca2+-cycling proteins in SR, the levels of these proteins were examined in age-matched phospholamban-deficient and wild-type mice. In initial studies, the expression levels of SERCA2a, which is the enzyme regulated by phospholamban, were determined. To quantify the expression levels of the SR Ca2+-ATPase, RNA dot blots from wild-type and phospholamban-deficient hearts were probed with the oligonucleotide specific for the SR Ca2+-ATPase, as described above. Fig 4A
shows dot blot analysis of the SERCA2 transcript levels in four hearts from wild-type and five hearts from phospholamban-deficient mice. Fig 4B
shows the same membranes hybridized with the 18S rRNA to account for RNA loading variability. The levels of SERCA2 transcripts were assessed in a total of 10 hearts from phospholamban-deficient and 12 hearts from wild-type mice by using RNA dot blot analyses. There were no significant differences between these two animal groups. Furthermore, the Ca2+-ATPase protein levels were determined using quantitative immunoblotting,19 and there were no differences between wild-type and phospholamban-deficient hearts (Fig 4C
and Table 1
).
|
|
Analysis of the transcript levels of calsequestrin using RNA dot blots of wild-type (n=5) and phospholamban-deficient (n=5) hearts revealed that the relative levels of calsequestrin were 1.06±0.08 in phospholamban-deficient hearts and 1.00±0.07 in wild-type hearts. These findings were further confirmed by Western blot analysis of calsequestrin protein levels (Table 1
). Thus, ablation of phospholamban was not associated with any alterations in the expression levels of this SR Ca2+ storage protein.
To assess the expression levels of the ryanodine receptor, several oligonucleotide probes were synthesized on the basis of rabbit cardiac ryanodine receptor cDNA, but they all failed to hybridize with mouse cardiac RNA in a specific manner. Furthermore, use of the rabbit cardiac cDNA revealed only weak hybridization to the mouse cardiac RNA, which did not allow quantitative evaluation of expression levels. Thus, the levels of the ryanodine receptor were determined using quantitative immunoblotting of cardiac homogenates (Fig 5A
). Phospholamban ablation was associated with a significant decrease in the levels of ryanodine receptor protein (26% decrease in phospholamban-deficient compared with wild-type hearts, Table 1
). The reduction in ryanodine receptor protein levels was reflected by a significant reduction (24%) in ryanodine binding in phospholamban-deficient cardiac homogenates compared with wild-type (100%) cardiac homogenates (Bmax, 803±38 versus 1058±45 fmol/mg in phospholamban-deficient versus wild-type hearts, respectively; n=6; P<.01; Fig 5B
). However, the affinity (Kd) for ryanodine binding was not significantly different between the two groups (Kd, 10.4±1.4 versus 12.3±1.0 nmol/L in phospholamban-deficient versus wild-type hearts, respectively; n=6; P>.05).
|
The downregulation of the ryanodine receptor levels, associated with ablation of phospholamban, prompted us to examine the expression levels of the sarcolemmal Na+-Ca2+ exchanger, which also plays a role in Ca2+ homeostasis in the heart. Several oligonucleotide probes, based on the guinea pig cardiac Na+-Ca2+ exchanger cDNA sequence, were synthesized, but they failed to hybridize with the mouse cardiac RNA. Thus, the guinea pig cardiac Na+-Ca2+ exchanger cDNA was used as a probe (Fig 1
) on Northern blots of phospholamban-deficient (n=7) and wild-type (n=7) hearts. The relative levels of Na+-Ca2+ exchanger were 0.95±0.16 in phospholamban-deficient hearts and 1.00±0.16 in wild-type hearts, indicating that ablation of phospholamban was not associated with any significant alteration in the gene expression levels of this Ca2+-cycling protein in the heart.
Ca2+ Stores
To determine whether the increased affinity of the SR Ca2+ pump for Ca2+ and the downregulation of the ryanodine receptor levels were associated with any alterations in the diastolic SR Ca2+ store in phospholamban-deficient hearts, EPMA on rapidly frozen heart tissues was used. EPMA on frozen cardiac muscle allows for measurement of differences in the size of the SR Ca2+ store because it combines the spatial resolution of the electron microscope (10 nm) with the ability to reproducibly measure Ca2+ concentration within a cell or organelle.23 25 26 Assessment of the Ca2+ content in the junctional SR of phospholamban-deficient hearts using EPMA revealed significantly higher levels compared with wild-type hearts (Table 2
). These differences were specific to the SR, since Ca2+ content at the A band and in the mitochondria was not different between the phospholamban-deficient and wild-type hearts (Table 2
).
|
In addition to Ca2+, EPMA provided simultaneous measurements of other elements of biological interest within the SR, A band, and mitochondria of wild-type and phospholamban-deficient hearts (Table 2
). There were no statistically significant differences in the content of Na+, Mg2+, P3-, S2-, Cl-, or K+ in any of the organelles studied between these two groups of animals. Furthermore, the lack of difference in Na+, Cl-, and K+ demonstrates equal viability among all frozen hearts.
