Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1996;79:974-983

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pietruck, F.
Right arrow Articles by Siffert, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pietruck, F.
Right arrow Articles by Siffert, W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Medline Plus Health Information
*High Blood Pressure
(Circulation Research. 1996;79:974-983.)
© 1996 American Heart Association, Inc.


Articles

Selectively Enhanced Cellular Signaling by Gi Proteins in Essential Hypertension

G{alpha}i2, G{alpha}i3, Gß1, and Gß2 Are Not Mutated

Frank Pietruck, Albrecht Moritz, Michael Montemurro, Alexandra Sell, Stefan Busch, Dieter Rosskopf, Sebastian Virchow, Helmut Esche, Norbert Brockmeyer, Karl H. Jakobs, Winfried Siffert

the Institut fur Pharmakologie (F.P., A.M., A.S., S.B., D.R., S.V., K.H.J., W.S.), the Abteilung fur Kardiologie (M.M.), the Institut fur Molekularbiologie (H.E.), and the Hautklinik (N.B.), Universitatsklinikum Essen (Germany).

Correspondence to Dr Winfried Siffert, Institut fur Pharmakologie, Universitatsklinikum Essen, Hufelandstrasse 55, D-45122 Essen, Germany.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Recent studies have shown an enhanced signaling capacity of receptors coupled to pertussis toxin (PTX)–sensitive guanine nucleotide–binding proteins (G proteins) in immortalized B lymphoblasts from patients with essential hypertension. In the present study, we analyzed (1) whether such alterations would also be expressed in nontransformed cells of these individuals and (2) whether other G protein–mediated signaling pathways were also altered. Therefore, we established primary cultures of skin fibroblasts from previously characterized normotensive and hypertensive individuals (NT and HT cells, respectively). [Ca2+]i rises induced by lyso-phosphatidic acid (LPA), thrombin, and sphingosine-1-phosphate as well as the formation of inositol 1,4,5-trisphosphate and [3H]thymidine incorporation evoked by LPA were PTX sensitive and enhanced twofold in HT fibroblasts. In contrast, cellular responses induced by bradykinin, endothelin-1, and angiotensin II (all PTX insensitive) were similar in NT and HT cells. Formation of cAMP induced by stimulation of Gs with isoproterenol was identical in NT and HT cells. Western blot analysis yielded no evidence for an overexpression of G{alpha}i2, G{alpha}i3, Gß2, and Gß4. Furthermore, sequencing of cDNAs encoding for the ubiquitously expressed PTX-sensitive G protein subunits G{alpha}i2, G{alpha}i3, Gß1, and Gß2 from NT and HT cell lines yielded no evidence for mutations in these genes. Although the molecular mechanisms remain to be defined, these data support the concept of a selective enhancement of signal transduction via PTX-sensitive G proteins in essential hypertension.


Key Words: fibroblasts • lyso-phosphatidic acid • bradykinin • platelet-derived growth factor • proliferation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Presently available data suggest that {approx}30% to 50% of patients with EH display an enhanced Na+-H+ exchange activity in blood cells and that this phenotype coincides with an increased body mass index, left ventricular hypertrophy, insulin resistance, renal Na+ retention, low plasma renin, and, in the presence of type-1 diabetes, an increased susceptibility of developing nephropathy.1 2 Studies on Epstein-Barr virus–immortalized B lymphoblasts from normotensive and hypertensive subjects have shown that the phenotypes of "low" or "high" Na+-H+ exchange activity persist after prolonged cell culture, suggesting that these properties are under genetic control.3 In addition, HT cell lines with enhanced Na+-H+ exchanger activity proliferate distinctly faster, display enhanced DNA synthesis, and pass faster through the cell cycle than those from normotensive subjects with low Na+-H+ exchanger activity.3 4 5 It could be ruled out, however, that the enhanced Na+-H+ exchanger activity is caused by a mutation in the NHE-1 gene,3 by an overexpression of NHE-1 mRNA3 or protein,6 or by a differential posttranslational modification (eg, glycosylation) of the transporter.6

Recent studies revealed distinct differences in intracellular signal transduction between these NT and HT cell lines. HT lymphoblasts displayed enhanced [Ca2+]i increases, IP3 formation, and proliferation upon stimulation with platelet-activating factor and somatostatin.7 Interestingly, this difference in signal transduction was completely corrected for in cells treated with PTX, which blunts signal transduction via Gi-type guanine nucleotide–binding proteins (G proteins).7 Furthermore, by measuring agonist-stimulated binding of the stable GTP analogue GTP{gamma}S to HT and NT cell lines, an enhanced receptor-induced activation of PTX-sensitive G proteins in HT lymphoblasts could be demonstrated directly.7 This enhanced activation of PTX-sensitive G proteins in HT cell lines was mimicked by mastoparan-7, a peptide mimetic of an activated G protein–coupled receptor. However, neither Western blot analysis nor ADP-ribosylation studies yielded any evidence for an overexpression of PTX substrates as the major reason for the enhanced G protein activation in HT lymphoblasts.7

Although these experiments have yielded novel insights into potential pathogenetic mechanisms that may finally result in EH in the group of patients with enhanced Na+-H+ exchanger activity, many questions remain to be answered. One of these relates to the issue of whether the enhanced G protein activation is restricted to immortalized B lymphoblasts, ie, cells that are not likely to play a major role in the pathogenetic mechanisms leading to EH, or whether this abnormality is expressed in nontransformed cells as well. Another limitation of the previously used B lymphoblast system resides in the fact that the repertoire of expressed G protein–coupled receptors is rather restricted. Thus, although our previous experiments demonstrated an enhanced signal transduction via PTX-sensitive G proteins in EH, an altered signaling by receptors coupled to other G protein subtypes could not be ruled out. To answer these questions, we have established primary cultures of skin fibroblasts from these previously characterized normotensive and hypertensive subjects. These cells offer the advantage of expressing a variety of different receptors that couple to different G proteins, thereby evoking distinct and well-characterized pathways of intracellular signal transduction. Furthermore, fibroblast receptor expression and intracellular effector systems display many similarities to those of cells of the cardiovascular system, eg, vascular smooth muscle cells, endothelial cells, and platelets, to name but a few. The data in the present study strongly suggest that enhanced G protein–mediated signal transduction in EH is restricted to those receptors that activate PTX-sensitive G proteins, whereas signaling by receptors coupled to PTX-insensitive G proteins, ie, Gs and Gq, is apparently unaltered. This enhanced responsiveness, however, is due to neither mutations in the genes encoding for the ubiquitously expressed PTX substrates G{alpha}i2 and G{alpha}i3 nor the ß subunits 1 and Gß2.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
LPA, bradykinin, thrombin, angiotensin II, ET-1, SPP, and PDGF were from Sigma Chemical Co, and [3H]thymidine (6.7 Ci/mmol) was from DuPont-New England Nuclear. The rabbit polyclonal antibodies directed against peptide epitopes on G{alpha}i/o/t/z,1, Gß2, 3, and Gß4 were purchased from St. Cruz Biotechnology. The anti-G{alpha}i1/2 antibody was obtained from Calbiochem, and the peroxidase-conjugated goat anti-rabbit antibody was from Sigma. All other materials were from previously described sources.7

Individuals and Establishment of Fibroblast Cell Lines
Skin biopsies were made from previously characterized normotensive and hypertensive subjects,3 8 and some of the individuals' characteristics are displayed in the TableDown. In brief, hypertensive and normotensive subjects had been selected on the basis of high and low Na+-H+ exchange activity, respectively, in blood cells and a positive and negative family history of EH, respectively. Immortalized B lymphoblasts from the hypertensive subjects retained the enhanced Na+-H+ exchange activity after prolonged cell culture3 and, in addition, displayed enhanced signal transduction in terms of agonist-stimulated [Ca2+]i signals, IP3 formation, and GTP{gamma}S binding.7 For the present study, we selected normotensive and hypertensive subjects who displayed lowest or highest agonist-evoked [Ca2+]i signals in immortalized lymphoblasts. It should be noted that three of four hypertensive subjects were under antihypertensive therapy with either a ß-adrenoceptor blocker or a Ca2+ channel blocker. Although a definitive proof is lacking, we assume that potential drug effects on signal transduction in skin fibroblasts disappear in cells cultured for more than five passages.


