This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Rouet-Benzineb, P. Articles by Crozatier, B. Search for Related Content PubMed PubMed Citation Articles by Rouet-Benzineb, P. Articles by Crozatier, B.

(Circulation Research. 1996;79:153-161.)
© 1996 American Heart Association, Inc.

Articles

Protein Kinase C Isoform Expression in Normal and Failing Rabbit Hearts

Patricia Rouet-Benzineb, Kamiar Mohammadi, Jeannine Perennec, Madeleine Poyard, Nour El Houda Bouanani, Bertrand Crozatier

Unite INSERM U 400, Faculte de Medecine (P.R.-B., K.M., J.P., N.E.H.B., B.C.), and Unite INSERM U99, Hopital Henri Mondor (M.P.), Creteil, France.

Correspondence to Bertrand Crozatier, INSERM U 400/Faculte de Medecine, 8, rue du General Sarrail, 94010 Creteil, France.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Protein kinase C (PKC) is activated by -adrenergic stimulation. Molecular analysis showed that PKC consists of a family of at least 12 isozymes. Studies of their distribution in the heart showed conflicting results. The first goal of our study was thus to characterize cardiac PKC in normal rabbits. PKC plays an important role in gene expression, cell growth, and differentiation and is involved in the hypertrophy phase of cardiac overload, but since its expression has never been evaluated in heart failure, the second goal of our study was to evaluate PKC activity and isoform expression in rabbits with heart failure induced by a double hemodynamic overload (aortic insufficiency followed by an aortic stenosis). In the first part of the study, PKC isoform expression analyzed in normal rabbits by immunoblotting showed that isoforms , ß, , and were expressed along with PKC, which had never been detected in the heart. PKC expression was also identified by polymerase chain reaction, and immunofluorescence techniques showed a localization on intercalated disks associated with the membrane localization observed with the other isoforms. In the second part of the study, PKC activity, content, and isoform expression showed a decrease of 37% in the failing group. PKC immunodetection with a monoclonal antibody (Mab 1.9) recognizing the catalytic domain of all PKC isoforms revealed a 20% decrease in the failing ventricles compared with normal left ventricles. Expressed PKC isoforms quantified by Western blot showed, in the failing heart group compared with the control group, a decrease of 27%, 32%, 16%, and 9% of PKC, PKCß₁, PKC, and PKC, respectively, whereas PKC was not significantly modified. These results show that, in heart failure, PKC activity and expression of Ca²⁺-dependent PKC isoforms are decreased. This may lead to alterations of PKC-induced phosphorylations.

Key Words: protein kinase C isoforms • heart failure • signal transduction

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The stimulation of cardiac ₁-adrenergic receptors increases phospholipase C activity through a guanidine nucleotide–binding protein.¹ Phospholipase C catalyzes the hydrolysis of phosphatidylinositol 4,5-diphosphate, with the resultant formation of inositol 1,4,5-tris-phosphate and 1,2-diacylglycerol, which in turn increases PKC activity² and induces the translocation of this kinase from the cytosol to the sarcolemma.^{3 4} This is associated with an increase in cardiac contractility.³

Stimulation of cardiac myocyte ₁-adrenergic receptors by catecholamines also produces cardiac myocyte hypertrophy in cultured neonatal cells⁵ as well as in adult cells.^{6 7} The mechanism of this hypertrophy appears to involve PKC. Phorbol esters that activate PKC induce immediate-early genes, including c-fos and c-jun proto-oncogenes,⁸ and PKC has been shown to increase the cellular content of cardiac myofibrillar gene products (MLC2).^{9 10}

When a cardiac overload is produced in vivo, the density of cardiac ₁-adrenergic receptors is modified during the hypertrophy process along with alterations of the cellular response to catecholamines. The ₁-adrenergic receptor density was found to be enhanced before the development of cardiac hypertrophy in pressure-overloaded hearts,¹¹ and in the phase of heart failure in which the downregulation of ß-adrenergic receptor density is well known,¹² the absolute number of ₁-adrenergic receptors has been found to be increased.¹³ Because there is no reduction in cardiac -adrenergic receptor density, it has been suggested that they might contribute to the maintenance of cardiac contractility in heart failure.¹⁴ Whether signal transduction via PKC pathway is modified or disrupted in heart failure remains to be explored. The present study had two principal goals: (1) to characterize which isoforms are expressed in the rabbit heart and (2) to measure PKC activity and amount in rabbits with induced heart failure and to look for a change in isoform expression in heart failure using immunoblotting techniques.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Chemicals and Reagents
[-³²P]ATP (111 TBq/mmol) was purchased from I.C.N. PKC isozyme–specific antibodies were obtained from Santa Cruz Biotechnology Inc. Another anti-PKC antibody was also obtained from GIBCO BRL. A Mab against PKC (Mab 1.9) and goat anti-mouse IgM AP conjugates were obtained from GIBCO BRL. Secondary antibody, either goat anti-rabbit IgG AP conjugates or goat biotinylated anti-rabbit IgG, were obtained from TEBU and Vector Laboratories. Chemical reagents and enzymes, such as BCIP p-toluidine salt and NBT chloride, RNA Trizol, M-MLV reverse transcriptase, and Thermus aquaticus thermostable DNA polymerase were purchased from GIBCO BRL. ECL films and ECL Western blotting reagents were obtained from Amersham.

Experimental Heart Failure Creation
New Zealand White rabbits (body weight, 2.8 to 3.0 kg) were obtained from C.E.G.A.V. (France). Heart failure was produced by a two-step mechanical overload as described by Gilson et al.¹⁵ A volume overload was first obtained by creation of an aortic insufficiency, followed 14 days later by a pressure overload induced by constricting the abdominal aorta.

For creation of the aortic insufficiency, after anesthetization by 0.1 mL etomidate chlorhydrate, a beveled polyethylene catheter (Biotrol; internal diameter, 0.76 mm; external diameter, 1.22 mm) connected to a pressure transducer was introduced into the right carotid artery and pushed abruptly into the LV through the aortic valve. The catheter was then removed from the carotid artery, which was ligated.

The aortic constriction was performed under similar anesthesia. The abdominal aorta was surgically isolated just below the diaphragm. A ligature was tightened around both the aorta and an adjacent piece of polyethylene catheter (Biotrol; external diameter, 2.42 mm). This produced an abdominal aortic constriction of 50%. Animals were killed 14 days later and were inspected for clinical markers of heart failure.

Model of LV Hypertrophy
In order to analyze PKC activity in a much milder cardiac overload, we performed an abdominal aortic stenosis in 11 rabbits by use of the same technique that we used in the heart-failure model without any previous aortic insufficiency. We compared these 11 rabbits with 6 sham-operated rabbits. Animals were killed 18 days after surgery.