Myofibrillar Proteins
Previous studies on contractile protein mRNAs indicated that myosin heavy chain mRNA alterations and/or isoform switches, during development and certain pathophysiological conditions, were associated with changes in myocardial contractility.30 37 Thus, we examined the
-myosin heavy chain and ß-myosin heavy chain mRNA and protein levels in hearts from phospholamban-deficient and wild-type age-matched mice. There were no alterations in either the transcript (1.10±0.05 in phospholamban-deficient versus 1.00±0.04 in wild-type hearts, n=6, P>.05) or protein (Table 1
) levels of
-myosin heavy chain upon ablation of phospholamban. Furthermore, there were no appreciable amounts of ß-myosin heavy chain transcript observed in either phospholamban-deficient or wild-type mouse hearts. Therefore, ablation of phospholamban did not result in any changes or transitions between
- and ß-myosin heavy chains in an attempt to compensate for the increased activity of the SR Ca2+-ATPase in the mouse heart.
Previous studies have also shown that overexpression of
-skeletal actin in mouse hearts was correlated with increased contractile function.15 Thus, gene expression levels of
-skeletal actin (1.03±0.16 in phospholamban-deficient versus 1.00±0.20 in wild-type hearts, n=5, P>.05) and
-cardiac actin (0.97±0.04 in phospholamban-deficient versus 1.00±0.03 in wild-type hearts, n=6, P>.05) were assessed in phospholamban-deficient mouse hearts, but there were no significant changes compared with wild-type hearts. Furthermore, the mRNA levels of cardiac troponin I (0.98±0.06 in phospholamban-deficient versus 1.00±0.03 in wild-type hearts, n=5, P>.05) were also similar between phospholamban-deficient and wild-type mice. These findings at the mRNA level were also confirmed at the protein level (Table 1
). In addition, measurement of cardiac troponin T protein revealed similar levels in phospholamban-deficient and wild-type mice (Table 1
).
ATP Levels
To determine whether the increased contractile parameters in phospholamban-deficient hearts were associated with alterations in the high-energy phosphate pools of the heart, we assessed the levels of ATP in these hearts. There were no significant differences in ATP levels between the phospholamban-deficient (4.18±0.45 µmol/g wet wt, n=5) and wild-type (3.95±0.44 µmol/g wet wt, n=5) hearts.
ATP Synthesis by Oxidative Phosphorylation
Since the steady state levels of ATP did not change in the hyperdynamic phospholamban-deficient hearts and since these hearts use ATP at a faster rate than wild-type hearts, we hypothesized that the rate of ATP synthesis via oxidative phosphorylation might have been increased to meet the increased energy demand. One of the potential mechanisms for increased ATP synthesis is activation of PDH and the tricarboxylic acid cycle. It has been shown that increases in cytosolic Ca2+ levels, associated with increases in cardiac contractility, reflect increases in intramitochondrial free Ca2+ and, thus, activation of PDH.38 Activation of PDH is associated with increases in the fraction of the dephosphorylated form of this enzyme that are due to stimulation of the PDH phosphatase by Ca2+ ions.39 Thus, the levels of active and total PDH activity were assessed in phospholamban-deficient and wild-type mouse hearts. The enhanced contractility in the phospholamban-deficient hearts was associated with a significant increase in the active form of PDH, whereas the total PDH activity was not significantly altered compared with wild-type hearts (Table 3
). The active fraction of PDH was 65.8±7.2% in phospholamban-deficient hearts and 27.5±6.1% in wild-type hearts compared with the respective total (100%) activity of the enzyme in these hearts. The increase in the fraction of active PDH was specific and not due to an increase in mitochondrial mass, since the total activity of this enzyme as well as the activity levels of CO and SCR did not reveal any alterations (Table 3
).
|
The increases in the active fraction of PDH activity in the phospholamban-deficient hearts suggested that oxygen utilization may also be higher in these hearts compared with wild-type hearts. Thus, phospholamban-deficient and wild-type hearts were perfused in a work-performing mode, in parallel, and contractile parameters, coronary flow, arterial oxygen content, and venous oxygen content were determined under identical loading conditions. The developed pressure and contractile parameters were significantly higher in phospholamban-deficient hearts, consistent with previous observations.5 The increased contractility was associated with increases in myocardial oxygen consumption rates in these hyperdynamic phospholamban-deficient hearts compared with wild-type hearts (Table 4
).
