Articles |
the Cardiology Division, Department of Medicine, State University of New York Health Science Center and Veterans Affairs Medical Center, Brooklyn, NY.
Correspondence to Madhavi Gidh-Jain, Cardiology Division, Veterans Affairs Medical Center, 800 Poly Pl, Brooklyn, NY 11209.
| Abstract |
|---|
|
|
|---|
Key Words: cardiac hypertrophy myocardial infarction K+ channel mRNA levels
| Introduction |
|---|
|
|
|---|
Five distinct K+ channel subunit mRNAs (Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2) are shown to be expressed in the rat ventricle.14 The present study was undertaken to examine the changes in the expression of the different sarcolemmal voltage-gated K+ channel genes associated with post-MI ventricular remodeling. We report here that the gene expression and protein levels of these channels in the noninfarcted hypertrophied LV myocardium were significantly, and differently, altered after MI. These changes can be correlated with the changes in the APD observed in this model.
| Materials and Methods |
|---|
|
|
|---|
Construction of DNA Templates
DNA templates were prepared by subcloning small (245- to 492-bp) cDNA fragments into pCR II (Invitrogen) and pBluescript I SK (Stratagene) vectors. The cDNA fragments used to make cRNA probes were from poorly conserved regions of the coding sequence; thus, there was little homology with the other K+ gene transcripts. The majority of the cDNA constructs were from the carboxy-terminal region of the proteins, where most of the nonidentity occurs between different isoforms. cDNA fragments were obtained in one of two ways: (1) cDNA fragments were isolated as restriction fragments or by PCR amplification from previously isolated cDNA clones (the Kv1.2, Kv1.4, Kv1.5, and Kv4.2 cDNAs were a kind gift from Dr M.M. Tamkun, Vanderbilt University, Nashville, Tenn) or (2) cDNA fragments were prepared by reverse transcription and PCR from total cellular RNA isolated from normal rat heart. Briefly, total cellular RNA was reverse-transcribed to cDNA with RNase H- reverse transcriptase using random and oligo(dT) primers (Stratagene). cDNA obtained from 10 µg of total RNA was reverse-transcribed with 0.1 µg of primers in 25 mmol/L Tris-HCl, pH 9.5, and 50 mmol/L KCl and 3 U Hot Tub DNA polymerase (Amersham). The amplification reaction was run for 30 cycles at 91°C (2 minutes), 54°C (1 minute), and 72°C (2 minutes), followed by a final extension period of 10 minutes at 72°C. PCR products were size-separated on 1.2% agarose gel.
In keeping with the nomenclature adopted by the literature, standard terminology for K+ channel genes will be used throughout, where Kv designates a voltage-gated K+ channel, the first number designates the Drosophila family to which the clone is most homologous, and the second number indicates the order in which a given clone was identified.16 For each template, the following sequences were used as probes (the reference nucleotide sequence is given in brackets, and PCR primers are given when used): Kv1.2--(nucleotides 1305 to 1600 [RK2]17 ) forward CCAAAGATCCCGTCCTCCCC, reverse GCAGAACCAGATGCACACTG; Kv1.4: Sac INsi I restriction fragment (nucleotides 1796 to 2127 [RK3]17 ) subcloned into the polylinker region of the SK+ vector in the Sac IPst I sites; Kv1.5: HindIIIPst I restriction fragment gel-purified (nucleotides 1921 to 2421 [RK4]17 ) and subcloned into the polylinker region of the SK+ vector in the HindIIIPst I sites; Kv2.1: (nucleotides 1931 to 2295 [drk]18 ) forward GCTCTGGTTTCTTCGTGGAG, reverse CACGCTGTAGAGCAGCTGAC; and Kv4.2: (nucleotides 295 to 640 [RK5]17 ) forward CCGCACGGGGAAGCTTCACT, reverse CCTGGGCTAGACCCACATGGA; the internal control used was a cDNA fragment of cyclophilin19 (nucleotides 38 to 142). All constructs were sequenced and were identical to the published sequences of Kv1.2, Kv1.4, Kv1.5, Kv2.1, and Kv4.2 rat genes.
Preparation of RNA From Ventricular Muscle
The animals from each experimental group, sham and post-MI, were killed 21 days after the procedure, and the heart was isolated. The right ventricle and left and right atrial appendages were carefully excised. For the post-MI group, the infarcted region was carefully removed from the noninfarcted remodeled LV myocardium under a dissecting microscope. The LV tissue was rinsed in saline to remove excess blood, snap-frozen in liquid nitrogen, and stored at -70°C. Total RNA was extracted from LV using the standard protocol of Chomczynski and Sacchi20 of homogenization in acid guanidinium thiocyanate followed by phenol-chloroform extraction and ethanol precipitation. The amount of RNA recovered in each sample was determined spectrophotometrically at a wavelength of 260 nm, and the integrity of each sample was confirmed by analysis on a denaturing agarose gel.
RPA
RPAs were performed through concomitant measurement of cyclophilin gene expression (internal standard) to determine whether the expression of the various voltage-gated K+ channels was altered in post-MI remodeled hypertrophied LV myocardium. RPAs were modified from the method described by Kreig and Melton.21 The data obtained are a mean of at least two separate determinations for each RNA sample.
The previously mentioned cDNA templates were used to prepare [
-32P]UTP radiolabeled antisense cRNA probes (MAXIscript, Ambion). To differentiate between the specifically protected region of the probe and any remaining undigested probe, all probes contained regions of the plasmid sequence at one end of the transcript. Yeast RNA (10 µg) was used as a negative control to test for the presence of probe self-complementation by intramolecular hybridization, resulting in smaller than expected protected bands. To account for the relatively greater abundance of internal control mRNA compared with K+ channel mRNA in cardiac tissues and to avoid saturation of autoradiography in hybridizations, the reaction was carried out in the presence of excess cold UTP (200 µmol/L for cyclophilin), rendering a probe with less specific activity. To obtain full-length transcripts and lengthen the shelf life of the cRNA probes for all the K+ channels, transcription was performed in the presence of 25 µmol/L cold UTP. All cRNA probes were purified before use over 5% polyacrylamide/8 mol/L urea gel. Concomitant hybridization of the two probes (1x104 cpm ionic channel cRNA and 1x104 cpm cyclophilin cRNA per 10 µg total RNA sample) was carried out at 50°C for 18 hours, followed by digestion with RNAses A (250 U/mL) and T1 (10 000 U/mL) (Ambion) at 37°C for 30 minutes. The reaction was terminated by the addition of SDS and proteinase K, followed by phenol-chloroform extraction and ethanol precipitation. The protected fragments were visualized by autoradiography after electrophoresis on a 5% polyacrylamide/8 mol/L urea gel. Quantitative evaluation was carried out using scanning densitometric analysis.
Western Blot Analysis
Cardiac cell membrane preparation and Western blot analysis were performed as described previously by Barry et al.22 Sham (n=4) and post-MI (n=4) animal cardiac cell membranes were prepared, and 85 µg of protein was fractionated on a 10% polyacrylamideSDS gel. After electrophoretic transfer to polyvinyldifluoride (Bio-Rad), the membranes were incubated with Kv 1.5, Kv2.1 (Upstate Biotechnology), and Kv4.2 (generously provided by D.M. Barry, J.M. Nerbonne, Washington University, St Louis, Mo) antisera at dilutions of 1:1000, 1:200, and 1:250, respectively. Bound primary antibody was detected with a 1:10 000 dilution of alkaline phosphataseconjugated goat anti-rabbit IgG and the Western Light chemiluminescent protein detection kit according to the manufacturer's protocol (Tropix Inc). Quantitative immunoreactivity was determined by densitometry of the developed film that was in the linear ranges with respect to film exposure. Linearity between amounts of protein and immunoreactive signals were proved for each Kv channel subunit protein by plotting different amounts of protein at varying exposure times against corresponding densitometric units. Quantitative densitometric analysis was performed (Jandel Scientific).
Statistical Analysis
For comparisons between sham and post-MI LV myocardium, the arbitrary densitometric units were normalized to the value of the cyclophilin gene and were statistically compared by one-way ANOVA. The results were reproducible in two independent determinations; ie, every sample pair had consistent changes in level of mRNA expression in the post-MI group relative to the sham group. Differences in level of mRNA expression and immunoreactive protein levels were considered significant at P<.05, and dispersion from the mean was noted as mean±SEM.
| Results |
|---|
|
|
|---|
|
Fig 2
shows the expression of Kv1.2 gene in the experimental and control groups. No significant difference in LV Kv1.2 mRNA levels was observed between sham and post-MI rats (0.164±0.002 in control versus 0.146±0.001 in post-MI myocardium, P=NS) (Fig 2
).
|
The Kv1.5 mRNA is equally expressed between the rat atrium and ventricle.14 Two isoforms of 75 kD and 60 kD are recognized by the anti-Kv1.5 antibody in the rat atrium; however, only one protein band at 75 kD is seen in the rat ventricular tissue.22 The expression of Kv1.5 mRNA was slightly reduced in the post-MI group compared with the sham group, but the difference was not statistically significant (0.327±0.012 in control versus 0.243±0.016 in post-MI myocardium, P=NS for mRNA) (Fig 3
).
|
Kv2 Gene Family
The rat heart has been shown to express only one (Kv2.1) of the two known genes in this family.16 The Kv2.1 mRNA level was significantly decreased in the post-MI group compared with the sham group (1.124±0.173 in control versus 0.508±0.015 in post-MI myocardium, P<.005) (Fig 4
).
|
Kv4 Gene Family
A significant change in the mRNA content between sham-operated and infarcted animals was seen in Kv4.2 channel subunit expression. Expression of this channel was decreased by 53% in the post-MI remodeled LV myocardium (0.726±0.035 in control versus 0.346±0.020 in post-MI myocardium, P<.002) (Fig 5
).
|
Changes in K+ Channel Subunit Protein Expression in Post-MI LV Myocardium
To ascertain whether the changes in the K+ channel subunit mRNAs were accompanied by a concordant change in the protein levels, Western blot analysis was performed. Since the Kv1.4 protein is not detected in the rat LV myocardium22 and the Kv1.2 mRNA levels were unchanged in the post-MI LV myocardium, determination of the expression of Kv1.5, Kv2.1, and Kv4.2 channel subunit proteins was undertaken (Fig 6
). The expression of Kv1.5 protein was unchanged in the post-MI group compared with the sham group. Densitometric measurements of the 130-kD Kv2.1 immunoreactive protein revealed that this protein decreased by 1.8-fold in the post-MI LV myocardium (control versus post-MI myocardium, P<.03) (Fig 6
). Densitometric measurements of the 74-kD Kv4.2 immunoreactive protein revealed that this protein decreased by threefold in the post-MI LV myocardium (control versus post-MI myocardium, P<.003).
|
| Discussion |
|---|
|
|
|---|
Cardiac hypertrophy is the primary long-term response of the heart to increased workload from a broad spectrum of causes, including MI.1 2 The morphological and functional characteristics of the hypertrophied ventricle depend on the nature of the workload. Dilatation of the LV chamber and cellular shape changes, characteristic of a combination of concentric and eccentric hypertrophic growth observed during remodeling after MI, are associated more with the features of volume-overload than pressure-overload hypertrophy.2 It is important to ascertain whether this enlargement in myocyte size is accompanied by a proportional or disproportional change in key sarcolemmal ion channels responsible for changes in APD. In this regard, we have shown the absence of change in the mRNA level of the adult isoform of the
1 subunit of the L-type cardiac Ca2+ channel in the remodeled LV myocardium 3 weeks after MI.24 This finding correlates with our electrophysiological observation that L-type Ca2+ current density is not changed in this model of hypertrophy.13
Functional analysis suggests that >30 distinct mammalian K+ channels exist.16 Recent studies show that only five K+ channel subunits are expressed in the rat ventricle, four of which are expressed at relatively uniform levels across the ventricle (Kv1.2, Kv1.4, Kv1.5, and Kv2.1), while the fifth subunit, Kv4.2, is expressed eight times higher in the epicardial muscle than in the papillary muscle.14 The steady state mRNA levels of the K+ channel subunit genes cannot be directly correlated to protein content and function. For example, although the mRNA of the Kv1.4 subunit gene is abundantly expressed in the rat ventricular myocardium, the Kv1.4 protein is barely detectable in adult rat ventricular myocytes by Western blotting.22 In the same study, the authors argued that Kv4.2 and Kv2.1 are the most likely candidates for Ito-f and Ito-s, respectively, in adult rat ventricular myocytes. Heterologous expression of Kv2.1 has revealed slowly activating tetraethylammonium chloridesensitive K+ current18 similar to Ito-s in adult rat ventricular myocytes.11 We have shown that there is a significant reduction in the level of both Kv2.1 and Kv4.2 mRNA and immunoreactive protein. On the other hand, the mRNA expression and protein level of Kv1.5 and the mRNA levels of Kv1.2 showed no significant changes. Our results show remarkable correlation with the electrophysiological observations in this model.13 The prolongation of APD of post-MI remodeled LV myocytes and the marked variation in the time course of repolarization were explained by the decreased density of both Ito-f and Ito-s.13
It has been proposed that K+ channel isoforms that belong to the same gene family can associate with each other to form heterotetramers.22 23 24 25 26 27 The properties of these heteromultimeric channels are intermediate between those observed with each isoform alone. For example, it has been shown that coexpression of human Kv1.4 with rat Kv1.2 in Xenopus oocytes results in the formation of a hybrid channel that resembles native rat Ito-f.28 The formation of K+ channel heterotetramers makes it more challenging in correlating expression of a single K+ channel subunit with the endogenous cardiac current.
The different K+ channel subunit genes are regulated at both the pretranslational and posttranslational levels. Matsubara et al29 have shown that developmental expression of the RMK2 K+ channel is regulated in a tissue-specific manner. The variations in the quantity of RMK2 transcripts during development, especially the marked reduction in the ventricle of 6-month-old rats, suggest that pretranslational control plays an important role in regulating channel expression and determining the type and amount of K+ channels expressed in excitable tissues. In MI-induced hypertrophy, we also see variation in the expression of the different K+ channels. The mRNA of all K+ channels expressed in the rat ventricle, with the exception of Kv1.2, was reduced at disparate levels. Of interest is the significant decrease in the Kv1.4 mRNA expression in the post-MI myocardium in spite of the fact that the Kv1.4 protein is not detectable in the control adult rat ventricular myocardium.22 Thus, differential posttranscriptional control may also be a determinant in regulation of post-MI hypertrophy.
Correlation With Other Models of Hypertrophy
The density of Ito is generally reported to be decreased in different hypertrophy models in the rat. Xu and Best30 found that the density of Ito (comparable to Ito-f) was reduced 38% in myocytes from rats with growth hormonesecreting tumors. Similarly, Cerbai et al31 described a substantial reduction in Ito density over a wide range of potentials in SHR. Tomita et al32 and Benitah et al9 reported diminished Ito in pressure overloadinduced hypertrophy in the rat. However, Brooksby et al33 found no change in the amplitude of early outward current at -35 mV in the SHR. There is no report concerning the density of Ito-s in rat hypertrophy models. Our findings that the magnitude of Ito-f density was diminished in post-MI LV myocytes are in general agreement with those reported from other rat hypertrophy models.
There are, however, several reasons why potentially different results should not be unexpected. First, different hypertrophy models may involve a different set of activating factors. Clark et al34 have shown that hypertrophy of isolated adult feline cardiac muscle cells can be induced in culture by either
- or ß-adrenergic agonists. However, each of these agonists activate different subsets of immediate-early response genes and have different effects on expression of "fetal protein" isoforms and stimulation of protein synthesis. Swynghedauw35 suggested that myocardial hypertrophy, after MI, which compensates for loss of myocardium, may involve a different set of activating factors as opposed to hypertrophy as a reaction to stretch due to mechanical overload. Some of our recent data also support this view. For example, we have shown that the T-type Ca2+ current36 and the fetal isoform of the
1 subunit of the L-type Ca2+ channel,24 present in neonatal rat cardiomyocytes but not in adult rat LV, are reexpressed in post-MI remodeled LV cardiomyocytes. None of these changes have been described in other models of rat cardiac hypertrophy.3 Thus, cardiac hypertrophy may involve a complex set of genetic, biochemical, physiological, and morphological changes involving diverse signal pathways, which ultimately result in an increase in cardiac muscle size and mass.1 Second, the density of Ito may differ at different stages of hypertrophy. For example, in the pulmonary hypertension model in the rat, the density of Ito was increased compared with control on day 14 but was significantly decreased at day 21.37 Third, the changes in Ito may be caused by changes in intracellular signals that regulate channel function rather than a change in sarcolemmal channel density.4
The only other study that investigated sarcolemmal K+ channel expression in cardiac hypertrophy has been performed in SHR and a pressure-overload rat model.38 The authors reported that the Kv1.5 mRNA level was shown to be decreased while Kv1.4 mRNA level was increased in cardiac hypertrophy. This differential regulation was completely reversed by the reversal of hypertrophy. The authors also suggested that the decrease in Kv1.5 mRNA levels may explain the prolongation of APD seen in these models. However, the significance of these data is questionable, since recent studies have shown that Kv1.4 protein is not detected in rat ventricular myocardium and that Kv2.1, rather than Kv1.5, seems to be the likely candidate for the native Ito-s in rat.22
In summary, we have shown that in rats 3 weeks after MI, the remodeled noninfarcted LV myocardium undergoes alteration in the expression of the different voltage-gated K+ channel subunit genes. The reduced mRNA and protein levels of the Kv4.2 and Kv2.1 channel subunits correlate remarkably well with our electrophysiological findings of decreased current density of Ito-f and Ito-s, respectively. These alterations in current density can explain, at least in part, the prolonged APD of remodeled LV myocytes and also contribute to the arrhythmogenicity of the post-MI heart.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received June 5, 1996; accepted July 5, 1996.
| References |
|---|
|
|
|---|
2.
Anversa P, Beghi C, Kikkawa Y, Olivetti G. Myocardial infarction in rats: infarct size, myocyte hypertrophy, and capillary growth. Circ Res. 1986;58:26-37.
3.
Hart G. Cellular electrophysiology in cardiac hypertrophy and failure. Cardiovasc Res. 1994;28:933-946.
4. Cohen IS, Datyner NB, Gintant GA, Kline RP. Time-dependent outward currents in the heart. In: Fozzard HA, Jennings RB, Haber E, Katz AM, Mortgan HE, eds. The Heart and Cardiovascular System. New York, NY: Raven Press Publishers; 1986:637-670.
5. Carmeliet E, Beimans G, Callewaert G, Vereecke J. Potassium currents in cardiac cells. Experientia. 1987;43:1175-1184.[Medline] [Order article via Infotrieve]
6. Anumonowo JMB, Freeman LC, Kwok WM, Kass RS. Potassium channels in the heart: electrophysiology and pharmacological regulation. Cardiovasc Drug Rev. 1991;9:299-316.
7.
Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, Di Diego JM, Gintant GA, Liu D-W. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ Res. 1991;69:1427-1449.
8. Varro A, Lathrop DA, Hester SB, Nanasi PP, Papp JGY. Ionic currents and action potentials in rabbit, rat and guinea pig ventricular myocytes. Basic Res Cardiol. 1993;88:93-102.[Medline] [Order article via Infotrieve]
9.
Benitah J-P, Gomez AM, Bailly P, Da-Ponte JP, Berson G, Delgado G, Lorente P. Heterogeneity of the early outward current in ventricular cells isolated from normal and hypertrophied rat hearts. J Physiol (Lond).. 1993;469:111-138.
10.
Wettwer E, Amos GJ, Posival H, Ravens U. Transient outward current in human ventricular myocytes of subepicardial and subendocardial origin. Circ Res. 1994;75:473-482.
11.
Apkon M, Nerbonne JM. Characterization of two distinct depolarization-activated K+ currents in isolated adult rat ventricular myocytes. J Gen Physiol. 1993;97:973-1011.
12. Zhang Z-H, Boutjdir M, El-Sherif N. A novel slow kinetics 4-AP insensitive K current in rat ventricular myocytes. Circulation. 1994;90(suppl I):I-582. Abstract.
13.
Qin D, Zhang Z-H, Boutjdir M, Jain P, El-Sherif N. Cellular and ionic basis of arrhythmias in post-infarction remodeled ventricular myocardium. Circ Res. 1996;79:461-473.
14.
Dixon JE, McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ Res. 1994;75:252-260.
15.
Jain P, Brown EJ Jr, Lagenback EG, Raeder E, Lillis O, Halpern J, Mannisi J. Effects of milrinone on left ventricular remodeling after acute myocardial infarction. Circulation. 1991;84:796-804.
16. Roberds SL, Knoth KM, Po S, Blair A, Bennett PB, Hartshorne RP, Synders DJ, Tamkun MM. Molecular biology of the voltage-gated potassium channels of the cardiovascular system. J Cardiovasc Electrophysiol. 1993;4:68-79.[Medline] [Order article via Infotrieve]
17.
Roberds SL, Tamkun MM. Cloning and tissue-specific expression of five voltage-gated potassium channel cDNAs expressed in rat heart. Proc Natl Acad Sci U S A. 1991;88:1798-1802.
18. Frech GC, VanDongen AMJ, Schuster G, Brown AM, Joho RH. A novel potassium channel with delayed rectifier properties isolated from rat brain by expression cloning. Nature. 1989;340:642-645.[Medline] [Order article via Infotrieve]
19. Danielson P, Forss-Petter S, Brow M, Calavette L, Douglass J, Milner R, Sutcliffe J. A cDNA clone of the rat mRNA encoding cyclophilin. DNA. 1988;7:261-267.[Medline] [Order article via Infotrieve]
20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
21. Kreig PA, Melton DA. In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol. 1987;155:397-415.[Medline] [Order article via Infotrieve]
22.
Barry DM, Trimmer JS, Merlie JP, Nerbonne JM. Differential expression of voltage-gated K+ channel subunits in adult rat heart: relation to functional K+ channels? Circ Res. 1995;77:361-369.
23.
Pfeffer JM, Pfeffer MA, Fletcher PG, Braunwald E. Progressive ventricular remodeling in rat with myocardial infarction. Am J Physiol. 1991;260:H1406-H1414.
24. Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non-infarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun. 1995;216:892-897.[Medline] [Order article via Infotrieve]
25. Christie MJ, North RA, Osborne PB, Douglass J, Adelman JP. Heteropolymeric potassium channels expressed in Xenopus oocytes from cloned subunits. Neuron. 1990;2:405-411.
26. Isacoff EY, Jan YN, Jan LY. Evidence for the formation of heteromultimeric potassium channels in Xenopus oocytes. Nature. 1990;345:530-534.[Medline] [Order article via Infotrieve]
27. Ruppersberg JP, Schroter KH, Sakmann B, Stocker M, Sewing S, Pongs O. Heteromultimeric channels formed by rat brain potassium-channel proteins. Nature. 1990;345:535-537.[Medline] [Order article via Infotrieve]
28.
Po S, Roberds S, Snyders DJ, Tamkun MM, Bennett PB. Heteromultimeric assembly of human potassium channels: molecular basis of a transient outward current? Circ Res. 1993;72:1326-1336.
29.
Matsubara H, Liman ER, Hess P, Koren G. Pretranslational mechanisms determine the type of potassium channels expressed in the rat skeletal and cardiac muscles. J Biol Chem. 1991;266:13324-13328.
30.
Xu X, Best PM. Decreased transient outward current K+ current in ventricular myocytes from acromegalic rats. Am J Physiol. 1991;260:H935-H942.
31.
Cerbai E, Barbieri M, Li Q, Mugelli A. Ionic bases of action potential prolongation of hypertrophied myocytes isolated from hearts of spontaneously hypertensive rats of different ages. Cardiovasc Res.. 1994;28:1180-1187.
32.
Tomita F, Bassett AL, Myerburg RJ, Kimura S. Diminished transient outward currents in rat hypertrophied ventricular myocytes. Circ Res. 1994;75:296-303.
33. Brooksby P, Levi AJ, Jones JV. The electrophysiological characteristics of hypertrophied ventricular myocytes from the spontaneously hypertensive rat. J Hypertens. 1993;11:611-622.[Medline] [Order article via Infotrieve]
34.
Clark WA, Rudnick SJ, Andersen LC, LaPres JJ. Myosin heavy chain synthesis is independently regulated in hypertrophy and atrophy of isolated adult cardiac myocytes. J Biol Chem. 1994;269:25562-25569.
35. Swynghedauw B. Biological adaptation of the myocardium to permanent change in loading condition. Basic Res Cardiol. 1992;87(suppl II):1-10.
36. Qin D, Jain P, Zhang Z-H, Boutjdir M, El-Sherif N. Expression of T-type calcium current in remodeled hypertrophied left ventricle from adult rat following myocardial infarction. Circulation. 1995;92(suppl I):I-587. Abstract.
37. Lee J-K, Kodama I, Honjo H, Kamiya K, Toyama J. Stage-dependent changes of membrane currents in rat ventricular myocytes associated with myocardial hypertrophy. Circulation. 1995;92(suppl I):I-574. Abstract.
38. Matsubara H, Suzuki J, Inada M. Shaker-related potassium channel, Kv1.4 mRNA regulation in cultured rat heart myocytes and differential expression of Kv1.4 and Kv1.5 genes in myocardial development and hypertrophy. J Clin Invest. 1993;92:1659-1697.
This article has been cited by other articles:
![]() |
L. Deng, M. Boujdir, A. Tremontano, M. R Pincus, and N. El-Sherif A Peptide from a ras Effector-Domain Blocks ras-Dependent Cardiac Hypertrophy in Myocytes Ann. Clin. Lab. Sci., January 1, 2009; 39(4): 351 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Saygili, O. R. Rana, E. Saygili, H. Reuter, K. Frank, R. H. G. Schwinger, J. Muller-Ehmsen, and C. Zobel Losartan prevents stretch-induced electrical remodeling in cultured atrial neonatal myocytes Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2898 - H2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nattel, A. Maguy, S. Le Bouter, and Y.-H. Yeh Arrhythmogenic Ion-Channel Remodeling in the Heart: Heart Failure, Myocardial Infarction, and Atrial Fibrillation Physiol Rev, April 1, 2007; 87(2): 425 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Goltz, J.-H. Schultz, C. Stucke, M. Wagner, P. Bassalay, A. P. Schwoerer, H. Ehmke, and T. Volk Diminished Kv4.2/3 but not KChIP2 levels reduce the cardiac transient outward K+ current in spontaneously hypertensive rats Cardiovasc Res, April 1, 2007; 74(1): 85 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Dhalla, M. R. Dent, P. S. Tappia, R. Sethi, J. Barta, and R. K. Goyal Subcellular Remodeling as a Viable Target for the Treatment of Congestive Heart Failure Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2006; 11(1): 31 - 45. [Abstract] [PDF] |
||||
![]() |
M. Eghbali, R. Deva, A. Alioua, T. Y. Minosyan, H. Ruan, Y. Wang, L. Toro, and E. Stefani Molecular and Functional Signature of Heart Hypertrophy During Pregnancy Circ. Res., June 10, 2005; 96(11): 1208 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Akar, R. C. Wu, G. J. Juang, Y. Tian, M. Burysek, D. DiSilvestre, W. Xiong, A. A. Armoundas, and G. F. Tomaselli Molecular mechanisms underlying K+ current downregulation in canine tachycardia-induced heart failure Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2887 - H2896. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. L. Bett and R. L. Rasmusson Inactivation and recovery in Kv1.4 K+ channels: lipophilic interactions at the intracellular mouth of the pore J. Physiol., April 1, 2004; 556(1): 109 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fedida, J. Eldstrom, J. C. Hesketh, M. Lamorgese, L. Castel, D. F. Steele, and D. R. Van Wagoner Kv1.5 Is an Important Component of Repolarizing K+ Current in Canine Atrial Myocytes Circ. Res., October 17, 2003; 93(8): 744 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Bouter, S. Demolombe, A. Chambellan, C. Bellocq, F. Aimond, G. Toumaniantz, G. Lande, S. Siavoshian, I. Baro, A. L. Pond, et al. Microarray Analysis Reveals Complex Remodeling of Cardiac Ion Channel Expression With Altered Thyroid Status: Relation to Cellular and Integrated Electrophysiology Circ. Res., February 7, 2003; 92(2): 234 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, G. C. L. Bett, X. Jiang, V. E. Bondarenko, M. J. Morales, and R. L. Rasmusson Regulation of N- and C-type inactivation of Kv1.4 by pHo and K+: evidence for transmembrane communication Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H71 - H80. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. El-Adawi, L. Deng, A. Tramontano, S. Smith, E. Mascareno, K. Ganguly, R. Castillo, and N. El-Sherif The functional role of the JAK-STAT pathway in post-infarction remodeling Cardiovasc Res, January 1, 2003; 57(1): 129 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kaprielian, R. Sah, T. Nguyen, A. D. Wickenden, and P. H. Backx Myocardial infarction in rat eliminates regional heterogeneity of AP profiles, Ito K+ currents, and [Ca2+]i transients Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1157 - H1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Rozanski and Z. Xu Glutathione and K+ channel remodeling in postinfarction rat heart Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2346 - H2355. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Swynghedauw and D Charlemagne What is wrong with positive inotropic drugs? Lessons from basic science and clinical trials Eur. Heart J. Suppl., April 1, 2002; 4(suppl_D): D43 - D49. [Abstract] [PDF] |
||||
![]() |
B Huang, D Qin, and N El-Sherif Spatial alterations of Kv channels expression and K+ currents in post-MI remodeled rat heart Cardiovasc Res, November 1, 2001; 52(2): 246 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Q. Zhang, L.-Q. Zhang, B. M. Palmer, Y.-C. Ng, T. I. Musch, R. L. Moore, and J. Y. Cheung Sprint training shortens prolonged action potential duration in postinfarction rat myocyte: mechanisms J Appl Physiol, May 1, 2001; 90(5): 1720 - 1728. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Huang, D. Qin, L. Deng, M. Boutjdir, and N. El-Sherif Reexpression of T-type Ca2+ channel gene and current in post-infarction remodeled rat left ventricle Cardiovasc Res, June 1, 2000; 46(3): 442 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Wickenden, R. Kaprielian, X.-M. You, and P. H. Backx The thyroid hormone analog DITPA restores Ito in rats after myocardial infarction Am J Physiol Heart Circ Physiol, April 1, 2000; 278(4): H1105 - H1116. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qu, A. Ghatpande, N. El-Sherif, and M. Boutjdir Gene expression of Na+/Ca2+ exchanger during development in human heart Cardiovasc Res, March 1, 2000; 45(4): 866 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Wickenden, P. Lee, R. Sah, Q. Huang, G. I. Fishman, and P. H. Backx Targeted Expression of a Dominant-Negative Kv4.2 K+ Channel Subunit in the Mouse Heart Circ. Res., November 26, 1999; 85(11): 1067 - 1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Huang, S. Wang, D. Qin, M. Boutjdir, and N. El-Sherif Diminished Basal Phosphorylation Level of Phospholamban in the Postinfarction Remodeled Rat Ventricle : Role of {beta}-Adrenergic Pathway, Gi Protein, Phosphodiesterase, and Phosphatases Circ. Res., October 29, 1999; 85(9): 848 - 855. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kiyosue and M. Arita Altered expression of cardiac K+ channel genes during sub-acute and healing phases of myocardial infarction Cardiovasc Res, October 1, 1999; 44(1): 13 - 16. [Full Text] [PDF] |
||||
![]() |
J.-A. Yao, M. Jiang, J.-S. Fan, Y.-Y. Zhou, and G.-N. Tseng Heterogeneous changes in K currents in rat ventricles three days after myocardial infarction Cardiovasc Res, October 1, 1999; 44(1): 132 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Volk, T. H.-D. Nguyen, J.-H. Schultz, and H. Ehmke Relationship between transient outward K+ current and Ca2+ influx in rat cardiac myocytes of endo- and epicardial origin J. Physiol., September 15, 1999; 519(3): 841 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Kaprielian, A D Wickenden, Z Kassiri, T G Parker, P P Liu, and P H Backx Relationship between K+ channel down-regulation and [Ca2+ ]i in rat ventricular myocytes following myocardial infarction J. Physiol., May 15, 1999; 517(1): 229 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Tomaselli and E. Marban Electrophysiological remodeling in hypertrophy and heart failure Cardiovasc Res, May 1, 1999; 42(2): 270 - 283. [Full Text] [PDF] |
||||
![]() |
J. M.B Pinto and P. A Boyden Electrical remodeling in ischemia and infarction Cardiovasc Res, May 1, 1999; 42(2): 284 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M Bryant, S.J. Shipsey, and G. Hart Normal regional distribution of membrane current density in rat left ventricle is altered in catecholamine-induced hypertrophy Cardiovasc Res, May 1, 1999; 42(2): 391 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Aimond, J. L Alvarez, J.-M. Rauzier, P. Lorente, and G. Vassort Ionic basis of ventricular arrhythmias in remodeled rat heart during long-term myocardial infarction Cardiovasc Res, May 1, 1999; 42(2): 402 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yue, P. Melnyk, R. Gaspo, Z. Wang, and S. Nattel Molecular Mechanisms Underlying Ionic Remodeling in a Dog Model of Atrial Fibrillation Circ. Res., April 16, 1999; 84(7): 776 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Hershman and E. S. Levitan Cell-cell contact between adult rat cardiac myocytes regulates Kv1.5 and Kv4.2 K+ channel mRNA expression Am J Physiol Cell Physiol, December 1, 1998; 275(6): C1473 - C1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kong, S. Po, T. Yamagishi, M. D. Ashen, G. Stetten, and G. F. Tomaselli Isolation and characterization of the human gene encoding Ito: further diversity by alternative mRNA splicing Am J Physiol Heart Circ Physiol, December 1, 1998; 275(6): H1963 - H1970. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, L. Yue, M. White, G. Pelletier, and S. Nattel Differential Distribution of Inward Rectifier Potassium Channel Transcripts in Human Atrium Versus Ventricle Circulation, December 1, 1998; 98(22): 2422 - 2428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nishiyama, F. Kambe, K. Kamiya, H. Seo, and J. Toyama Effects of thyroid status on expression of voltage-gated potassium channels in rat left ventricle Cardiovasc Res, November 1, 1998; 40(2): 343 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lee, G. Morley, Q. Huang, A. Fischer, S. Seiler, J. W. Horner, S. Factor, D. Vaidya, J. Jalife, and G. I. Fishman Conditional lineage ablation to model human diseases PNAS, September 15, 1998; 95(19): 11371 - 11376. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Barry, H. Xu, R. B. Schuessler, and J. M. Nerbonne Functional Knockout of the Transient Outward Current, Long-QT Syndrome, and Cardiac Remodeling in Mice Expressing a Dominant-Negative Kv4 {alpha} Subunit Circ. Res., September 7, 1998; 83(5): 560 - 567. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D Wickenden, R. Kaprielian, Z. Kassiri, J. N Tsoporis, R. Tsushima, G. I Fishman, and P. H Backx The role of action potential prolongation and altered intracellular calcium handling in the pathogenesis of heart failure Cardiovasc Res, February 1, 1998; 37(2): 312 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Rozanski, Z. Xu, K. Zhang, and K. P. Patel Altered K+ current of ventricular myocytes in rats with chronic myocardial infarction Am J Physiol Heart Circ Physiol, January 1, 1998; 274(1): H259 - H265. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takimoto, D. Li, K. M. Hershman, P. Li, E. K. Jackson, and E. S. Levitan Decreased Expression of Kv4.2 and Novel Kv4.3 K+ Channel Subunit mRNAs in Ventricles of Renovascular Hypertensive Rats Circ. Res., October 19, 1997; 81(4): 533 - 539. [Abstract] [Full Text] |
||||
![]() |
A. M. Choy, C. C. Lang, D. M. Chomsky, G. H. Rayos, J. R. Wilson, and D. M. Roden Normalization of Acquired QT Prolongation in Humans by Intravenous Potassium Circulation, October 7, 1997; 96(7): 2149 - 2154. [Abstract] [Full Text] |
||||
![]() |
M. Song, G. Helguera, M. Eghbali, N. Zhu, M. M. Zarei, R. Olcese, L. Toro, and E. Stefani Remodeling of Kv4.3 Potassium Channel Gene Expression under the Control of Sex Hormones J. Biol. Chem., August 17, 2001; 276(34): 31883 - 31890. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Rozanski and Z. Xu Glutathione and K+ channel remodeling in postinfarction rat heart Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2346 - H2355. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |