This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gidh-Jain, M. Articles by El-Sherif, N. Search for Related Content PubMed PubMed Citation Articles by Gidh-Jain, M. Articles by El-Sherif, N. Pubmed/NCBI databases Medline Plus Health Information Heart Attack

(Circulation Research. 1996;79:669-675.)
© 1996 American Heart Association, Inc.

Articles

Differential Expression of Voltage-Gated K⁺ Channel Genes in Left Ventricular Remodeled Myocardium After Experimental Myocardial Infarction

Madhavi Gidh-Jain, Boyu Huang, Praveer Jain, Nabil El-Sherif

the Cardiology Division, Department of Medicine, State University of New York Health Science Center and Veterans Affairs Medical Center, Brooklyn, NY.

Correspondence to Madhavi Gidh-Jain, Cardiology Division, Veterans Affairs Medical Center, 800 Poly Pl, Brooklyn, NY 11209.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Left ventricular (LV) remodeling after experimental myocardial infarction (MI) is associated with hypertrophy of noninfarcted myocardium and electrophysiological alterations. We have recently shown that post-MI hypertrophied LV myocytes have prolonged action potential duration (APD) and generate triggered activity from early afterdepolarizations. The prolonged APD was attributed to decreased density of the two outward K⁺ currents, I_to-fast (I_to-f) and I_to-slow (I_to-s), rather than changes in the density and/or kinetics of the L-type Ca²⁺ current. The changes in ionic current density may be related to alterations in the expression and levels of ion channel proteins. To test this hypothesis, rats underwent either left anterior descending coronary artery (LAD) ligation (post-MI group [n=10]) or sham surgery (sham group [n=10]). Three weeks later, transcripts from the noninfarcted LV myocardium in the post-MI group (n=6) and LV myocardium of the sham group (n=6) were analyzed by RNase protection assay. Expressions of five K⁺ channel subunit mRNAs (Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2) reported in the rat ventricle were analyzed. Compared with the sham group, expressions of Kv1.4, Kv2.1 (putative I_to-s), and Kv4.2 (putative I_to-f) channel subunit mRNAs were significantly decreased by 60% (P<.03), 54% (P<.005), and 53% (P<.002), respectively, in the post-MI group. There was no significant change in the Kv1.2 and Kv1.5 mRNA levels. Western blotting demonstrated a similar decrease in the Kv2.1 and Kv4.2 immunoreactive protein levels (43% [P<.03] and 67% [P<.003], respectively [n=4]) and no significant change in Kv1.5 immunoreactive protein level. Our results strongly correlate with the electrophysiological findings in this model and show that transcriptional regulation in the post-MI remodeled rat LV is distinct for each voltage-gated K⁺ channel subunit. These findings provide, at least in part, the molecular basis for the electrophysiological alterations observed in this model.

Key Words: cardiac hypertrophy • myocardial infarction • K⁺ channel • mRNA levels

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cardiac hypertrophy is an adaptive universal response of the heart to increased workload.¹ After MI, the noninfarcted myocardium undergoes significant hypertrophy, with features that are more consistent with volume-overload than with pressure-overload hypertrophy.² The most consistent electrical abnormality that has been described in association with cardiac hypertrophy is prolongation of APD.³ K⁺ currents are of fundamental importance because of their role in initiating and modulating repolarization of the action potential. In the heart, several K⁺ currents with differing kinetics and voltage-dependent properties have been reported.^{4 5 6} Differences in K⁺ channel properties contribute to variations in the electrophysiological properties of cardiac myocytes in different species and in different regions of the heart in the same species.^{6 7 8} I_to is a major repolarizing current in many cardiac cells, and differences in I_to are important in determining regional variations in action potential configuration.^{6 7 9 10} In rat ventricular myocytes, the outward current waveform results from the activation of two kinetically distinct voltage-dependent K⁺ currents: One activates and inactivates rapidly, is preferentially blocked by 4-AP, and is usually referred to as I_to or I_to-fast (I_to-f). The second K⁺ current activates and inactivates at a much slower rate, is predominantly suppressed by tetraethylammonium chloride, and has been termed I_K¹¹ or I_to-slow (I_to-s).¹² I_to-f is thought to underlie the initial rapid repolarization phase of the action potential; I_to-s, the slower phase of repolarization back to the resting potential. Our recent electrophysiological study has shown that the prolongation of APD in the LV hypertrophied myocytes from rats, 3 to 4 weeks after MI, could be explained by the decreased current density of both the fast and slow components of the outward K⁺ current rather than by changes in the density or kinetics of the L-type Ca²⁺ current.¹³

Five distinct K⁺ channel subunit mRNAs (Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2) are shown to be expressed in the rat ventricle.¹⁴ The present study was undertaken to examine the changes in the expression of the different sarcolemmal voltage-gated K⁺ channel genes associated with post-MI ventricular remodeling. We report here that the gene expression and protein levels of these channels in the noninfarcted hypertrophied LV myocardium were significantly, and differently, altered after MI. These changes can be correlated with the changes in the APD observed in this model.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Experimental Myocardial Infarction
Female Sprague-Dawley rats weighing 200 to 250 g underwent either LAD ligation (post-MI group [n=10]) or sham operation (sham group [n=10]) as previously described.¹⁵ The rats used were of similar age and size to prevent the variability in gene expression that has been previously reported to be due to these factors. This model has been used in our and other laboratories for electophysiological experiments and was therefore chosen for the present study to facilitate comparison with prior reports. In this model, the infarcts are transmural, scar tissue formation is complete, and there is no visible evidence of inflammation.

Construction of DNA Templates
DNA templates were prepared by subcloning small (245- to 492-bp) cDNA fragments into pCR II (Invitrogen) and pBluescript I SK (Stratagene) vectors. The cDNA fragments used to make cRNA probes were from poorly conserved regions of the coding sequence; thus, there was little homology with the other K⁺ gene transcripts. The majority of the cDNA constructs were from the carboxy-terminal region of the proteins, where most of the nonidentity occurs between different isoforms. cDNA fragments were obtained in one of two ways: (1) cDNA fragments were isolated as restriction fragments or by PCR amplification from previously isolated cDNA clones (the Kv1.2, Kv1.4, Kv1.5, and Kv4.2 cDNAs were a kind gift from Dr M.M. Tamkun, Vanderbilt University, Nashville, Tenn) or (2) cDNA fragments were prepared by reverse transcription and PCR from total cellular RNA isolated from normal rat heart. Briefly, total cellular RNA was reverse-transcribed to cDNA with RNase H^- reverse transcriptase using random and oligo(dT) primers (Stratagene). cDNA obtained from 10 µg of total RNA was reverse-transcribed with 0.1 µg of primers in 25 mmol/L Tris-HCl, pH 9.5, and 50 mmol/L KCl and 3 U Hot Tub DNA polymerase (Amersham). The amplification reaction was run for 30 cycles at 91°C (2 minutes), 54°C (1 minute), and 72°C (2 minutes), followed by a final extension period of 10 minutes at 72°C. PCR products were size-separated on 1.2% agarose gel.

In keeping with the nomenclature adopted by the literature, standard terminology for K⁺ channel genes will be used throughout, where Kv designates a voltage-gated K⁺ channel, the first number designates the Drosophila family to which the clone is most homologous, and the second number indicates the order in which a given clone was identified.¹⁶ For each template, the following sequences were used as probes (the reference nucleotide sequence is given in brackets, and PCR primers are given when used): Kv1.2--(nucleotides 1305 to 1600 [RK2]¹⁷ ) forward CCAAAGATCCCGTCCTCCCC, reverse GCAGAACCAGATGCACACTG; Kv1.4: Sac I–Nsi I restriction fragment (nucleotides 1796 to 2127 [RK3]¹⁷ ) subcloned into the polylinker region of the SK⁺ vector in the Sac I–Pst I sites; Kv1.5: HindIII–Pst I restriction fragment gel-purified (nucleotides 1921 to 2421 [RK4]¹⁷ ) and subcloned into the polylinker region of the SK⁺ vector in the HindIII–Pst I sites; Kv2.1: (nucleotides 1931 to 2295 [drk]¹⁸ ) forward GCTCTGGTTTCTTCGTGGAG, reverse CACGCTGTAGAGCAGCTGAC; and Kv4.2: (nucleotides 295 to 640 [RK5]¹⁷ ) forward CCGCACGGGGAAGCTTCACT, reverse CCTGGGCTAGACCCACATGGA; the internal control used was a cDNA fragment of cyclophilin¹⁹ (nucleotides 38 to 142). All constructs were sequenced and were identical to the published sequences of Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2 rat genes.

Preparation of RNA From Ventricular Muscle
The animals from each experimental group, sham and post-MI, were killed 21 days after the procedure, and the heart was isolated. The right ventricle and left and right atrial appendages were carefully excised. For the post-MI group, the infarcted region was carefully removed from the noninfarcted remodeled LV myocardium under a dissecting microscope. The LV tissue was rinsed in saline to remove excess blood, snap-frozen in liquid nitrogen, and stored at -70°C. Total RNA was extracted from LV using the standard protocol of Chomczynski and Sacchi²⁰ of homogenization in acid guanidinium thiocyanate followed by phenol-chloroform extraction and ethanol precipitation. The amount of RNA recovered in each sample was determined spectrophotometrically at a wavelength of 260 nm, and the integrity of each sample was confirmed by analysis on a denaturing agarose gel.

RPA
RPAs were performed through concomitant measurement of cyclophilin gene expression (internal standard) to determine whether the expression of the various voltage-gated K⁺ channels was altered in post-MI remodeled hypertrophied LV myocardium. RPAs were modified from the method described by Kreig and Melton.²¹ The data obtained are a mean of at least two separate determinations for each RNA sample.

The previously mentioned cDNA templates were used to prepare [-³²P]UTP radiolabeled antisense cRNA probes (MAXIscript, Ambion). To differentiate between the specifically protected region of the probe and any remaining undigested probe, all probes contained regions of the plasmid sequence at one end of the transcript. Yeast RNA (10 µg) was used as a negative control to test for the presence of probe self-complementation by intramolecular hybridization, resulting in smaller than expected protected bands. To account for the relatively greater abundance of internal control mRNA compared with K⁺ channel mRNA in cardiac tissues and to avoid saturation of autoradiography in hybridizations, the reaction was carried out in the presence of excess cold UTP (200 µmol/L for cyclophilin), rendering a probe with less specific activity. To obtain full-length transcripts and lengthen the shelf life of the cRNA probes for all the K⁺ channels, transcription was performed in the presence of 25 µmol/L cold UTP. All cRNA probes were purified before use over 5% polyacrylamide/8 mol/L urea gel. Concomitant hybridization of the two probes (1x10⁴ cpm ionic channel cRNA and 1x10⁴ cpm cyclophilin cRNA per 10 µg total RNA sample) was carried out at 50°C for 18 hours, followed by digestion with RNAses A (250 U/mL) and T1 (10 000 U/mL) (Ambion) at 37°C for 30 minutes. The reaction was terminated by the addition of SDS and proteinase K, followed by phenol-chloroform extraction and ethanol precipitation. The protected fragments were visualized by autoradiography after electrophoresis on a 5% polyacrylamide/8 mol/L urea gel. Quantitative evaluation was carried out using scanning densitometric analysis.

Western Blot Analysis
Cardiac cell membrane preparation and Western blot analysis were performed as described previously by Barry et al.²² Sham (n=4) and post-MI (n=4) animal cardiac cell membranes were prepared, and 85 µg of protein was fractionated on a 10% polyacrylamide–SDS gel. After electrophoretic transfer to polyvinyldifluoride (Bio-Rad), the membranes were incubated with Kv 1.5, Kv2.1 (Upstate Biotechnology), and Kv4.2 (generously provided by D.M. Barry, J.M. Nerbonne, Washington University, St Louis, Mo) antisera at dilutions of 1:1000, 1:200, and 1:250, respectively. Bound primary antibody was detected with a 1:10 000 dilution of alkaline phosphatase–conjugated goat anti-rabbit IgG and the Western Light chemiluminescent protein detection kit according to the manufacturer's protocol (Tropix Inc). Quantitative immunoreactivity was determined by densitometry of the developed film that was in the linear ranges with respect to film exposure. Linearity between amounts of protein and immunoreactive signals were proved for each Kv channel subunit protein by plotting different amounts of protein at varying exposure times against corresponding densitometric units. Quantitative densitometric analysis was performed (Jandel Scientific).

Statistical Analysis
For comparisons between sham and post-MI LV myocardium, the arbitrary densitometric units were normalized to the value of the cyclophilin gene and were statistically compared by one-way ANOVA. The results were reproducible in two independent determinations; ie, every sample pair had consistent changes in level of mRNA expression in the post-MI group relative to the sham group. Differences in level of mRNA expression and immunoreactive protein levels were considered significant at P<.05, and dispersion from the mean was noted as mean±SEM.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Changes in K⁺ Channel Subunit mRNA Expression in Post-MI LV Myocardium
Kv1 Gene Family
Three distinct genes of the Shaker Kv1 family (Kv1.2, Kv1.4, and Kv1.5) are expressed in the rat ventricular tissue at moderate levels.¹⁴ RPA of LV myocardium of post-MI and sham-operated hearts demonstrated significant alterations principally in the mRNA levels of the Kv1.4 channel subunit. Fig 1 shows the expression of the Kv1.4 mRNA in post-MI and sham-operated animals. Relative to control, the gene expression of the Kv1.4 channel normalized to the cyclophilin expression was significantly decreased in the post-MI remodeled LV myocardium (0.811±0.211 in control versus 0.326±0.009 in post-MI myocardium, P<.03) (Fig 1).

View larger version (27K): [in this window] [in a new window]   Figure 1. Representative comparison of cardiac Kv1.4 gene expression in post-MI and sham-operated animals. A, Total cellular RNA was isolated from LV myocardium 3 weeks after sham operation and LAD ligation. Aliquots (10 µg) of RNA obtained from samples from six animals in each group were hybridized with antisense 32P-labeled cRNA probes, treated with single strand–specific RNases, and electrophoresed as described in "Materials and Methods." The bands represent the 295-bp and 103-bp "protected" fragments corresponding to Kv1.4 mRNA and cyclophilin mRNA. The negative sample contained 10 µg of yeast RNA. Each RPA was performed in duplicate to validate the results presented here. B, Bar graph demonstrating quantitative analysis of RPA of Kv1.4 mRNA levels in post-MI and sham-operated rat hearts. Radioactivity was quantified by scanning densitometry. Results were normalized to hybridization signals of cyclophilin mRNA. Reduced Kv1.4 mRNA levels were observed in the LV myocardium of the post-MI group compared with the sham-operated group (P<.03). Values are mean±SEM (n=6 for each group).

Fig 2 shows the expression of Kv1.2 gene in the experimental and control groups. No significant difference in LV Kv1.2 mRNA levels was observed between sham and post-MI rats (0.164±0.002 in control versus 0.146±0.001 in post-MI myocardium, P=NS) (Fig 2).

View larger version (27K): [in this window] [in a new window]   Figure 2. A, Representative comparison of cardiac Kv1.2 gene expression in post-MI and sham-operated animals by RPA. In these experiments, the LV myocardium sample contained 10 µg of total RNA. B, Bar graph of Kv1.2 mRNA content in LV of sham-operated and post-MI rats. There was no significant change in the mRNA levels of Kv1.2 between the LV myocardium of the post-MI and that of the sham-operated animals. Solid bars indicate post-MI rats; crosshatched bars, sham-operated rats. Values are mean±SEM (n=6 for each group).

The Kv1.5 mRNA is equally expressed between the rat atrium and ventricle.¹⁴ Two isoforms of 75 kD and 60 kD are recognized by the anti-Kv1.5 antibody in the rat atrium; however, only one protein band at 75 kD is seen in the rat ventricular tissue.²² The expression of Kv1.5 mRNA was slightly reduced in the post-MI group compared with the sham group, but the difference was not statistically significant (0.327±0.012 in control versus 0.243±0.016 in post-MI myocardium, P=NS for mRNA) (Fig 3).

View larger version (29K): [in this window] [in a new window]   Figure 3. A, Representative comparison of cardiac Kv1.5 gene expression in post-MI and sham-operated animals by RPA. In these experiments, the LV myocardium sample contained 10 µg of total RNA, and the negative sample contained 10 µg of yeast RNA. B, Bar graph of Kv1.5 mRNA from sham-operated and post-MI rats. There was no significant change in the mRNA levels of Kv1.5 between the LV myocardium of the post-MI and the sham-operated animals. Solid bars indicate post-MI rats; crosshatched bars, sham-operated rats. Values are mean±SEM (n=6 for each group).

Kv2 Gene Family
The rat heart has been shown to express only one (Kv2.1) of the two known genes in this family.¹⁶ The Kv2.1 mRNA level was significantly decreased in the post-MI group compared with the sham group (1.124±0.173 in control versus 0.508±0.015 in post-MI myocardium, P<.005) (Fig 4).

View larger version (29K): [in this window] [in a new window]   Figure 4. A, Representative comparison of cardiac Kv2.1 gene expression in post-MI and sham-operated animals by RPA. In these experiments, the LV myocardium sample contained 10 µg of total RNA, and the negative sample contained 10 µg of yeast RNA. B, Bar graph of Kv2.1 mRNA in LV of sham-operated and post-MI rats. There was significant decrease in the mRNA levels of Kv2.1 in the LV myocardium of the post-MI animals compared with sham-operated animals (P<.005). Solid bars indicate post-MI rats; crosshatched bars, sham-operated rats. Values are mean±SEM (n=6 for each group).

Kv4 Gene Family
A significant change in the mRNA content between sham-operated and infarcted animals was seen in Kv4.2 channel subunit expression. Expression of this channel was decreased by 53% in the post-MI remodeled LV myocardium (0.726±0.035 in control versus 0.346±0.020 in post-MI myocardium, P<.002) (Fig 5).

View larger version (33K): [in this window] [in a new window]   Figure 5. A, Representative comparison of cardiac Kv4.2 gene expression in post-MI and sham-operated animals by RPA. In these experiments, the LV myocardium sample contained 10 µg of total RNA, and the negative sample contained 10 µg of yeast RNA. Cardiac hypertrophy after MI is associated with downregulation of Kv4.2 channel mRNA levels in the LV. B, Bar graph of Kv4.2 mRNA in LV of sham-operated and post-MI rats. There was significant decrease in the mRNA levels of Kv4.2 in the LV myocardium of the post-MI group compared with the sham-operated group (P<.002). Solid bars indicate post-MI rats; crosshatched bars, sham-operated rats. Values are mean±SEM (n=6 for each group).

Changes in K⁺ Channel Subunit Protein Expression in Post-MI LV Myocardium
To ascertain whether the changes in the K⁺ channel subunit mRNAs were accompanied by a concordant change in the protein levels, Western blot analysis was performed. Since the Kv1.4 protein is not detected in the rat LV myocardium²² and the Kv1.2 mRNA levels were unchanged in the post-MI LV myocardium, determination of the expression of Kv1.5, Kv2.1, and Kv4.2 channel subunit proteins was undertaken (Fig 6). The expression of Kv1.5 protein was unchanged in the post-MI group compared with the sham group. Densitometric measurements of the 130-kD Kv2.1 immunoreactive protein revealed that this protein decreased by 1.8-fold in the post-MI LV myocardium (control versus post-MI myocardium, P<.03) (Fig 6). Densitometric measurements of the 74-kD Kv4.2 immunoreactive protein revealed that this protein decreased by threefold in the post-MI LV myocardium (control versus post-MI myocardium, P<.003).

View larger version (27K): [in this window] [in a new window]   Figure 6. A, Western blot analysis of Kv channel subunit immunoreactive proteins (Kv1.5, Kv 2.1, and Kv4.2) in LV myocardium from post-MI (n=4) and sham-operated (n=4) animals. Please note that different proteins were investigated in different blots. B, Bar graph showing Kv immunoreactivity by measuring the signal for the protein (Kv1.5, Kv2.1, and Kv4.2) by densitometry. Columns represent the immunoreactivities relative to the mean of the sham group, with error bars indicating SEM (n=4). Immunoreactivity of Kv2.1 and Kv4.2 proteins was significantly decreased in the LV myocardium of post-MI animals compared with sham-operated animals (P<.03 and P<.003, respectively). There was no significant change in the Kv1.5 immunoreactive protein level between the two experimental groups.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We used the well-established rat model of LAD ligation in which compensatory hypertrophy of the noninfarcted portion of the ventricle occurs rapidly after MI.^{2 23} Our recent electrophysiological study showed that the prolongation of APD of remodeled LV myocytes from rats 3 weeks after MI may be explained, in part, by decreased current density of both outward K⁺ currents, I_to-f and I_to-s, rather than by changes in the density or kinetics of the L-type Ca²⁺ current.¹³ The findings in the present study demonstrate a differential alteration in the expression of the five K⁺ channel subunits expressed in the rat ventricular myocardium. This is the first study undertaken to elucidate the molecular mechanisms underlying electrophysiological changes in post-MI remodeled LV myocardium and provides confirmation of our electrophysiological observations at the molecular level.

Cardiac hypertrophy is the primary long-term response of the heart to increased workload from a broad spectrum of causes, including MI.^{1 2} The morphological and functional characteristics of the hypertrophied ventricle depend on the nature of the workload. Dilatation of the LV chamber and cellular shape changes, characteristic of a combination of concentric and eccentric hypertrophic growth observed during remodeling after MI, are associated more with the features of volume-overload than pressure-overload hypertrophy.² It is important to ascertain whether this enlargement in myocyte size is accompanied by a proportional or disproportional change in key sarcolemmal ion channels responsible for changes in APD. In this regard, we have shown the absence of change in the mRNA level of the adult isoform of the ₁ subunit of the L-type cardiac Ca²⁺ channel in the remodeled LV myocardium 3 weeks after MI.²⁴ This finding correlates with our electrophysiological observation that L-type Ca²⁺ current density is not changed in this model of hypertrophy.¹³

Functional analysis suggests that >30 distinct mammalian K⁺ channels exist.¹⁶ Recent studies show that only five K⁺ channel subunits are expressed in the rat ventricle, four of which are expressed at relatively uniform levels across the ventricle (Kv1.2, Kv1.4, Kv1.5, and Kv2.1), while the fifth subunit, Kv4.2, is expressed eight times higher in the epicardial muscle than in the papillary muscle.¹⁴ The steady state mRNA levels of the K⁺ channel subunit genes cannot be directly correlated to protein content and function. For example, although the mRNA of the Kv1.4 subunit gene is abundantly expressed in the rat ventricular myocardium, the Kv1.4 protein is barely detectable in adult rat ventricular myocytes by Western blotting.²² In the same study, the authors argued that Kv4.2 and Kv2.1 are the most likely candidates for I_to-f and I_to-s, respectively, in adult rat ventricular myocytes. Heterologous expression of Kv2.1 has revealed slowly activating tetraethylammonium chloride–sensitive K⁺ current¹⁸ similar to I_to-s in adult rat ventricular myocytes.¹¹ We have shown that there is a significant reduction in the level of both Kv2.1 and Kv4.2 mRNA and immunoreactive protein. On the other hand, the mRNA expression and protein level of Kv1.5 and the mRNA levels of Kv1.2 showed no significant changes. Our results show remarkable correlation with the electrophysiological observations in this model.¹³ The prolongation of APD of post-MI remodeled LV myocytes and the marked variation in the time course of repolarization were explained by the decreased density of both I_to-f and I_to-s.¹³

It has been proposed that K⁺ channel isoforms that belong to the same gene family can associate with each other to form heterotetramers.^{22 23 24 25 26 27} The properties of these heteromultimeric channels are intermediate between those observed with each isoform alone. For example, it has been shown that coexpression of human Kv1.4 with rat Kv1.2 in Xenopus oocytes results in the formation of a hybrid channel that resembles native rat I_to-f.²⁸ The formation of K⁺ channel heterotetramers makes it more challenging in correlating expression of a single K⁺ channel subunit with the endogenous cardiac current.

The different K⁺ channel subunit genes are regulated at both the pretranslational and posttranslational levels. Matsubara et al²⁹ have shown that developmental expression of the RMK2 K⁺ channel is regulated in a tissue-specific manner. The variations in the quantity of RMK2 transcripts during development, especially the marked reduction in the ventricle of 6-month-old rats, suggest that pretranslational control plays an important role in regulating channel expression and determining the type and amount of K⁺ channels expressed in excitable tissues. In MI-induced hypertrophy, we also see variation in the expression of the different K⁺ channels. The mRNA of all K⁺ channels expressed in the rat ventricle, with the exception of Kv1.2, was reduced at disparate levels. Of interest is the significant decrease in the Kv1.4 mRNA expression in the post-MI myocardium in spite of the fact that the Kv1.4 protein is not detectable in the control adult rat ventricular myocardium.²² Thus, differential posttranscriptional control may also be a determinant in regulation of post-MI hypertrophy.

Correlation With Other Models of Hypertrophy
The density of I_to is generally reported to be decreased in different hypertrophy models in the rat. Xu and Best³⁰ found that the density of I_to (comparable to I_to-f) was reduced 38% in myocytes from rats with growth hormone–secreting tumors. Similarly, Cerbai et al³¹ described a substantial reduction in I_to density over a wide range of potentials in SHR. Tomita et al³² and Benitah et al⁹ reported diminished I_to in pressure overload–induced hypertrophy in the rat. However, Brooksby et al³³ found no change in the amplitude of early outward current at -35 mV in the SHR. There is no report concerning the density of I_to-s in rat hypertrophy models. Our findings that the magnitude of I_to-f density was diminished in post-MI LV myocytes are in general agreement with those reported from other rat hypertrophy models.

There are, however, several reasons why potentially different results should not be unexpected. First, different hypertrophy models may involve a different set of activating factors. Clark et al³⁴ have shown that hypertrophy of isolated adult feline cardiac muscle cells can be induced in culture by either - or ß-adrenergic agonists. However, each of these agonists activate different subsets of immediate-early response genes and have different effects on expression of "fetal protein" isoforms and stimulation of protein synthesis. Swynghedauw³⁵ suggested that myocardial hypertrophy, after MI, which compensates for loss of myocardium, may involve a different set of activating factors as opposed to hypertrophy as a reaction to stretch due to mechanical overload. Some of our recent data also support this view. For example, we have shown that the T-type Ca²⁺ current³⁶ and the fetal isoform of the ₁ subunit of the L-type Ca²⁺ channel,²⁴ present in neonatal rat cardiomyocytes but not in adult rat LV, are reexpressed in post-MI remodeled LV cardiomyocytes. None of these changes have been described in other models of rat cardiac hypertrophy.³ Thus, cardiac hypertrophy may involve a complex set of genetic, biochemical, physiological, and morphological changes involving diverse signal pathways, which ultimately result in an increase in cardiac muscle size and mass.¹ Second, the density of I_to may differ at different stages of hypertrophy. For example, in the pulmonary hypertension model in the rat, the density of I_to was increased compared with control on day 14 but was significantly decreased at day 21.³⁷ Third, the changes in I_to may be caused by changes in intracellular signals that regulate channel function rather than a change in sarcolemmal channel density.⁴

The only other study that investigated sarcolemmal K⁺ channel expression in cardiac hypertrophy has been performed in SHR and a pressure-overload rat model.³⁸ The authors reported that the Kv1.5 mRNA level was shown to be decreased while Kv1.4 mRNA level was increased in cardiac hypertrophy. This differential regulation was completely reversed by the reversal of hypertrophy. The authors also suggested that the decrease in Kv1.5 mRNA levels may explain the prolongation of APD seen in these models. However, the significance of these data is questionable, since recent studies have shown that Kv1.4 protein is not detected in rat ventricular myocardium and that Kv2.1, rather than Kv1.5, seems to be the likely candidate for the native I_to-s in rat.²²

In summary, we have shown that in rats 3 weeks after MI, the remodeled noninfarcted LV myocardium undergoes alteration in the expression of the different voltage-gated K⁺ channel subunit genes. The reduced mRNA and protein levels of the Kv4.2 and Kv2.1 channel subunits correlate remarkably well with our electrophysiological findings of decreased current density of I_to-f and I_to-s, respectively. These alterations in current density can explain, at least in part, the prolonged APD of remodeled LV myocytes and also contribute to the arrhythmogenicity of the post-MI heart.

	Selected Abbreviations and Acronyms

 

4-AP = 4-aminopyridine APD = action potential duration Ito = transient outward current Ito-f, Ito-s = rapidly and slowly activating Ito LAD = left anterior descending coronary artery LV = left ventricle (ventricular) MI = myocardial infarction PCR = polymerase chain reaction RPA = RNase protection assay SHR = spontaneously hypertensive rat(s)

	Acknowledgments

 
This study was supported by Veterans Affairs Medical Research Funds. The authors wish to thank Drs M. Boutjdir, M. Restivo, and M.A.Q. Siddiqui for their critical evaluation of this manuscript and Ben Caref and Venkat Batulla for their technical assistance. We thank Dr M.M. Tamkun for the cDNAs of the K⁺ channel subunits and Drs J.M. Nerbonne and D.M. Barry for the Kv4.2 antisera.

Received June 5, 1996; accepted July 5, 1996.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Swynghedauw B, ed. Cardiac Hypertrophy and Failure. Paris, France: INSERM/John Libbey; 1990.

2. Anversa P, Beghi C, Kikkawa Y, Olivetti G. Myocardial infarction in rats: infarct size, myocyte hypertrophy, and capillary growth. Circ Res. 1986;58:26-37.[Abstract/Free Full Text]

3. Hart G. Cellular electrophysiology in cardiac hypertrophy and failure. Cardiovasc Res. 1994;28:933-946.[Free Full Text]

4. Cohen IS, Datyner NB, Gintant GA, Kline RP. Time-dependent outward currents in the heart. In: Fozzard HA, Jennings RB, Haber E, Katz AM, Mortgan HE, eds. The Heart and Cardiovascular System. New York, NY: Raven Press Publishers; 1986:637-670.

5. Carmeliet E, Beimans G, Callewaert G, Vereecke J. Potassium currents in cardiac cells. Experientia. 1987;43:1175-1184.[Medline] [Order article via Infotrieve]

6. Anumonowo JMB, Freeman LC, Kwok WM, Kass RS. Potassium channels in the heart: electrophysiology and pharmacological regulation. Cardiovasc Drug Rev. 1991;9:299-316.

7. Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, Di Diego JM, Gintant GA, Liu D-W. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ Res. 1991;69:1427-1449.[Free Full Text]

8. Varro A, Lathrop DA, Hester SB, Nanasi PP, Papp JGY. Ionic currents and action potentials in rabbit, rat and guinea pig ventricular myocytes. Basic Res Cardiol. 1993;88:93-102.[Medline] [Order article via Infotrieve]

9. Benitah J-P, Gomez AM, Bailly P, Da-Ponte JP, Berson G, Delgado G, Lorente P. Heterogeneity of the early outward current in ventricular cells isolated from normal and hypertrophied rat hearts. J Physiol (Lond).. 1993;469:111-138.[Abstract/Free Full Text]

10. Wettwer E, Amos GJ, Posival H, Ravens U. Transient outward current in human ventricular myocytes of subepicardial and subendocardial origin. Circ Res. 1994;75:473-482.[Abstract/Free Full Text]

11. Apkon M, Nerbonne JM. Characterization of two distinct depolarization-activated K⁺ currents in isolated adult rat ventricular myocytes. J Gen Physiol. 1993;97:973-1011.[Abstract/Free Full Text]

12. Zhang Z-H, Boutjdir M, El-Sherif N. A novel slow kinetics 4-AP insensitive K current in rat ventricular myocytes. Circulation. 1994;90(suppl I):I-582. Abstract.

13. Qin D, Zhang Z-H, Boutjdir M, Jain P, El-Sherif N. Cellular and ionic basis of arrhythmias in post-infarction remodeled ventricular myocardium. Circ Res. 1996;79:461-473.[Abstract/Free Full Text]

14. Dixon JE, McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ Res. 1994;75:252-260.[Abstract/Free Full Text]

15. Jain P, Brown EJ Jr, Lagenback EG, Raeder E, Lillis O, Halpern J, Mannisi J. Effects of milrinone on left ventricular remodeling after acute myocardial infarction. Circulation. 1991;84:796-804.[Abstract/Free Full Text]

16. Roberds SL, Knoth KM, Po S, Blair A, Bennett PB, Hartshorne RP, Synders DJ, Tamkun MM. Molecular biology of the voltage-gated potassium channels of the cardiovascular system. J Cardiovasc Electrophysiol. 1993;4:68-79.[Medline] [Order article via Infotrieve]

17. Roberds SL, Tamkun MM. Cloning and tissue-specific expression of five voltage-gated potassium channel cDNAs expressed in rat heart. Proc Natl Acad Sci U S A. 1991;88:1798-1802.[Abstract/Free Full Text]

18. Frech GC, VanDongen AMJ, Schuster G, Brown AM, Joho RH. A novel potassium channel with delayed rectifier properties isolated from rat brain by expression cloning. Nature. 1989;340:642-645.[Medline] [Order article via Infotrieve]

19. Danielson P, Forss-Petter S, Brow M, Calavette L, Douglass J, Milner R, Sutcliffe J. A cDNA clone of the rat mRNA encoding cyclophilin. DNA. 1988;7:261-267.[Medline] [Order article via Infotrieve]

20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]

21. Kreig PA, Melton DA. In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol. 1987;155:397-415.[Medline] [Order article via Infotrieve]

22. Barry DM, Trimmer JS, Merlie JP, Nerbonne JM. Differential expression of voltage-gated K⁺ channel subunits in adult rat heart: relation to functional K⁺ channels? Circ Res. 1995;77:361-369.[Abstract/Free Full Text]

23. Pfeffer JM, Pfeffer MA, Fletcher PG, Braunwald E. Progressive ventricular remodeling in rat with myocardial infarction. Am J Physiol. 1991;260:H1406-H1414.[Abstract/Free Full Text]

24. Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non-infarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun. 1995;216:892-897.[Medline] [Order article via Infotrieve]

25. Christie MJ, North RA, Osborne PB, Douglass J, Adelman JP. Heteropolymeric potassium channels expressed in Xenopus oocytes from cloned subunits. Neuron. 1990;2:405-411.

26. Isacoff EY, Jan YN, Jan LY. Evidence for the formation of heteromultimeric potassium channels in Xenopus oocytes. Nature. 1990;345:530-534.[Medline] [Order article via Infotrieve]

27. Ruppersberg JP, Schroter KH, Sakmann B, Stocker M, Sewing S, Pongs O. Heteromultimeric channels formed by rat brain potassium-channel proteins. Nature. 1990;345:535-537.[Medline] [Order article via Infotrieve]

28. Po S, Roberds S, Snyders DJ, Tamkun MM, Bennett PB. Heteromultimeric assembly of human potassium channels: molecular basis of a transient outward current? Circ Res. 1993;72:1326-1336.[Abstract/Free Full Text]

29. Matsubara H, Liman ER, Hess P, Koren G. Pretranslational mechanisms determine the type of potassium channels expressed in the rat skeletal and cardiac muscles. J Biol Chem. 1991;266:13324-13328.[Abstract/Free Full Text]

30. Xu X, Best PM. Decreased transient outward current K⁺ current in ventricular myocytes from acromegalic rats. Am J Physiol. 1991;260:H935-H942.[Abstract/Free Full Text]

31. Cerbai E, Barbieri M, Li Q, Mugelli A. Ionic bases of action potential prolongation of hypertrophied myocytes isolated from hearts of spontaneously hypertensive rats of different ages. Cardiovasc Res.. 1994;28:1180-1187.[Abstract/Free Full Text]

32. Tomita F, Bassett AL, Myerburg RJ, Kimura S. Diminished transient outward currents in rat hypertrophied ventricular myocytes. Circ Res. 1994;75:296-303.[Abstract/Free Full Text]

33. Brooksby P, Levi AJ, Jones JV. The electrophysiological characteristics of hypertrophied ventricular myocytes from the spontaneously hypertensive rat. J Hypertens. 1993;11:611-622.[Medline] [Order article via Infotrieve]

34. Clark WA, Rudnick SJ, Andersen LC, LaPres JJ. Myosin heavy chain synthesis is independently regulated in hypertrophy and atrophy of isolated adult cardiac myocytes. J Biol Chem. 1994;269:25562-25569.[Abstract/Free Full Text]

35. Swynghedauw B. Biological adaptation of the myocardium to permanent change in loading condition. Basic Res Cardiol. 1992;87(suppl II):1-10.

36. Qin D, Jain P, Zhang Z-H, Boutjdir M, El-Sherif N. Expression of T-type calcium current in remodeled hypertrophied left ventricle from adult rat following myocardial infarction. Circulation. 1995;92(suppl I):I-587. Abstract.

37. Lee J-K, Kodama I, Honjo H, Kamiya K, Toyama J. Stage-dependent changes of membrane currents in rat ventricular myocytes associated with myocardial hypertrophy. Circulation. 1995;92(suppl I):I-574. Abstract.

38. Matsubara H, Suzuki J, Inada M. Shaker-related potassium channel, Kv1.4 mRNA regulation in cultured rat heart myocytes and differential expression of Kv1.4 and Kv1.5 genes in myocardial development and hypertrophy. J Clin Invest. 1993;92:1659-1697.

This article has been cited by other articles:

				E. Saygili, O. R. Rana, E. Saygili, H. Reuter, K. Frank, R. H. G. Schwinger, J. Muller-Ehmsen, and C. Zobel Losartan prevents stretch-induced electrical remodeling in cultured atrial neonatal myocytes Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2898 - H2905. [Abstract] [Full Text] [PDF]

				S. Nattel, A. Maguy, S. Le Bouter, and Y.-H. Yeh Arrhythmogenic Ion-Channel Remodeling in the Heart: Heart Failure, Myocardial Infarction, and Atrial Fibrillation Physiol Rev, April 1, 2007; 87(2): 425 - 456. [Abstract] [Full Text] [PDF]

				D. Goltz, J.-H. Schultz, C. Stucke, M. Wagner, P. Bassalay, A. P. Schwoerer, H. Ehmke, and T. Volk Diminished Kv4.2/3 but not KChIP2 levels reduce the cardiac transient outward K+ current in spontaneously hypertensive rats Cardiovasc Res, April 1, 2007; 74(1): 85 - 95. [Abstract] [Full Text] [PDF]

				N. S. Dhalla, M. R. Dent, P. S. Tappia, R. Sethi, J. Barta, and R. K. Goyal Subcellular Remodeling as a Viable Target for the Treatment of Congestive Heart Failure Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2006; 11(1): 31 - 45. [Abstract] [PDF]

				M. Eghbali, R. Deva, A. Alioua, T. Y. Minosyan, H. Ruan, Y. Wang, L. Toro, and E. Stefani Molecular and Functional Signature of Heart Hypertrophy During Pregnancy Circ. Res., June 10, 2005; 96(11): 1208 - 1216. [Abstract] [Full Text] [PDF]

				F. G. Akar, R. C. Wu, G. J. Juang, Y. Tian, M. Burysek, D. DiSilvestre, W. Xiong, A. A. Armoundas, and G. F. Tomaselli Molecular mechanisms underlying K+ current downregulation in canine tachycardia-induced heart failure Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2887 - H2896. [Abstract] [Full Text] [PDF]

				G. C. L. Bett and R. L. Rasmusson Inactivation and recovery in Kv1.4 K+ channels: lipophilic interactions at the intracellular mouth of the pore J. Physiol., April 1, 2004; 556(1): 109 - 120. [Abstract] [Full Text] [PDF]

				D. Fedida, J. Eldstrom, J. C. Hesketh, M. Lamorgese, L. Castel, D. F. Steele, and D. R. Van Wagoner Kv1.5 Is an Important Component of Repolarizing K+ Current in Canine Atrial Myocytes Circ. Res., October 17, 2003; 93(8): 744 - 751. [Abstract] [Full Text] [PDF]

				S. L. Bouter, S. Demolombe, A. Chambellan, C. Bellocq, F. Aimond, G. Toumaniantz, G. Lande, S. Siavoshian, I. Baro, A. L. Pond, et al. Microarray Analysis Reveals Complex Remodeling of Cardiac Ion Channel Expression With Altered Thyroid Status: Relation to Cellular and Integrated Electrophysiology Circ. Res., February 7, 2003; 92(2): 234 - 242. [Abstract] [Full Text] [PDF]

				X. Li, G. C. L. Bett, X. Jiang, V. E. Bondarenko, M. J. Morales, and R. L. Rasmusson Regulation of N- and C-type inactivation of Kv1.4 by pHo and K+: evidence for transmembrane communication Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H71 - H80. [Abstract] [Full Text] [PDF]

				H. El-Adawi, L. Deng, A. Tramontano, S. Smith, E. Mascareno, K. Ganguly, R. Castillo, and N. El-Sherif The functional role of the JAK-STAT pathway in post-infarction remodeling Cardiovasc Res, January 1, 2003; 57(1): 129 - 138. [Abstract] [Full Text] [PDF]

				R. Kaprielian, R. Sah, T. Nguyen, A. D. Wickenden, and P. H. Backx Myocardial infarction in rat eliminates regional heterogeneity of AP profiles, Ito K+ currents, and [Ca2+]i transients Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1157 - H1168. [Abstract] [Full Text] [PDF]

				G. J. Rozanski and Z. Xu Glutathione and K+ channel remodeling in postinfarction rat heart Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2346 - H2355. [Abstract] [Full Text] [PDF]

				B Swynghedauw and D Charlemagne What is wrong with positive inotropic drugs? Lessons from basic science and clinical trials Eur. Heart J. Suppl., April 1, 2002; 4(suppl_D): D43 - D49. [Abstract] [PDF]

				B Huang, D Qin, and N El-Sherif Spatial alterations of Kv channels expression and K+ currents in post-MI remodeled rat heart Cardiovasc Res, November 1, 2001; 52(2): 246 - 254. [Abstract] [Full Text] [PDF]

				X.-Q. Zhang, L.-Q. Zhang, B. M. Palmer, Y.-C. Ng, T. I. Musch, R. L. Moore, and J. Y. Cheung Sprint training shortens prolonged action potential duration in postinfarction rat myocyte: mechanisms J Appl Physiol, May 1, 2001; 90(5): 1720 - 1728. [Abstract] [Full Text] [PDF]

				B. Huang, D. Qin, L. Deng, M. Boutjdir, and N. El-Sherif Reexpression of T-type Ca2+ channel gene and current in post-infarction remodeled rat left ventricle Cardiovasc Res, June 1, 2000; 46(3): 442 - 449. [Abstract] [Full Text] [PDF]

				A. D. Wickenden, R. Kaprielian, X.-M. You, and P. H. Backx The thyroid hormone analog DITPA restores Ito in rats after myocardial infarction Am J Physiol Heart Circ Physiol, April 1, 2000; 278(4): H1105 - H1116. [Abstract] [Full Text] [PDF]

				Y. Qu, A. Ghatpande, N. El-Sherif, and M. Boutjdir Gene expression of Na+/Ca2+ exchanger during development in human heart Cardiovasc Res, March 1, 2000; 45(4): 866 - 873. [Abstract] [Full Text] [PDF]

				A. D. Wickenden, P. Lee, R. Sah, Q. Huang, G. I. Fishman, and P. H. Backx Targeted Expression of a Dominant-Negative Kv4.2 K+ Channel Subunit in the Mouse Heart Circ. Res., November 26, 1999; 85(11): 1067 - 1076. [Abstract] [Full Text] [PDF]

				B. Huang, S. Wang, D. Qin, M. Boutjdir, and N. El-Sherif Diminished Basal Phosphorylation Level of Phospholamban in the Postinfarction Remodeled Rat Ventricle : Role of {beta}-Adrenergic Pathway, Gi Protein, Phosphodiesterase, and Phosphatases Circ. Res., October 29, 1999; 85(9): 848 - 855. [Abstract] [Full Text] [PDF]

				T. Kiyosue and M. Arita Altered expression of cardiac K+ channel genes during sub-acute and healing phases of myocardial infarction Cardiovasc Res, October 1, 1999; 44(1): 13 - 16. [Full Text] [PDF]

				J.-A. Yao, M. Jiang, J.-S. Fan, Y.-Y. Zhou, and G.-N. Tseng Heterogeneous changes in K currents in rat ventricles three days after myocardial infarction Cardiovasc Res, October 1, 1999; 44(1): 132 - 145. [Abstract] [Full Text] [PDF]

				T. Volk, T. H.-D. Nguyen, J.-H. Schultz, and H. Ehmke Relationship between transient outward K+ current and Ca2+ influx in rat cardiac myocytes of endo- and epicardial origin J. Physiol., September 15, 1999; 519(3): 841 - 850. [Abstract] [Full Text] [PDF]

				R Kaprielian, A D Wickenden, Z Kassiri, T G Parker, P P Liu, and P H Backx Relationship between K+ channel down-regulation and [Ca2+ ]i in rat ventricular myocytes following myocardial infarction J. Physiol., May 15, 1999; 517(1): 229 - 245. [Abstract] [Full Text] [PDF]

				G. F. Tomaselli and E. Marban Electrophysiological remodeling in hypertrophy and heart failure Cardiovasc Res, May 1, 1999; 42(2): 270 - 283. [Full Text] [PDF]

				J. M.B Pinto and P. A Boyden Electrical remodeling in ischemia and infarction Cardiovasc Res, May 1, 1999; 42(2): 284 - 297. [Abstract] [Full Text] [PDF]

				S. M Bryant, S.J. Shipsey, and G. Hart Normal regional distribution of membrane current density in rat left ventricle is altered in catecholamine-induced hypertrophy Cardiovasc Res, May 1, 1999; 42(2): 391 - 401. [Abstract] [Full Text] [PDF]

				F. Aimond, J. L Alvarez, J.-M. Rauzier, P. Lorente, and G. Vassort Ionic basis of ventricular arrhythmias in remodeled rat heart during long-term myocardial infarction Cardiovasc Res, May 1, 1999; 42(2): 402 - 415. [Abstract] [Full Text] [PDF]

				L. Yue, P. Melnyk, R. Gaspo, Z. Wang, and S. Nattel Molecular Mechanisms Underlying Ionic Remodeling in a Dog Model of Atrial Fibrillation Circ. Res., April 16, 1999; 84(7): 776 - 784. [Abstract] [Full Text] [PDF]

				K. M. Hershman and E. S. Levitan Cell-cell contact between adult rat cardiac myocytes regulates Kv1.5 and Kv4.2 K+ channel mRNA expression Am J Physiol Cell Physiol, December 1, 1998; 275(6): C1473 - C1480. [Abstract] [Full Text] [PDF]

				W. Kong, S. Po, T. Yamagishi, M. D. Ashen, G. Stetten, and G. F. Tomaselli Isolation and characterization of the human gene encoding Ito: further diversity by alternative mRNA splicing Am J Physiol Heart Circ Physiol, December 1, 1998; 275(6): H1963 - H1970. [Abstract] [Full Text] [PDF]

				Z. Wang, L. Yue, M. White, G. Pelletier, and S. Nattel Differential Distribution of Inward Rectifier Potassium Channel Transcripts in Human Atrium Versus Ventricle Circulation, December 1, 1998; 98(22): 2422 - 2428. [Abstract] [Full Text] [PDF]

				A. Nishiyama, F. Kambe, K. Kamiya, H. Seo, and J. Toyama Effects of thyroid status on expression of voltage-gated potassium channels in rat left ventricle Cardiovasc Res, November 1, 1998; 40(2): 343 - 351. [Abstract] [Full Text] [PDF]

				P. Lee, G. Morley, Q. Huang, A. Fischer, S. Seiler, J. W. Horner, S. Factor, D. Vaidya, J. Jalife, and G. I. Fishman Conditional lineage ablation to model human diseases PNAS, September 15, 1998; 95(19): 11371 - 11376. [Abstract] [Full Text] [PDF]

				D. M. Barry, H. Xu, R. B. Schuessler, and J. M. Nerbonne Functional Knockout of the Transient Outward Current, Long-QT Syndrome, and Cardiac Remodeling in Mice Expressing a Dominant-Negative Kv4 {alpha} Subunit Circ. Res., September 7, 1998; 83(5): 560 - 567. [Abstract] [Full Text] [PDF]

				A. D Wickenden, R. Kaprielian, Z. Kassiri, J. N Tsoporis, R. Tsushima, G. I Fishman, and P. H Backx The role of action potential prolongation and altered intracellular calcium handling in the pathogenesis of heart failure Cardiovasc Res, February 1, 1998; 37(2): 312 - 323. [Abstract] [Full Text] [PDF]

				G. J. Rozanski, Z. Xu, K. Zhang, and K. P. Patel Altered K+ current of ventricular myocytes in rats with chronic myocardial infarction Am J Physiol Heart Circ Physiol, January 1, 1998; 274(1): H259 - H265. [Abstract] [Full Text] [PDF]

				K. Takimoto, D. Li, K. M. Hershman, P. Li, E. K. Jackson, and E. S. Levitan Decreased Expression of Kv4.2 and Novel Kv4.3 K+ Channel Subunit mRNAs in Ventricles of Renovascular Hypertensive Rats Circ. Res., October 19, 1997; 81(4): 533 - 539. [Abstract] [Full Text]

				A. M. Choy, C. C. Lang, D. M. Chomsky, G. H. Rayos, J. R. Wilson, and D. M. Roden Normalization of Acquired QT Prolongation in Humans by Intravenous Potassium Circulation, October 7, 1997; 96(7): 2149 - 2154. [Abstract] [Full Text]

				M. Song, G. Helguera, M. Eghbali, N. Zhu, M. M. Zarei, R. Olcese, L. Toro, and E. Stefani Remodeling of Kv4.3 Potassium Channel Gene Expression under the Control of Sex Hormones J. Biol. Chem., August 17, 2001; 276(34): 31883 - 31890. [Abstract] [Full Text] [PDF]

				G. J. Rozanski and Z. Xu Glutathione and K+ channel remodeling in postinfarction rat heart Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2346 - H2355. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gidh-Jain, M. Articles by El-Sherif, N. Search for Related Content PubMed PubMed Citation Articles by Gidh-Jain, M. Articles by El-Sherif, N. Pubmed/NCBI databases Medline Plus Health Information Heart Attack