|
ATP Synthesis via the CK Reaction
Another potential mechanism for increasing ATP synthesis in the hyperdynamic phospholamban-deficient hearts is to increase high-energy phosphate transfer via the CK reaction. We tested this possibility using 31P NMR spectroscopy to measure high-energy phosphate content and turnover (Fig 6
) while simultaneously measuring contractile performance. We observed that the wild-type and phospholamban-deficient hearts perfused in the isovolumic Langendorff mode showed differences in contractile performance consistent with those observed using the work-performing mode. In the isovolumic mode, systolic pressure was 19 mm Hg higher in the phospholamban-deficient (107±8 mm Hg) compared with the wild-type (88±8 mm Hg) hearts. Similarly, positive and negative dP/dts were increased 66% and 77%, respectively, in the phospholamban-deficient hearts. These increases compare well with those observed in work-performing hearts. Furthermore, there were no differences in body weights, heart rates, or coronary flow rates between the two groups of mice studied.
|
31P NMR spectroscopy revealed that PCr/ATP was decreased in the phospholamban-deficient hearts relative to the wild-type hearts. Taken together with the observation that the ATP concentrations were not different in the two groups of hearts, this indicates that the PCr concentration was lower (17%) in the phospholamban-deficient than in the wild-type hearts. Consistent with a decrease in the PCr/ATP ratio, we observed increases in calculated ADP and AMP concentrations in the phospholamban-deficient hearts (Table 5
). However, there were no alterations in CK enzymatic activity levels assayed in homogenates or soluble or particular fractions in phospholamban-deficient hearts compared with wild-type hearts (Table 5
). Similarly, neither Kfor as measured by magnetization transfer nor the CK reaction velocity differed in the two groups of mice (Table 5
). Furthermore, there were no changes in pHi between phospholamban-deficient and wild-type hearts.
|
| Discussion |
|---|
|
|
|---|
The phospholamban-deficient hearts exhibited no histological or morphological alterations compared with wild-type hearts. Furthermore, ablation of phospholamban and the accompanied increase in the affinity of the SR Ca2+ pump for Ca2+5 did not reflect alterations in Ca2+ pump mRNA or protein levels as a compensatory response to the ablation of its inhibitor. These findings suggest that the SERCA2 and phospholamban gene expression levels are not coordinately regulated in the heart, and they are in agreement with previous studies in altered thyroid conditions40 41 and in heart failure.42 43 Other changes at the SR level of phospholamban-deficient hearts may be expected to involve the levels of calsequestrin (the predominant Ca2+-storage protein in SR) and the ryanodine receptor (the Ca2+-release protein in SR). Phospholamban ablation was not associated with any changes in the transcript or protein levels of calsequestrin, whereas the ryanodine receptor protein levels and ryanodine receptor binding were significantly reduced. Thus, it is interesting to propose that there is a sufficient number of "spare" calsequestrin molecules (available in wild-type cardiac SR) that can be recruited to accommodate the increased Ca2+ levels in the phospholamban-deficient hyperdynamic hearts. Actually, analysis of the diastolic Ca2+ content in junctional SR revealed that the phospholamban-deficient ventricles had twofold higher levels compared with wild-type ventricles. This increase was specific to Ca2+, since there were no alterations in the content of any other elements in SR. Furthermore, analysis of the mitochondrial and the A-band Ca2+ revealed no significant differences between phospholamban-deficient and wild-type hearts. Although SR Ca2+ content measurements were performed on sections of the epicardial surface of the left ventricle, whereas SR Ca2+ cycling protein data were obtained using whole hearts, it is unlikely that inclusion of the atria significantly contributed to the protein measurements. Thus, these data indicate that the increased Ca2+ required for the increased contractility in the hyperdynamic hearts was mainly supplied by the SR Ca2+ stores. Downregulation of the ryanodine receptor may constitute an important compensatory mechanism, which is designed to reduce the fraction of Ca2+ released from the phospholamban-deficient SR and control the overall force of contraction in these hyperdynamic hearts.
Besides the SR Ca2+-cycling proteins, the contractile proteins myosin and actin have also been shown to play a major role in regulating contraction of cardiac muscle. Alterations in myosin heavy chain isoenzyme levels due to long-term hormonal administration, pathological stress, or physiological manipulations are associated with alterations in cardiac function.30 37 41 44 45 Furthermore, overexpression of
-skeletal actin appears to be correlated with increased myocardial contractility compared with the expression of mainly
-cardiac actin.15 Thus, alterations in the expression levels of these contractile proteins could partially contribute to the phenotype of the hyperdynamic phospholamban-deficient hearts. However, analysis of the transcript and protein levels of myosin, actin, and troponin isoforms revealed no differences between phospholamban-deficient and wild-type hearts. Therefore, in the absence of any changes in the major contractile proteins, it is anticipated that increases in the rate of SR Ca2+ uptake upon phospholamban ablation would contribute significantly to enhanced rates of cardiac relaxation.