View this table:
[in this window]
[in a new window]
 
Table 1. Characterization of Enrolled Individuals

The biopsy cylinders were cut into several thin slices and were cultured under a cover glass in six-well plates using DMEM supplemented with 10% FCS, 100 U/mL penicillin, and 100 µg/mL streptomycin in a humidified atmosphere (95% O2/5% CO2, 37°C). When enough fibroblasts were grown out of the primary material, the cells were trypsinized (trypsin-EDTA, GIBCO-BRL) and transferred into small culture flasks (25-cm2 culture area). Fibroblasts from passages 5 to 15 were used for all experiments. To avoid fortuitous influences of cell culture conditions, each of the different experiments was repeated within a time interval of >2 weeks.

[Ca2+]i Measurements
Cells were grown to confluence and passaged at a ratio of 1:0.8 two days before the experiment. Thereafter, cells were growth-arrested in serum-free DMEM containing 100 U/mL penicillin and 100 µg/mL streptomycin for 20 to 24 hours. Cells were trypsinized, pelleted by centrifugation (10 minutes, 700g), resuspended in DMEM containing 1% (wt/vol) fatty acid–free BSA, and then incubated with 3 µmol/L fura 2-AM for 1 hour at 37°C. Thereafter, the cells were again pelleted, resuspended in DMEM, and stored at 37°C. Before each measurement, an aliquot (0.25 to 0.5x106 cells per measurement) was transferred to Eppendorf tubes, centrifuged to remove extraneous dye, and resuspended in 2 mL prewarmed buffer containing (mmol/L) NaCl 135, KCl 5, MgCl2 1, CaCl2 1, D-glucose 10, and HEPES 20, pH 7.4. [Ca2+]i measurements were performed on a spectrofluorometer (LS 5B, Perkin Elmer Corp) equipped with a thermostated cuvette holder and a fast filter application (ratio mode device) as described before.7

Quantification of IP3 Formation
Fibroblasts were grown in six-well tissue culture dishes to subconfluent density and labeled with 5 µCi/mL myo-[3H]inositol in serum-free DMEM (without inositol) for 48 hours. Then, the cells were washed three times with phosphate-buffered saline and stimulated with the indicated agonists for 30 seconds at 37°C. Reactions were terminated by addition of 500 µL of 1.2 mol/L HCl and 3 mL of chloroform/methanol/HCl (200:100:0.75 [vol/vol/vol]) under vigorous shaking. After phase separation, the aqueous supernatants were collected, and the [3H]IP3 formed was analyzed as described previously.7

Determination of cAMP Accumulation
Cells grown to subconfluence on 60-mm plates were incubated in serum-free DMEM for 30 minutes at 37°C under cell culture conditions (95% O2/5% CO2). Thereafter, the medium was changed to DMEM supplemented with 0.5 mmol/L 3-isobutyl 1-methylxanthine for 20 minutes, followed by cell stimulation with isoproterenol or forskolin for 5 minutes. Cellular cAMP levels were quantified using the method of Gilman.9

DNA Synthesis and Cell Proliferation
DNA synthesis was determined from [3H]thymidine incorporation. Fibroblasts were seeded onto 24-well plates at a density of 10 000 cells per well. After attachment of the cells overnight, cells were growth-arrested by incubation in DMEM supplemented with 0.5% FCS, 100 U/mL penicillin, and 100 µg/mL streptomycin. After 48 hours, the cells were stimulated with different agonists. After another 24 hours, 0.5 µCi of [3H]thymidine was added to each well. Another 24 hours later, the medium was aspirated, and the cells were washed with phosphate-buffered saline and lysed with 200 µL of tissue solubilizer (Solvable NEF-910 G, DuPont). Radioactivity was measured by liquid scintillation counting after adding 4 mL of scintillation cocktail.

Immunoblotting
Crude fibroblast cell membranes were prepared by nitrogen cavitation as described previously.7 Since these nontransformed primary human skin fibroblasts proliferated very slowly, analysis of G protein subunit expression in single defined NT and HT fibroblast cell lines was impossible. Therefore, membranes from cell lines N1 to N4 and H1 to H4 were collected and pooled (see also "Discussion"). Protein concentration was determined according to Bradford,10 with bovine IgG used as a standard. Membrane proteins (25 µg) were heated for 5 minutes at 95°C in sample buffer containing 5% 2-mercaptoethanol. They were fractionated by SDS-PAGE according to Laemmli11 with 10% ({alpha} subunits) or 12% (ß subunits) acrylamide in the running gel and 4% acrylamide in the stacking gel. Urea (6 mol/L) was present in part of the running gels to resolve {alpha}i2 from {alpha}i1 and {alpha}i3, respectively. Proteins were electrotransferred to nitrocellulose using a Trans-Blot electrophoretic transfer cell (Bio-Rad) at 100 V for 1 hour. Nitrocellulose filters were blocked for 1 hour at room temperature in TBS (10 mmol/L Tris-HCl [pH 8.0] and 150 mmol/L NaCl) containing 5% skimmed milk powder and 0.05% Tween 20. The filters were washed three times for 5 minutes each in TBS containing 0.05% Tween 20 (TBS/Tween 20) and subsequently incubated for 60 minutes at room temperature in the primary antibody, which was diluted to a final concentration of 0.1 µg/mL with TBS containing 1% BSA (TBS/BSA). The filters were washed four times for 5 minutes each in TBS/Tween 20 and incubated for 30 minutes at room temperature in the peroxidase-conjugated antibody, which was diluted at 1:5000 with TBS/BSA. The filters were washed three times for 5 minutes each in TBS/Tween 20 and once in TBS. Finally, the filters were treated with ECL reagent (Amersham) according to the manufacturer, and immunoreactive bands were visualized by autoradiography. Autoradiographs were scanned, and the density of the specific bands was quantified using the computer program Quantiscan (Biosoft)

Cloning and Sequencing of G Protein Subunits {alpha}i2, {alpha}i3, ß1, and ß2
RNA was prepared, and cDNAs were synthesized in oligo dT–primed RT reactions as described previously.3 From each of the two cell lines of NT and HT origin, cDNAs spanning the entire coding regions were obtained by RT-PCR. 5'-Oligonucleotide primers were as follows: GGCCGGGCCGGCGGACGGC ({alpha}i2), CGTGTCCCCTCTCCCGCCGC ({alpha}i3), GCATTGAAGAGCACTAAGATCG (ß1), and CCCCCAACCCTGCCCCACG 2). 3'-Oligonucleotide primers were as follows: TCCCGCCAGGCCCCGCTGC ({alpha}i2), CTTTCACTAACATCCATGCTTCTC ({alpha}i3), TGGCATCCACATGCTACTGGC 1), and CCAGTGGGGGTGGGGCCA (ß2). For each PCR product, 35 cycles consisting of 1 minute at 95°C for denaturation, 1 minute at 56°C for annealing, and 2 minutes at 72°C for extension were performed. In the last cycle, extension was for 9 minutes. After purification on agarose gels, the specific PCR products were directly ligated into a pGem5Z T-vector (Promega), and the ligation products were transformed into competent cells of the JM 109 strain. Clones containing cDNA inserts were selected by blue-white screening of ampicillin-resistant colonies. Plasmid DNA was prepared from those clones and selected for cDNA inserted in one specific direction by restriction analysis. For each cell line, mixtures of equal amounts of plasmid DNA from 50 clones were subjected to automated sequencing using fluorescent dyes. Sequences not unequivocally resolved in one direction were verified by sequencing of the opposite strand.

Presentation of Data and Statistics
Results are given as mean±SEM if not otherwise indicated. Data were analyzed using two-tailed Student's t test and regarded significantly different at P<.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Receptor-Induced Increases in [Ca2+]i and IP3 Formation
First, we quantified LPA-, bradykinin-, and PDGF-induced [Ca2+]i rises in each of the established four NT and four HT fibroblast cell lines. Mean values of basal [Ca2+]i were calculated at 113±46 (n=208) and 112±36 (n=211) nmol/L, respectively, and were, thus, not significantly different. Upon stimulation by 100 nmol/L LPA, [Ca2+]i rises were distinctly higher in HT fibroblasts compared with NT fibroblasts (Fig 1ADown), and changes in [Ca2+]i averaged 560±75 versus 218±45 nmol/L (P<.01) in HT and NT fibroblasts, respectively. In contrast, [Ca2+]i increased by 853±66 and 763±47 nmol/L in HT and NT fibroblasts, respectively, stimulated with 100 nmol/L bradykinin; these figures were not significantly different (P>.3, Fig 1BDown). LPA-evoked [Ca2+]i signals were enhanced in HT fibroblasts at all concentrations studied and amounted to 234±45, 343±42, 560±75, and 561±34 nmol/L above baseline at 1, 10, 100, and 1000 nmol/L LPA, respectively (Fig 2ADown). The corresponding figures of NT fibroblasts averaged to 61±15, 165±31, 218±45, and 324±47 nmol/L above basal values upon stimulation with 1, 10, 100, and 1000 nmol/L LPA, respectively. Differences were statistically significant at all concentrations of LPA studied (P<.05 for NT versus HT). Upon treatment of fibroblasts with PTX (50 ng/mL, 5 hours), LPA (1 µmol/L)–evoked Ca2+ signals were strongly reduced and averaged 163±23 nmol/L (P<.02 for PTX versus control) and 199±34 nmol/L (P<.001 for PTX versus control) above baseline in NT and HT fibroblasts, respectively, and [Ca2+]i rises were not significantly different (P>.4 for NT versus HT). This not only confirms that LPA stimulates receptors coupled to Gi-type G proteins12 but also apparently supports our previous notion of a selectively enhanced signaling via PTX-sensitive G proteins in our highly selected hypertensive individuals.7 In contrast, bradykinin-evoked changes of [Ca2+]i were similar in NT and HT fibroblasts at all concentrations applied (Fig 2BDown). These bradykinin-evoked [Ca2+]i rises remained largely unaffected by PTX, and only a minor reduction by {approx}10% to 15% was observed in some experiments (data not shown). This is in agreement with previous reports demonstrating that this peptide activates cellular signaling mechanisms via the PTX-insensitive Gq protein.13 Interestingly, rises in [Ca2+]i were also enhanced in HT fibroblasts stimulated by 25 ng/mL PDGF (Fig 2CDown). The average increases in [Ca2+]i evoked by this growth factor amounted to 317±31 and 210±31 nmol/L in HT and NT fibroblasts, respectively (P<.05). Surprisingly, PDGF-induced [Ca2+]i increases were also partially PTX sensitive, with the observed inhibition ranging from 30% to 50% (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. LPA- and bradykinin-induced rises in [Ca2+]i in individual NT and HT fibroblast cell lines. Displayed are [Ca2+]i rises in NT (open symbols) and HT (filled symbols) cell lines upon stimulation with 100 nmol/L LPA (A) or 100 nmol/L bradykinin (B). Each symbol represents the mean of three measurements performed on a given day. The number of symbols indicates the number of independent determinations (each in triplicate), which were conducted at >2-week intervals. The different cell lines are designated N1 to N4 (NT cell lines) and H1 to H4 (HT cell lines), and the respective individuals refer to those characterized previously7 and in the TableUp. Dashed lines indicate means of all NT and HT fibroblast cell lines.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. LPA-, bradykinin-, and PDGF-evoked [Ca2+]i signals in NT and HT fibroblasts. Skin fibroblasts from normotensive (open columns) and hypertensive (filled columns) subjects were stimulated with LPA (1 to 1000 nmol/L, A), bradykinin (1 to 100 nmol/L, B), or PDGF (20 ng/mL, C). In some experiments, cells were pretreated with 50 ng/mL PTX for 4 hours and subsequently stimulated with 1 µmol/L LPA (A). Each column represents values from four NT and HT cell lines each, in which [Ca2+]i determinations have been conducted in triplicate in at least two independent measurement series, each constituting two to three determinations for each agonist concentration. Values are mean±SE. *P<.05 vs NT.

To further substantiate our hypothesis of an enhanced Gi -type G protein activation in the established HT fibroblast cell lines, we quantified [Ca2+]i rises upon stimulation with four additional different agonists that are known to activate intracellular signal transduction pathways via PTX-sensitive and/or PTX-insensitive G proteins. The putative receptor for SPP has been proposed to predominantly activate PTX-sensitive G proteins in a variety of cell types.14 SPP (1 µmol/L) increased [Ca2+]i by 227±44 and 403±19 nmol/L above baseline in NT and HT fibroblasts (Fig 3ADown), respectively (P=.013). In PTX-treated cells, this difference was completely abrogated (Fig 3ADown), and [Ca2+]i rises averaged 115±9 versus 125±21 nmol/L in NT and HT fibroblasts (P>.4 for NT versus HT), respectively. This effect of PTX on SPP-induced Ca2+ signals was statistically significant (P<.05 for control versus PTX). Thrombin, which activates PTX-sensitive as well as PTX-insensitive G proteins,15 also induced enlarged Ca2+ signals in HT fibroblasts (Fig 3BDown). [Ca2+]i rises evoked by thrombin (10 U/mL) averaged 46±6 versus 121±17 nmol/L above baseline (P<.025) in NT and HT fibroblasts, respectively. Again, this difference was almost completely abrogated by PTX (Fig 3BDown). Whereas PTX reduced the thrombin-evoked [Ca2+]i rise only slightly in NT fibroblasts (to 30±1 nmol/L, P<.05 versus control), its effect was much more marked in HT fibroblasts, with mean [Ca2+]i rises being calculated at 41±2 nmol/L (P<.01 versus control). Angiotensin II–mediated signal transduction via the AT1 receptor can involve PTX-sensitive and/or PTX-insensitive G proteins, depending on cell type or tissue investigated.16 17 Angiotensin II–evoked Ca2+ signals were slightly, albeit not significantly, higher in HT compared with NT cell lines (201±33 versus 141±19 nmol/L, P=.14, Fig 3CDown). PTX did not significantly reduce the angiotensin II–induced [Ca2+]i rise in NT fibroblasts ({Delta}[Ca2+]i=121±23 nmol/L, P>.5 versus control). In HT fibroblasts, the PTX sensitivity of angiotensin II–induced Ca2+ signals was somewhat more pronounced ({Delta}[Ca2+]i=142±23 nmol/L) but still not significantly different from untreated controls (P>.2). Thus, angiotensin II–evoked Ca2+ signals appear to be predominantly mediated by PTX-insensitive G proteins in primary human skin fibroblasts and were, in agreement with the concept proposed here, not significantly different in NT and HT fibroblasts. Finally, we stimulated NT and HT fibroblasts with ET-1. ET-1–evoked Ca2+ signals showed a tendency to be slightly higher in HT compared with NT fibroblasts (178±21 versus 133±19 nmol/L, P=.16). This tendency disappeared after PTX treatment ({Delta}[Ca2+]i=106±14 and 102±26 nmol/L for NT and HT fibroblasts, respectively). Identification of the endothelin receptor subtype mediating the ET-1–induced Ca2+ signals in human skin fibroblasts was beyond the scope of the present study.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. SPP–, thrombin (Thr)–, angiotensin II (Ang II)–, and ET-1–evoked [Ca2+]i signals in NT and HT fibroblasts. Skin fibroblasts from normotensive (open columns) and hypertensive (filled columns) subjects were stimulated with SPP (1 µmol/L, A), Thr (10 U/mL, B), Ang II (1 µmol/L, C), or ET-1 (1 µmol/L, D). In some experiments, cells were pretreated with 50 ng/mL PTX for 4 hours and subsequently stimulated with agonists, as indicated. Each column represents values from four NT and HT cell lines each, in which [Ca2+]i determinations have been conducted in triplicate in at least two independent measurement series. Values are mean±SE. *P<.05 vs NT.