Homogenate Preparations
Hearts were quickly excised from the thorax of killed animals and rinsed in an ice-cold 0.3 mol/L sucrose buffer. The whole LV including septum was separated from the right ventricle so that all ventricular layers were used for the analyses. All steps were performed at 4°C. The LV (100 mg) was minced and homogenized with a Tenbroeck homogenizer in 1 mL of a buffer containing (mmol/L) Tris-HCl 20 (pH 7.5), sucrose 250, EDTA 2, EGTA 2, 2-mercaptoethanol 10, and dithiothreitol 2, along with 1% Triton X-100 supplemented with protease inhibitors (1 mmol/L phenylmethylsulfonyl fluoride and 1 µg/mL leupeptin). Protein determination was performed with the Bio-Rad DC protein assay, which is a colorimetric assay protein similar to the Lowry assay.¹⁶ These homogenates were used to assay PKC activity and to determine PKC isoforms.

In order to measure PKC activity and amount in cytosolic and particulate fractions, an aliquot of obtained ventricular homogenates of 6 control and 6 failing hearts was centrifuged at 100 000g in a TL-100.2 rotor (Beckman) for 6 minutes at 4°C. The resulting pellet (particulate fraction) was resuspended in the homogenization buffer, and the supernatant was considered as the cytosolic fraction.

Tissue Processing for Immunochemistry
Rabbits were anesthetized with 0.1 mL of etomidate chlorhydrate in 5 mL of physiological serum, which was administered via the marginal ear vein. After cannulation of the abdominal aorta, heart arrest was obtained in diastole by injection of procainamide in the inferior vena cava. First, animals were retrogradely perfused with 250 mL of isotonic NaCl solution through the abdominal catheter. This was followed by a perfusion with 2 L of fixative (4% formaldehyde in PBS) for 15 minutes. The heart was excised and then postfixed at 4°C in fixative overnight. The LV and the septum were separated from the right ventricle. Tissues were embedded in O.C.T. compound (Tissue-Tek), which allows the frozen block to be mounted on cryostat chuck and sectioned. Frozen tissues or tissue sections (12 µm) were stored at -80°C until use.

PKC Assay
PKC was assayed on LV homogenates by measuring ³²P_i transferred from [-³²P]ATP to lysine-rich histone type III-S according to the technique of Thomas et al.¹⁷ The reaction mixture (250 µL) contained 20 mmol/L Tris-HCl (pH 7.4), 0.75 mmol/L CaCl₂, 100 µg/mL histone H₁, 10 µmol/L [-³²P]ATP (1250 cpm/pmol), 31 µmol/L bovine brain phosphatidylserine, and 0.5 µmol/L 1,2-dioleoyl-sn-glycerol. LV homogenates (50 µL) were added to the incubation mixture. After 10 minutes at 30°C, the reaction was stopped by the addition of 0.9 mL of 12% trichloroacetic acid and 30 µL of casein (30 mg/mL). The acid-precipitable material was collected by centrifugation, dissolved in 1N NaOH (100 µL), and precipitated again with 1 mL of 12% trichloroacetic acid. ³²P_i incorporation was measured in the presence or in the absence of phospholipids. The linearity of the reaction over the 10-minute period was verified in preliminary experiments.

Immunoblotting
Slot Blots
Equal amounts of protein homogenates (range, from 5 to 100 µg) were loaded in each slot onto nylon membrane (Biohylon Z⁺). Membranes were probed with a Mab against PKC (Mab 1.9) used at a 1:1000 dilution. This Mab was developed by Mochly-Rosen and Koshland.¹⁸ It has been prepared against highly purified rat brain PKC containing both membrane associated and cytosolic PKC.¹⁸ It recognizes a region of the catalytic fragment near the active site of the enzyme, thus recognizing all PKC isoforms. Secondary antibody was AP-conjugated goat anti-mouse IgM (dilution, 1:3000). The immunoreactivity was visualized using BCIP and NBT.

In 6 control and 6 failing hearts in which cytosolic and particulate fractions were prepared, the PKC amount was quantified using a single amount of proteins of each heart (40 µg per lane).

Western Blots
Protein homogenates were diluted 1:1 with 2x SDS sample buffer (60 mmol/L Tris-HCl [pH 7.5], 2 mmol/L EDTA, 10 mmol/L 2-mercaptoethanol, 20% glycerol, and 2% SDS). Equal amounts of proteins were loaded in each lane as verified by staining duplicate gels with Coomassie brilliant blue R-250. Proteins (20 µg) were loaded on each lane of a 10% SDS-polyacrylamide gel. On one lane, purified brain PKC was also loaded to be used as a positive control. Proteins were separated by electrophoresis and transferred from the gel to a nylon membrane (Biohylon Z⁺) using an electroblotting apparatus. Membranes were incubated for 30 minutes in 5% dry milk, Tris-buffered saline (10 mmol/L Tris-HCl [pH 8], 150 mmol/L NaCl, and 0.05% Tween-20) to block nonspecific binding sites. Western blots were probed with affinity-purified rabbit antisera directed against the carboxy terminal extremity of specific PKC isoforms: , ß₁, ß₂, , , , or (Table 1) at a dilution of 1:500 for 1 hour, followed by incubation with AP-conjugated goat anti-rabbit IgG antibody. Immunoreactive bands were visualized by AP color development.

View this table: [in this window] [in a new window]   Table 1. C-Terminal PKC Isoform Sequences

Western blots were also performed using an anti-PKC antibody directed toward the V₃ region of this isoform (amino acids 306 to 318) developed by Makowske et al.¹⁹ Rat brain protein extracts were run in parallel and served as positive controls for immunodetection of PKC. Membranes were processed as described above, but in some cases, PKC isozyme-specific peptides were added to the primary antibody solution to block the specific isozyme bands. Immunoreactive bands were visualized in this particular case by chemiluminescence. After the washing, a 1:10 000 dilution of horseradish peroxidase–labeled anti-rabbit IgG was added for 1 hour at room temperature. The blots were developed using ECL Western blotting reagents.

RNA and cDNA Preparation
Total RNA was extracted from rat brain and from rabbit or rat LV using Trizol (RNA isolation method developed by Chomczynski and Sacchi²⁰ ) according to the manufacturer's instructions. Total RNA (2 µg) was reverse-transcribed into cDNA for a 1-hour incubation at 37°C in a reaction medium composed of (final concentration) 30 µL of 1.5 µmol/L oligo (dT), 0.5 mmol/L dNTP, 1 U/µL recombinant RNase inhibitor, 13.3 U/µL M-MLV reverse transcriptase in 10 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, and 0.6 mmol/L MgCl₂.

PCR
For each PCR, 10 µL of the first-strand cDNA was added to 90 µL of a mixture containing 20 pmol/µL of each PKC primer as described by Brick-Ghannam et al,²¹ 200 µmol/L each of dATP, dCTP, dTTP, and dGTP, 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9.0), 2.5 mmol/L MgCl₂, and 2 U of Thermus aquaticus thermostable DNA polymerase. The sequences of the primers derived from human cDNA sequences were as follows: 5'-primer, CGGGCTCCCACAGCAGATGAG; 3'-primer, GCAGTCGTCCAGGGCTGGCCCC.