Increases in cardiac contractile performance, such as those observed in phospholamban-deficient hearts, are expected to require increases in ATP utilization, which must be balanced by increases in ATP synthesis. The mechanisms involved in increased ATP synthesis of rodent hearts in response to acute increases in contractile performance have been previously studied.27 Upon acute increases of myocardial work, ATP concentration remained the same, whereas ATP synthesis via oxidative phosphorylation (measured as oxygen consumption) increased.27 In isovolumic beating rat hearts, an acute increase in systolic pressure of
20%, when the rate-pressure product was
35 000 mm Hg/min, as observed for the mouse hearts described in the present study, was associated with a small decrease in PCr concentration with little change in either Kfor or the unidirectional CK reaction velocity.27 It is interesting to note that the chronic hyperdynamic state of the phospholamban-deficient mouse heart has an energetic profile similar to that we previously observed for acute increases in workload of rat hearts.27 The ATP content remained the same as oxygen consumption increased (62%) to meet the demand of increased ATP utilization in these hyperdynamic mouse hearts. Also, similar to acute increases in workload, the PCr content was lower in the chronic hyperdynamic state of the phospholamban-deficient hearts. This persistent decrease in PCr content was unexpected and suggests that phospholamban-deficient hearts operate at a new energetic steady state. The decrease in PCr content was not sufficient to reduce the velocity of the CK reaction. However, the unidirectional velocity of the CK reaction was
6.7-fold higher than ATP synthesis rate by oxidative phosphorylation in the phospholamban-deficient hearts (6.8 versus 1.02 mmol/L per second), whereas it was 11-fold higher in the wild-type heart (6.9 versus 0.62 mmol/L per second). These findings suggest that energy reserve via the CK reaction is relatively diminished in the hyperdynamic state and that these hearts have a greater reliance on ATP synthesis from oxidative phosphorylation to maintain normal ATP concentrations.
To examine the basis for the increase in oxygen consumption, we measured the activity levels of PDH in mitochondria as an indication of increased tricarboxylic acid cycle turnover and increased ATP synthesis. Normally, only 20% to 30% of this enzyme is in the active form, and 60% to 90% can be activated during increased heart work.46 47 In the phospholamban-deficient mouse heart, the active fraction of PDH was 65% compared with 27% in wild-type hearts, suggesting that the rate of ATP synthesis was augmented to meet the increased energy requirements in these hearts. Activation of PDH indicated an increased fraction of the enzyme in the dephosphorylated form39 due to stimulation of the mitochondrial matrix protein phosphatase by the increases in intramitochondrial free Ca2+ concentration. Although no significant increase in mitochondrial Ca2+ was detected in our EPMA measurements, this technique measures total rather than free Ca2+, and it is possible that a small increase in matrix free Ca2+ would not be detected. Additionally, the mouse hearts used for EPMA were frozen during diastole, when cytosolic and possibly mitochondrial Ca2+ would be at their lowest values. Stimulation of PDH activity in the mitochondria is symptomatic of increased turnover of the tricarboxylic acid cycle, since PDH is one of the key enzymes that regulates this cycle. The resulting increases in the rates of NADH and FADH2 production and the stimulation of electron transport to oxygen are expected to increase the rates of ATP synthesis and, thus, oxygen consumption, as observed in the hyperdynamic phospholamban-deficient hearts.
Other mechanisms that may contribute to increased ATP synthesis via oxidative phosphorylation are increases in ADP, AMP, and Pi concentrations.46 In the phospholamban-deficient hearts, the ADP concentration, calculated from the CK equilibrium equation, was almost double (39.4 µmol/L) compared with wild-type hearts (20.6 µmol/L), although there were no changes in Pi concentration. The calculated AMP concentration was also much higher (3.5-fold) in phospholamban-deficient hearts. These increases in ADP and AMP concentrations would be expected to stimulate important enzymes, such as phosphofructokinase, in the glycolytic pathway and thus further increase the rate of ATP synthesis to accommodate the enhanced contractile performance of the heart. Thus, increases in ADP and AMP levels may constitute important compensatory mechanisms in the hyperdynamic phospholamban-deficient hearts to meet the increased energy demand.
In summary, the present findings demonstrate that the major adaptive changes, upon ablation of phospholamban in the heart, involve decreases in the ryanodine receptor levels (to regulate the release of the high SR Ca2+ content) and metabolic alterations in myocardial energetics (to meet the increases in ATP demand in these hyperdynamic hearts). Histopathological and morphological examinations revealed no abnormalities, and the expression levels of the other SR Ca2+-cycling and contractile proteins were similar in phospholamban-deficient and wild-type hearts. Thus, the augmentation of contractile parameters is mainly due to the "uninhibited" SR Ca2+-ATPase activity as a result of phospholamban ablation. The downregulation of the ryanodine receptor indicates a cross talk between SR Ca2+ uptake and Ca2+ release in an attempt to maintain proper Ca2+ homeostasis in the myocardium, whereas the metabolic alterations indicate a cross talk between ATP synthesis and utilization in an attempt to maintain the increased contractile performance. However, it remains to be determined whether this cross talk is initiated in early developmental stages and whether it is maintained as the animals age or as they are subjected to physiological and pathophysiological interventions.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received February 2, 1996; accepted September 4, 1996.
| References |
|---|
|
|
|---|
2.