Subsequently, we quantified the formation of IP3 in NT and HT fibroblasts stimulated with 100 nmol/L LPA or 100 nmol/L bradykinin (Fig 4Down). LPA-induced IP3 formation, which was completely blunted in cells pretreated with PTX, was significantly higher in HT than in NT fibroblasts and averaged 324±50% versus 219±36% of unstimulated controls (P<.05). In contrast, PTX-insensitive bradykinin-induced IP3 formation was not significantly different in HT and NT fibroblasts.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. LPA- and bradykinin-induced IP3 formation in NT and HT fibroblasts. NT (open columns) and HT (filled columns) fibroblasts labeled with [3H]inositol and pretreated or not with 100 ng/mL PTX were stimulated with 100 nmol/L LPA or 100 nmol/L bradykinin as indicated. [3H]IP3 formation was quantified as detailed in "Experimental Procedures." IP3 formation is expressed as percentage of controls, the 100% value reflecting IP3 levels in unstimulated fibroblasts. Basal IP3 levels were not different in NT and HT fibroblasts. Values are mean±SD from each of the four NT and HT cell lines. *P<.05 vs NT.

cAMP Formation in Fibroblasts
To study whether receptor signaling via Gs, the adenylyl cyclase–stimulatory G protein, is altered, NT and HT fibroblasts were stimulated with isoproterenol, an agonist of ß-adrenoceptors, coupled via Gs to adenylyl cyclase (Fig 5Down). Upon stimulation with 10 µmol/L isoproterenol, cAMP increased by factors of 6.1±1.2 and 4.3±2.2 above baseline in NT and HT fibroblasts, respectively (P>.2). When NT and HT fibroblasts were stimulated with 50 µmol/L forskolin, which directly activates adenylyl cyclase, cAMP formation was also similar in NT and HT fibroblasts and averaged to 16.2±7.3- and 17.6±9.9-fold above basal values, respectively. Thus, signal transduction via Gs is apparently not enhanced in HT fibroblasts. Subsequently, we quantified the inhibition by LPA of forskolin-stimulated cAMP formation in NT and HT fibroblasts. In these experiments, cells were stimulated with 50 µmol/L forskolin in the presence of 10 µmol/L LPA. LPA-induced inhibition of forskolin-stimulated cAMP formation was fully PTX sensitive (data not shown) and almost identical in NT and HT fibroblasts (Fig 5Down). Thus, cAMP formation averaged to 5.1±1.9- and 4.3±1.0-fold above basal values in NT and HT fibroblasts stimulated with 50 µmol/L forskolin in the presence of LPA.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Adenylyl cyclase activation in NT and HT fibroblasts. NT (open columns) and HT (filled columns) fibroblast cell lines were stimulated with 10 µmol/L isoproterenol, 50 µmol/L forskolin, or 50 µmol/L forskolin plus 10 µmol/L LPA, as indicated. cAMP formation was quantified as detailed in "Experimental Procedures" and is given as x-fold above control, ie, cAMP levels in unstimulated cells. Columns represent mean±SD from each of the four NT and HT cell lines, in which triplicate determinations had been performed.

Receptor-Regulated DNA Synthesis
DNA synthesis was quantified in NT and HT fibroblasts stimulated with LPA (10 µmol/L), PDGF (20 ng/mL), or FCS (10%) by measuring the incorporation of [3H]thymidine. DNA synthesis in response to LPA was completely PTX sensitive, whereas that induced by PDGF and FCS was reduced by 55% and 75%, respectively (Fig 6ADown). Bradykinin did not increase DNA synthesis. In NT fibroblasts (Fig 6BDown), LPA, PDGF, and FCS increased [3H]thymidine incorporation to 152±7%, 150±15%, and 214±22% of unstimulated controls, respectively (mean±SE). The corresponding values in HT fibroblasts were 196±16%, 278±22%, and 435±82%, respectively. Thus, DNA synthesis initiated via fully (LPA) or partially (PDGF, FCS) PTX-sensitive signal transduction pathways was significantly enhanced in HT fibroblasts.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. DNA synthesis in NT and HT fibroblasts. DNA synthesis was determined by measuring the incorporation of [3H]thymidine in cells stimulated with 10 µmol/L LPA, 10 ng/mL PDGF, or 10% FCS. A, Effect of PTX (100 ng/mL) on [3H]thymidine incorporation evoked by these stimuli. Data represent mean±SD and were obtained from four NT and 2 HT cell lines. B, [3H]thymidine incorporation into four NT (open columns) and four HT (filled columns) cell lines (mean±SD, triplicate determinations each). Control (100% value) is defined as [3H]thymidine incorporation into fibroblasts kept in 0.5% FCS. *P<.05 vs NT.

Expression of G Protein {alpha} and ß Subunits
To investigate whether HT fibroblasts would potentially overexpress PTX-sensitive G proteins, we performed Western blot analysis using various antibodies directed against different G protein subunits. In Fig 7ADown (left blot) is displayed a representative analysis of {alpha}-subunit expression as assessed using an anti-G{alpha}i,common antibody. This antibody detected two discrete bands of similar density in NT and HT fibroblast cell lines as well as in bovine brain membranes. An anti-G{alpha}i1,2 antibody, on the other hand, detected only one single band in NT and HT fibroblasts, respectively, but two discrete bands in brain membranes (Fig 7ADown, right blot). Thus, human skin fibroblasts predominantly express G{alpha}i2 and G{alpha}i3, but not G{alpha}i1, which was also confirmed by RT-PCR analysis (see below). Densitometric evaluation of these bands yielded no evidence for different amounts of G{alpha}i2/3 subunits in NT and HT fibroblasts. The anti-Gß1 antibody detected only very faint bands in membranes from NT and HT fibroblasts (not shown), although this subunit could be easily detected and cloned by RT-PCR (see below). Strong bands corresponding to molecular weights of {approx}37 kD were detected by specific anti-Gß2 and anti-Gß4 antibodies (Fig 7BDown), which were again not significantly different in NT and HT fibroblasts. The anti-Gß3 antibody, on the other hand, detected multiple bands (not shown), all of which appeared unspecific. To determine which potential differences in G protein {alpha}-subunit expression are detectable with our assay system, we blotted different amounts of membrane protein and probed the blots with an anti-{alpha}i,common antibody. In the representative result displayed in Fig 7CDown, relative densities of the stained bands were determined at <10, 65, 132, 952, and 3828 arbitrary units for 10, 20, 30, 50, and 75 µg of protein. We conclude from these data that a 50% to 70% difference in the amount of G proteins expressed in NT and HT cells would not have escaped detection.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 7. Western blot analysis of G protein subunit expression in NT and HT fibroblasts. Membranes from cell lines N1 to N4 and H1 to H4 were pooled separately, and 20 µg of protein was transferred to nitrocellulose as described in "Experimental Procedures." Membranes from bovine brain served as controls as indicated. Blots were probed with an anti-G{alpha}i,common antibody (A, left blot), with an antibody directed against G{alpha}i1,2 (A, right blot), or with antibodies against Gß2 (B, left blot) or Gß4 (B, right blot). The positions of standard molecular weight markers are indicated. Shown are results from each one representative experiment. C, Representative experiment in which different amounts of membrane protein were blotted as indicated, followed by probing of blots with an anti-G{alpha}i,common antibody. It is concluded that a 50% to 70% difference in G protein expression would not have escaped detection in our assays.

Cloning and Sequencing of G{alpha}i2, G{alpha}i3, Gß1, and Gß2
Since the data accumulated so far indicated a selectively enhanced signaling via PTX-sensitive G proteins in HT cells (lymphoblasts and fibroblasts), without any indications for an overexpression of G proteins, we searched for potential mutations in genes encoding for {alpha} and ß subunits of PTX-sensitive G proteins. G{alpha}i2, G{alpha}i3, Gß1, and Gß2 were considered as potential candidates, since these subunits are ubiquitously expressed,18 including in human lymphoblasts and fibroblasts as confirmed by RT-PCR analysis (not shown). In contrast, the expression of the PTX-sensitive G proteins G{alpha}o and G{alpha}i1 is far more restricted.18 Nucleotide sequences of G{alpha}i2, G{alpha}i3, Gß1, and Gß2 were identical in NT and HT cells, excluding a mutation in these proteins as the primary reason for the enhanced signal transduction.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Previous studies on immortalized B lymphoblasts from patients with EH and enhanced Na+-H+ exchanger activity have revealed an enhanced activation of PTX-sensitive G proteins.7 This conclusion was mainly based on two findings. First, HT lymphoblasts displayed enhanced [Ca2+]i signals upon stimulation with platelet-activating factor and somatostatin. Pretreatment with PTX strongly reduced these agonist-evoked Ca2+ signals, and the residual Ca2+ responses were no longer different between NT and HT cell lines. Second, both receptor-mediated stimulation and direct (by mastoparan-7) stimulation of GTP{gamma}S binding to PTX-sensitive G proteins were significantly increased in HT lymphoblasts.7 Unfortunately, B lymphoblasts apparently do not express functional receptors that are selectively coupled to PTX-insensitive G proteins, eg, Gq or Gs. Therefore, our proposal of a selective enhancement of signal transduction via PTX-sensitive G proteins in HT cell lines was based on circumstantial evidence but could not be confirmed experimentally. Thus, one of the major reasons that we established primary cultures of skin fibroblasts from the previously characterized normotensive and hypertensive individuals was because these cells express a variety of receptors that activate fairly well-described signal transduction mechanisms involving either Gi, Gq, or Gs. Clearly, the present study was not intended to be an epidemiological one but aimed at further characterizing potential changes in intracellular signal transduction pathways in previously characterized, highly selected normotensive and hypertensive individuals (see Table and Reference 7). Therefore, and because the experiments presented here were conducted on fibroblasts from only four hypertensive individuals, only speculations are possible regarding the prevalence of the "enhanced G protein activation phenotype" in the overall hypertensive population. Our patients had originally been selected on the basis of elevated Na+-H+ exchanger activity in blood cells.8 Available evidence suggests that this abnormality can be found in 30% to 50% of patients with EH.1 19 If the reason for enhanced Na+-H+ exchanger activity were the same in these patients, ie, increased responsiveness of PTX-sensitive G proteins, it could be estimated that also 30% to 50% of patients with EH may display the characteristics described here.

During the work with the established fibroblast cell lines, two major disadvantages of this system became apparent. In contrast to immortalized cells, primary cultures of skin fibroblasts proliferate very slowly, which made it very difficult to collect sufficient cell material for the repetitive experiments reported in the present study. This difficulty made it impossible, for example, to determine agonist-induced GTP{gamma}S binding as a direct measure of G protein activation or dose-response curves for all agonist-mediated cellular responses reported here, since the amount of cell material required for such experiments distinctly exceeded its availability. Second, the senescence of these cells, which became apparent at passages >20, made it imperative that all experiments were conducted at passages between 5 and 15, which imposed further limits on the number and diversity of possible experiments. Despite these limitations, the findings reported here provide novel insights into potential pathogenetic mechanisms in EH that significantly exceed those reported previously.

The results reported herein demonstrate that LPA-, SPP-, and thrombin-induced cellular responses, eg, [Ca2+]i increase, all of which were strongly PTX sensitive, were significantly enhanced in HT fibroblasts, with the exception of adenylyl cyclase inhibition (see below). The fact that this enhancement was seen with three different chemically unrelated agonists makes it unlikely, in our view, that increased agonist affinity of receptors in HT fibroblasts could explain the enhanced cellular reactivity. In contrast, PTX-insensitive signaling via receptors for bradykinin, angiotensin II, and ET-1, which is presumably mediated by Gq-type G proteins, was similar in NT and HT fibroblasts. Furthermore, isoprenaline-induced formation of cAMP, which involves the adenylyl cyclase–stimulatory G protein, Gs, was almost identical in NT and HT fibroblasts. On the other hand, the observation of a virtually identical inhibition by LPA of forskolin-stimulated cAMP formation, although PTX sensitive, was somewhat surprising. Several facts may account for this apparent inconsistency with the general hypothesis proposed here. First, we had to apply relatively high concentrations of LPA (10 µmol/L) to induce a substantial and well-reproducible inhibition of the adenylyl cyclase. It appears possible that differences in LPA-induced adenylyl cyclase inhibition between NT and HT fibroblasts would have been observed at lower agonist concentrations. Unfortunately, the establishment of complete dose-response curves was not feasible because of the lack of sufficient cell material (see above). In addition, the existence of different isoforms of adenylyl cyclase has to be considered, and these isoforms differ with respect to activation and inhibition by G protein {alpha} and ß{gamma} subunits.20 It remains unknown which of the hitherto cloned adenylyl cyclase isoforms is expressed in human skin fibroblasts. Finally, it has to be considered that the potency of G protein ß{gamma} subunits to activate or inhibit adenylyl cyclases is {approx}10-fold higher than that necessary to activate phospholipase Cß.21 It appears possible, therefore, that reduced activation of G protein {alpha} subunits in NT fibroblast still releases sufficient ß{gamma} subunits for substantial inhibition of adenylyl cyclase but that their availability becomes limiting with regard to phospholipase Cß activation. These issues require clarification in future experiments.

In general, the findings reported in the present study support our previous suggestion that signal transduction in which PTX-sensitive G proteins are involved is enhanced in EH. Pretreatment of the fibroblasts with PTX reduced PDGF-induced [Ca2+]i increase and DNA synthesis by up to 50%, and in agreement with the enhanced activation of PTX-sensitive G proteins, PDGF-induced enhanced [Ca2+]i rises and DNA synthesis were significantly enhanced in HT fibroblasts. The PTX sensitivity of PDGF signaling may appear surprising at first glance. PDGF belongs to the group of growth factors that are believed to activate signal transduction pathways involving receptor tyrosine kinases without the contribution of G proteins (for review see Reference 22). Nevertheless, evidence has been accumulated that growth factor signaling, at least in some cell types, may also involve G protein activation. For example, activation of hepatocytes by epidermal growth factor has been shown to be partially PTX sensitive.23 24 Furthermore, activation of the mitogen-activated protein kinase by the insulin-like growth factor 1 receptor in Rat-1 fibroblasts was recently shown to involve ß{gamma} subunits released from Gi-type G proteins,25 and finally, the PDGF-stimulated growth of aortic smooth muscle cells from guinea pig was found to be strongly inhibited by PTX.26 Taken together, signaling via growth factor receptors with intrinsic tyrosine kinase activity could well account for G protein activation.27 28 Whether such a mechanism actually underlies the findings reported here remains unresolved. It appears also possible that PDGF stimulation of fibroblasts induces the release of compounds, eg, sphingosine derivatives,29 which in turn stimulate PTX-sensitive G proteins,29 thereby initiating [Ca2+]i rises and DNA synthesis. However, further elucidating these mechanisms was clearly beyond the scope of the present study.

Besides providing experimental evidence that PTX-sensitive signaling pathways are enhanced in these HT cell lines, two additional major conclusions can be drawn from the present study. First, the fact that this enhanced signal transduction is also present in nontransformed primary cell lines rules out the possibility that this abnormality arises as an artifact of immortalization, with HT and NT lymphoblasts being differentially influenced by the Epstein-Barr virus genome. Second, the expression of an enhanced signal transduction in both (B lymphoblasts and fibroblasts) of these selected hypertensive individuals lends more credit to the notion that this abnormality may be inherited and potentially expressed in other body cells as well. Thus, we hypothesize that similar alterations are expressed in vascular smooth muscle cells, platelets, endothelial cells, and cardiomyocytes of these individuals, which then display an enhanced cellular response if stimulated by an agonist activating PTX-sensitive G protein–coupled receptors.

The major question to be answered in the future relates to the molecular reason(s) for this enhanced G protein activation. Heterotrimeric G proteins consist of {alpha} and ß{gamma} subunits, which display a marked diversity in terms of cloned isoforms and selective tissue distribution. Presently available evidence suggests that only the {alpha}i2 and {alpha}i3 isoforms of PTX-sensitive G proteins are expressed in lymphoblasts and fibroblasts, whereas the expression pattern of {alpha}i1 and the two {alpha}o isoforms is rather restricted. Earlier studies have made an overexpression of PTX substrates in HT cells as the reason for enhanced signal transduction unlikely.7 The results presented here add further support to this previous assumption, since from Western blot analysis of NT and HT fibroblasts, no indication for an overexpression of G{alpha}i2, G{alpha}i3, Gß2, or Gß4 was evident. This finding is in full agreement with those obtained in human platelets.30 The apparent lack of expression of Gß3 in fibroblasts is consistent with findings by Hansen et al,31 whereas the weak expression of Gß1 protein was unexpected.

We could rule out mutations in the genes encoding for G{alpha}i2, G{alpha}i3, 1, or Gß2 to be responsible for the reported alterations. However, altered posttranslational modification(s) of these {alpha} subunits, eg, lipid modifications,32 which could be functionally important, have not yet been excluded. Gß4, which from Western blot analysis appears to be abundantly expressed in skin fibroblasts, has not yet been sequenced, because only a mouse sequence is available for the encoding cDNA,33 and Gß5 appears brain specific.34 It must also be emphasized that the chosen experimental approaches are not likely suitable for detecting potential splice variants of the above G protein subunits, but experiments addressing this issue are currently being performed.

Not only {alpha} subunits but also the ß{gamma} dimers play a decisive role in the efficacy of receptor–G protein coupling. ß subunits can combine with different {gamma} subunits.35 Among these, G{gamma}5, G{gamma}7, G{gamma}10, G{gamma}11, and G{gamma}12 appear expressed in most tissues,35 36 37 38 whereas the expression of G{gamma}1, G{gamma}2, G{gamma}3, and G{gamma}8 may be tissue specific.31 36 37 39 Alterations in primary structure or posttranslational processing of any of these {gamma} subunits cannot yet be excluded.

Although the molecular reason underlying the enhanced G protein activation in HT cells remains to be elucidated, the findings in the present study may significantly contribute to the clarification of some unresolved issues and put forward a hypothesis regarding the pathogenesis of EH in that group of patients that we are investigating. One major issue concerns conflicting results regarding the potential cellular overreactivity in EH. Platelets have often been used as a model to study cellular signal transduction in hypertension, but the results reported from different groups were contradictory. For example, thrombin has been observed to evoke increased [Ca2+]i rises in platelets from hypertensive patients,40 41 whereas others could not find such increased [Ca2+]i signals upon stimulation of platelets with vasopressin.42 43 This discrepancy may be explained in terms of differential G protein activation by these agonists. The platelet V1 vasopressin receptor appears to predominantly activate Gq-type G proteins,44 the activation of which appears unchanged in EH (see above). In contrast, PTX-sensitive G proteins, which are apparently readily activated in EH, significantly contribute to thrombin-induced platelet activation.45

On the basis of the findings presented here, we would like to propose a hypothetical scenario to explain pathogenetic mechanisms that could be operative in those patients with essential hypertension who display the enhanced Na+-H+ exchanger phenotype. We propose that the basic abnormality resides in an enhanced activation of PTX-sensitive G proteins. This would explain increased immediate cellular responses, such as platelet activation and vasoconstriction, provided that these cells are stimulated with an appropriate agonist. Since Gi-type G proteins are also important mediators of cell proliferation, we propose that the described abnormality could also significantly contribute to abnormal growth phenomena in EH, eg, left ventricular hypertrophy (which, in some individuals, may develop before the establishment of hypertension46 ) and/or media hypertrophy of blood vessels. Potentially, the phenotype described here could also constitute the missing link between hypertension, atherosclerosis, and coronary heart disease. Available concepts propose an important role for cytokines, such as PDGF, in the development of these disorders.47 48 Provided that signal transduction of PDGF partially involves PTX-sensitive G proteins not only in skin fibroblasts but also in vascular smooth muscle cells and cardiac fibroblasts, enhanced signaling via such G proteins could be a major step in the development of these hypertension-associated complications. Finally, the proposed "G protein concept of hypertension" appears ideally suited to fit within the framework of current understandings regarding the contribution of genes versus environment in the pathogenesis of hypertension. Thus, an enhanced activation of PTX-sensitive G proteins would provide the inherited susceptibility for hypertension without necessarily being sufficient to establish hypertension by itself. This proposed genetic background may become important only when the respective signal transduction pathways are excessively stimulated. One can easily envisage exogenous factors, eg, smoking or stress, which by increasing circulating hormones/neurotransmitters could increase the frequency by which this enhanced signal transduction mechanism is in use, which then could be a decisive or aggravating step in the development of hypertension and related disorders.


*    Selected Abbreviations and Acronyms
 
EH = essential hypertension
ET-1 = endothelin-1
GTP{gamma}S = guanosine 5'-[{gamma}-thio]triphosphate
HT, NT cells = cell lines established from hypertensive and normotensive subjects
IP3 = inositol 1,4,5-tris-phosphate
LPA = lyso-phosphatidic acid
PCR = polymerase chain reaction
PDGF = platelet-derived growth factor
PTX = pertussis toxin
RT = reverse transcriptase
SPP = sphingosine-1-phosphate
TBS = Tris-buffered saline


*    Acknowledgments
 
This study was supported by the Deutsche Forschungsgemeinschaft, the Deutsche Stiftung fur Herzforschung e.V. (Frankfurt/Main), and the Fritz Thyssen-Stiftung. Dr Pietruck is the recipient of a fellowship from the Deutsche Forschungsgemeinschaft. The technical assistance of Gerlinde Siffert (Institut fur Pharmakologie) and Ursula Schmucker (Institut fur Molekularbiologie) is greatly appreciated.

Received April 15, 1996; accepted August 26, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Siffert W, Dusing R. Sodium-proton exchange and primary hypertension: an update. Hypertension. 1995;26:649-655.[Abstract/Free Full Text]

2. Siffert W, Dusing R. Na+/H+ exchange in hypertension and in diabetes mellitus: facts and hypotheses. Basic Res Cardiol. 1996;91:179-190.[Medline] [Order article via Infotrieve]

3. Rosskopf D, Fromter E, Siffert W. Hypertensive sodium-proton exchanger phenotype persists in immortalized lymphoblasts from essential hypertensive patients: a cell culture model for human hypertension. J Clin Invest. 1993;92:2553-2559.

4. Rosskopf D, Schroder K-J, Siffert W. Role of sodium-hydrogen exchange in the proliferation of immortalised lymphoblasts from patients with essential hypertension and normotensive subjects. Cardiovasc Res. 1995;29:254-259.[Medline] [Order article via Infotrieve]

5. Rosskopf D, Hartung K, Hense J, Siffert W. Enhanced immunoglobulin formation of immortalized B cells from hypertensive patients. Hypertension. 1995;26:432-435.[Abstract/Free Full Text]

6. Ng LL, Sweeney FP, Siczkowski M, Davies JE, Quinn PA, Krolewski B, Krolewski AS. Na+/H+ antiporter phenotype, abundance, and phosphorylation of immortalized lymphoblasts from humans with hypertension. Hypertension. 1995;25:971-977.[Abstract/Free Full Text]

7. Siffert W, Rosskopf D, Moritz A, Wieland T, Kaldenberg-Stasch S, Kettler N, Hartung K, Beckmann S, Jakobs KH. Enhanced G protein activation in immortalized lymphoblasts from patients with essential hypertension. J Clin Invest. 1995;96:759-766.

8. Rosskopf D, Siffert G, Osswald U, Witte K, Dusing R, Akkerman JWN, Siffert W. Platelet Na+/H+ exchange activity in normotensive and hypertensive subjects: effect of enalapril therapy upon antiport activity. J Hypertens. 1992;10:839-847.[Medline] [Order article via Infotrieve]

9. Gilman AG. A protein binding assay for adenosine 3': 5'-cyclic monophosphate. Proc Natl Acad Sci U S A. 1970;67:305-312.[Abstract/Free Full Text]

10. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254.[Medline] [Order article via Infotrieve]

11. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680-685.[Medline] [Order article via Infotrieve]

12. van-Corven EJ, Hordijk PL, Medema RH, Bos JL, Moolenaar WH. Pertussis toxin-sensitive activation of p21ras by G protein-coupled receptor agonists in fibroblasts. Proc Natl Acad Sci U S A. 1993;90:1257-1261.[Abstract/Free Full Text]

13. LaMorte VJ, Harootunian AT, Spiegel AM, Tsien RY, Feramisco JR. Mediation of growth factor induced DNA synthesis and calcium mobilization by Gq and Gi2. J Cell Biol. 1993;121:91-99.[Abstract/Free Full Text]

14. Van Koppen CJ, Heringdorf DMZ, Laser KT, Zhang CY, Jakobs KH, Bunemann M, Pott L. Activation of a high affinity Gi protein-coupled plasma membrane receptor by sphingosine-1-phosphate. J Biol Chem. 1996;271:2082-2087.[Abstract/Free Full Text]

15. Kanthou C, Kanse SM, Kakkar VV, Benzakour O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in {alpha}-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 1996;8:59-66.[Medline] [Order article via Infotrieve]

16. Ohya Y, Sperelakis N. Involvement of a GTP-binding protein in stimulating action of angiotensin II on calcium channels in vascular smooth muscle cells. Circ Res. 1991;68:763-771.[Abstract/Free Full Text]

17. Pfeilschifter J, Bauer C. Pertussis toxin abolishes angiotensin II–induced phosphoinositide hydrolysis and prostaglandin synthesis in rat renal mesangial cells. Biochem J. 1986;236:289-294.[Medline] [Order article via Infotrieve]

18. Nurnberg B, Gudermann T, Schultz G. Receptors and G proteins as primary components of transmembrane signal transduction, 2: G proteins: structure and function. J Mol Med. 1995;73:123-132.[Medline] [Order article via Infotrieve]

19. Rosskopf D, Dusing R, Siffert W. Membrane sodium-proton exchange and primary hypertension. Hypertension. 1993;21:607-617.[Abstract/Free Full Text]

20. Taussig R, Gilman AG. Mammalian membrane-bound adenylyl cyclases. J Biol Chem. 1995;270:1-4.[Free Full Text]

21. Ueda N, Iniguez-Lluhi JA, Lee E, Smrcka AV, Robishaw JD, Gilman AG. G protein ß{gamma} subunits: simplified purification and properties of novel isoforms. J Biol Chem. 1994;269:4388-4395.[Abstract/Free Full Text]

22. Malarkey K, Belham CM, Paul A, Graham A, McLees A, Scott PH, Plevin R. The regulation of tyrosine kinase signalling pathways by growth factor and G-protein-coupled receptors. Biochem J. 1995;309:361-375.

23. Yang L, Baffy G, Rhee SG, Manning D, Hansen CA, Williamson JR. Pertussis toxin-sensitive Gi protein involvement in epidermal growth factor-induced activation of phospholipase C-{gamma} in rat hepatocytes. J Biol Chem. 1991;266:22451-22458.[Abstract/Free Full Text]

24. Yang L, Camoratto AM, Baffy G, Raj S, Manning DR, Williamson JR. Epidermal growth factor-mediated signaling of Gi-protein to activation of phospholipases in rat-cultured hepatocytes. J Biol Chem. 1993;268:3739-3746.[Abstract/Free Full Text]

25. Luttrell LM, Van Biesen T, Hawes BE, Koch WJ, Touhara K, Lefkowitz RJ. Gß{gamma} subunits mediate mitogen-activated protein kinase activation by the tyrosine kinase insulin-like growth factor 1 receptor. J Biol Chem. 1995;270:16495-16498.[Abstract/Free Full Text]

26. Zhang LM, Newman WH, Castresana MR, Hildebrandt JD. The effect of pertussis toxin on the growth of vascular smooth muscle cells stimulated by serum or platelet-derived growth factor. Endocrinology. 1994;134:1297-1304.[Abstract/Free Full Text]

27. Ramirez I, Tebar F, Grau M, Soley M. Role of heterotrimeric G-proteins in epidermal growth factor signalling. Cell Signal. 1995;7:303-311.[Medline] [Order article via Infotrieve]

28. Ives HE. GTP binding proteins and growth factor signal transduction. Cell Signal. 1991;3:491-499.[Medline] [Order article via Infotrieve]

29. Jacobs LS, Kester M. Sphingolipids as mediators of effects of platelet-derived growth factor in vascular smooth muscle cells. Am J Physiol.. 1993;265:C740-C747.[Abstract/Free Full Text]

30. McLellan AR, Milligan G, Houslay MD, Connell JMC. G-proteins in essential hypertension: a study on human platelet plasma membranes. J Hypertens. 1993;11:543-549.[Medline] [Order article via Infotrieve]

31. Hansen CA, Schroering AG, Robishaw JD. Subunit expression of signal transducing G proteins in cardiac tissue: implications for phospholipase C-ß regulation. J Mol Cell Cardiol. 1995;27:471-484.[Medline] [Order article via Infotrieve]

32. Wedegaertner PB, Wilson PT, Bourne HR. Lipid modifications of trimeric G proteins. J Biol Chem. 1995;270:503-506.[Free Full Text]

33. von Weizsacker E, Strathmann MP, Simon MI. Diversity among the ß subunits of heterotrimeric GTP-binding proteins: characterization of a novel ß-subunit cDNA. Biochem Biophys Res Commun. 1992;183:350-356.[Medline] [Order article via Infotrieve]

34. Watson AJ, Katz A, Simon MI. A fifth member of the mammalian G-protein ß-subunit family: expression in brain and activation of the ß2 isotype of phospholipase C. J Biol Chem. 1994;269:22150-22156.[Abstract/Free Full Text]

35. Kausik R, Kunsch C, Bonner LM, Robishaw JD. Isolation of cDNA clones encoding eight different human G protein {gamma} subunits, including three novel forms designated the {gamma}4, {gamma}10, and {gamma}11 subunits. J Biol Chem. 1995;270:21765-21771.[Abstract/Free Full Text]

36. Cali JJ, Balcueva EA, Rybalkin I, Robishaw JD. Selective tissue distribution of G protein {gamma} subunits, including a new form of the {gamma} subunits identified by cDNA cloning. J Biol Chem. 1992;267:24023-24027.[Abstract/Free Full Text]

37. Asano T, Morishita R, Ohashi K, Nagahama M, Miyake T, Kato K. Localization of various forms of the {gamma} subunit of G protein in neural and nonneural tissues. J Neurochem. 1995;64:1267-1273.[Medline] [Order article via Infotrieve]

38. Morishita R, Nakayama H, Isobe T, Matsuda T, Hashimoto Y, Okano T, Fukada Y, Mizuno K, Ohno S, Kozawa O, Kato K, Asano T. Primary structure of a {gamma} subunit of G protein, {gamma}12, and its phosphorylation by protein kinase C. J Biol Chem. 1995;270:29469-29475.[Abstract/Free Full Text]

39. Ryba NJP, Tirindelli R. A novel GTP-binding protein {gamma}-subunit, G{gamma}8, is expressed during neurogenesis in the olfactory and vomeronasal neuroepithelia. J Biol Chem. 1995;270:6757-6767.[Abstract/Free Full Text]

40. Poch E, Botey A, Gaya J, Darnell A, Rivera F, Revert L. Intracellular calcium concentration and activation of the Na+/H+ exchanger in essential hypertension. Kidney Int. 1994;45:1037-1043.[Medline] [Order article via Infotrieve]

41. Lechi A, Lechi C, Bonadonna G, Sinigaglia D, Corradini P, Polignano R, Arosio E, Covi G, de Togni P. Increased basal and thrombin-induced free calcium in platelets of essential hypertensive patients. Hypertension. 1987;9:230-235.[Abstract/Free Full Text]

42. Dominiczak AF, Morton JJ, Murray G, Semple PF. Platelet cytosolic free calcium in essential hypertension: responses to vasopressin. Clin Sci. 1989;77:183-188.[Medline] [Order article via Infotrieve]

43. Miller MA, Sagnella GA, Markandu ND, MacGregor GA. Determinants of platelet intracellular free calcium in essential hypertension and effect of stimulation by arginine vasopressin. Am J Hypertens. 1993;6:209-216.[Medline] [Order article via Infotrieve]

44. Thibonnier M, Goraya T, Berti-Mattera L. G protein coupling of human platelet V1 vascular vasopressin receptors. Am J Physiol. 1993;264:C1336-C1344.[Abstract/Free Full Text]

45. Brass LF, Laposata M, Singh Banga H, Rittenhouse SE. Regulation of the phosphoinositide hydrolysis pathway in thrombin-stimulated platelets by a pertussis toxin-sensitive guanine nucleotide-binding protein. J Biol Chem. 1986;261:16838-16847.[Abstract/Free Full Text]

46. Hansen HS, Nielsen JR, Hyldebrandt N, Froberg K. Blood pressure and cardiac structure in children with a parental history of hypertension: the Odense Schoolchild Study. J Hypertens. 1992;10:677-682.[Medline] [Order article via Infotrieve]

47. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791-804.[Medline] [Order article via Infotrieve]

48. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
N. Wettschureck and S. Offermanns
Mammalian G Proteins and Their Cell Type Specific Functions
Physiol Rev, October 1, 2005; 85(4): 1159 - 1204.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. K. Brar, A. Chen, M. H. Perrin, and W. Vale
Specificity and Regulation of Extracellularly Regulated Kinase1/2 Phosphorylation through Corticotropin-Releasing Factor (CRF) Receptors 1 and 2{beta} by the CRF/Urocortin Family of Peptides
Endocrinology, April 1, 2004; 145(4): 1718 - 1729.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Izawa, Y. Yamada, T. Okada, M. Tanaka, H. Hirayama, and M. Yokota
Prediction of Genetic Risk for Hypertension
Hypertension, May 1, 2003; 41(5): 1035 - 1040.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
W. Siffert
Effects of the G protein {beta}3-subunit gene C825T polymorphism: should hypotheses regarding the molecular mechanisms underlying enhanced G protein activation be revised? Focus on "A splice variant of the G protein {beta}3-subunit implicated in disease states does not modulate ion channels"
Physiol Genomics, April 16, 2003; 13(2): 81 - 84.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Heusch, R. Erbel, and W. Siffert
Genetic determinants of coronary vasomotor tone in humans
Am J Physiol Heart Circ Physiol, October 1, 2001; 281(4): H1465 - H1468.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
K. Okumura, T. Osanai, T. Kosugi, H. Hanada, H. Ishizaka, T. Fukushi, T. Kamada, T. Miura, T. Hatayama, T. Nakano, et al.
Enhanced phospholipase C activity in the cultured skin fibroblast obtained from patients with coronary spastic angina: possible role for enhanced vasoconstrictor response
J. Am. Coll. Cardiol., November 15, 2000; 36(6): 1847 - 1852.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
W. Siffert
G protein {beta}3 subunit 825T allele, hypertension, obesity, and diabetic nephropathy
Nephrol. Dial. Transplant., September 1, 2000; 15(9): 1298 - 1306.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
W. SIFFERT, P. FORSTER, K.-H. JÖCKEL, D. A. MVERE, B. BRINKMANN, C. NABER, R. CROOKES, A. D. P. HEYNS, J. T. EPPLEN, J. FRIDEY, et al.
Worldwide Ethnic Distribution of the G Protein {beta}3 Subunit 825T Allele and Its Association with Obesity in Caucasian, Chinese, and Black African Individuals
J. Am. Soc. Nephrol., September 1, 1999; 10(9): 1921 - 1930.
[Abstract] [Full Text]


Home page
HypertensionHome page
E. Brand, S.-M. Herrmann, V. Nicaud, J.-B. Ruidavets, A. Evans, D. Arveiler, G. Luc, P.-F. Plouin, L. Tiret, and F. Cambien
The 825C/T Polymorphism of the G-Protein Subunit ß3 Is Not Related to Hypertension
Hypertension, May 1, 1999; 33(5): 1175 - 1178.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. V. Benjafield, C. L. Jeyasingam, D. R. Nyholt, L. R. Griffiths, and B. J. Morris
G-Protein ß3 Subunit Gene (GNB3) Variant in Causation of Essential Hypertension
Hypertension, December 1, 1998; 32(6): 1094 - 1097.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. A. Hegele, S. B. Harris, A. J. G. Hanley, H. Cao, and B. Zinman
G Protein ß3 Subunit Gene Variant and Blood Pressure Variation in Canadian Oji-Cree
Hypertension, October 1, 1998; 32(4): 688 - 692.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Schunkert, H.-W. Hense, A. Doring, G. A. J. Riegger, and W. Siffert
Association Between a Polymorphism in the G Protein ß3 Subunit Gene and Lower Renin and Elevated Diastolic Blood Pressure Levels
Hypertension, September 1, 1998; 32(3): 510 - 513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pietruck, F.
Right arrow Articles by Siffert, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pietruck, F.
Right arrow Articles by Siffert, W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Medline Plus Health Information
*High Blood Pressure