PCR amplification was performed using the Perkin-Elmer/Cetus thermal cycler set for 30 cycles of 1-minute denaturation at 94°C, 1-minute annealing at 55°C, and 1-minute extension at 72°C. PCR fragments were analyzed by electrophoresing 10 µL of each reaction in 2% agarose gels, followed by ethidium bromide staining.

Immunocytochemical PKC Analyses
Histochemical Procedures
Frozen tissue sections/slides were sequentially placed at room temperature for 10 minutes, bleached with 1% hydrogen peroxide in PBST (PBS and 0.025% Tween 20) for 30 minutes to inactivate endogenous peroxidase, rinsed three times in PBS for 5 minutes, and then incubated with "blocking serum" (10% newborn calf serum in PBST) for 1 hour to saturate cellular Fc receptors.

The incubation with the primary antibody (specific anti-PKC isoform antibody) at a 1:500 dilution in a buffer (1% BSA and 0.25% Triton X-100 in PBS) was performed at room temperature in humid chamber overnight. All washings were performed with 2 mmol/L levamisole (to inhibit endogenous alkaline phosphatase) in TBST (0.14 mol/L NaCl, 2.7 mmol/L KCl, 25 mmol/L Tris-HCl [pH 7.5], and 1% Tween 20) three times for 5 minutes.

After the third rinse, the sections were incubated with the secondary antibody (goat anti-rabbit IgG AP conjugate) for 1 hour. Then three washings were performed as described above. In darkness, the sections were incubated with NBT and BCIP. The duration of color development was 1.5 hours. The sections/slides were rinsed twice for 10 minutes with PBT and then immediately mounted in immunomount medium (Shandon). Slides were photographed under a microscope (Axioplan, Zeiss) with 100 ASA Kodak color slide film.

Indirect Immunofluorescence Method
Treatments of cryostat sections 12 µm thick were similar to those described above for immunohistochemical studies, but the second antibody was goat biotinylated anti-rabbit IgG used at a 1:200 dilution for 1 hour at room temperature and then washed. This was followed by incubation with avidin FITC-labeled goat anti-rabbit IgG at a 1:100 dilution for 1 hour at room temperature. The preparations were rinsed, mounted in immunomounting medium (Moviol), and examined under a Zeiss Axioplan epifluorescence microscope using a x40 objective. Controls were similarly processed but with the omission of the primary antiserum. Slides were photographed with 800 ASA Kodak color slide film.

Data Analysis
PKC activity was calculated by subtracting incorporated ³²P_i without phospholipids to the value obtained with phospholipids. PKC activity was expressed as picomoles of incorporated ³²P_i per minute per milligram protein. PKC activity was also expressed per gram of ventricle and per total LVs. Immunoblots and Western blots were scanned with a Shimadzu CS9000 densitometer at 600 nm wavelength. PKC content was expressed in arbitrary units according to the integration of the area of the densitometric peak. Comparisons between groups (heart failure versus control group) were made using an unpaired Student's t test. Statistical significance was considered to be obtained for a value of P<.05. Values are presented as mean±1 SEM.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Characterization of the Animals
Among 12 rabbits with induced hemodynamic overload, 10 rabbits showed clinical signs of heart failure, such as pericardial and/or pleural effusions and ascites. As shown in Table 2, the LV weight–to–body weight ratio, an index of hypertrophy, was increased by 83% in the group with heart failure compared with the control group, with a small scatter (from 1.96 to 2.6) that was independent of the clinical status.

View this table: [in this window] [in a new window]   Table 2. Anatomic Data and PKC Activity in Animals With Heart Failure and Aortic Stenosis

The protein yield in homogenates was slightly but not significantly smaller in failing LV (201±91 mg/g of LV) than in control LV (234±16.9 mg/g of LV).

PKC Activity
Diacylglycerol was previously shown to increase the apparent affinity of PKC for Ca²⁺²² so that the enzyme was active at micromolar Ca²⁺ concentrations. Measured PKC activity in the absence of phospholipids represented 12.5% of that in the presence of phospholipids in control rabbits (0.09±0.01 versus 0.74±0.03 nmol·min^-1·g LV^-1) and 20% in rabbits with heart failure (0.09±0.01 versus 0.47±0.04 nmol·min^-1·g LV^-1). As shown in Table 2, PKC activity was decreased by 37% in the heart-failure group when expressed per milligram of protein and by 47% when expressed per gram of LV.

PKC activity was also measured in the cytosolic and in the particulate fraction of 6 control and 6 failing hearts. It tended to be decreased in the membrane fraction of failing hearts (control, 275±21 pmol·min^-1·g LV^-1; heart failure, 177±59 pmol·min^-1·g LV^-1), but this change was not statistically significant. In contrast, PKC activity was significantly decreased in the cytosolic fraction of failing hearts (control, 479±58 pmol·min^-1·g LV^-1; heart failure, 248±38 pmol·min^-1·g LV^-1; P<.01). The translocation index expressed as the particulate/(particulate+cytosolic) activity ratio was not significantly modified (control, 0.37±0.01; heart failure, 0.34±0.07; P=NS).

We also measured PKC activity in rabbits with LV hypertrophy induced by an abdominal aortic stenosis for 18 days without the production of a previous aortic insufficiency. Table 2 shows a 20% increase in the LV weight–to–body weight ratio in animals with aortic stenosis compared with sham-operated animals, and PKC activity was not significantly different in the two groups.

PKC Immunodetection
Fig 1, left, shows PKC immunoreactivity of a control and a failing heart using Mab 1.9 directed against the catalytic domain of PKC. The relation of immunoreactivity versus protein concentration was highly linear in each heart for protein concentrations of <100 µg (range, between 10 and 80 µg: all r values >0.93). The right panel of Fig 1 is a plot of the relations in the normal and in the failing heart that are shown in the left panel. A statistically significant decrease in PKC content was observed in failing LV homogenates compared with control homogenates with all protein concentrations (Fig 2). The slope of the immunoreactivity-protein concentration relationship was significantly smaller in failing than in normal hearts (120.8±7.1 versus 91.9±7.8 arbitrary units/µg protein, P<.03).

View larger version (18K): [in this window] [in a new window]   Figure 1. Immunoslot of LV homogenates. Left, Typical example of PKC immunoslots from homogenates of one control rabbit and of one rabbit with heart failure. From slot 1 to slot 8, protein amount was 10, 20, 30, 40, 50, 60, 70, and 80 µg, respectively. Proteins were blotted to a nylon membrane and then probed with a Mab directed against PKC (Mab 1.9), as described in "Materials and Methods.'' Right, Corresponding correlations between protein concentrations and densitometric profiles of immunoslots measured with a laser densitometer at 600-nm wavelength. This panel shows the linearity of the relation with a steeper slope in the control than in the failing heart.