Wegener AD, Simmerman HK, Lindemann JP, Jones LR. Phospholamban phosphorylation in intact ventricles: phosphorylation of serine 16 and threonine 17 in response to ß-adrenergic stimulation. J Biol Chem. 1989;264:11468-11474.
3.
Lindemann JP, Jones LR, Hathaway DR, Henry BG, Watanabe AM. Beta-Adrenergic stimulation of phospholamban phosphorylation and Ca2+-ATPase activity in guinea pig ventricles. J Biol Chem. 1983;258:464-471.
4. Kranias EG, Garvey JL, Srivastava RD, Soloro RJ. Phosphorylation and functional modifications of sarcoplasmic reticulum and myofibrils in isolated rabbit hearts stimulated with isoprenaline. Biochem J. 1985;226:113-121.[Medline] [Order article via Infotrieve]
5.
Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy JJ, Doetschman T, Kranias EG. Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of ß-agonist stimulation. Circ Res. 1994;75:401-409.
6. Lytton J, MacLennan DH. Sarcoplasmic reticulum. In: Fozzard HA, Haber E, Jennings RB, Katz AM, Morgan HE, eds. The Heart and Cardiovascular System. 2nd ed. New York, NY: Raven Press Publishers; 1991:1203-1222.
7.
MacLennan DH, Wong PT. Isolation of a calcium-sequestering protein from sarcoplasmic reticulum. Proc Natl Acad Sci U S A. 1971;68:1231-1235.
8. Sorrentino V, Volpe P. Ryanodine receptors: how many, where and why? Trends Pharmacol Sci. 1993;14:98-103.[Medline] [Order article via Infotrieve]
9.
Boerth SR, Zimmer DB, Artman M. Steady-state mRNA levels of the sarcolemmal Na+-Ca2+ exchanger peak near birth in developing rabbit and rat hearts. Circ Res. 1994;74:354-359.
10.
Bassani JWM, Qi M, Samarel AM, Bers DM. Contractile arrest increases sarcoplasmic reticulum calcium uptake and SERCA2 gene expression in cultured neonatal rat heart cells. Circ Res. 1994;74:991-997.
11. Carson FL. Histotechnology: A Self-Instructional Text. Chicago, Ill: ASCP Press; 1990:25-37, 103-105.
12. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
13. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. New York, NY: Cold Spring Harbor Laboratory Press; 1989.
14.
Robbins J, Gulick J, Sanchez A, Howles P, Doetschman T. Mouse embryonic stem cells express the cardiac myosin heavy chain genes during development in vitro. J Biol Chem. 1990;265:11905-11909.
15.
Hewett TE, Grupp IL, Grupp G, Robbins J.
-Skeletal actin is associated with increased contractility in the mouse heart. Circ Res. 1994;74:740-746.
16.
Gunteski-Hamblin AM, Greeb J, Shull GE. A novel Ca2+ pump expressed in brain, kidney, and stomach is encoded by an alternative transcript of the slow-twitch muscle sarcoplasmic reticulum Ca-ATPase gene: identification of cDNAs encoding Ca2+ and other cation-transporting ATPases using an oligonucleotide probe derived from the ATP-binding site. J Biol Chem. 1988;263:15032-15040.
17.
Ganim JR, Luo W, Ponniah S, Grupp I, Kim HW, Ferguson DG, Kadambi V, Neumann JC, Doetschman T, Kranias EG. Mouse phospholamban gene expression during development in vivo and in vitro. Circ Res. 1992;71:1021-1030.
18. Arai M, Alpert NR, Periasamy M. Cloning and characterization of the gene encoding rabbit cardiac calsequestrin. Gene. 1991;109:275-279.[Medline] [Order article via Infotrieve]
19. Harrer JM, Kiss E, Kranias EG. Application of the immunoblot technique for quantitation of protein levels in cardiac homogenates. Biotechniques. 1995;18:995-997.[Medline] [Order article via Infotrieve]
20. Rockman HA, Hamilton R, Jones LR, Milano CA, Mao L, Lefkowitz RJ. Enhanced myocardial relaxation in vivo in transgenic mice overexpressing the ß2-adrenergic receptor is associated with reduced phospholamban protein. J Clin Invest. 1996;97:1618-1623.[Medline] [Order article via Infotrieve]
21.
Bers DM, Stiffel VM. Ratio of ryanodine to dihydropyridine receptors in cardiac and skeletal muscle and implications for E-C coupling. Am J Physiol. 1993;264:C1587-C1593.
22.
Vatner DE, Sato N, Kiuchi K, Shannon RP, Vatner SF. Decrease in myocardial ryanodine receptors and altered excitation-concentration coupling early in the development of heart failure. Circulation. 1994;90:1423-1430.
23.
Moravec CS, Bond M. Calcium is released from the junctional sarcoplasmic reticulum during cardiac muscle contraction. Am J Physiol. 1991;260:H989-H997.
