This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by James, A. F. Articles by Tominaga, M. Search for Related Content PubMed PubMed Citation Articles by James, A. F. Articles by Tominaga, M.

(Circulation Research. 1996;79:201-207.)
© 1996 American Heart Association, Inc.

Articles

Distribution of cAMP-Activated Chloride Current and CFTR mRNA in the Guinea Pig Heart

Andrew F. James, Tomoko Tominaga, Yasunobu Okada, Makoto Tominaga

the Department of Cellular and Molecular Physiology, National Institute for Physiological Sciences, Japan.

Correspondence to Dr M. Tominaga, Department of Cellular and Molecular Physiology, National Institute for Physiological Sciences, Myodaiji-cho, Okazaki 444, Japan.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Guinea pig ventricular myocytes exhibit a Cl^--selective current regulated by the cAMP-dependent pathway. We have investigated the distribution of cAMP-activated Cl^- channel current density and cystic fibrosis transmembrane-conductance regulator (CFTR) mRNA in three regions of the guinea pig heart: the atrium, and the epicardium and endocardium of the free wall of the left ventricle. The regional differences in the Cl^- current density were investigated in enzymatically isolated myocytes using the whole-cell patch-clamp technique. Forskolin (1 µmol/L) activated Cl^--selective currents in all ventricular myocytes and 21% of atrial myocytes examined. The conductance density, estimated as the outward chord conductance normalized to cell capacitance, was greatest in epicardial myocytes (79.8±8.4 pS/pF, n=21) and significantly lower in endocardial (59.8±9.5 pS/pF, n=22) and atrial (10.9±5.0 pS/pF, n=38) myocytes. The regional differences in CFTR mRNA expression levels were investigated by competitive reverse-transcribed polymerase chain reaction. The regional distribution of the mRNA levels was similar to that of the Cl^- conductance density, ie, highest in the epicardium (23 230±1840 molecules/µg total RNA, n=3), significantly lower in endocardium (10 610±780 molecules/µg total RNA, n=3), and lowest in atrium (1450±290 molecules/µg total RNA, n=3). The data indicate that regional differences in CFTR mRNA expression in the guinea pig heart are responsible, at least in part, for the regional differences in cAMP-activated Cl^- current density.

Key Words: Cl^- channel • CFTR • cardiac myocyte • guinea pig • competitive RT-PCR

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Ventricular myocytes from the guinea pig heart possess a time- and voltage-independent Cl^- current induced by ß-adrenoceptor activation.^{1 2 3 4} The current is regulated through a G protein/adenylate cyclase/protein kinase A pathway.^{5 6} Since E_Cl is thought to be between -50 and -70 mV under physiological conditions, activation of this current will result in inward current at RMP, causing depolarization, and outward current during the plateau phase of the action potential, shortening APD,^{2 3} and may therefore play a significant role in autonomic regulation of the cardiac action potential.

CFTR is an epithelial cAMP-activated Cl^- channel, the function of which is impaired in patients with cystic fibrosis.⁷ Both CFTR and cardiac cAMP-activated Cl^- channels exhibit common properties in single-channel conductance (13 pS),^{8 9 10} ion selectivity (Br^->Cl^->I^->F^-),^{11 12} Cl^- gradient–dependent rectification,^{11 13} sensitivity to glibenclamide,^{14 15 16} and regulation by protein kinase A.^{1 5 10 17} These facts suggest that the CFTR gene encodes a cAMP-activated Cl^- channel in the heart. In fact, the existence of mRNA homologous to human CFTR has been reported in rabbit^{18 19} and guinea pig ventricle^{8 14 18 19} and human atrium.¹⁸ Results from a sequencing analysis of CFTR cDNA from rabbit heart suggested that the cardiac isoform is an alternatively spliced product of CFTR.¹⁹

Isoproterenol is known to activate cAMP-activated Cl^- currents in ventricular myocytes from guinea pig,^{1 2 3 4 5} rabbit,^{2 20} cat,²¹ and monkey,²² but not dog²³ or rat.²⁴ In rabbit ventricle, isoproterenol-activated Cl^- currents have been reported to be twofold larger in myocytes isolated from epicardium than in those from endocardium.²⁰

The present study was undertaken to investigate whether there is a heterogeneous distribution of the cAMP-activated Cl^- channel current in the guinea pig heart and whether the distribution is correlated to the CFTR mRNA expression.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Myocyte Isolation
Cardiac myocytes were isolated from guinea pigs (250 to 300 g) by retrograde perfusion of collagenase through the aorta, as described previously.⁵ The differences in the technique were that the heart was exposed by intracostal thoracotomy and the collagenase solution contained 0.4 mg/mL collagenase (Type I, Sigma Chemical Company) in low-Ca²⁺ Tyrode's solution (1 mL Ca²⁺ Tyrode's in 99 mL Ca²⁺-free Tyrode's). Ca²⁺ Tyrode's contained (in mmol/L) 145 NaCl, 5.4 KCl, 0.5 MgCl₂, 1.8 CaCl₂, 5.5 glucose, and 10 HEPES/NaOH (pH 7.4), and Ca²⁺-free Tyrode's was made by omission of CaCl₂ from Ca²⁺ Tyrode's. Solutions were warmed to 37°C using a Langendorff apparatus. After collagenase digestion, the remaining collagenase was rinsed away with high K⁺, Ca²⁺-free KB solution.²⁵ The heart was dissected in KB solution. After removal of the atria, the right ventricular muscle was trimmed away by incisions through the free wall of the right ventricle. The remaining left ventricle was then opened into a flat sheet by an incision through the septum from base to apex. Samples of endocardial muscle (3 mmx1 mmx2 mm) were taken from the free wall of the left ventricle after removal of the papillary muscle by grasping 1 to 2 mm of the muscle in forceps and trimming from apex to base with a pair of fine scissors. The sheet of ventricular muscles was then turned over, and similar samples were taken from the epicardial surface of the free wall by grasping the pericardium in the forceps and trimming from apex to base. Atrial myocytes were obtained from the left atrium after opening the atrium by an incision through the atrial wall. Myocytes were gently dispersed by stroking between the tips of partially closed forceps. Cells were stored until use in KB solution at 4°C.

Whole-Cell Patch-Clamp Recording
Aliquots of cell suspension were added to a perfusion chamber on the stage of an understage microscope (TMD, Nikon), and Ca²⁺ Tyrode's solution was perfused (37°C) at a rate of 1.5 mL/min by gravity feed. Borosilicate glass pipettes (Hilgenberg) were pulled using a P-97 puller (Sutter Instruments) and had a tip resistance of 1.2 M when filled with a pipette solution containing (in mmol/L) 85 aspartic acid, 20 TEA-chloride, 10 MgATP, 5 sodium creatine phosphate, 0.5 MgCl₂, 5.5 glucose, 10 EGTA, 0.1 Na₂GTP, and 10 HEPES/CsOH (pH 7.4). For the Cl^- current recording, cells were superfused with Ca²⁺-free, K⁺-free experimental solution containing (in mmol/L) 150 NaCl, 0.5 MgCl₂, 1 CdCl₂, and 10 HEPES/NaOH (pH 7.4) after achieving the whole-cell configuration. When necessary, the Cl^- concentration was reduced to 21 mmol/L by replacing NaCl with sodium gluconate or sodium aspartate. Whole-cell Cl^- currents were recorded from a holding potential of 0 mV with a patch-clamp amplifier (Axopatch 200A, Axon Instruments) to an NEC 9800–compatible computer (PC-286VF, Epson) for on- and off-line analysis with home-written software. Data were recorded on videotape by means of an A/D converter (PCM 501ES, Sony) for backup. Ramp voltage pulses were generated using a signal generator (Type 1915, NF Instruments), and square-shaped voltage pulses were generated by an electric stimulator (SEN-3301, Nihon Kohden). The membrane capacitance was fully compensated and a record kept as an estimate of cell size.

I_Ca was monitored by applying a 400-millisecond depolarization (to 0 mV) to cells bathed in Ca²⁺ Tyrode's from a holding potential of -40 mV. Only those cell preparations showing at least twofold increases in I_Ca on exposure to forskolin were used. Cells not showing sustained forskolin-induced increases in whole-cell Cl^- conductance or with a significant change in the baseline conductance after washout of forskolin were discarded from this study.

For Cl^- current recordings under whole-cell conditions, K⁺ currents were eliminated by internal TEA (20 mmol/L) and by omission of K⁺ from both pipette and bath solutions: Na⁺ and Ca²⁺ currents by inactivating at 0 mV; residual Ca²⁺ current by extracellular Cd²⁺ (1 mmol/L); Na⁺/K⁺ pump currents by removal of external K⁺; and Na⁺/Ca²⁺ exchange currents by the nominal absence of internal and external Ca²⁺.

Isoproterenol (0.1 µmol/L; Nacalai Tesque), 1 µmol/L forskolin (Nippon Kayaku), 0.5 mmol/L IBMX (Nacalai Tesque), or 100 µmol/L DIDS (Sigma) was added to the bath solution. A stock solution of isoproterenol (1 mmol/L in distilled water), forskolin (10 mmol/L in ethanol), or IBMX (0.5 mol/L in DMSO) was diluted to the desired final concentrations immediately before use. Neither DMSO (0.1%) nor ethanol (0.1%) alone affected the cAMP-activated Cl^- conductance. DIDS was directly dissolved in the bath solution.

RT-PCR
Total RNAs were isolated from the three regions of the guinea pig heart by the guanidinium isothiocyanate lysis method and sedimentation in CsCl.

The gene-specific primers (descending, 5'-TGGTCACTTCTAAAATGGAAC-3'; ascending, 5'-GTTATCAGGTTCAACACCGAC-3') corresponding to the R domain (M76128, Reference 26) of guinea pig CFTR were synthesized on an automated DNA synthesizer (Type 392; Applied Biosystems). The expected size of the amplified fragment was 512 bp.

A 5-µg portion of the total RNA was mixed, in a final volume of 50 µL, with random primer (50 pmol), dNTPs (250 µmol/L), RNase inhibitor (50 units), DTT (1 mmol/L), and avian myoblastosis virus reverse transcriptase (50 units, Seikagaku Corp) in 1x reverse-transcription buffer (in mmol/L: 65 KCl, 10 MgCl₂, 50 Tris-HCl; pH 7.6). The mixtures were incubated at room temperature for 10 minutes, at 42°C for 90 minutes, at 95°C for 10 minutes, and then quick-chilled on ice. PCR was performed in a total volume of 50 µL of 1x PCR buffer, 250 µmol/L dNTPs, 100 pmol 5' and 3' primers, and 2 units of Taq polymerase (Takara) by repeated 30 cycles, using a PCR machine (PC-700, Astec). The amplification profiles involved denaturation at 94°C for 1 minute, primer annealing at 57°C for 1 minute, and extension at 72°C for 2 minutes. Southern blot analysis of PCR products was performed by standard methods.²⁷ The probe employed was a full sequence of human CFTR cDNA.¹⁴

Competitive PCR
Competitive PCR was carried out by titration of sample cDNA with known amounts of a nonhomologous CFTR-MIMIC standard produced using the CLONTECH PCR MIMIC Construction Kit. Briefly, composite primers comprising the CFTR gene–specific primers described above with v-erb B oncogene–specific 20-nucleotide base sequences at the 3' end (upstream, CAAGTTTCGTGAGCTGATTG; downstream, TCTGTCAATGCAGTTTGTAG) were used to construct a 320-bp fragment of the v-erb B oncogene with CFTR primer–specific sequences at the 5' end of each strand.²⁸ This CFTR-MIMIC was amplified using the noncomposite CFTR-specific primers described above, and the molar quantity produced was determined. A 2-µg portion of total RNA from each region of guinea pig heart was used for synthesis of cDNA as described above. Portions (10%) of the cDNA were titrated with known quantities of the CFTR-MIMIC standard, and PCR was carried out using the CFTR gene–specific primers under the conditions described above. Portions (10%) of the PCR products were loaded on a 2% EtBr agarose gel, and a photograph was taken under UV light. The density of the bands corresponding to CFTR and CFTR-MIMIC standard were quantified using a Protein+DNA Imaging System (TOYOBO), and the ratio of the density of CFTR to that of CFTR-MIMIC was calculated.

Statistical Analysis
Data are presented as the mean±SE. Differences in regional distribution were assessed by a two-way ANOVA, with a value of P<.05 being accepted as significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Fig 1A shows a representative whole-cell current trace from an epicardial myocyte of the left ventricular free wall. The basal current reversed at -32 mV (Fig 1B, a). On exposure to forskolin (1 µmol/L), the whole-cell conductance during ramp pulses (+100 to -100 mV) increased approximately fourfold, with a slight leftward shift in the reversal potential (Fig 1A and 1B). Neither an increase in the concentration of forskolin (to 5 µmol/L) nor supplementing with a phosphodiesterase inhibitor, IBMX (0.5 mmol/L), further increased the whole-cell conductance (data not shown). The forskolin-induced current (Fig 1B, b-a) reversed at -36.5±0.6 mV (n=43), fairly close to E_Cl (-52 mV). The currents during square-shaped voltage pulses from 0 to ±100 mV in 20-mV increments showed little time-dependent activation or inactivation (Fig 1C). Thus, the I-V relation observed during ramp voltage pulses was representative of the whole-cell I-V relation (Fig 1B). Reduction of the external Cl^- concentration from 153 to 21 mmol/L produced a decrease in the whole-cell conductance and shifted the reversal potential in the positive direction from -35.8±1.1 to -7.8±2.2 mV (n=4), as expected of a predominantly Cl^--selective channel current (Fig 1D). Similar Cl^- current activation was observed on the extracellular application of isoproterenol (data not shown).

View larger version (19K): [in this window] [in a new window]   Figure 1. cAMP-activated Cl- current in guinea pig ventricular myocytes. A, Representative whole-cell current trace of a ventricular myocyte from epicardium of the left ventricular free wall at the holding potential of 0 mV. Ramp pulses (1 second) from +100 to -100 mV were given at 0.1 Hz. Square-shaped voltage pulses in 20-mV increments (to ±20, ±40, ±60, ±80, and ±100 mV) were also applied at 0.1 Hz (c and d). The whole-cell capacitance was 140 pF. The horizontal bar above the trace indicates a bath application of 1 µmol/L forskolin. B, I-V relations for the whole-cell currents at the point of a and b in A, and forskolin-induced current (b-a). C, Superimposed forskolin-induced currents (c-d) in response to the 300-ms square-shaped voltage pulses. The arrowhead indicates the zero current level. D, I-V relations for the whole-cell currents in high (153 mmol/L) and low (21 mmol/L) external Cl- concentrations. Separate cell from that shown in A.

Although the cAMP-activated Cl^- current was reported to be absent in rabbit^{20 29} and guinea pig¹⁹ atrial myocytes, an isoproterenol-induced current, reversing at the potential near E_Cl, has been reported in a small population of guinea pig atrial myocytes.^{30 31} We investigated the existence of a cAMP-activated Cl^- current in guinea pig atrial myocytes under the same conditions applied to the ventricular myocytes. The majority of myocytes investigated (30 of 38, or 79%) did not show significant increases in whole-cell conductance during exposure to 1 µmol/L forskolin. However, in 8 of 38 myocytes (21%), exposure to forskolin resulted in an increase in the whole-cell conductance (Fig 2A). The forskolin-induced current (Fig 2B, b-a) reversed at -39.2±2.8 mV (n=8). Reduction of the extracellular Cl^- concentration from 153 to 21 mmol/L resulted in a reduction in the whole-cell conductance, with a rightward shift of the reversal potential from -36.3±1.7 to -7.7±1.5 mV (n=3), close to E_Cl (0 mV), suggesting a Cl^--selective channel current (Fig 2B, b and d). Forskolin-induced currents showed time-independent kinetics (Fig 2C) and were not blocked by extracellular application of DIDS (100 µmol/L, Fig 2D).

View larger version (23K): [in this window] [in a new window]   Figure 2. cAMP-activated Cl- current in guinea pig atrial myocytes. A, Representative whole-cell current trace from an atrial myocyte. Ramp pulses and square-shaped voltage pulses were identical to those in Fig 1. The whole-cell capacitance was 48 pF. The horizontal bar above the trace indicates a bath application of 1 µmol/L forskolin. The horizontal bar below the trace indicates the period during which extracellular Cl- concentration was reduced to 21 mmol/L. B, I-V relations for the whole-cell currents at the point of a, b, and d in A, and forskolin-induced current (b-a). C, Superimposed forskolin-induced currents (c-e) in response to the 300-ms square-shaped voltage pulses. The arrowhead indicates the zero current level. D, Effect of DIDS on the whole-cell current activated by forskolin. Horizontal bars above the trace indicate bath applications of forskolin (1 µmol/L) and DIDS (100 µmol/L). Similar results were obtained in three cells examined that responded to forskolin.

Although the heterogeneous distribution of the isoproterenol-induced Cl^- current in the left ventricular free wall of the rabbit heart has been reported,²⁰ there are no data from the guinea pig heart. We investigated the distribution of the forskolin-induced Cl^- current in myocytes from three regions of the guinea pig heart: the epicardium and endocardium of the left ventricular free wall, and the atrium. As found in the rabbit ventricle,²⁰ there was a high degree of variation between the currents of individual myocytes taken from any of the three regions of the guinea pig heart (Fig 3). It is not clear whether this degree of variation exists in the intact heart or is a consequence of the enzymatic isolation procedure. On average, the highest conductance density was found in the epicardial myocytes of the left ventricular free wall (79.8±8.4 pS/pF, n=21) and the lowest in atrial myocytes (10.9±5.0 pS/pF, n=38). The conductance density in endocardial myocytes (59.8±9.5 pS/pF, n=22) was slightly lower than that in epicardial myocytes. The differences in conductance density between the three regions of the heart were significant (P<.05).

View larger version (11K): [in this window] [in a new window]   Figure 3. Distribution of forskolin-induced Cl- conductance density in the guinea pig heart. A, Density distribution in 22 endocardial myocytes from the left ventricular free wall. The whole-cell capacitance was 112.1±4.5 pF. B, Density distribution in 21 epicardial myocytes from the left ventricular free wall. The whole-cell capacitance was 115.5±6.7 pF. C, Density distribution in 38 atrial myocytes. The whole-cell capacitance was 44.0±4.2 pF. The conductance density (pS/pF) was calculated as the outward chord conductance normalized to cell capacitance, using the following equation: where I(+100 mV) is the outward current when the ramp pulse reaches +100 mV, Erev is the potential at which the current reverses sign, and C is the whole-cell capacitance.

It has been suggested that the cardiac cAMP-activated Cl^- channel is an isoform of the epithelial CFTR Cl^- channel.^{18 19} Indeed, we have previously shown the existence of CFTR mRNA in the guinea pig ventricle by Northern blot hybridization,¹⁴ consistent with an earlier report.⁸ Since mRNA homologous to CFTR could not be detected by Northern blot hybridization¹⁴ or RT-PCR¹⁹ in the guinea pig atrium, the existence of CFTR mRNA in the atrium was investigated by amplifying a gene fragment corresponding to the CFTR R domain using an RT-PCR technique. As shown in Fig 4A, EtBr staining of the agarose gel identified a 512-bp product in the lanes loaded with PCR products from ventricle and atrium. The PCR products were confirmed to be CFTR gene specific using Southern blot analysis (data not shown). These findings demonstrate the existence of CFTR mRNA in both regions of guinea pig heart.

View larger version (25K): [in this window] [in a new window]   Figure 4. RT-PCR analysis of CFTR mRNA from guinea pig heart. A, EtBr staining of the agarose gel in the lanes loaded with PCR products from ventricle (lane V) and from atrium (lane A). Lane M shows DNA size markers (1-kb ladder from GIBCO-BRL). The arrowhead indicates a position of a 512-bp fragment. B, An example of the EtBr staining pattern of the competitive PCR products. Lanes 1 through 5 and 6 through 10 contain PCR products derived from RNAs of endocardium and epicardium, respectively. Lanes 1 and 6 contain 24x102 molecules CFTR-MIMIC; lanes 2 and 7, 12x102; lanes 3 and 8, 6x102; lanes 4 and 9, 3x102; lanes 5 and 10, 1.5x102. M represents DNA size markers. Arrowheads indicate positions corresponding to CFTR and CFTR-MIMIC. C, Quantitative analysis of the competitive PCR experiment shown in B. and denote data derived from the RNAs of endocardium and epicardium, respectively.

To investigate whether the distribution of CFTR mRNA expression correlates with the cAMP-activated Cl^- current, we examined CFTR mRNA levels in the three regions of the guinea pig heart by means of a competitive PCR technique, allowing the quantitative comparison of mRNA expression. An example of competitive PCR of CFTR gene from endocardium and epicardium is shown in Fig 4B. The ratio of the amount of CFTR PCR product to that of CFTR-MIMIC PCR product is 1 when the amounts of cDNA are equal. Because the molar quantity of the competitive CFTR-MIMIC is known, the actual number of CFTR molecules added to the PCR reaction can be estimated. The amount of CFTR mRNA in the epicardium was larger than that in the endocardium (Fig 4C).

Similar to the pattern of the Cl^- conductance density distribution in guinea pig heart, the highest level of CFTR mRNA expression was found in the epicardium of the left ventricle (23 230±1840 molecules/µg total RNA, n=3) and the lowest in the atrium (1450±290 molecules/µg total RNA, n=3), with intermediate expression in endocardium (10 610±780 molecules/µg total RNA, n=3) (Fig 5). The regional differences in CFTR mRNA expression were significant (P<.001).

View larger version (12K): [in this window] [in a new window]   Figure 5. Distribution of CFTR mRNA in the guinea pig heart. The amount of CFTR mRNA (molecules per microgram total RNA) in three different regions of the guinea pig heart was estimated by competitive PCR. Total RNAs derived from three guinea pigs were used as templates for cDNA synthesis.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
This study has demonstrated significant regional differences in the forskolin-induced Cl^- conductance density (Fig 3) and expression of CFTR mRNA (Fig 5) in the guinea pig heart. To the best of our knowledge, this is the first report of quantitative differences in the regional expression of CFTR mRNA in the heart. Since the Cl^- conductance was maximally increased by forskolin at the concentration used in this study (1 µmol/L), it is likely that the regional differences in forskolin-induced Cl^- conductance density represent differences in the Cl^- channel density. Therefore, the similarity of the distribution of CFTR mRNA to that of the forskolin-induced Cl^- conductance density not only supports the view that the CFTR gene in the heart actually encodes a cAMP-activated Cl^- channel^{8 18 19} but also indicates that the regional differences in CFTR mRNA expression may be responsible, at least in part, for the regional differences in forskolin-induced Cl^- conductance density.

The present study represents the first demonstration of CFTR mRNA expression in atrial tissue together with cAMP-activated Cl^- currents in atrial myocytes of guinea pig. Forskolin has recently been shown to potentiate the swelling-induced Cl^- current of human atrial myocytes.³² However, the guinea pig atrial myocytes of the present study did not show cell swelling during the course of experiments, and the Cl^- conductance did not increase until application of forskolin, suggesting that forskolin induced cAMP-activated Cl^- currents, not swelling-induced Cl^- currents. This possibility was confirmed by the ineffectiveness of DIDS in inhibiting the forskolin-induced Cl^- current in atrial myocytes (Fig 2D). The atrial tissues from which the RNAs were extracted also contained a small proportion of smooth muscle and endothelial cells, and it is possible that the low expression levels represent CFTR gene expression in a cell type other than atrial myocytes. However, to the best of our knowledge, to date there have been no reports of CFTR gene expression in those cells.

We were unable to detect CFTR gene expression in the guinea pig atrium by Northern blot assay,¹⁴ possibly due to a lower intrinsic sensitivity of the assay. The findings of the present study are in contrast to an earlier report¹⁹ showing the absence of cAMP-activated Cl^- currents with no detectable CFTR gene expression by RT-PCR. The reasons for the difference in detection of the gene are not clear but may be related to differences in the regions amplified, in the species specificity of the primers, or in the parameters of the PCR reaction. The observation of a forskolin-induced Cl^- current in 21% of guinea pig atrial myocytes in this study is fairly consistent with the reports of an isoproterenol-induced Cl^- current in 10% of atrial myocytes from the guinea pig.^{30 31}

The finding of a difference between epicardial and endocardial myocytes in the density of the forskolin-induced Cl^- conductance in the guinea pig left ventricle is consistent with the existence of a regional difference in the isoproterenol-induced Cl^- current density in the free wall of the rabbit left ventricle.²⁰ However, the regional distributions of CFTR mRNA and forskolin-induced Cl^- conductance were not precisely identical. While the expression of CFTR mRNA in epicardium of the left ventricle was 16 times greater than in atrium, the Cl^- conductance density in epicardium was only 7 times greater than in atrium. This could be due to regional differences in translation of CFTR mRNA and translocation of CFTR protein to the sarcolemma.

APD in the epicardium of the ventricular wall is known to be shorter than in the endocardium of a number of species,³³ including guinea pig.³⁴ This fact has been thought to be mainly caused by regional differences in repolarizing K⁺ currents, such as transient outward K⁺ current^{35 36 37 38} and delayed rectifier K⁺ current.³⁹ However, there has been no report of the existence of significant transient outward K⁺ channel currents in the guinea pig ventricle. Because the Cl^- current is involved in the modulation of action potential, the regional differences in cAMP-activated Cl^- current may in part contribute to the heterogeneity in APD within the ventricle, particularly during sympathetic stimulation.

	Selected Abbreviations and Acronyms

 

APD = action potential duration CFTR = cystic fibrosis transmembrane-conductance regulator DIDS = 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid ECl = equilibrium potential for Cl- EtBr = ethidium bromide I-V = current-voltage IBMX = isobutylmethylxanthine ICa = L-type Ca2+ channel current RMP = resting membrane potential RT-PCR = reverse-transcribed polymerase chain reaction TEA = tetraethylammonium

	Acknowledgments

 
This work was supported by grants-in-aid on priority areas of "Cardiac Development and Gene Regulation" (06274231) and of "Channel-Transporter Correlation" (07276104) from the Ministry of Education, Science, and Culture, and by The Mochida Memorial Foundation for Medical and Pharmaceutical Research in Japan.

	Footnotes

 
Previously published as preliminary results in abstract form (Jpn J Physiol. 1995;45:S76 and J Physiol (Lond). 1995;489P:63P).

Received October 13, 1995; accepted May 6, 1996.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Bahinski A, Nairn AC, Greengard P, Gadsby DC. Chloride conductance regulated by cyclic AMP–dependent protein kinase in cardiac myocytes. Nature. 1989;340:718-721.[Medline] [Order article via Infotrieve]

2. Harvey RD, Hume JR. Autonomic regulation of a chloride current in heart. Science. 1989;244:983-985.[Abstract/Free Full Text]

3. Harvey RD, Clark CD, Hume JR. Chloride current in mammalian cardiac myocytes. J Gen Physiol. 1990;95:1077-1102.[Abstract/Free Full Text]

4. Matsuoka S, Ehara T, Noma A. Chloride-sensitive nature of the adrenaline-induced current in guinea pig cardiac myocytes. J Physiol (Lond). 1990;425:579-598.[Abstract/Free Full Text]

5. Hwang T-C, Horie M, Nairn AC, Gadsby DC. Role of GTP-binding proteins in the regulation of mammalian cardiac chloride conductance. J Gen Physiol. 1992;99:465-489.[Abstract/Free Full Text]

6. James AF, Xie L-H, Fujitani Y, Hayashi S, Horie M. Inhibition of the cardiac protein kinase A–dependent chloride conductance by endothelin-1. Nature. 1994;370:297-300.[Medline] [Order article via Infotrieve]

7. Anderson MP, Rich DP, Gregory RJ, Smith AE, Welsh MJ. Generation of cAMP-activated chloride currents by expression of CFTR. Science. 1991;251:679-682.[Abstract/Free Full Text]

8. Nagel G, Hwang T-C, Nastiuk KL, Nairn AC, Gadsby DC. The protein kinase A–regulated cardiac Cl^- channel resembles the cystic fibrosis transmembrane conductance regulator. Nature. 1992;360:81-84.[Medline] [Order article via Infotrieve]

9. Ehara T, Ishihara K. Anion channels activated by adrenaline in cardiac myocytes. Nature. 1990;347:284-286.[Medline] [Order article via Infotrieve]

10. Welsh MJ, Anderson MP, Rich DP, Berger HA, Denning GM, Ostegaard LS, Sheppard DN, Cheng SH, Gregory RJ, Smith AE. Cystic fibrosis transmembrane conductance regulator: a chloride channel with novel regulation. Neuron. 1992;8:821-829.[Medline] [Order article via Infotrieve]

11. Overholt JL, Hobert ME, Harvey RD. On the mechanisms of rectification of the isoproterenol-activated chloride current in guinea-pig ventricular myocytes. J Gen Physiol. 1993;102:871-895.[Abstract/Free Full Text]

12. Anderson MP, Gregory RJ, Thompson S, Souza DW, Paul S, Mulligan RC, Smith AE, Welsh MJ. Demonstration that CFTR is a chloride channel by alteration of its anion selectivity. Science. 1991;253:202-205.[Abstract/Free Full Text]

13. Overholt JL, Saulino A, Drumm ML, Harvey RD. Rectification of whole cell cystic fibrosis transmembrane conductance regulator chloride current. Am J Physiol. 1995;268:C636-C646.[Abstract/Free Full Text]

14. Tominaga M, Horie M, Okada Y. Additional similarity of cardiac cAMP-activated Cl^- channels to CFTR Cl^- channels. Jpn J Physiol. 1994;44:S215-S218.

15. Tominaga M, Horie M, Sasayama S, Okada Y. Glibenclamide, an ATP-sensitive K⁺ channel blocker, inhibits the cardiac cAMP-activated Cl^- conductance. Circ Res. 1995;77:417-423.[Abstract/Free Full Text]

16. Sheppard DN, Welsh MJ. Effect of ATP-sensitive K⁺ channel regulators on cystic fibrosis transmembrane conductance regulator chloride currents. J Gen Physiol. 1992;100:573-591.[Abstract/Free Full Text]

17. Riordan JR. The cystic fibrosis transmembrane conductance regulator. Annu Rev Physiol. 1993;55:609-630.[Medline] [Order article via Infotrieve]

18. Levesque PC, Hart PJ, Hume JR, Kenyon JL, Horowitz B. Expression of cystic fibrosis transmembrane regulator Cl^- channels in heart. Circ Res. 1992;71:1002-1007.[Abstract/Free Full Text]

19. Horowitz B, Tsung SS, Hart P, Levesque PC, Hume JR. Alternative splicing of CFTR Cl^- channels in heart. Am J Physiol. 1993;264:H2214-H2220.[Abstract/Free Full Text]

20. Takano M, Noma A. Distribution of the isoprenaline-induced chloride current in rabbit heart. Pflugers Arch. 1992;420:223-226.[Medline] [Order article via Infotrieve]

21. Zhang K, Ten Eick RE. A single type of chloride current (I_Cl) induced by activation of protein kinase A and C in feline ventricular myocytes. Biophys J. 1993;64:A239. Abstract.

22. Warth JD, Horowitz B, Hume JR. Identification of CFTR cardiac in non-human primate ventricular myocytes. Biophys J. 1994;66:A420. Abstract.

23. Sorota S, Siegel MS, Hoffman BF. The isoproterenol-induced chloride current and cardiac resting potential. J Mol Cell Cardiol. 1991;23:1191-1198.[Medline] [Order article via Infotrieve]

24. Dukes ID, Cleemann L, Morad M. Tedisamil blocks the transient and delayed rectifier K⁺ currents in mammalian glial cells. J Pharmacol Exp Ther. 1990;254:560-569.[Abstract/Free Full Text]

25. Isenberg G, Klockner U. Calcium tolerant ventricular myocytes prepared by pre-incubation in a `KB' medium. Pflugers Arch. 1982;395:6-18.[Medline] [Order article via Infotrieve]

26. Diamond G, Scanlin TF, Zasloff MA, Bevins CL. Across-species analysis of the cystic fibrosis transmembrane conductance regulator. J Biol Chem. 1991;266:22761-22769.[Abstract/Free Full Text]

27. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Laboratory; 1989.

28. Siebert PD, Larrick JW. PCR MIMIC: competitive DNA fragments for use as internal standards in quantitative PCR. Biotechniques. 1993;14:244-249.[Medline] [Order article via Infotrieve]

29. Hagiwara N, Masuda H, Shoda M, Irisawa H. Stretch-activated anion currents of rabbit cardiac myocytes. J Physiol (Lond). 1992;456:285-302.[Abstract/Free Full Text]

30. Matsuura H, Ehara T. Activation of chloride current by purinergic stimulation in guinea pig heart cells. Circ Res. 1992;70:851-855.[Abstract/Free Full Text]

31. Vandenberg JI, Yoshida A, Kirk K, Powell T. Swelling-activated and isoprenaline-activated chloride currents in guinea pig cardiac myocytes have distinct electrophysiology and pharmacology. J Gen Physiol. 1994;104:997-1017.[Abstract/Free Full Text]

32. Oz MC, Sorota S. Forskolin stimulates swelling-induced chloride current, not cardiac cystic fibrosis transmembrane-conductance regulator current, in human cardiac myocytes. Circ Res. 1995;76:1063-1070.[Abstract/Free Full Text]

33. Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, Di Diego JM, Gintant GA, Liu D-W. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ Res. 1991;69:1427-1449.[Free Full Text]

34. Watanabe T, Rautaharju PM, McDonald TF. Ventricular action potentials, ventricular extracellular potentials, and the ECG of guinea pig. Circ Res. 1985;57:362-373.[Abstract/Free Full Text]

35. Litovsky SH, Antzelevitch C. Transient outward current prominent in canine ventricular epicardium but not endocardium. Circ Res. 1988;62:116-126.[Abstract/Free Full Text]

36. Furukawa T, Myerburg RJ, Furukawa N, Bassett AL, Kimura S. Differences in transient outward currents of feline endocardial and epicardial myocytes. Circ Res. 1990;67:1287-1291.[Abstract/Free Full Text]

37. Fedida D, Giles WR. Regional variations in action potentials and transient outward current in myocytes isolated from rabbit left ventricle. J Physiol (Lond). 1991;442:191-209.[Abstract/Free Full Text]

38. Wettwer E, Amos GJ, Posival H, Ravens U. Transient outward current in human ventricular myocytes of subepicardial and subendocardial origin. Circ Res. 1994;75:473-482.[Abstract/Free Full Text]

39. Gintant GA. Regional differences in I_K density in canine left ventricle: role of I_K,s in electrical heterogeneity. Am J Physiol. 1995;268:H604-H613.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. N. Flaim, W. R. Giles, and A. D. McCulloch Contributions of sustained INa and IKv43 to transmural heterogeneity of early repolarization and arrhythmogenesis in canine left ventricular myocytes Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2617 - H2629. [Abstract] [Full Text] [PDF]

				A. Takeuchi, S. Tatsumi, N. Sarai, K. Terashima, S. Matsuoka, and A. Noma Ionic Mechanisms of Cardiac Cell Swelling Induced by Blocking Na+/K+ Pump As Revealed by Experiments and Simulation J. Gen. Physiol., November 1, 2006; 128(5): 495 - 507. [Abstract] [Full Text] [PDF]

				W. L. Davies, J. I. Vandenberg, R. A. Sayeed, and A. E. O. Trezise Cardiac Expression of the Cystic Fibrosis Transmembrane Conductance Regulator Involves Novel Exon 1 Usage to Produce a Unique Amino-terminal Protein J. Biol. Chem., April 16, 2004; 279(16): 15877 - 15887. [Abstract] [Full Text] [PDF]

				M. Nagasaki, L. Ye, D. Duan, B. Horowitz, and J. R Hume Intracellular cyclic AMP inhibits native and recombinant volume-regulated chloride channels from mammalian heart J. Physiol., March 15, 2000; 523(3): 705 - 717. [Abstract] [Full Text] [PDF]

				C. I. Spencer, W. Uchida, L. Turner, and R. Z. Kozlowski Signature Currents: A Patch-Clamp Method for Determining the Selectivity of Ion-Channel Blockers in Isolated Cardiac Myocytes Journal of Cardiovascular Pharmacology and Therapeutics, January 1, 2000; 5(3): 193 - 201. [Abstract] [PDF]

				J. R. Hume, D. Duan, M. L. Collier, J. Yamazaki, and B. Horowitz Anion Transport in Heart Physiol Rev, January 1, 2000; 80(1): 31 - 81. [Abstract] [Full Text] [PDF]

				S. D. Freedman, M. H. Katz, E. M. Parker, M. Laposata, M. Y. Urman, and J. G. Alvarez A membrane lipid imbalance plays a role in the phenotypic expression of cystic fibrosis in cftr-/- mice PNAS, November 23, 1999; 96(24): 13995 - 14000. [Abstract] [Full Text] [PDF]

				K. R. Wong, A. E. O. Trezise, S. Bryant, G. Hart, and J. I. Vandenberg Molecular and functional distributions of chloride conductances in rabbit ventricle Am J Physiol Heart Circ Physiol, October 1, 1999; 277(4): H1403 - H1409. [Abstract] [Full Text] [PDF]

				S. Sorota Insights into the structure, distribution and function of the cardiac chloride channels Cardiovasc Res, May 1, 1999; 42(2): 361 - 376. [Abstract] [Full Text] [PDF]

				M. Hiraoka, S. Kawano, Y. Hirano, and T. Furukawa Role of cardiac chloride currents in changes in action potential characteristics and arrhythmias Cardiovasc Res, October 1, 1998; 40(1): 23 - 33. [Abstract] [Full Text] [PDF]

				L. C. Hool, L. M. Middleton, and R. D. Harvey Genistein Increases the Sensitivity of Cardiac Ion Channels to ß-Adrenergic Receptor Stimulation Circ. Res., July 13, 1998; 83(1): 33 - 42. [Abstract] [Full Text] [PDF]

				L. M. Middleton and R. D. Harvey PKC regulation of cardiac CFTR Cl- channel function in guinea pig ventricular myocytes Am J Physiol Cell Physiol, July 1, 1998; 275(1): C293 - C302. [Abstract] [Full Text] [PDF]

				S. Pelzer, Y. You, Y. M. Shuba, and D. J. Pelzer beta -Adrenoceptor-coupled Gs protein facilitates the activation of cAMP-dependent cardiac Cl- current Am J Physiol Heart Circ Physiol, December 1, 1997; 273(6): H2539 - H2548. [Abstract] [Full Text] [PDF]

				S.-S. Zhou, A. Takai, M. Tominaga, and Y. Okada Phosphatase-Mediated Enhancement of Cardiac cAMP-Activated Cl- Conductance by a Cl- Channel Blocker, Anthracene-9-Carboxylate Circ. Res., August 19, 1997; 81(2): 219 - 228. [Abstract] [Full Text]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by James, A. F. Articles by Tominaga, M. Search for Related Content PubMed PubMed Citation Articles by James, A. F. Articles by Tominaga, M.