View larger version (22K): [in this window] [in a new window]   Figure 2. PKC immunoreactivity expressed in arbitrary units as a function of micrograms of protein loaded in a slot. Open and closed bars represent PKC content detected in control and in failing LV homogenates, respectively. *P<.05 and P<.005 for control vs failing hearts.

The immunoreactivity of cytosolic and particulate fractions was also measured in 6 control and in 6 failing hearts by using the same technique, with a single protein concentration loaded per lane (40 µg). Immunoreactivity was not different in control (29 910±3551 arbitrary units) and failing (29 424±2523 arbitrary units) membrane fractions. In contrast, it was significantly decreased in cytosolic fractions (control, 17 440±1750 arbitrary units; heart failure, 12 076±1490 arbitrary units; P<.05).

PKC Isoform Expression in LV Myocardium
Typical results of Western blot analysis performed on total proteins extracted from control or failing LVs using polyclonal antibodies directed against the C terminus of each PKC isoform and using purified bovine brain PKC as positive reference are presented in Fig 3. PKC content of normal and failing LVs expressed in arbitrary units is given in Table 3. The protein yield on the membranes was similar in control and failing hearts, as shown in the SDS-PAGE stained with Coomassie blue in Fig 3A.

View larger version (42K): [in this window] [in a new window]   Figure 3. Western blots of PKC isoforms. Representative Western blots assess amounts of PKC isoforms in LVs of rabbits with heart failure (HF) and control rabbits (C). Equal amounts of proteins obtained from different individual hearts were separated on 10% SDS-polyacrylamide gel and then electrically transferred to a nylon membrane (Biohylon Z+). A, SDS-PAGE with Coomassie blue stain shows a similar protein yield in control and failing hearts. B, With purified bovine brain PKC (*) used as reference, each blot was probed with the PKC isozyme-specific antibodies as described in "Materials and Methods.'' The numbers on the right of the figure indicate the molecular weight (MW, in kilodaltons) of each immunoreactive band, which was estimated from the electrophoretic mobilities of the prestained SDS molecular weight markers and also provided a visual check of transfer efficiency.

View this table: [in this window] [in a new window]   Table 3. Densitometric Scores of PKC Isoform Western Blots

Polyclonal antibody directed against PKC detected an 80-kD apparent molecular mass protein in LVs corresponding to the same immunoreactive band as brain PKC (Fig 3). PKC isoform was significantly decreased (by 28%) in failing LVs (Table 3).

Although anti-PKCß₁ antiserum reacted strongly with an 80-kD cerebral PKC, it reacted only weakly with both control and failing LV proteins (Fig 3), with a 32% decrease in failing ventricles compared with control ventricles (Table 3). Immunoreactive bands obtained with anti-PKCß₂ antiserum were faint in control ventricles (data not shown) and were not detected in failing ventricles, but anti-PKCß₂ reacted strongly with brain PKC (molecular apparent mass, 80 kD; Table 3).

PKC was detected as an 80-kD molecular mass protein in purified brain PKC and in heart extracts (Fig 3). It was significantly decreased in failing ventricles compared with control ventricles (Table 3) by 9%, which may not have physiological consequences. In order to confirm the presence of the PKC isoform in the rabbit heart, we performed additional experiments using the corresponding peptide of the utilized antibody directed against the C-terminal region, and we also used another antibody directed against the V₃ region with and without the corresponding peptide. As shown in Fig 4, the presence of PKC isoform was detected with both antibodies in the rabbit LV but not in the rat LV, and this immunoreactivity disappeared when the corresponding peptides were included.

View larger version (53K): [in this window] [in a new window]   Figure 4. Western blots of PKC isoform using chemiluminescence technique. The upper panels represent Western blots obtained with the antibody directed toward the carboxy-terminal region (antibody 1), and the lower panels are those obtained using the antibody directed toward the V3 region (antibody 2). Lanes are as follows: 1, rat brain; 2, rat LV; 3, rabbit brain; and 4, rabbit LV. Both antibodies against PKC recognized a protein of 80 kD in brains from rats and rabbits and in rabbit LVs. No immunoreactivity was detected in rat LVs (left panels). Immunoreactive bands were not detected with coincubation with the respective immunogen peptide (right panels).

PKC was not detected in normal and failing hearts (data not shown). An absence of recognition of this isoform in rabbits by the utilized antibody is excluded, since this isoform was detected in homogenates obtained from rabbit brain. PKC was detected as a 90-kD molecular mass protein in purified brain PKC and in heart extracts (Fig 3). It was decreased by 25% in failing ventricles compared with control ventricles (Table 3). PKC immunoreactivity revealed a double band of 79 and 75 kD (Fig 3). Although its expression tended to be increased in failing ventricles compared with control ventricles, this change was not statistically significant (Table 3).

Immunological Studies
Immunohistochemistry
PKC immunoreactivity was detected in cryostat sections of the LV free wall compared with a control experiment in which the primary specific PKC antiserum was omitted, followed by the second antibody conjugated with AP. Light microscopic examination of sections from LV tissues provided a clear overview of myocyte structures.

As shown in Fig 5, immunostaining indicates that PKCß₁, PKC, and PKC were localized along the cell surface and the sarcomeres. PKC was mainly found as a fine line at the lateral border of the myocytes, whereas PKC was localized to these borders but also specifically to intercalated disks.

View larger version (152K): [in this window] [in a new window]   Figure 5. Immunohistochemical localization of PKC isoforms in a normal rabbit heart. The second antibody was an AP conjugate. In panel A, the primary antibody was not added. In the other panels, LV free wall cryostat sections were incubated with specific antibodies directed against PKC: anti-PKC (B), anti-PKC (C), anti-PKCß1 (D), anti-PKC (E), and anti-PKC (F). Magnification, x40 in each panel.

Immunofluorescence Analysis for PKC Localization
Cryostat sections of the free wall of the rabbit LVs were analyzed with anti-PKC antibody using the biotin-avidin technique. As presented in Fig 6, PKC immunofluorescence staining was clearly observed in intercalated disks as well as on cell membranes.

View larger version (130K): [in this window] [in a new window]   Figure 6. Indirect immunofluorescence of PKC in a normal heart. Top, Control without the primary antibody. Bottom, Anti-PKC. The second antibody was biotinylated and revealed by the FITC-avidin complex. Note the clear localization of PKC on intercalated disks as well as on cellular membranes.

Specific Gene Amplification of PKC Isoform
Since PKC had not been previously detected in the heart, we looked for PKC gene expression in normal hearts. As seen in Fig 7, gel analysis after 30 cycles of amplification of reverse-transcribed PKC mRNA revealed that PKC was detectable after ethidium bromide staining, and the oligonucleotide PKC pair gave a single amplification product of the expected size. PKC mRNA was expressed in rat brain and in rabbit LV but not in rat LV.

View larger version (51K): [in this window] [in a new window]   Figure 7. PKC gene product amplification (reverse-transcriptase PCR). In lane 1, total RNA of rat brain without reverse transcriptase shows an absence of genomic DNA amplification. Total RNAs were reverse-transcribed into cDNA and amplified with specific oligonucleotides as indicated in "Materials and Methods'': rat brain (lane 2), rabbit LV (lane 3), and rat LV (lane 4).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The principal results of our study are as follows: (1) Most PKC isoforms are expressed in normal rabbit ventricles, and we demonstrate for the first time a cardiac expression of PKC. (2) In heart failure, there is a decrease in total PKC activity per gram of LV with a decrease in total PKC amount. (3) This is associated in heart failure with a small (9% to 32%) but significant decreased amount of most expressed PKC isoforms.

PKC Isoform Expression in Normal Hearts
Biochemical and molecular analysis have revealed that PKC (EC 2.7.1.37) consists of a family of at least 12 isoenzymes encoded by 9 genes.^{22 23} They can be divided into three groups according to their lipid and Ca²⁺ dependence (cPKC isoenzymes, , ß₁, ß₂, and ) or to their Ca²⁺ independence (nPKC isoenzymes, , , , , and µ, lacking the Ca²⁺-binding domain) or to their diacylglycerol and phorbol ester independence (aPKC isoenzymes, , , and ). Using ion-exchange chromatography and immunoblotting with PKC isoform antibodies,²⁴ it was shown that the expression of these isoforms is different among different tissues: PKC, PKC, and PKC are widespread, whereas others such as PKC-, PKC, and PKC are restricted to one or few tissues. For instance, it was shown that the heart contains a large amount of Ca²⁺-dependent isoforms , ß₁, and ß₂ but not ^{25 26} and Ca²⁺-independent isoforms , , and . However, another study could only detect the presence of PKC in rat hearts.²⁷

The present study shows the expression of multiple PKC isoforms, not only , ß₁, ß₂, , and (similar to what was found by Wetsel et al,²⁴ Mochly-Rosen et al,²⁵ and Inoguchi et al²⁶ ) but also PKC, which was not detected in previous studies.^{24 25 26 27 28 29 30} Three principal factors may explain these differences. Results may depend on utilized antibodies. Polyclonal antibodies we chose in the present study were directed against 20 amino acids of the carboxy-terminus sequence of rabbit PKC isoforms. A cross-reactivity is quite unlikely, since the antibody used for its detection was directed toward a sequence that has no homology with any other sequence of PKC isoforms (Table 1), and this result was confirmed by the utilization of another antibody directed toward the V₃ region and by reverse-transcriptase PCR studies, which showed PKC gene expression in the rabbit heart (Fig 7). The second possibility is that previous studies were performed on isolated cells, whereas we used whole-heart homogenates, which contain vascular cells and fibroblasts in addition to cardiomyocytes. However, a recent study³⁰ in whole rat hearts also failed to detect the PKC isoform. Our immunohistochemical studies (Figs 5 and 6) showed clearly the localization of PKC on cell membranes and intercalated disks of cardiomyocytes. The third possibility for explaining the difference between our results and previously published results concerning PKC isoform expression in the heart is a species difference, since we used rabbits but all other studies used rats, except one, which used bovine hearts.²⁸ This result suggests that the PKC isoform, which is a Ca²⁺-dependent isoform, may be expressed in the hearts of species other than rats. The specific localization of the PKC isoform on intercalated disks, which is associated with that on cellular membranes, suggests that it may play a role in the communication between cells. PKC was not detected in rabbit LVs. This may also be a species difference, since it has been found in rats,^{24 30} although its expression is much smaller in adult than in neonatal rat hearts.³¹

PKC Isoform Expression in Heart Failure
The second goal of the present study was to evaluate PKC activity and isoform expression in heart failure, since PKC is involved in the regulation of transcriptional activity and in the regulation of cardiac contractility, which may be modified in hypertrophy and heart failure.

The development of heart failure in response to cardiac overload can be divided into three different phases. In the initial phase, which follows the creation of the hemodynamic defect, the hypertrophy process takes place by the induction of "immediate-early genes," such as c-fos and c-myc,^{32 33} and the induction of "late-responsive genes," such as those of ß-myosin heavy chain and skeletal actin.³⁴ PKC has been shown to induce immediate-early genes, to activate cardiac gene transcription,⁸ and to activate cardiac MLC2 in neonatal rat ventricular myocytes.¹⁰ It was also shown that PKCß is the pathway of ₁-adrenergic receptor regulation of ß-myosin heavy chain transcription during cardiac myocyte hypertrophy.³⁵ This phase of development of hypertrophy, which lasts a few days, is followed by a stable hypertrophy phase, after which the heart begins to decompensate, leading to the heart failure syndrome. The advantage of our model of double pressure plus volume overload is that it produces within 1 month an important LV hypertrophy (Table 1) associated with the appearance of clinical markers of heart failure. We previously characterized in detail this model, which associates a number of contractile abnormalities in vivo¹⁵ and ex vivo.³⁶ In conscious instrumented rabbits with this double overload compared with normal rabbits, we showed¹⁵ an increased heart rate (from 234 to 276 bpm), an increased end-diastolic pressure (from 2.7 to 11.7 mm Hg), and a decrease in diameter systolic shortening (from 28.5% to 16.2%). In isolated hearts, we showed an abnormal force-frequency relationship,³⁶ and these contractile abnormalities were associated with abnormalities of the ß-adrenergic pathway³⁷ and sarcoplasmic reticulum function.³⁸

The observed decrease in PKC content and activity observed in the present study in animals with heart failure is at variance with the results of a recent study,³⁰ which showed that PKC activity was increased in the early phase of pressure overload induced in rats, with an associated increase in the expression of ß and isoforms, whereas , , and were not modified. One factor that can explain the differences is that the study of Gu and Bishop³⁰ was performed in the early phase of the hypertrophic process, whereas we analyzed PKC in adult rabbit failing hearts. In failing hearts, although there was no significant difference in protein yield compared with control hearts, more interstitial fibrosis may be present, leading to a decrease in PKC activity and amount when reported per gram of LV. The decrease in PKC content and activity may be the consequence of a general decrease in metabolic activity in heart failure, which may produce a decrease in all enzymatic and synthetic activities. However, when we studied a much milder overload, which produced a moderate LV hypertrophy without signs of heart failure, we could not detect any significant change in PKC activity. The differences between the present study and that of Gu and Bishop can be due to species differences or to the fact that this latter study was performed in young developing rats. It can thus be hypothesized that PKC gene expression is stimulated or unchanged depending on the model and the species in the early phase of cardiac overload, during which the hypertrophy process is taking place, and that PKC is downregulated during the final failing phase, when hypertrophy has already developed.

In addition to its role in gene expression stimulation, PKC activation may play a role in the positive inotropic effect induced by ₁-adrenergic receptors. This effect is strongly suggested by the PKC-induced phosphorylations of a number of proteins: troponin I and troponin T in vivo,³⁹ phospholamban of sarcoplasmic reticulum,⁴⁰ and a 15-kD sarcolemmal and a 28-kD cytosolic protein in vitro^{41 42} and in vivo.⁴ PKC also enhances myosin light chain kinase effects on force development and ATPase activity in skinned cardiac cells.⁴³ All these effects may induce an increased contractility, which has been excluded in one study.⁴⁴ Until now, it is unclear how important a decrease in total PKC activity or the expression of a specific isoform would be in terms of physiological function. Thus, the physiological role of PKC and particularly of the different isoforms requires further investigation. However, our data do not support the hypothesis that ₁-adrenergic stimulation may contribute to the inotropic support of the failing heart, which is probably limited in most species since the density of ₁-receptors is small.^{11 13} In addition, the role of PKC in gene expression and thus, probably, in the hypertrophy process of the heart has been clearly shown. Our data, which show a downregulation of PKC activity and isoform expression, suggest that this PKC downregulation may participate in the decompensation that appears in heart failure.

	Selected Abbreviations and Acronyms

 

AP = alkaline phosphatase BCIP = 5-bromo-4-chloro-3-indolyl phosphate FITC = fluorescein isothiocyanate LV = left ventricle, left ventricular Mab = monoclonal antibody MLC2 = myosin light chain-2 M-MLV = Moloney murine leukemia virus NBT = nitro blue tetrazolium PCR = polymerase chain reaction PKC = protein kinase C

	Acknowledgments

 
This study was supported in part by grants from Association Francaise contre les Myopathies and Federation Francaise de Cardiologie. We thank Dr Herve Coste (Paris) for kindly supplying us with purified bovine PKC and Dr Nuala Mooney for the gift of specific PKC oligonucleotides. We acknowledge Monique Laplace and Monique Willemin for expert technical assistance and Lydia Le Bouil for secretarial assistance.

Received November 27, 1995; accepted April 5, 1996.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Berridge MJ. Inositol trisphosphate and diacylglycerol as second messengers. J Biochem. 1984;220:345-360.

2. Nishizuka Y. The role of protein kinase C in cell surface signal transduction and tumour promotion. Nature. 1984;308:693-698.[Medline] [Order article via Infotrieve]

3. Kaku T, Lakata E, Filburn C. -Adrenergic regulation of phosphoinositide metabolism and protein kinase C in isolated cardiac myocytes. Am J Physiol. 1991;260:C635-C642.[Abstract/Free Full Text]

4. Talosi L, Kranias EG. Effect of -adrenergic stimulation on activation of protein kinase C and phosphorylation of proteins in intact rabbit hearts. Circ Res. 1992;70:670-678.[Abstract/Free Full Text]

5. Simpson PC, Kariya K, Karns LR, Long CS, Karliner JS. Adrenergic hormones and control of cardiac myocyte growth. Mol Cell Biochem. 1991;104:35-43.[Medline] [Order article via Infotrieve]

6. Springhorn JP, Ellingsen O, Berger HJ, Kelly RA, Smith TW. Transcriptional regulation in cardiac muscle: coordinate expression of Id with a neonatal phenotype during development and following a hypertrophic stimulus in adult rat ventricular myocytes in vitro. J Biol Chem. 1992;267:14360-14365.[Abstract/Free Full Text]

7. Schluter KD, Piper HM. Trophic effects of catecholamines and parathyroid hormone on adult ventricular cardiomyocytes. Am J Physiol. 1992;263:H1739-H1746.[Abstract/Free Full Text]

8. Dunnmon PM, Iwaki K, Henderson SA, Sen A, Chien KR. Phorbol esters induce immediate-early genes and activate cardiac gene transcription in neonatal rat myocardial cells. J Mol Cell Cardiol. 1990;22:901-910.[Medline] [Order article via Infotrieve]

9. Lee HR, Henderson SA, Reynolds R, Dunnmon P, Yuan D, Chien KR. -1 Adrenergic stimulation of cardiac gene transcription in neonatal rat myocardial cells: effects on myosin light chain-2 gene expression. J Biol Chem. 1988;263:7352-7358.[Abstract/Free Full Text]

10. Shubeita HE, Martinson EA, Van Bilsen M, Chien KE, Brown JH. Transcriptional activation of the cardiac myosin light chain 2 and atrial natriuretic factor genes by protein kinase C in neonatal rat ventricular myocytes. Proc Natl Acad Sci U S A. 1992;89:1305-1309.[Abstract/Free Full Text]

11. Tamai J, Hori M, Kagiya T, Iwakura K, Iwai K, Kitabatake A, Watanabe Y, Yoshida H, Inoue M, Kamada T. Role of ₁-adrenoceptor activity in progression of cardiac hypertrophy in guinea pig hearts with pressure overload. Cardiovasc Res. 1989;23:315-322.[Medline] [Order article via Infotrieve]

12. Bristow MR, Ginsburg R, Minobe WA, Cubicciotti RS, Sageman WS, Lubie K, Billingham ME, Harrison DC, Stinson EB. Decreased catecholamine sensitivity and ß adrenergic-receptor density in failing rabbit human heart. N Engl J Med. 1982;307:205-211.[Abstract]

13. Bristow MR, Minobe W, Rasmussen R, Heshberger RE, Hoffman BB. Alpha-1 adrenergic receptors in the nonfailing and failing human heart. J Pharmacol Exp Ther. 1988;247:1039-1045.[Abstract/Free Full Text]

14. Bohm M, Diet F, Feiler G, Kemkes B, Erdmann E. -Adrenoceptors and -adrenoceptor-mediated positive inotropic effects in failing human myocardium. J Cardiovasc Pharmacol. 1988;12:357-364.[Medline] [Order article via Infotrieve]

15. Gilson N, Bouanani NEH, Corsin A, Crozatier B. Left ventricular function and ß-adrenoceptors in rabbit failing heart. Am J Physiol. 1990;258:H634-H641.[Abstract/Free Full Text]

16. Lowry OH, Rosebrough NH, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-275.[Free Full Text]

17. Thomas TP, Gopalakrishna R, Anderson WB. Hormone and tumor promoter induced activation or membrane association of protein kinase C in intact cells. Methods Enzymol. 1987;141:399-412.[Medline] [Order article via Infotrieve]

18. Mochly-Rosen D, Koshland DE Jr. Domain structure and phosphorylation of protein kinase C. J Biol Chem. 1987;262:2291-2297.[Abstract/Free Full Text]

19. Makowske M, Ballester R, Cayre Y, Rosen OM. Immunochemical evidence that three protein kinase C isozymes increase in abundance during HL-60 differentiation induced by dimethyl sulfoxide and retinoic acid. J Biol Chem. 1988;263:3402-3410.[Abstract/Free Full Text]

20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]

21. Brick-Ghannam C, Ericson ML, Schelle I, Charron D. Differential regulation of mRNAs encoding protein kinase C isoenzymes in activated human ß cells. Hum Immunol. 1994:41:216-224.

22. Asaoka Y, Nakamura SI, Yoshida K, Nishizuka Y. Protein kinase C, calcium and phospholipid degradation. Trends Biochem Sci. 1992;17:414-418.[Medline] [Order article via Infotrieve]

23. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature. 1988;334:661-665.[Medline] [Order article via Infotrieve]

24. Wetsel WC, Khan WA, Merchenthaler I, Rivera H, Halpern AE, Phung HM, Negro-Vilar A, Hannun YA. Tissue and cellular distribution of the extended family of protein kinase C isoenzymes. J Cell Biol. 1992:117;121-133.

25. Mochly-Rosen D, Henrich CJ, Cheever L, Khaner H, Simpson PC. A protein kinase C isozyme is translocated to cytoskeletal elements on activation. Cell Regul. 1990;1:693-706.[Medline] [Order article via Infotrieve]

26. Inoguchi T, Battan R, Handler E, Sportsman JR, Heath W, King GL. Preferential elevation of protein kinase C isoform ß2 and diacylglycerol levels in the aorta and heart of diabetic rats: differential reversibility to glycemic control by islet cell transplantation. Proc Natl Acad Sci U S A. 1992;89:11059-11063.[Abstract/Free Full Text]

27. Bogoyevitch MA, Parker PJ, Sugden PH. Characterization of protein kinase C isotype expression in adult rat heart: protein kinase C- is a major isotype present, and it is activated by phorbol esters, epinephrine, and endothelin. Circ Res. 1992;72:757-767.[Abstract/Free Full Text]

28. Allen BG, Katz S. Isolation and characterization of the calcium- and phospholipid-dependent protein kinase (protein kinase C) subtypes from bovine heart. Biochemistry. 1991;30:430-434.

29. Puceat M, Hilal-Dandan R, Strulovici B, Brunton LL, Brown JH. Differential regulation of protein kinase C isoforms in isolated neonatal and adult rat cardiomyocytes. J Biol Chem. 1994;269:16938-16944.[Abstract/Free Full Text]

30. Gu X, Bishop SP. Increased protein kinase C and isozyme redistribution in pressure-overload cardiac hypertrophy in the rat. Circ Res. 1994;75:926-931.[Abstract/Free Full Text]

31. Rybin VO, Steinberg SF. Protein kinase C isoform expression and regulation in the developing rat heart. Circ Res. 1994;74:299-309.[Abstract/Free Full Text]

32. Starksen NF, Simpson PC, Bishopric N, Coughlin SR, Lee WMF. Cardiac myocyte hypertrophy is associated with c-myc protooncogene expression. Proc Natl Acad Sci U S A. 1986;83:8348-8350.[Abstract/Free Full Text]

33. Izumo S, Nadal-Ginard B, Mahdavi V. Protooncogene induction and reprogramming of cardiac gene expression produced by pressure overload. Proc Natl Acad Sci U S A. 1988;185;339-343.

34. Swynghedauw B. Developmental and functional adaptation of contractile proteins in cardiac and skeletal muscles. Physiol Rev. 1986;66:710-771.[Abstract/Free Full Text]

35. Kariya KI, Karns LR, Simpson PC. An enhancer core element mediates stimulation of the rat ß-myosin heavy chain promoter by an ₁-adrenergic agonist and activated ß-protein kinase C in hypertrophy of cardiac myocytes. J Biol Chem. 1994;269:3775-3782.[Abstract/Free Full Text]

36. Ezzaher A, Bouanani NEH, Crozatier B. Force-frequency relations and response to ryanodine in failing rabbit hearts. Am J Physiol. 1992;263:H1710-H1715.[Abstract/Free Full Text]

37. Bouanani NEH, Corsin A, Gilson N, Crozatier B. ß-Adrenoceptors and adenylate cyclase activity in hypertrophied and failing rabbit left ventricle. J Mol Cell Cardiol. 1991:23:537-581.

38. Bouanani N el H, Perennec J, Ezzaher A, Jdaiaa H, Crozatier B. Sarcoplasmic reticulum function abnormalities in rabbit failing hearts. C R Acad Sci III. 1994;317:825-831.[Medline] [Order article via Infotrieve]

39. Lim MS, Sutherland C, Walsh MP. Phosphorylation of bovine cardiac c-protein by protein kinase C. Biochem Biophys Res Commun. 1985;132:1187-1195.[Medline] [Order article via Infotrieve]

40. Movsesian MA, Nishikawa M, Adelstein RS. Phosphorylation of phospholamban by calcium-activated, phospholipid-dependent protein kinase. J Biol Chem. 1984;259:8029-8032.[Abstract/Free Full Text]

41. Presti CF, Scott BT, Jones LR. Identification of an endogenous protein kinase C activity and its intrinsic 15-kilodalton substrate in purified canine cardiac sarcolemmal vesicles. J Biol Chem. 1985;260:13879-13889.[Abstract/Free Full Text]

42. Edes I, Kranias EG. Phospholamban and troponin I are substrates for protein kinase C in vitro but not in intact beating guinea pig hearts. Circ Res. 1990;67:394-400.[Abstract/Free Full Text]

43. Clement O, Puceat M, Walsh MP, Vassort G. Protein kinase C enhances myosin light-chain kinase effects on force development and ATPase activity in rat single skinned cardiac cells. J Biochem. 1992;285:311-317.

44. Endou M, Hattori Y, Tohse N, Kanno M. Protein kinase C is not involved in ₁-adrenoceptor-mediated positive inotropic effect. Am J Physiol. 1992;260:H27-H36.

This article has been cited by other articles:

				S. S. Palaniyandi, L. Sun, J. C. B. Ferreira, and D. Mochly-Rosen Protein kinase C in heart failure: a therapeutic target? Cardiovasc Res, May 1, 2009; 82(2): 229 - 239. [Abstract] [Full Text] [PDF]

				F. Vincent, N. Duquesnes, C. Christov, T. Damy, J.-L. Samuel, and B. Crozatier Dual level of interactions between calcineurin and PKC-{varepsilon} in cardiomyocyte stretch Cardiovasc Res, July 1, 2006; 71(1): 97 - 107. [Abstract] [Full Text] [PDF]

				S. Dhein Pharmacology of gap junctions in the cardiovascular system Cardiovasc Res, May 1, 2004; 62(2): 287 - 298. [Abstract] [Full Text] [PDF]

				J. M. Metzger and M. V. Westfall Covalent and Noncovalent Modification of Thin Filament Action: The Essential Role of Troponin in Cardiac Muscle Regulation Circ. Res., February 6, 2004; 94(2): 146 - 158. [Abstract] [Full Text] [PDF]

				E. Mazzoni, A. Adam, E. Bal de Kier Joffe, and J. A. Aguirre-Ghiso Immortalized Mammary Epithelial Cells Overexpressing Protein Kinase C {gamma} Acquire a Malignant Phenotype and Become Tumorigenic in Vivo Mol. Cancer Res., August 1, 2003; 1(10): 776 - 787. [Abstract] [Full Text] [PDF]

				J. Wang, X. Liu, E. Sentex, N. Takeda, and N. S. Dhalla Increased expression of protein kinase C isoforms in heart failure due to myocardial infarction Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2277 - H2287. [Abstract] [Full Text] [PDF]

				K. Mohammadi, P. Kometiani, Z. Xie, and A. Askari Role of Protein Kinase C in the Signal Pathways That Link Na+/K+-ATPase to ERK1/2 J. Biol. Chem., November 2, 2001; 276(45): 42050 - 42056. [Abstract] [Full Text] [PDF]

				K. L. Schreiber, L. Paquet, B. G. Allen, and H. Rindt Protein kinase C isoform expression and activity in the mouse heart Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2062 - H2071. [Abstract] [Full Text] [PDF]

				D. H. Korzick, D. A. Holiman, M. O. Boluyt, M. H. Laughlin, and E. G. Lakatta Diminished {alpha}1-adrenergic-mediated contraction and translocation of PKC in senescent rat heart Am J Physiol Heart Circ Physiol, August 1, 2001; 281(2): H581 - H589. [Abstract] [Full Text] [PDF]

				S. Baudet, J. Weisser, A. P Janssen, K. Beulich, U. Bieligk, B. Pieske, J. Noireaud, P. M.L Janssen, G. Hasenfuss, and J. Prestle Increased basal contractility of cardiomyocytes overexpressing protein kinase C{epsilon} and blunted positive inotropic response to endothelin-1 Cardiovasc Res, June 1, 2001; 50(3): 486 - 494. [Abstract] [Full Text] [PDF]

				K S Thorneloe, X F Liu, M P Walsh, and Y Shimoni Transmural differences in rat ventricular protein kinase C epsilon correlate with its functional regulation of a transient cardiac K+ current J. Physiol., May 15, 2001; 533(1): 145 - 154. [Abstract] [Full Text] [PDF]

				J.-M. Pei, J.-J. Zhou, J.-S. Bian, X.-C. Yu, M.-L. Fung, and T.-M. Wong Impaired [Ca2+]i and pHi responses to kappa -opioid receptor stimulation in the heart of chronically hypoxic rats Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1483 - C1494. [Abstract] [Full Text] [PDF]

				H.-G. Shin, J. V. Barnett, P. Chang, S. Reddy, D. C. Drinkwater, R. N. Pierson, R. G. Wiley, and K. T. Murray Molecular heterogeneity of protein kinase C expression in human ventricle Cardiovasc Res, November 1, 2000; 48(2): 285 - 299. [Abstract] [Full Text] [PDF]

				J. R. Hume, D. Duan, M. L. Collier, J. Yamazaki, and B. Horowitz Anion Transport in Heart Physiol Rev, January 1, 2000; 80(1): 31 - 81. [Abstract] [Full Text] [PDF]

				Y Shimoni Protein kinase C regulation of K+ currents in rat ventricular myocytes and its modification by hormonal status J. Physiol., October 15, 1999; 520(2): 439 - 449. [Abstract] [Full Text] [PDF]

				X. Meng, B. D. Shames, E. J. Pulido, D. R. Meldrum, L. Ao, K. S. Joo, A. H. Harken, and A. Banerjee Adrenergic induction of bimodal myocardial protection: signal transduction and cardiac gene reprogramming Am J Physiol Regulatory Integrative Comp Physiol, May 1, 1999; 276(5): R1525 - R1533. [Abstract] [Full Text] [PDF]

				H. F. Clemo, B. S. Stambler, and C. M. Baumgarten Swelling-Activated Chloride Current Is Persistently Activated in Ventricular Myocytes From Dogs With Tachycardia-Induced Congestive Heart Failure Circ. Res., February 5, 1999; 84(2): 157 - 165. [Abstract] [Full Text] [PDF]

				N. Bowling, R. A. Walsh, G. Song, T. Estridge, G. E. Sandusky, R. L. Fouts, K. Mintze, T. Pickard, R. Roden, M. R. Bristow, et al. Increased Protein Kinase C Activity and Expression of Ca2+-Sensitive Isoforms in the Failing Human Heart Circulation, January 26, 1999; 99(3): 384 - 391. [Abstract] [Full Text] [PDF]

				T. Kameyama, Z. Chen, S. P. Bell, P. VanBuren, D. Maughan, and M. M. LeWinter Mechanoenergetic Alterations During the Transition From Cardiac Hypertrophy to Failure in Dahl Salt-Sensitive Rats Circulation, December 22, 1998; 98(25): 2919 - 2929. [Abstract] [Full Text] [PDF]

				B. Z. Simkhovich, K. Przyklenk, and R. A. Kloner Role of protein kinase C as a cellular mediator of ischemic preconditioning: a critical review Cardiovasc Res, October 1, 1998; 40(1): 9 - 22. [Abstract] [Full Text] [PDF]

				M. Suzuki, N. Ohte, Z.-M. Wang, D. L. Williams Jr., W. C. Little, and C.-P. Cheng Altered inotropic response of endothelin-1 in cardiomyocytes from rats with isoproterenol-induced cardiomyopathy Cardiovasc Res, September 1, 1998; 39(3): 589 - 599. [Abstract] [Full Text] [PDF]

				H. Yonemochi, S. Yasunaga, Y. Teshima, T. Iwao, K. Akiyoshi, M. Nakagawa, T. Saikawa, and M. Ito Mechanism of ß-Adrenergic Receptor Upregulation Induced by ACE Inhibition in Cultured Neonatal Rat Cardiac Myocytes : Roles of Bradykinin and Protein Kinase C Circulation, June 9, 1998; 97(22): 2268 - 2273. [Abstract] [Full Text] [PDF]

				M. van Bilsen Signal transduction revisited: recent developments in angiotensin II signaling in the cardiovascular system Cardiovasc Res, December 1, 1997; 36(3): 310 - 322. [Full Text] [PDF]

				P. Ping, J. Zhang, Y. Qiu, X.-L. Tang, S. Manchikalapudi, X. Cao, and R. Bolli Ischemic Preconditioning Induces Selective Translocation of Protein Kinase C Isoforms {epsilon} and {eta} in the Heart of Conscious Rabbits Without Subcellular Redistribution of Total Protein Kinase C Activity Circ. Res., September 19, 1997; 81(3): 404 - 414. [Abstract] [Full Text]

				M.A. Hassan Talukder and M. Endoh Differential Effects of Protein Kinase C Activators and Inhibitors on {alpha}- and {beta}-Adrenoceptor-mediated Positive Inotropic Effect in Isolated Rabbit Papillary Muscle Journal of Cardiovascular Pharmacology and Therapeutics, January 1, 1997; 2(3): 159 - 169. [Abstract] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Rouet-Benzineb, P. Articles by Crozatier, B. Search for Related Content PubMed PubMed Citation Articles by Rouet-Benzineb, P. Articles by Crozatier, B.