24.
Moravec CS, Bond M. Effect of inotropic stimulation on mitochondrial calcium in cardiac muscle. J Biol Chem. 1992;267:5310-5316.
25.
Keller E, Moravec CS, Bond M. Altered subcellular Ca2+ regulation in papillary muscles from cardiomyopathic hamster heart. Am J Physiol. 1995;268:H1875-H1883.
26. Bond M, Schluchter MD, Keller E, Moravec CS. Measurement of subcellular Ca2+ redistribution in cardiac muscle in situ: time resolved rapid freezing and electron probe microanalysis. Scanning Microsc. 1994;8:1-11.
27.
Bittl JA, Ingwall JS. Reaction rates of creatine kinase and ATP synthesis in the isolated rat heart: a 31P NMR magnetization transfer study. J Biol Chem. 1985;260:3512-3517.
28. Kammermeier H. Microassay of free and total creatine from tissue extracts by combination of chromatographic and fluorometric methods. Anal Biochem. 1973;56:341-345.[Medline] [Order article via Infotrieve]
29. Friedrich J, Nascimben L, Liao R, Ingwall JS. Phosphocreatine T1 measurements with and without exchange in the heart. Magn Reson Med. 1993;30:45-50.[Medline] [Order article via Infotrieve]
30.
Ng WA, Grupp IL, Subramaniam A, Robbins J. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ Res. 1991;68:1742-1750.
31. Matherne GP, Headrick JP, Ely SW, Coleman SD, Berne RM. Changes in work rate to oxygen consumption ratio during hypoxia and ischemia in immature and mature rabbit hearts. J Mol Cell Cardiol. 1992;24:1409-1421.[Medline] [Order article via Infotrieve]
32. King TE. Preparation of succinate-cytochrome c reductase and the cytochrome b-c1 particle, and reconstitution of succinate-cytochrome c reductase. In: Estabrook RW, Pullman ME, eds. Methods in Enzymology, Volume X: Oxidation and Phosphorylation. New York, NY: Academic Press Inc; 1967:216-225.
33. Coore HG, Denton RM, Martin BR, Randle PJ. Regulation of adipose tissue pyruvate dehydrogenase by insulin and other hormones. Biochem J. 1971;125:115-127.[Medline] [Order article via Infotrieve]
34.
Tabor H, Mehler AH, Stadtman ER. The enzymatic acetylation of amines. J Biol Chem. 1953;204:127-138.
35.
Kaempfer S, Blackham M, Christiansen M, Wu K, Cesar D, Vary T, Hellerstein MK. Fraction of hepatic cytosolic acetyl-CoA derived from glucose in vivo: relation to PDH phosphorylation state. Am J Physiol. 1991;260:E865-E875.
36. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-259.[Medline] [Order article via Infotrieve]
37.
Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matrix components. Circ Res. 1994;75:23-32.
38. Hansford RG. Physiological role of mitochondrial Ca2+ transport. J Bioenerg Biomembr. 1994;26:495-508.[Medline] [Order article via Infotrieve]
39.
McCormack JG, Denton RM. Signal transduction of intramitochondrial Ca2+ in mammalian energy metabolism. News Physiol Sci. 1994;9:71-76.
40.
Kiss E, Jakab G, Kranias EG, Edes I. Thyroid hormoneinduced alterations in phospholamban protein expression: regulatory effects on sarcoplasmic reticulum Ca2+ transport and myocardial relaxation. Circ Res. 1994;75:245-251.
41.
Arai M, Otsu K, MacLennan DH, Alpert NR, Periasamy M. Effect of thyroid hormone on the expression of mRNA encoding sarcoplasmic reticulum proteins. Circ Res. 1991;69:266-276.
42.
Arai M., Alpert NR, MacLennan DH, Barton P, Periasamy M. Alterations in sarcoplasmic reticulum gene expression in human heart failure: A possible mechanism for alterations in systolic and diastolic properties of the failing myocardium. Circ Res. 1993;72:463-469.
43.
Meyer M, Schillinger W., Pieske B, Holubarsch C, Heilmann C, Posival H, Kuwajima G, Mikoshiba K, Just H, Hasenfuss G. Alterations of sarcoplasmic reticulum proteins in failing human dilated cardiomyopathy. Circulation. 1995;92:778-784.
44.
Lompre AM, Nadal-Ginard B, Mahdavi V. Expression of the cardiac ventricular alpha- and beta-myosin heavy chain genes is developmentally and hormonally regulated. J Biol Chem. 1984;259:6437-6446.
45.
Nagai R, Zarain-Herzberg A, Brandl CJ, Fujii J, Tada M, MacLennan DH, Alpert NR, Periasamy M. Regulation of myocardial Ca2+-ATPase and phospholamban mRNA expression in response to pressure overload and thyroid hormone. Proc Natl Acad Sci U S A. 1989;86:2966-2970.
46. Opie LH. The Heart: Physiology and Metabolism. 2nd ed. New York, NY: Raven Press Publishers; 1991:208-276.
47. McCormack JG, Denton RM. The activation of pyruvate dehydrogenase in the perfused rat heart by adrenaline and other inotropic agents. Biochem J. 1981;194:639-643.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
M. Gnecchi, H. He, L. G. Melo, N. Noiseaux, F. Morello, R. A. de Boer, L. Zhang, R. E. Pratt, V. J. Dzau, and J. S. Ingwall Early Beneficial Effects of Bone Marrow-Derived Mesenchymal Stem Cells Overexpressing Akt on Cardiac Metabolism After Myocardial Infarction Stem Cells, April 1, 2009; 27(4): 971 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vafiadaki, D. A. Arvanitis, S. N. Pagakis, V. Papalouka, D. Sanoudou, A. Kontrogianni-Konstantopoulos, and E. G. Kranias The Anti-apoptotic Protein HAX-1 Interacts with SERCA2 and Regulates Its Protein Levels to Promote Cell Survival Mol. Biol. Cell, January 1, 2009; 20(1): 306 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Pinz, S. E. Ostroy, K. Hoyer, H. Osinska, J. Robbins, J. D. Molkentin, and J. S. Ingwall Calcineurin-induced energy wasting in a transgenic mouse model of heart failure Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1459 - H1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Belke, E. Swanson, J. Suarez, B. T. Scott, A. E. Stenbit, and W. H. Dillmann Increased expression of SERCA in the hearts of transgenic mice results in increased oxidation of glucose Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1755 - H1763. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mattiazzi, C. Mundina-Weilenmann, C. Guoxiang, L. Vittone, and E. Kranias Role of phospholamban phosphorylation on Thr17 in cardiac physiological and pathological conditions Cardiovasc Res, December 1, 2005; 68(3): 366 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Janczewski, M. Zahid, B. H Lemster, C. S Frye, G. Gibson, Y. Higuchi, E. G Kranias, A. M Feldman, and C. F McTiernan Phospholamban gene ablation improves calcium transients but not cardiac function in a heart failure model Cardiovasc Res, June 1, 2004; 62(3): 468 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R Pena and B. M Wolska Troponin I phosphorylation plays an important role in the relaxant effect of {beta}-adrenergic stimulation in mouse hearts Cardiovasc Res, March 1, 2004; 61(4): 756 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Cross, E. G. Kranias, E. Murphy, and C. Steenbergen Ablation of PLB exacerbates ischemic injury to a lesser extent in female than male mice: protective role of NO Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H683 - H690. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhao, K. F Frank, G. Chu, M. J Gerst, A. G Schmidt, Y. Ji, M. Periasamy, and E. G Kranias Combined phospholamban ablation and SERCA1a overexpression result in a new hyperdynamic cardiac state Cardiovasc Res, January 1, 2003; 57(1): 71 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Tupling, M. Asahi, and D. H. MacLennan Sarcolipin Overexpression in Rat Slow Twitch Muscle Inhibits Sarcoplasmic Reticulum Ca2+ Uptake and Impairs Contractile Function J. Biol. Chem., November 15, 2002; 277(47): 44740 - 44746. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asahi, K. Kurzydlowski, M. Tada, and D. H. MacLennan Sarcolipin Inhibits Polymerization of Phospholamban to Induce Superinhibition of Sarco(endo)plasmic Reticulum Ca2+-ATPases (SERCAs) J. Biol. Chem., July 19, 2002; 277(30): 26725 - 26728. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Jo, V. Leblais, P. H. Wang, M. T. Crow, and R.-P. Xiao Phosphatidylinositol 3-Kinase Functionally Compartmentalizes the Concurrent Gs Signaling During {beta}2-Adrenergic Stimulation Circ. Res., July 12, 2002; 91(1): 46 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. del Monte, E. Williams, D. Lebeche, U. Schmidt, A. Rosenzweig, J. K. Gwathmey, E. D. Lewandowski, and R. J. Hajjar Improvement in Survival and Cardiac Metabolism After Gene Transfer of Sarcoplasmic Reticulum Ca2+-ATPase in a Rat Model of Heart Failure Circulation, September 18, 2001; 104(12): 1424 - 1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E Hebert Signalling in cardiac disease: the molecular deficit at the heart of the problem Cardiovasc Res, April 1, 2001; 50(1): 7 - 9. [Full Text] [PDF] |
||||
![]() |
J. Zhai, A. G. Schmidt, B. D. Hoit, Y. Kimura, D. H. MacLennan, and E. G. Kranias Cardiac-specific Overexpression of a Superinhibitory Pentameric Phospholamban Mutant Enhances Inhibition of Cardiac Function in Vivo J. Biol. Chem., March 31, 2000; 275(14): 10538 - 10544. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Hoit, V. J. Kadambi, D. A. Tramuta, N. Ball, E. G. Kranias, and R. A. Walsh Influence of sarcoplasmic reticulum calcium loading on mechanical and relaxation restitution Am J Physiol Heart Circ Physiol, March 1, 2000; 278(3): H958 - H963. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Herzig and J. Neumann Effects of Serine/Threonine Protein Phosphatases on Ion Channels in Excitable Membranes Physiol Rev, January 1, 2000; 80(1): 173 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
U Ravens and D Dobrev Regulation of sarcoplasmic reticulum Ca2+-ATPase and phospholamban in the failing and nonfailing heart Cardiovasc Res, January 1, 2000; 45(1): 245 - 252. [Full Text] [PDF] |
||||
![]() |
M. J. Lalli, S. Shimizu, R. L. Sutliff, E. G. Kranias, and R. J. Paul [Ca2+]i homeostasis and cyclic nucleotide relaxation in aorta of phospholamban-deficient mice Am J Physiol Heart Circ Physiol, September 1, 1999; 277(3): H963 - H970. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Kadambi, N. Ball, E. G. Kranias, R. A. Walsh, and B. D. Hoit Modulation of force-frequency relation by phospholamban in genetically engineered mice Am J Physiol Heart Circ Physiol, June 1, 1999; 276(6): H2245 - H2250. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chen, R. London, E. Murphy, and C. Steenbergen Regulation of the Ca2+ Gradient Across the Sarcoplasmic Reticulum in Perfused Rabbit Heart : A 19F Nuclear Magnetic Resonance Study Circ. Res., November 2, 1998; 83(9): 898 - 907. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sato, D. G. Ferguson, H. Sako, G. W. Dorn II, V. J. Kadambi, A. Yatani, B. D. Hoit, R. A. Walsh, and E. G. Kranias Cardiac-specific Overexpression of Mouse Cardiac Calsequestrin Is Associated with Depressed Cardiovascular Function and Hypertrophy in Transgenic Mice J. Biol. Chem., October 23, 1998; 273(43): 28470 - 28477. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Hajjar, U. Schmidt, T. Matsui, J. L. Guerrero, K.-H. Lee, J. K. Gwathmey, G. W. Dec, M. J. Semigran, and A. Rosenzweig Modulation of ventricular function through gene transfer in vivo PNAS, April 28, 1998; 95(9): 5251 - 5256. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Luo, G. Chu, Y. Sato, Z. Zhou, V. J. Kadambi, and E. G. Kranias Transgenic Approaches to Define the Functional Role of Dual Site Phospholamban Phosphorylation J. Biol. Chem., February 20, 1998; 273(8): 4734 - 4739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chu, G. W. Dorn II, W. Luo, J. M. Harrer, V. J. Kadambi, R. A. Walsh, and E. G. Kranias Monomeric Phospholamban Overexpression in Transgenic Mouse Hearts Circ. Res., October 19, 1997; 81(4): 485 - 492. [Abstract] [Full Text] |
||||
![]() |
R. Kelly and M. Buckingham Manipulating Myosin Light Chain 2 Isoforms In Vivo : A Transgenic Approach to Understanding Contractile Protein Diversity Circ. Res., May 19, 1997; 80(5): 751 - 753. [Full Text] |
||||
![]() |
Y. Sato, H. Kiriazis, A. Yatani, A. G. Schmidt, H. Hahn, D. G. Ferguson, H. Sako, S. Mitarai, R. Honda, L. Mesnard-Rouiller, et al. Rescue of Contractile Parameters and Myocyte Hypertrophy in Calsequestrin Overexpressing Myocardium by Phospholamban Ablation J. Biol. Chem., March 16, 2001; 276(12): 9392 - 9399. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Haghighi, A. G. Schmidt, B. D. Hoit, A. G. Brittsan, A. Yatani, J. W. Lester, J. Zhai, Y. Kimura, G. W. Dorn II, D. H. MacLennan, et al. Superinhibition of Sarcoplasmic Reticulum Function by Phospholamban Induces Cardiac Contractile Failure J. Biol. Chem., June 22, 2001; 276(26): 24145 - 24152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jane Lalli, J. Yong, V. Prasad, K. Hashimoto, D. Plank, G. J. Babu, D. Kirkpatrick, R. A. Walsh, M. Sussman, A. Yatani, et al. Sarcoplasmic Reticulum Ca2+ ATPase (SERCA) 1a Structurally Substitutes for SERCA2a in the Cardiac Sarcoplasmic Reticulum and Increases Cardiac Ca2+ Handling Capacity Circ. Res., July 20, 2001; 89(2): 160 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. DAVIA, R. J. HAJJAR, C. M. N. TERRACCIANO, N. S. KENT, H. K. RANU, P. O'GARA, A. ROSENZWEIG, and S. E. HARDING Functional alterations in adult rat myocytes after overexpression of phospholamban with use of adenovirus Physiol Genomics, August 31, 1999; 1(2): 41 - 50. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |