Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1996;79:920-929

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiojima, I.
Right arrow Articles by Yazaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiojima, I.
Right arrow Articles by Yazaki, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
(Circulation Research. 1996;79:920-929.)
© 1996 American Heart Association, Inc.


Articles

Molecular Cloning and Characterization of Human Cardiac Homeobox Gene CSX1

Ichiro Shiojima, Issei Komuro, Takehiko Mizuno, Ryuichi Aikawa, Hiroshi Akazawa, Toru Oka, Tsutomu Yamazaki, Yoshio Yazaki

the Department of Medicine III, University of Tokyo (Japan) School of Medicine.

Correspondence to Issei Komuro, Department of Medicine III, University of Tokyo School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan. E-mail komuro-tky@umin.u-tokyo.ac.jp.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Accumulating evidence has suggested that homeodomain-containing proteins play critical roles in regulating the tissue-specific gene expression essential for tissue differentiation and in determining the temporal and spatial patterns of development. In order to elucidate the mechanisms of human heart development, we have isolated a human homologue of the murine cardiac homeobox gene Csx (also called Nkx-2.5) and denoted it as CSX1. The amino acid sequence of the CSX1 homeodomain is 100% and 67% identical to that of murine Csx/Nkx-2.5 and Drosophila tinman, respectively. CSX1 has at least three isoforms generated by an alternative splicing mechanism. One of these isoforms (CSX1a) encodes a protein of {approx}35 kD that possesses the homeodomain, whereas the other two (CSX1b and CSX1c) encode a truncated protein of {approx}12 kD that is identical to the CSX1a protein at the amino-terminal 112 amino acids but lacks the homeodomain. Northern blot analysis showed that CSX1 transcripts are abundantly expressed in both fetal and adult hearts, but no signal was detected in other human tissues examined. Amplification of each isoform by reverse transcriptase–polymerase chain reaction revealed that all of the three isoforms are expressed in fetal and adult hearts and that the homeobox-containing isoform CSX1a is most abundant. The homeodomain-containing protein encoded by CSX1a binds to Csx/Nkx-2.5 binding sequences and transactivates the sequence-containing luciferase reporter gene. Unexpectedly, the homeodomain-lacking protein encoded by CSX1b also transactivates the reporter gene, although CSX1b does not bind to the Csx/Nkx-2.5 binding sequences. The highly conserved homeodomain sequence in evolution and the restricted expression in the heart suggest that CSX1 plays an important role in the development and differentiation of the human heart and that there may be two different mechanisms in transcriptional regulation by the CSX1 protein, homeodomain-dependent and -independent mechanisms.


Key Words: cardiac development • cardiac-specific gene expression • transcription factor • alternative splicing • evolution


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Homeobox-containing genes were first identified as genes responsible for homeotic mutations in Drosophila. A homeobox is a 180-bp conserved sequence motif that encodes a helix-turn-helix DNA binding domain called the homeodomain.1 2 Homeobox genes exist in a wide variety of metazoan genomes and encode sequence-specific DNA binding transcription factors that play fundamental roles in the temporal and spatial pattern formation or in the commitment of cells to specific developmental pathways.3 4 5 Mammalian homeobox genes could be divided into two classes, Hox class genes and non-Hox class genes. Hox class genes exist in four clusters in the mammalian genome, and each cluster exhibits intriguing similarities to the complement of the Drosophila HOM-C genes, not only in the homeodomain sequences but also in the temporal order of the activation and regionally restricted expression patterns.6 7 In addition, ectopic overexpression of mammalian Hox genes in Drosophila mimics in part the effect of the overexpression of the Drosophila homologous genes,8 9 and disruption of Hox genes shows the phenotype similar to the loss-of-function mutants of corresponding Drosophila HOM-C genes.10 11 These results suggest that, like HOM-C genes, Hox class genes appear to convey positional information rather than specification of cell types.

As for cell-type specification, lineage-restricted transcription factors play an important role in lineage commitment and tissue differentiation. For example, the MyoD gene family of skeletal muscle–specific transcription factors plays a critical role in skeletal muscle differentiation.12 13 Many non-Hox class homeobox genes have been identified to date, and some of them, eg, Pit-1,14 TTF-1 (also called Nkx-2.1),15 16 or Gtx,17 show restricted expression patterns in specific tissues or cell types, suggesting their role in the differentiation of the tissues. In fact, Pit-1 is expressed only in the anterior pituitary gland and is necessary for the differentiation of the pituitary cells.14 18 Therefore, a homeobox gene of the non-Hox class whose expression is restricted to specific cell lineages may be of interest as a candidate for a "cell-type commitment" gene.

It has been demonstrated that a Drosophila homeobox-containing gene, tinman, is expressed in the developing dorsal vessel, an insect equivalent of the vertebrate heart.19 Mutations in tinman result in loss of heart formation in the embryo, suggesting that tinman is essential for Drosophila heart formation.20 21 Recently Csx (also called Nkx-2.5), which is a non-Hox class homeoprotein and a presumptive murine homologue of tinman, has been isolated and characterized.22 23 The expression of Csx/Nkx-2.5 is observed in the cardiac progenitor cells and in the heart from the time of the heart differentiation to the adult stage and is detected earlier than the expression of cardiac-specific genes. Furthermore, targeted disruption of murine Csx/Nkx-2.5 results in morphogenetic defects of the heart tube and in embryonic lethality.24 These results strongly suggest that the Csx/Nkx-2.5tinman homeobox gene family may play important roles in cardiac differentiation in vertebrates as well as in Drosophila. Other possible cardiogenic factors, such as GATA-425 and the MEF2 family of transcription factors,26 are also expressed in the cardiac progenitor cells at almost the same developmental stage as Csx/Nkx-2.5, suggesting that these factors may cooperatively regulate the differentiation of cardiac myocytes.

In the present study, in order to elucidate the mechanisms of the human heart development, we have isolated and characterized CSX1, a human homologue of the murine cardiac homeobox gene Csx/Nkx-2.5. The similarity in amino acid sequences and expression patterns between CSX1, Csx/Nkx-2.5, and tinman suggests that the Csx/Nkx-2.5tinman family is highly conserved in evolution and that CSX1 plays an important role in the development and differentiation of the human heart. In addition, CSX1 has at least three isoforms produced by alternative splicing mechanisms, and one of the three isoforms encodes a homeodomain-containing protein, whereas the other two encode a truncated protein that lacks a homeodomain. Interestingly, cotransfection analysis with Csx/Nkx-2.5 binding sequence–containing reporter gene revealed that not only the homeodomain-containing protein but also the homeodomain-lacking one function as a transcriptional activator, although the latter did not bind to the Csx/Nkx-2.5 binding sequences.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Screening of Libraries and DNA Sequencing
The human fetal heart cDNA library constructed in {lambda}gt 11 (Clontech) was screened with the 1.0-kb EcoRI fragment of murine Csx cDNA as a probe. Approximately 1.0x106 plaques were plated, and nylon replicas were prepared using Colony/Plaque Screen (NEN). Hybridization was performed at 42°C for 16 hours in a solution containing 50% formamide, 2x SSC, 10% dextran sulfate, 1% SDS, 2.5x Denhardt's solution, and 100 µg/mL salmon sperm DNA. Filters were washed to a stringency of 0.1x SSC/0.1% SDS at room temperature and exposed for 24 hours at -80°C to XAR-5 film (Kodak). Positive recombinant phages were purified by sequential screening at low plaque density. Phage DNA of isolated positive clones was prepared by Lambda Mini Kit (QIAGEN), and EcoRI-excised cDNA inserts were subcloned into pBluescript plasmid vector. Screening of the human genomic DNA library constructed in {lambda}FIX II (Stratagene) with 32P-labeled CSX1a cDNA was performed by using essentially the same protocol as that used for cDNA library screening. Inserts of the positive clone excised by Not I were subcloned into pBluescript.

Sequencing of the isolated cDNA and genomic clones was performed by the dideoxy chain–termination method using the Taq Dyedeoxy Terminator cycle sequencing kit and 373A automated sequencer (Applied Biosystems) according to the manufacturer's directions.

Southern Blot Analysis
Genomic DNA (20 µg) prepared from HeLa cells was digested with BamHI, EcoRI, and HindIII and electrophoresed on 0.6% agarose gel. After blotting to Hybond-N, the DNA was hybridized with a 32P-labeled CSX1a cDNA probe at 42°C for 16 hours in 50% formamide, 2x SSC, 1% SDS, 5x Denhardt's solution, and 100 µg/mL salmon sperm DNA. The blot was washed to a stringency of 0.1x SSC/0.1% SDS at 42°C and exposed to x-ray film for 12 hours at -80°C.

Northern Blot Analysis
Human MTN blot and human fetal MTN blot (Clontech) were used for Northern blot analysis. Each lane contains 2 µg of poly(A)+ RNA from various human tissues. Blots were hybridized with 32P-labeled CSX1a cDNA probe at 42°C for 16 hours in 50% formamide, 5x SSPE, 1% SDS, 5x Denhardt's solution, and 100 µg/mL salmon sperm DNA, washed to a stringency of 0.1% SDS at 42°C, and exposed to x-ray film for 12 hours at -80°C. The filters were rehybridized sequentially with GAPDH cDNA probe to show the integrity of mRNA.

Amplification of the Isoform-Specific Sequences by RT-PCR
To examine the expression pattern of the three CSX1 isoforms, a pair of primers (primer 1, 5'CTT CAA GCC AGA GGC CTA CG-3'; primer 2, 5'-CCG CCT CTG TCT TCT TCA GC-3' [indicated as P1 and P2, respectively, in Fig 1BDown]) were synthesized, ie, expected to amplify different sizes of isoform-specific PCR products (233 bp for CSX1a, 416 bp for CSX1b, and 525 bp for CSX1c). cDNA was synthesized from fetal and adult human heart poly(A)+ RNA (0.5 µg each) by Moloney murine leukemia virus RT with random primers, and PCR was performed with the synthesized cDNA as a template. The cycling conditions were as follows: 5 minutes at 94°C for the initial denaturation step, followed by 35 cycles of 1 minute at 94°C (denaturation), 30 seconds at 60°C (annealing), and 2 minutes at 72°C (elongation). The PCR products were electrophoresed on 2.2% agarose gel, transferred to Hybond-N nylon membrane (Amersham), and hybridized with 5' end-labeled internal oligonucleotides (5'-TTC TAT CCA CGT GCC TAC AG-3', indicated as IP in Fig 1BDown). Hybridization was performed at 42°C for 16 hours in 6x SSC, 0.4% SDS, 5x Denhardt's solution, 20 mmol/L NaH2PO4, and 0.5 mg/mL salmon sperm DNA. The blot was washed to a stringency of 2x SSC/0.1% SDS at 42°C and exposed to x-ray film for 6 hours at -80°C.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide and deduced amino acid sequence of CSX1. A, Nucleotide and amino acid sequence of CSX1. The predicted amino acid sequence is shown in the one-letter code under the nucleotide sequence. The start and stop codons are in boldface type, and the homeobox is boxed. Insertional sequences specific for CSX1b and CSX1c are indicated by braces and brackets, respectively. The TN domain is underlined, and the NK-2–specific domain is doubly underlined under the amino acid sequence. The mRNA instability sequence is underlined, and the polyadenylation site is doubly underlined under the nucleotide sequence. The number of nucleotides and amino acids of CSX1 is indicated. B, Schematic diagram of the CSX1 cDNAs. The black box represents the homeobox. Primers used for isoform-specific cDNA amplification (P1 and P2) are indicated. IP represents the internal probe used for Southern blot analysis. Start and stop codons and a polyadenylation signal are also indicated. C, Schematic diagram of CSX1 protein. The black box represents the homeodomain. Proline/alanine-rich regions (Pro/Ala), charged amino acid region (+-+-+-), TN domain (dense stripes), and the NK-2–specific domain (sparse stripes) are shown. D, Comparison of the CSX1 homeodomain and the homeodomains of other NK family–related and HOM-C/Hox class homeobox genes. Amino acid identity with CSX1 is indicated by a dash, and the percent identity with CSX1 is shown at the right. Three homeodomain helixes are indicated with boxes at the bottom. Asterisks on top represent putative DNA contact sites.2 E, Comparison of the NK-2–specific domain of CSX1 with those of other NK family–related genes. F, Comparison of the TN domain of CSX1 with the domains of other NK family–related genes.

Transient Transfection and Luciferase Assay
For transient transfection, a eukaryotic expression vector containing the human elongation factor 1{alpha} promoter pEFSA27 was used. pEFSA-CSX1a and pEFSA-CSX1b contain cDNA of CSX1a and CSX1b and express the homeodomain-containing and the homeodomain-lacking CSX1 protein, respectively. pEFSA-CSX1a{Delta}C and pEFSA-CSX1a{Delta}N contain PCR-amplified cDNA fragments corresponding to the NH2-terminal domain and homeodomain of CSX1a protein (amino acids 1 to 201) and the homeodomain and COOH-terminal domain of CSX1a protein (amino acids 125 to 324), respectively. 4x(TTF-1)-tk-luc reporter gene was generated by subcloning four tandem copies of the TTF-1 binding sequences (CACTGCCCAGTCAAGTGTTC)28 into the pT81luc vector containing the tk minimum promoter linked to the firefly luciferase gene.29 Transient transfections were performed by the standard calcium phosphate method30 in COS-7 cells using 0.2 µg of reporter gene and 0.06 to 2.0 µg of effector plasmid per 3.5-cm dish. Total amounts of DNA were kept constant (2.5 µg per dish) by adding appropriate amounts of pEFSA plasmid DNA. Cells were seeded at a density of 5.0x104 cells per dish 24 hours before transfection, and luciferase activities were measured by using a Berthold Lumat LB9501 luminometer at 48 hours after transfection. Differences in transfection efficiency were corrected by ß-galactosidase activities of cotransfected simian virus 40–ß-galactosidase plasmids. Experiments were repeated at least six times, and the data are shown as mean±SEM.

Western Blot Analysis
To generate expression vectors of the epitope-tagged CSX1 proteins, the corresponding cDNA fragment was amplified by PCR with influenza HA sequence containing 5' primers and subcloned into the pEFSA vector (pEFSA-HA-CSX1a, pEFSA-HA-CSX1b, pEFSA-HA-CSX1a{Delta}C, and pEFSA-HA-CSX1a{Delta}N). COS-7 cells were transiently transfected with pEFSA-HA-CSX plasmids (20 µg of each pEFSA-HA-CSX DNA per 10-cm dish). After 48 hours, whole-cell lysates were prepared, electrophoresed by 15% SDS-polyacrylamide gel, and blotted onto nitrocellulose membranes (Hybond ECL, Amersham). The membrane was incubated with an anti-HA monoclonal antibody 12CA5 and a secondary rabbit anti-mouse IgG antibody conjugated with horseradish peroxidase. Signals were visualized by using an ECL Western blotting detection system (Amersham) according to the manufacturer's directions.

In Vitro Transcription and Translation of CSX1 Protein
PCR-amplified cDNA fragments corresponding to CSX1a, CSX1b, CSX1a{Delta}C, and CSX1a{Delta}N were subcloned into pSPUTK vector (Promega) containing SP6 RNA polymerase promoter and the sequence of Xenopus ß-globin 5'-untranslated region. Each protein was transcribed and translated in vitro using the TNT SP6 coupled reticulocyte lysate system (Promega).

EMSA
Oligonucleotides corresponding to both strands of the TTF-1 binding sequences were synthesized with GATC nucleotides overhanging at the 5' terminal of each oligonucleotide. The complementary two oligos were annealed and labeled by [{alpha}-32P]dCTP with Klenow enzyme. Labeled oligonucleotide probes ({approx}10 000 cpm) were incubated with 5 µg of in vitro–translated CSX1 protein and 2 µg of poly(dI-dC) in 20 µL of binding buffer (10 mmol/L Tris-HCl, pH 7.5, 50 mmol/L NaCl, 10% glycerol, 0.5 mmol/L dithiothreitol, and 0.05% Nonidet P-40) for 30 minutes at 4°C. The protein-DNA mixture was resolved in 5% polyacrylamide gel in 1x TAE buffer at 4°C for 2 hours at 150 V.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Isolation of CSX1 cDNA Clones
From {approx}1.0x106 recombinant phages screened, 10 positive clones were isolated. Among them, we extensively studied three clones, designated as CSX1a, CSX1b, and CSX1c, because they were considered to encode full open reading frames of CSX1. The nucleotide and predicted amino acid sequences of CSX1a, CSX1b, and CSX1c are shown in Fig 1AUp. The possible initiation methionine codon is in a favorable context for the Kozak consensus sequence,31 and there are no other in-frame ATG codons upstream. In the 3'-untranslated region, there is a consensus mRNA destabilization sequence (TATTTAT)32 and a polyadenylation signal (ATTAAA)33 14 bp upstream from the 3'-terminal poly(A)+ tract. CSX1b and CSX1c have an additional insertion of 182 bp (indicated by braces in Fig 1AUp) and 292 bp (indicated by brackets in Fig 1AUp), respectively, at the coding region 80 bp upstream from the homeobox. The 182-bp sequence at the 5' region of CSX1c insertion is identical to the insertional sequence of CSX1b, and an in-frame stop codon appears at the 5' end of this insertion (Fig 1A and 1BUpUp). The overall homology at the nucleotide level between murine Csx and CSX1 is {approx}80% for CSX1a and {approx}70% for both CSX1b and CSX1c, calculated by the best-fit alignment program of GENETYX-MAC (Software Development Co).

CSX1a has a 972-bp open reading frame and is predicted to encode a polypeptide of 324 amino acids with a molecular mass of {approx}35 kD. CSX1a protein has a homeodomain in the center of the protein, and at both the amino- and carboxy-terminal sides of the homeodomain, there are two regions containing many proline and alanine residues. The amino-terminal region adjacent to the homeodomain contains many amino acids with charged side chains (Fig 1CUp). CSX1b and CSX1c have a common 336-bp open reading frame and are predicted to encode a truncated protein of 112 amino acids with a molecular mass of {approx}12 kD. This protein lacks the homeodomains and has a proline/alanine-rich region and a part of charged amino acid region at the carboxy-terminal end of the protein (Fig 1CUp).

The homeodomain sequences of CSX1 and other homeobox genes are shown in Fig 1DUp. The sequence homology between the CSX1 homeodomain and that of other related genes in vertebrates is 100% for murine Csx/Nkx-2.5, 95% for XCsx/XNkx-2.5, 93% for murine Nkx-2.3, and 92% for XNkx-2.3, respectively (References 22, 23, 34, and 35 and authors' unpublished data). Further, the CSX1 homeodomain sequences are highly related to that of NK family genes (82% identical to TTF-1, 73% to NK-2, and 67% to tinman), whereas they show a limited homology to HOM-C/Hox class genes (43% identical to HoxA6 and Antp). The putative DNA contact sites (shown as asterisks in Fig 1DUp), based on the crystallographic studies of the DNA homeodomain complex,2 are also highly conserved between CSX1 and NK-2, tinman, or TTF-1, suggesting that the target sequences of CSX1 may be similar to those of the NK family genes. In addition to the homeodomain, there are two regions in the CSX1 sequence that are conserved among other NK family homeoproteins. One exists in the carboxy terminal to the homeodomain and consists of a 17–amino acid motif called the NK-2–specific domain36 (Fig 1EUp), and the other is an 11–amino acid stretch at the 5' end of the protein called the TN (tinmanNkx-2.5/2.1) domain37 (Fig 1FUp).

Southern Blot Analysis
To determine whether there are any other genes closely related to CSX1 in the human genome, Southern blot analysis was performed using human genomic DNA. Hybridization with the CSX1a cDNA probe revealed a single major band and a few weak bands in each lane under high-stringency conditions (Fig 2Down, left). These results suggest that CSX1 exists as a single copy and that there may be some CSX1-related genes in the human genome.




View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. A, Southern blot analysis of human CSX1 gene. Twenty micrograms of human genomic DNA was digested with BamHI, EcoRI, and HindIII and electrophoresed in a 0.6% agarose gel. After it was blotted to nylon membrane, the DNA was hybridized at high stringency with a 32P-labeled CSX1 cDNA probe. Molecular weights are shown at the left. B, Schematic illustration of the gene structure, splicing patterns, and open reading frame of the three isoforms of CSX1. The structure of CSX1 genomic DNA is presented at the top. The exons are indicated by boxes, and an intron is drawn by a line. Each box corresponds to the box indicated in Fig 1BUp. Homeoboxes are indicated by black boxes, and the open reading frame of each CSX1 isoform is striped.

Isolation of CSX1 Genomic Clone
From {approx}1.0x106 phage clones screened, one positive clone {approx}20 kb in size was isolated. Sequencing of this clone revealed that the CSX1 gene is composed of at least two exons and one intron, and all three isoforms of the CSX1 cDNA were mapped to the same chromosomal region. The schematic diagram of the structure and the splicing pattern of the CSX1 gene is shown in Fig 2Up, right. The insertional sequences of CSX1b and CSX1c, which contain in-frame stop codons, are spliced out when homeodomain-containing CSX1a is generated.

Northern Blot Analysis
To examine the tissue distribution and the developmental regulation of CSX1 gene expression, 2 µg of poly(A)+ RNA prepared from various fetal (19 to 23 weeks of age) and adult human tissues was hybridized with CSX1a cDNA. Among six fetal and eight adult human tissues examined, CSX1 was expressed only in the heart both in the fetal and adult stages (Fig 3Down, top). It is noteworthy that CSX1 mRNA was abundantly expressed in adult hearts as well as in fetal hearts. At least two different sizes of transcripts ({approx}1.8 kb and 3.6 kb) were detected. These different sizes of mRNA may come from different polyadenylation sites, alternatively spliced variants, or unspliced transcripts.




View larger version (111K):
[in this window]
[in a new window]
 
Figure 3. Top, Northern blot analysis of CSX1 mRNA. Two micrograms of poly(A)+ RNA isolated from various human tissues of fetus and adult was hybridized with 32P-labeled CSX1a cDNA probe. Hybridizations with GAPDH are shown at the bottom. The weaker bands around 5 kb are considered to represent the nonspecific binding to 28S ribosomal RNA. Bottom, Amplification of CSX1 isoform–specific sequences by RT-PCR. RT-PCR was performed as described in the text, and samples were electrophoresed in a 2.2% agarose gel and stained with ethidium bromide (left). Southern blot analysis was performed to rule out the nonspecific amplification with the 32P-labeled internal probe described in the text (right).

Expression of CSX1 Isoforms
RT-PCR was performed using poly(A)+ RNA of the human fetal (19 to 23 weeks of age) and adult hearts. To examine the expression of each isoform, we used a pair of primers that would amplify all three isoforms by different sizes. All of the three CSX1 isoforms were detected by RT-PCR, and the homeobox-containing isoform, CSX1a, was predominantly amplified among these three isoforms both in the fetal and adult hearts (Fig 3Up, bottom).

DNA-Binding Properties of CSX1 Protein
Many lines of evidence have indicated that most of the homeoproteins directly bind to DNA by their homeodomains.1 2 To elucidate the DNA-binding properties of CSX1 proteins, EMSA was performed using in vitro–translated CSX1 proteins and the TTF-1 binding sequences, which were demonstrated to be favorable binding sequences of Csx/Nkx-2.5 protein.38 SDS-PAGE of in vitro–translated CSX1 proteins revealed that almost the same amount of the proteins of expected size was produced (data not shown). As shown in Fig 4Down, in vitrotranslated CSX1a, CSX1a{Delta}C, and CSX1a{Delta}N proteins, all of which contain the homeodomain, efficiently bound to TTF-1 binding sequences, whereas homeodomain-less CSX1b protein did not. None of the proteins bound to the junctional region between the multimerized TTF-1 binding sequences and tk minimum promoter (data not shown).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 4. EMSA analysis. The interaction between CSX1 proteins and the TTF-1 binding sequences was examined by EMSA. 32P-labeled oligonucleotide probe corresponding to the TTF-1 binding sequences was incubated with in vitro–translated CSX1 proteins (CSX1a, CSX1b, CSX1a{Delta}C, and CSX1a{Delta}N) and electrophoresed by 5% polyacrylamide gel. FP indicates free probe.

Transcriptional Activation by CSX1 Protein
To assess the function of CSX1 protein as a transcriptional regulator, we performed transfection experiments using a reporter gene containing four copies of TTF-1 binding sequences linked to the tk minimum promoter–luciferase construct. The homeodomain-containing CSX1a protein transactivated the reporter gene up to 11.2-fold (Fig 5ADown). The degree of the transactivation by CSX1a was not simply dose dependent. Maximum activation was obtained when equal amounts of reporter and effector genes were cotransfected. When more CSX1a expression vector was transfected, the activation levels decreased (Fig 5BDown). To determine the activation domain of CSX1a protein, we made deletion mutants of CSX1a. The COOH-terminal–deleted CSX1a protein (CSX1a{Delta}C) revealed much stronger stimulation than the wild-type CSX1a protein (CSX1awt), whereas the NH2-terminal–deleted protein (CSX1a{Delta}N) exhibited weaker transcriptional activity than that of CSX1awt (Fig 5ADown). These results suggest that the activation domain exists in the NH2-terminal region and that the COOH-terminal region has an inhibitory function. Surprisingly, the homeodomain-less CSX1 protein (CSX1b), which did not bind to the TTF-1 binding sequences (Fig 4Up), also transactivated the reporter gene. CSX1b did not transactivate pT81luc but reproducibly transactivated 4x(TTF-1)-tk-luc up to 6.0-fold (Fig 5BDown). To confirm that same amounts of CSX1 proteins are expressed in transfection experiments, epitope-tagged CSX1 proteins were transiently expressed in COS-7 cells and examined by immunoblotting. Western blot analysis with an anti-HA monoclonal antibody demonstrated that CSX1a, CSX1b, CSX1a{Delta}C, and CSX1a{Delta}N were evenly expressed in transfected COS-7 cells (Fig 6Down).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. Transcriptional activation by CSX1 protein. COS-7 cells were transfected with 0.2 µg of reporter gene and various amounts of effector plasmids. Relative luciferase activities normalized by ß-galactosidase activity are shown. A, Dissection of the functional domains of CSX1 protein. B, Transactivation by the homeodomain-containing (CSX1a) and the homeodomain-lacking (CSX1b) proteins.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. Western blot analysis of transiently expressed epitope-tagged CSX1 proteins. COS-7 cells were transfected with the expression vectors of various HA-tagged CSX1 proteins, and extracted cell lysates were electrophoresed and blotted on nitrocellulose membranes. Filters were incubated with an anti-HA monoclonal antibody. Molecular mass (MW) is indicated on the left.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we have isolated a human homeobox-containing gene (CSX1) that is a homologue of murine Csx/Nkx-2.5. The amino acid sequences were highly conserved between CSX1 and Csx/Nkx-2.5, {approx}80% identical in the overall proteins and 100% identical in the homeodomain. Csx/Nkx-2.5–like genes with almost identical homeodomain sequences have been demonstrated to exist in mammalian, avian, and amphibian species.22 23 34 35 Collectively, these results suggest that Csx/Nkx-2.5 family genes are highly conserved in evolution.

The homeodomain sequence of CSX1 is also related to that of Drosophila NK family genes39 and mammalian NK family homologues.15 16 Among the Drosophila NK family genes, tinman (formerly known as NK-4 or msh-2) is expressed in all mesoderm cells in the segmentation parts of the embryo during germ-band elongation, but its expression becomes restricted to the heart primordium and the heart thereafter.19 The heart does not form in flies with the mutant for tinman.20 21 Csx/Nkx-2.5 is first expressed in the cardiac progenitor cells, and Csx/Nkx-2.5 null mutants first form the heart tube but do not exhibit heart looping or subsequent normal heart development, resulting in embryonic lethality. These results strongly suggest that tinman and Csx/Nkx-2.5 play a critical role in the heart formation of Drosophila and mice, respectively. However, since there are some differences in expression patterns and roles in cardiac development between Csx/Nkx-2.5 and tinman, it is not known at present whether CSX1 is the human homologue of Drosophila tinman or not. Moreover, the recent isolation and characterization of the Xenopus Csx/Nkx-2.5–related gene XNkx-2.3 suggests that Drosophila tinman may be represented by a family of Nkx class homeobox genes in vertebrates35 and that other CSX1-related genes such as XNkx-2.3 homologue may exist in humans. The result of genomic Southern blot (Fig 2AUp) is consistent with this hypothesis.

In the carboxy-terminal outside of the CSX1 homeodomain, a conserved 17–amino acid motif called the NK-2–specific domain36 is observed. The NK-2–specific domain, which contains a central cluster of hydrophobic amino acids, is found in NK-2 relatives and a more divergent form in bagpipe (NK-3). One sequence error has been discovered in murine Csx, and one G should be added in the position of 615 bp of the Csx sequence (Fig 1AUp of Reference 22). This correction has made Csx to contain the NK-2–specific domain 100% identical to that of CSX1 at the amino acid level (Fig 1EUp). There is also a highly conserved 11–amino acid stretch at the 5' end of the protein sequence called the TN domain (Fig 1FUp), which is found in Nkx-2.5,23 XNkx-2.5,34 TTF-1,15 tinman,19 and bagpipe.20 It is of interest that all homeoproteins containing the TN domain except TTF-1 are expressed in the heart. In addition, there are two regions rich in proline and alanine and one region rich in charged amino acids outside of the homeodomain (Fig 1CUp). These regions may have a role in protein-protein interaction or may act as transcriptional activation or repression domains. In fact, there is a transactivation domain and an inhibitory domain in the NH2-terminal side and COOH-terminal side of the homeodomain, respectively (Reference 38 and Fig 5AUp).

There are at least three distinct CSX1 mRNAs in the human heart. CSX1a encodes a homeodomain-containing protein; CSX1b and CSX1c encode a truncated protein that is identical to the amino-terminal region of CSX1a but lacks the homeodomain. Southern blot analysis and characterization of the CSX1 genomic clone revealed that the CSX1 gene exists as a single copy in the human genome and that the three isoforms of CSX1 cDNA are generated by alternative splicing mechanisms (Fig 2Up). We have recently reported that CSX1 is located at 5q34 of the human chromosome.40 Although no heart disease or anomaly has been previously mapped to this chromosomal position, distal 5q trisomies are often associated with several types of congenital cardiac defects, such as tetralogy of Fallot or ventricular septal defect.41 Since HOX gene clusters exist at different chromosomes (HOXA, chromosome 7; HOXB, 17; HOXC, 12; and HOXD, 2),42 CSX1 is not related to Hox class genes in terms of the chromosomal localization as well as the homeodomain sequences. In CSX1 family genes, Csx and Nkx-2.5, the sequences of which are completely divergent in a part of the amino-terminal region, were proved to be alternatively spliced variants by sequencing murine genomic DNA (data not shown). XCsx has at least three isoforms. XCsx1 and XCsx2 are generated possibly by alternative splicing and have different nucleotide sequences only in the untranslated regions (authors' unpublished data). Several homeobox genes such as Drosophila bicoid,43 Xenopus XIHbox 2,44 Xenopus Xhox 36,45 and murine ERA-1 have also been demonstrated to have the alternatively spliced variants that lack the homeodomain, although the precise role of these homeodomain-less variants is unknown at present.

The expression of CSX1 was observed only in the heart among various human tissues examined (Fig 3Up, top). In mice, however, Csx/Nkx-2.5 is weakly expressed in tissues other than heart, such as tongue, spleen, and stomach. Although the detailed distribution and temporal profile of CSX1 expression is not known, its abundant expression in the heart (which is conserved Xenopus, mouse and human) strongly suggests that CSX1 plays an important role in the human heart formation. In addition, the abundant expression of CSX1 family genes in the adult heart suggests that they may play some roles in maintaining the highly differentiated phenotype of cardiac myocytes at the adult stage.

The relative expression levels of the three CSX1 isoforms did not change during developmental stages by RT-PCR analysis (Fig 3Up, bottom). We performed RNase protection assay with a cRNA probe, which is expected to generate different sizes of isoform-specific protected RNA-RNA hybrids and detected only CSX1a transcripts both in the fetal and adult heart poly(A)+ RNA (2 µg each) (data not shown). The results of the RNase protection assay, together with the RT-PCR analysis, suggest that the homeobox-containing isoform CSX1a is predominantly expressed. We are now examining whether the relative expression levels of the three CSX1 isoforms would change in diseased hearts.

Cotransfection analysis revealed that CSX1 protein activated the transcription of the reporter gene containing multimerized Csx/Nkx-2.5 binding sites and that the transactivation domain exists in the NH2-terminal region of CSX1a. The previous report by Chen et al38 indicated that the NH2-terminal deletion of murine Csx/Nkx-2.5 protein showed stronger transactivation activity than the wild-type Csx/Nkx-2.5, whereas in the present study, NH2-terminal deletion of CSX1a revealed much less transactivation than the wild-type CSX1awt. The reasons for such discrepancies are unclear at present; however, they may be due to the differences in the cell type or the reporter and the effector constructs used in the transfection experiments. Although the homeodomain-lacking CSX1b does not bind to the TTF-1 binding sequences (Fig 4Up) or to the junctional region between the tk-luc backbone and 4x(TTF-1) cassette (data not shown), it also significantly transactivated the reporter gene.

CSX1b did not increase the luciferase activity of the control reporter construct pT81luc containing only the tk minimal promoter, suggesting that the transactivation by CSX1b is not nonspecific. Accumulating evidence has suggested that homeoproteins bind to specific DNA sequences by homeodomains.2 3 However, there have been some reports suggesting that homeoproteins function by associating with other proteins. The Drosophila homeoprotein extradenticle associates with Ultrabithorax protein via a region NH2 terminal of the extradenticle homeodomain and modulates the DNA-binding specificity of Ultrabithorax.47 48 It has been reported that the homeodomain-deleted ftz protein could function as a transcriptional activator in vitro49 and could rescue the phenotype of the ftz mutant embryos through protein-protein interactions with pair-rule protein paired by the NH2-terminal domain of the ftz protein.50 Since the basal luciferase activity of 4x(TTF-1)-tk-luc gene was significantly higher than that of tk-luc (pT81luc), it is possible that some other transcription factors that exist in COS-7 cells may bind and activate the 4x(TTF-1)-tk-luc gene and that the homeodomain-less CSX1b protein may transactivate the reporter gene by interacting with the protein(s) that bind to the TTF-1 binding sequences. Indeed, the TTF-1 binding protein(s) in COS-7 cells can be detected by EMSA (data not shown). Collectively, these data suggest that there may be two different mechanisms in transcriptional regulation by the CSX1 protein, homeodomain-dependent and -independent mechanisms. By analogy, DNA binding-independent muscle-specific gene activation via protein-protein interaction has recently been demonstrated between the MyoD and MEF2 family of transcription factors.51 In this respect, it is interesting to note that the knockout construct of Nkx-2.5 disrupts the homeodomain but leaves the NH2-terminal domain intact and that the mRNA corresponding to the NH2-terminal domain of Nkx-2.5 is abundantly transcribed in Nkx-2.5 null mice.24 The differences in the phenotype of the tinman mutant in Drosophila and Nkx-2.5 null mice may be due not only to the functional redundancy of Csx/Nkx-2.5–related genes but also to the homeodomain-independent functions of the Csx/Nkx-2.5 protein. Further investigations are needed to elucidate the mechanism of the transactivation by the homeodomain-containing and the homeodomain-less CSX1 protein.


*    Selected Abbreviations and Acronyms
 
EMSA = electrophoretic mobility shift assay
ftz = fushitarazu
HA = hemagglutinin
MTN = multiple tissue Northern
PCR = polymerase chain reaction
RT = reverse transcriptase
tk = thymidine kinase
XCsx = Xenopus Csx
XNkx = Xenopus Nkx



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1B. FIG 1B through E. See legend with 1A.


*    Acknowledgments
 
This study was supported by grants from the Japanese Ministry of Education, Science, and Culture, the Japan Cardiovascular Foundation, and the Study Group of Molecular Cardiology, Japan (to Dr Komuro). Dr Shiojima is a research fellow of the Japan Society for the Promotion of Science. The authors thank Fumiko Harima and Makiko Iwata for technical assistance.

Received June 25, 1996; accepted August 12, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Scott MP, Tamkun JW, Hartzell GW. The structure and function of the homeodomain. Biochem Biophys Acta.. 1989;989:25-48.[Medline] [Order article via Infotrieve]

2. Gehring WJ, Qian YQ, Billeter M, Furukubo-Tokunaga K, Schier AF, Resendez-Perez D, Affolter M, Otting G, Wuthrich K. Homeodomain-DNA recognition. Cell.. 1994;78:211-223.[Medline] [Order article via Infotrieve]

3. Hayashi S, Scott M. What determines the specificity of action of Drosophila homeodomain proteins? Cell.. 1990;63:883-894.[Medline] [Order article via Infotrieve]

4. Lawrence PA, Morata G. Homeobox genes: their function in Drosophila segmentation and pattern formation. Cell.. 1994;78:181-189.[Medline] [Order article via Infotrieve]

5. Krumlauf R. Hox genes in vertebrate development. Cell.. 1994;78:191-201.[Medline] [Order article via Infotrieve]

6. Duboule D, Dolle P. The structure and functional organization of the murine HOX gene family resembles that of Drosophila homeotic genes. EMBO J. 1989;8:1497-1505.[Medline] [Order article via Infotrieve]

7. Graham A, Papalopulu N, Krumlauf R. The murine and Drosophila homeobox gene complexes have common features of organization and expression. Cell.. 1989;57:367-378.[Medline] [Order article via Infotrieve]

8. Malicki J, Schughart K, McGinnis W. Mouse Hox-2.2 specifies thoracic segmental identity in Drosophila embryos and larvae. Cell.. 1990;63:961-967.[Medline] [Order article via Infotrieve]

9. McGinnis N, Kuziora MA, McGinnis W. Human Hox-4.2 and Drosophila Deformed encode similar regulatory specificities in Drosophila embryos and larvae. Cell.. 1990;63:969-976.[Medline] [Order article via Infotrieve]

10. Chisaka O, Capecchi M. Regionally restricted developmental defects resulting from targeted disruption of the mouse homeobox gene hox-l.5. Nature.. 1991;350:473-479.[Medline] [Order article via Infotrieve]

11. Lufkin T, Dierich A, LeMeur M, Mark M, Chambon P. Disruption of the Hox-1.6 homeobox gene results in defects in a region corresponding to its rostal domain of expression. Cell.. 1991;66:1105-1119.[Medline] [Order article via Infotrieve]

12. Weintraub H, Davis R, Tapscott S, Thayer M, Krause M, Benezra R, Blackwell K, Turner D, Rupp R, Hollenberg S, Zhuang Y, Lassar A. The MyoD gene family: nodal point during specification of the muscle cell lineage. Science.. 1991;251:761-766.[Abstract/Free Full Text]

13. Olson EN. Regulation of muscle transcription by the MyoD family: the heart of the matter. Circ Res.. 1993;72:1-6.[Abstract/Free Full Text]

14. Ingraham HA, Chen R, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson L, Rosenfeld MG. A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell.. 1988;55:519-529.[Medline] [Order article via Infotrieve]

15. Guazzi S, Price M, De Felce M, Damante G, Mattei MG, Di Lauro R. Thyroid nuclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J.. 1990;9:3631-3639.[Medline] [Order article via Infotrieve]

16. Lazzaro D, Price M, De Felce M, Di Lauro R. The transcription factor TTF-1 is expressed at the onset of thyroid and lung morphogenesis and in restricted regions of the forebrain. Development.. 1991;113:1093-1104.[Abstract]

17. Komuro I, Schalling M, Jahn L, Bodmer R, Jenkins NA, Copeland N, Izumo S. Gtx: a novel murine homeobox-containing gene, expressed specifically in glial cells of the brain and germ cells of testis, has a transcriptional repressor activity in vitro for a serum-inducible promoter. EMBO J.. 1993;12:1387-1401.[Medline] [Order article via Infotrieve]

18. Castrillo JL, Theill LE, Karin M. Function of the homeodomain protein GHF1 in pituitary cell proliferation. Science.. 1991;253:197-199.[Abstract/Free Full Text]

19. Bodmer R, Jan LY, Jan YN. A new homeobox-containing gene, msh-2, is transiently expressed early during mesoderm formation of Drosophila. Development.. 1990;110:661-669.[Abstract/Free Full Text]

20. Azpiazu N, Frasch M. tinman and bagpipe: two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila. Genes Dev.. 1993;7:1325-1340.[Abstract/Free Full Text]

21. Bodmer R. The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development.. 1993;118:719-729.[Abstract]

22. Komuro I, Izumo S. Csx: a murine homeobox-containing gene specifically expressed in the developing heart. Proc Natl Acad Sci U S A.. 1993;90:8145-8149.[Abstract/Free Full Text]

23. Lints TJ, Parsons LM, Hartley L, Lyons I, Harvey RP. Nkx-2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development.. 1993;119:419-431.[Abstract]

24. Lyons I, Parsons LM, Hartley L, Li R, Andrews JE, Robb L, Harvey RP. Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev.. 1995;9:1654-1666.[Abstract/Free Full Text]

25. Heikinheimo M, Scandrett JM, Wilson DB. Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev Biol.. 1994;164:361-373.[Medline] [Order article via Infotrieve]

26. Edmondson DG, Lyons GE, Martin JF, Olson EN. Mef2 gene expression marks the cardiac and skeletal muscle lineage during mouse embryogenesis. Development. 1994; 120: 1251-1263.

27. Kuro-o M, Hanaoka K, Hiroi Y, Noguchi T, Fujimori Y, Takewaki S, Hayasaka M, Katoh H, Miyagishi A, Nagai R, Yazaki Y, Nabeshima Y. Salt-sensitive hypertension in transgenic mice overexpressing Na+-proton exchanger. Circ Res.. 1995;76:148-153.[Abstract/Free Full Text]

28. Civitareale D, Lonigro R, Sinclair A, Di Lauro R. A thyroid-specific nuclear protein essential for tissue-specific expression of the thyroglobulin promoter. EMBO J.. 1989;8:2537-2542.[Medline] [Order article via Infotrieve]

29. Nordeen SK. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques.. 1989;6:454-458.

30. Chen C, Okayama H. High-efficiency transformation of mammalian cells by plasmid DNA. Moll Cell Biol.. 1987;7:2745-2752.[Abstract/Free Full Text]

31. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res.. 1987;15:8125-8148.[Abstract/Free Full Text]

32. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell.. 1986;46:659-667.[Medline] [Order article via Infotrieve]

33. Proudfoot N. Poy(A) signals. Cell.. 1991;64:671-674.[Medline] [Order article via Infotrieve]

34. Tonissen KF, Drysdale TA, Lints TJ, Harvey RP, Kreig PA. XNkx-2.5, a Xenopus gene related to Nkx-2.5 and tinman: evidence for a conserved role in cardiac development. Dev Biol.. 1993;162:325-328.

35. Evans MS, Yan W, Murillo MP, Ponce J, Papalopulu N. tinman, a Drosophila homeobox gene required for heart and visceral mesoderm specification, may be represented by a family of genes in vertebrates: XNkx-2.3, a second vertebrate homolog of tinman. Development.. 1995;121:3889-3899.[Abstract]

36. Price M, Lazzaro D, Pohl T, Mattei MG, Ruther U, Olivo JC, Duboule D, Di Lauro R. Regional expression of the homeobox gene Nkx-2.2 in the developing mammalian forebrain. Neuron.. 1992;8:241-255.[Medline] [Order article via Infotrieve]

37. Bodmer R. Heart development in Drosophila and its relationship to vertebrates. Trends Cardiovasc Med.. 1995;5:21-28.

38. Chen CY, Schwartz RJ. Identification of novel DNA binding targets and regulatory domains of a murine tinman homeodomain factor, nkx-2.5. J Biol Chem. 1995;270:15628-15633.[Abstract/Free Full Text]

39. Kim Y, Nirenberg M. Drosophila NK-homeobox genes. Proc Natl Acad Sci U S A.. 1989;86:7716-7720.[Abstract/Free Full Text]

40. Shiojima I, Komuro I, Inazawa J, Nakahori Y, Matsumura I, Abe T, Nagai R, Yazaki Y. Assignment of cardiac homeobox gene CSX to human chromosome 5q34. Genomics.. 1995;27:204-206.[Medline] [Order article via Infotrieve]

41. Kumar D, Heath PR, Blank CE. Clinical manifestations of trisomy 5q. J Med Genet.. 1987;24:180-184.[Abstract/Free Full Text]

42. Acampora D, D'Esposito M, Faiella A, Pannese M, Migliaccio E, Morelli F, Stornaiuolo A, Nigro V, Simeone A, Boncinelli E. The human HOX gene family. Nucleic Acids Res.. 1989;17:10385-10402.[Abstract/Free Full Text]

43. Berleth T, Burri M, Gudrun T, Bopp D, Richstein S, Frigerio G, Noll M, Nusslein-Volhard C. The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo. EMBO J. 1988;7:1749-1756.[Medline] [Order article via Infotrieve]

44. Wright CVE, Cho KWY, Fritz A, Burglin TR, E. M. Robertis EM. A Xenopus laevis gene encodes both homeobox-containing and homeobox-less transcripts. EMBO J.. 1987;6:4083-4094.[Medline] [Order article via Infotrieve]

45. Condie BG, Brivanlou AH, Harland RM. Most of the homeobox-containing Xhox 36 transcripts in early Xenopus embryos cannot encode a homeodomain protein. Moll Cell Biol.. 1990;10:3376-3385.[Abstract/Free Full Text]

46. Larosa GJ, Gudas LJ. Early retinoic acid-induced F9 teratocarcinoma stem cell gene ERA-1: alternative splicing creates transcripts for a homeobox-containing protein and one lacking the homeobox. Mol Cell Biol.. 1988;8:3906-3917.[Abstract/Free Full Text]

47. Chan SK, Jaffe L, Capovilla M, Botas J, Mann RS. The DNA binding specificity of Ultrabithorax is modulated by cooperative interactions with extradenticle, another homeoprotein. Cell.. 1994;78:603-615.[Medline] [Order article via Infotrieve]

48. van Dijk MA, Murre C. extradenticle raises the DNA binding specificity of homeotic selector gene product. Cell.. 1994;78:617-624.[Medline] [Order article via Infotrieve]

49. Ananthan J, Bader R, Morrissey D, Zuo J, Lan Y, Weir M, Voellmy R. Synergistic activation of transcription is mediated by the N-terminal domain of Drosophila fushi tarazu hemeoprotein and can occur without DNA binding by the protein. Mol Cell Biol.. 1993;13:1599-1609.[Abstract/Free Full Text]

50. Copeland JWR, Nasiadka A, Dietrich BH, Krause HM. Patterning of the Drosophila embryo by a homeodomain-deleted Ftz polypeptide. Nature.. 1996;379:162-165.[Medline] [Order article via Infotrieve]

51. Molkentin JD, Black BL, Martin JF, Olson EN. Cooperative activation of muscle specific gene expression by MEF2 and myogenic bHLH proteins. Cell.. 1995;83:1125-1136.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
R. David, J. Stieber, E. Fischer, S. Brunner, C. Brenner, S. Pfeiler, F. Schwarz, and W.-M. Franz
Forward programming of pluripotent stem cells towards distinct cardiovascular cell types
Cardiovasc Res, November 1, 2009; 84(2): 263 - 272.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. J. Hatcher and C. T. Basson
Specification of the Cardiac Conduction System by Transcription Factors
Circ. Res., September 25, 2009; 105(7): 620 - 630.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H.-Y. Chu and A. Ohtoshi
Cloning and Functional Analysis of Hypothalamic Homeobox Gene Bsx1a and Its Isoform, Bsx1b
Mol. Cell. Biol., May 15, 2007; 27(10): 3743 - 3749.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Rubin, X. Wu, T. Zhu, J. C.Y. Cheung, H. Chen, A. Lorincz, R. K. Pandita, G. G. Sharma, H. C. Ha, J. Gasson, et al.
A Role for the HOXB7 Homeodomain Protein in DNA Repair
Cancer Res., February 15, 2007; 67(4): 1527 - 1535.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. M. Reamon-Buettner, H. Hecker, K. Spanel-Borowski, S. Craatz, E. Kuenzel, and J. Borlak
Novel NKX2-5 Mutations in Diseased Heart Tissues of Patients with Cardiac Malformations
Am. J. Pathol., June 1, 2004; 164(6): 2117 - 2125.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Nagel, M. Kaufmann, H. G. Drexler, and R. A. F. MacLeod
The Cardiac Homeobox Gene NKX2-5 Is Deregulated by Juxtaposition with BCL11B in Pediatric T-ALL Cell Lines via a Novel t(5;14)(q35.1;q32.2)
Cancer Res., September 1, 2003; 63(17): 5329 - 5334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ueyama, H. Kasahara, T. Ishiwata, N. Yamasaki, and S. Izumo
Csm, a Cardiac-specific Isoform of the RNA Helicase Mov10l1, Is Regulated by Nkx2.5 in Embryonic Heart
J. Biol. Chem., August 1, 2003; 278(31): 28750 - 28757.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Akazawa and I. Komuro
Roles of Cardiac Transcription Factors in Cardiac Hypertrophy
Circ. Res., May 30, 2003; 92(10): 1079 - 1088.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. K. Ghosh, E. A. Packham, A. J. Bonser, T. E. Robinson, S. J. Cross, and J. D. Brook
Characterization of the TBX5 binding site and analysis of mutations that cause Holt-Oram syndrome
Hum. Mol. Genet., September 1, 2001; 10(18): 1983 - 1994.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhu, Y. Zou, I. Shiojima, S. Kudoh, R. Aikawa, D. Hayashi, M. Mizukami, H. Toko, F. Shibasaki, Y. Yazaki, et al.
Ca2+/Calmodulin-dependent Kinase II and Calcineurin Play Critical Roles in Endothelin-1-induced Cardiomyocyte Hypertrophy
J. Biol. Chem., May 12, 2000; 275(20): 15239 - 15245.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Monzen, I. Shiojima, Y. Hiroi, S. Kudoh, T. Oka, E. Takimoto, D. Hayashi, T. Hosoda, A. Habara-Ohkubo, T. Nakaoka, et al.
Bone Morphogenetic Proteins Induce Cardiomyocyte Differentiation through the Mitogen-Activated Protein Kinase Kinase Kinase TAK1 and Cardiac Transcription Factors Csx/Nkx-2.5 and GATA-4
Mol. Cell. Biol., October 1, 1999; 19(10): 7096 - 7105.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Shiojima, I. Komuro, T. Oka, Y. Hiroi, T. Mizuno, E. Takimoto, K. Monzen, R. Aikawa, H. Akazawa, T. Yamazaki, et al.
Context-dependent Transcriptional Cooperation Mediated by Cardiac Transcription Factors Csx/Nkx-2.5 and GATA-4
J. Biol. Chem., March 19, 1999; 274(12): 8231 - 8239.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Reecy, X Li, M Yamada, F. DeMayo, C. Newman, R. Harvey, and R. Schwartz
Identification of upstream regulatory regions in the heart-expressed homeobox gene Nkx2-5
Development, January 2, 1999; 126(4): 839 - 849.
[Abstract] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Kasahara and S. Izumo
Identification of the In Vivo Casein Kinase II Phosphorylation Site within the Homeodomain of the Cardiac Tisue-Specifying Homeobox Gene Product Csx/Nkx2.5
Mol. Cell. Biol., January 1, 1999; 19(1): 526 - 536.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. Yang, H. Zhang, G. Hu, H. Wang, C. Abate-Shen, and M. M. Shen
An Early Phase of Embryonic Dlx5 Expression Defines the Rostral Boundary of the Neural Plate
J. Neurosci., October 15, 1998; 18(20): 8322 - 8330.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. Schott, D. W. Benson, C. T. Basson, W. Pease, G. M. Silberbach, J. P. Moak, B. J. Maron, C. E. Seidman, and J. G. Seidman
Congenital Heart Disease Caused by Mutations in the Transcription Factor NKX2-5
Science, July 3, 1998; 281(5373): 108 - 111.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
H. Kasahara, S. Bartunkova, M. Schinke, M. Tanaka, and S. Izumo
Cardiac and Extracardiac Expression of Csx/Nkx2.5 Homeodomain Protein
Circ. Res., May 19, 1998; 82(9): 936 - 946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. T. Thompson, M. S. Rackley, and T. X. O'Brien
Upregulation of the cardiac homeobox gene Nkx2-5 (CSX) in feline right ventricular pressure overload
Am J Physiol Heart Circ Physiol, May 1, 1998; 274(5): H1569 - H1573.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. Okkema, E Ha, C Haun, W Chen, and A Fire
The Caenorhabditis elegans NK-2 homeobox gene ceh-22 activates pharyngeal muscle gene expression in combination with pha-1 and is required for normal pharyngeal development
Development, January 10, 1997; 124(20): 3965 - 3973.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhu, I. Shiojima, Y. Hiroi, Y. Zou, H. Akazawa, M. Mizukami, H. Toko, Y. Yazaki, R. Nagai, and I. Komuro
Functional Analyses of Three Csx/Nkx-2.5 Mutations That Cause Human Congenital Heart Disease
J. Biol. Chem., November 3, 2000; 275(45): 35291 - 35296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Yang, C. K. Hwang, U. M. D'Souza, S.-H. Lee, E. Junn, and M. M. Mouradian
Three-amino acid Extension Loop Homeodomain Proteins Meis2 and TGIF Differentially Regulate Transcription
J. Biol. Chem., June 30, 2000; 275(27): 20734 - 20741.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiojima, I.
Right arrow Articles by Yazaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiojima, I.
Right arrow Articles by Yazaki, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH