This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Colbert, M. C. Articles by Robbins, J. Search for Related Content PubMed PubMed Citation Articles by Colbert, M. C. Articles by Robbins, J.

(Circulation Research. 1996;78:790-798.)
© 1996 American Heart Association, Inc.

Articles

Endogenous Retinoic Acid Signaling Colocalizes With Advanced Expression of the Adult Smooth Muscle Myosin Heavy Chain Isoform During Development of the Ductus Arteriosus

Melissa C. Colbert, Margaret L. Kirby, Jeffrey Robbins

From the Department of Pediatrics, Division of Molecular Cardiovascular Biology, Children's Hospital Research Foundation, Children's Hospital Medical Center, Cincinnati, Ohio, and the Heart Development Group, Department of Cellular Biology and Anatomy, Medical College of Georgia, Augusta (M.L.K.).

Correspondence to Jeffrey Robbins, Department of Pediatrics, Division of Molecular Cardiovascular Biology, Children's Hospital Research Foundation, Children's Hospital Medical Center, 3333 Burnet Ave, Cincinnati, OH 45229. E-mail teachdna@aol.com.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract During fetal development, a specialized vessel, the ductus arteriosus, shunts blood from the pulmonary artery to the aorta, thus bypassing the lungs. The ductus differs primarily from the great vessels in that it is a muscular rather than an elastic artery, and the etiology of this differential development remains controversial. We present evidence that retinoic acid (RA) may contribute to the unique muscle phenotype of the ductus arteriosus. Using a transgenic mouse carrying an RA response element–lacZ transgene that expresses ß-galactosidase (ß-gal) in response to endogenous RA signals during embryonic and fetal development, we observe a strong ß-gal signal in the ductus arteriosus. By immunofluorescence, this signal colocalizes with the expression of the adult-specific smooth muscle myosin heavy chain isoform, SM2. The ß-gal signal is present throughout fetal development and persists in the neonate until the ductus arteriosus is completely closed. ß-Gal–positive cells are first detected by immunofluorescence at 13.5 days postcoitum (dpc) in the mesenchyme surrounding the ductus. By 15.5 dpc, very intense ß-gal staining localizes to the ductus arteriosus but is absent or minimal in the pulmonary trunk and aortic arch; by 17.5 dpc, the smooth muscle layers of the tunica media in the ductus arteriosus exhibit positive ß-gal staining. Immunostaining with antibodies against smooth muscle myosins shows that, while SM1 is expressed in all embryonic vessels, SM2 is precociously expressed in the ductus arteriosus. Furthermore, SM2 expression can be detected in the ductus as early as 15.5 dpc. In the neonate, the ß-gal signal persists in the smooth muscle layer of the ductus and immunostaining colocalizes with SM2 expression. These data suggest that RA may play a role in inducing and maintaining smooth muscle differentiation in the developing ductus arteriosus and may promote precocious expression of the adult vascular phenotype.

Key Words: retinoic acid • ductus arteriosus • smooth muscle myosin heavy chain • mouse • development

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The ductus arteriosus, a specialized embryonic vessel, shunts blood leaving the right side of the heart from the pulmonary trunk into the aorta and thus bypasses the lungs. Within hours of birth, the ductus begins to close via a two-step process. First, the smooth muscle layers of this remarkable vessel respond to changes in PO₂ and/or other physiological stimuli and contract vigorously.¹ Contraction brings the intimal swellings that narrow the lumen into apposition, occludes blood flow to the aorta, and establishes normal pulmonary circulation. Final anatomic closure involves fibrous replacement of the smooth muscle and transformation of the vessel into the ligamentum arteriosus.² Failure of the ductus to close properly compromises both cardiac and pulmonary function in the newborn and poses serious complications, especially in the preterm infant.³

The ductus differs from the other embryonic great vessels in that it is a muscular rather than an elastic artery. Histological differences are apparent early in fetal development, and fully differentiated smooth muscle cells containing prominent myofilaments are already present at birth.⁴ Expression of the adult-specific vascular smooth muscle myosin heavy chain isoform, SM2, is developmentally regulated and not detected in the aorta of the rabbit until nearly 3 weeks after birth.⁵ In contrast, SM2 is expressed in the ductus at term. In fact, this isoform is present in the rabbit ductus by 28 days of gestation.⁴ Thus, a precociously mature vascular smooth muscle phenotype is apparently established well before birth.

Although the muscular nature of the ductus is well characterized, the reasons for this unique phenotype and the signals for precocious smooth muscle differentiation are somewhat controversial. On the basis of observations by Le Livère and Le Douarin,⁶ De Ruiter et al⁷ speculated that the muscular character of the ductus may arise from mesoderm of mixed origins and hypothesized that the splanchnopleuric mesoderm, as well as the neural crest, may contribute mesenchymal cells to the pulmonary plexus and sixth arch progenitors of the ductus. Leonard et al⁸ proposed that mechanical support from the recurrent laryngeal branch of the vagus nerve allows for muscular differentiation of the ductus. Brezinka et al⁹ further speculated that neurotransmitters from the laryngeal nerve might provide signals for muscle differentiation, citing vagal innervation of the ductus in the lungfish.¹⁰ Consistent with this hypothesis, stimulation of the vagus in guinea pigs has been shown to induce contraction of the ductus arteriosus.¹¹

The association of vitamin A with development of the cardiovascular system has long been recognized in mammals; VAD produces a variety of aortic arch malformations.^{12 13} However, the molecular underpinnings of the effects of RA, the active metabolite of vitamin A, have only recently been elucidated. The actions of RA are mediated by two families of nuclear receptors, the RARs and the RXRs, both of which are members of the steroid hormone superfamily of receptors.^{14 15} The RARs and RXRs heterodimerize and function as ligand-activated transcription factors. Each family is composed of three different receptor subtypes, , ß, and , encoded by separate and distinct genes. The RXRs dimerize with a host of other related nuclear receptors as well, and it is this overall variety of receptor combinations that results in the pleiotropic actions of retinoids on cells and tissues.^{16 17} Recent ablation of RARs and RXRs by homologous recombination, furthermore, recapitulated the VAD-associated aortic arch anomalies described more than 40 years ago, which included absence of the ductus arteriosus.^{18 19 20} Therefore, RA may play a role in the development or maturation of the ductus.

We have evaluated retinoid signaling during cardiovascular development, using a transgenic mouse model that responds to a distinct subset of RA-mediated signals.^{21 22 23} RA-responsive genes contain elements with specific DNA sequence, RAREs, that bind the receptor dimers.¹⁵ These binding sites, generally located within the proximal promoter of a gene, provide an effective means for both positive and negative regulation of transcription via retinoid signals. Our transgene contains three copies of an RARE placed upstream of the herpes simplex virus thymidine kinase promoter/lacZ reporter gene.²¹ By exploiting these well-characterized interactions between RA-RAR/RXR trans-activators and a cis RARE to regulate the expression of a lacZ gene in response to endogenous RA, this model serves as an indicator of sites of RA signaling.

We have also examined the distribution of mRNA for RARs, RXRs, and other proteins involved in retinoid signaling by in situ hybridization in these transgenic animals.²² While these assays show distinct temporal- and spatial-expression patterns for specific receptors, we have found that this distribution alone is insufficient to predict the significance of any particular receptor in signaling or the likelihood of a retinoid-mediated response. This unpredictability is due to a variety of factors, including the apparent redundancy of the signaling system, the limitations on availability of endogenous RA, the characteristics of the responding genes, and the presence of other indeterminate factors (see References 22 and 24 for further discussion).

In this study, we present evidence that RA provides an endogenous signal that may contribute to smooth muscle differentiation and maturation during the development of the ductus arteriosus. The transgene is expressed specifically in the ductus arteriosus during embryonic, fetal, and early neonatal development. Furthermore, ß-gal–positive cells are present in the muscle of the tunica media of the ductus and appear coincident with expression of the mature SM2 myosin isoform, both in the fetus and in the neonate. These data suggest that RA may play a part in promoting and maintaining advanced smooth muscle differentiation in the developing ductus arteriosus.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Transgenic Animals
Transgenic mice used in this study were produced at the Duke University Comprehensive Cancer Center transgenic facility and housed under pathogen-free conditions. Timed pregnancies were obtained from overnight matings, and gestational ages were determined, after morning identification of a copulation plug, by taking noon as 0.5 dpc.

LacZ Staining
Embryos were prepared and processed for lacZ staining as previously described.^{21 22} Briefly, the thoracic viscera were removed from embryos and drop fixed in ice-cold 0.25% glutaraldehyde in PBS. Tissues were washed extensively with PBS and immersed in a PBS/substrate solution containing 2 mmol/L MgCl₂, 0.01% sodium desoxycholate, 0.02% NP-40, 4 mg/mL spermidine, 25 mmol/L potassium ferricyanide, 25 mmol/L potassium ferrocyanide, and 0.1% X-gal dissolved in dimethyl formamide. The reactions were allowed to proceed overnight in a humidified chamber at 30°C. The substrate was removed, and the samples were washed extensively with PBS and stored in 50% glycerol in PBS containing 0.01% sodium azide or were processed for sectioning.

For vibratome sections, lacZ-stained tissue was removed from fixative, rinsed with PBS, and embedded in 4% agar in PBS. Sections of 200 to 300 µm were cut on a Vibratome 1000 and placed into wells containing PBS. Photographs were taken on a Zeiss Photostereomicroscope. For frozen sections, the stained tissue was postfixed in 4% paraformaldehyde in PBS, infiltrated with sucrose, embedded in OCT, and frozen in isopentane cooled with liquid nitrogen. Twenty-five–µm sections were cut, air dried, and counterstained with fast red.²⁵

Immunohistochemistry
Transgenic embryos were identified for immunohistochemistry by PCR analysis using primers specific for ß-gal (5' primer, 5'TGGGGAATGAATCAGGCCACGG3', and 3' primer, 5'GCGTGGGCGTATTCGCCAAGGA3'). Midgestation embryos (13 to 15 dpc) were fixed in ice-cold freshly prepared 4% paraformaldehyde in 0.1 mol/L phosphate buffer, pH 7.2, containing 4% sucrose as previously described.^{22 23} They were then infiltrated with 30% sucrose at 4°C and embedded in 3.5% agar/4% sucrose. Agar blocks containing the embryos were cut and positioned in cryomolds, which were then filled with OCT embedding media. Unfixed fetal (17 dpc) or newborn tissues were sucrose infiltrated and placed into OCT-filled cryomolds. The blocks were frozen in isopentane cooled with liquid nitrogen for 2 minutes and stored at -80°C. Serial 10-µm sections were mounted onto Superfrost/Plus (Fisher) slides and processed for immunohistochemistry as previously described.

Sections were blocked in 2% BSA/10% normal goat serum in 0.1 mol/L phosphate buffer. Polyclonal rabbit antibodies against ß-gal (1:500, provided by Dr J.R. Sanes, Washington University School of Medicine, St Louis, Mo) and smooth muscle myosin heavy chain isoform SM1 (1:150, provided by Dr A.F. Martin, University of Illinois at Chicago) or SM2 (1:100, provided by Dr M. Periasamy, University of Cincinnati, Ohio) were diluted in blocking solution and applied to sections at room temperature for 2 hours. After three PBS washes of 10 minutes each, Texas red–conjugated goat anti-rabbit secondary antibody (1:100 in blocking solution, Vector, Inc) was used to detect primary antibody reactivity. Sections were photographed using an Olympus BH2-RFCA microscope equipped for epifluorescence.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Retinoic Acid Signaling in the Ductus Arteriosus at Midgestation
In previous studies, we have used a transgenic mouse model to examine the spatial and temporal patterns of endogenous retinoid signaling during embryonic development.^{21 22 23} Given the strong association between RA and cardiovascular development,^{12 13} we wished to determine when and where RA signaling could be detected during development of the heart. Examination of the cardiovascular system of transgenic embryos at 15.5 and 17.5 dpc revealed ß-gal–positive cells in the developing myocardium (M.C.C. and J.R., unpublished data, 1996), as well as prominent ß-gal staining specifically in the ductus arteriosus (Fig 1A).

View larger version (99K): [in this window] [in a new window]   Figure 1. RA-mediated ß-gal staining is prominent in the ductus arteriosus at midgestation and during fetal development. Whole hearts from 15.5- and 17.5-dpc embryos were fixed in glutaraldehyde and incubated overnight in substrate (X-gal) for ß-gal. A, Anterior view of 15.5- (left) and 17.5-dpc (right) whole hearts shows positive ß-gal reactions in cells of the myocardium and in the ductus arteriosus (arrows). B, The surrounding tissue was dissected away from the great vessels and the left atrium removed to expose the ductus arteriosus of a 15.5-dpc embryo. The ductus (arrow) shows strong ß-gal expression, with the staining bounded superiorly by the aorta and inferiorly by the pulmonary artery. The view is of the posterior aspect, from the left side. Ao indicates aorta; bca, brachiocephalic artery; lcc, left common carotid; Pt, pulmonary trunk; ra, right atrium; rcc, right common carotid; and rsa, right subclavian artery.

To examine the specificity of the staining pattern in the ductus, the connective tissue was carefully dissected away and the great vessels with their collateral arteries were exposed. The region of intensely positive cells was restricted to the ductus arteriosus, although patches of ß-gal–positive cells were also scattered across the surface of the arch of the aorta, as well as on the pulmonary trunk (Fig 1B). This distinctive staining pattern of the ductus was also apparent at 14.5 dpc (not shown). ß-gal–positive cells could also be detected in whole stained embryos in the loose mesenchyme surrounding the ductus arteriosus as early as 12.5 dpc.

By 13.5 dpc, the ductus arteriosus, derived from the left sixth aortic arch, is a large artery with a lumenal diameter equal to that of the aorta.²⁶ At this developmental stage, the tunica media surrounding the main thoracic arteries in rodents is well formed.²⁷ To examine the distribution and specific localization of the ß-gal–positive cells, we analyzed the pattern of ß-gal immunostaining on frozen sections of 13.5- and 15.5-dpc embryos (Fig 2). On transverse section, the antibody detected ß-gal–positive cells in the thick circular layers of mesenchyme surrounding the ductus and the arch of the aorta (Fig 2A). Occasional ß-gal–positive cells were also seen in the pulmonary trunk and the aorta distal to the aortic valves. These stained cells in the great vessels were few in number and only observed during midgestation. A coronal section at 15.5 days of gestation showed ß-gal–positive cells in the loose mesenchyme surrounding the ductus, as well as in the condensed circular layers of mesenchyme in the tunica media (Fig 2B).

View larger version (98K): [in this window] [in a new window]   Figure 2. Indirect immunofluorescence shows that ß-gal–positive cells surround the developing ductus and invade the forming tunica media during midgestation. Frozen sections of 13.5-dpc (A) and 15.5-dpc (B) embryos were immunostained with a polyclonal antibody against bacterial ß-gal. A, ß-Gal–positive (white) cells are first observed in the thick circular layers of mesenchymal cells surrounding the ductus arteriosus at 13.5 dpc. B, At 15.5 dpc, the ß-gal–positive cells are prominent in the mesenchyme and throughout the tunica media of the ductus. Ao indicates aorta; d, ductus arteriosus; e, esophagus; pa, left pulmonary artery; Pt, pulmonary trunk; and t, trachea. Arrowheads indicate region of tunica media. Bar=100 µm.

Localization of the ß-Gal Signal in the Fetal and Neonatal Ductus to the Medial Layer
In situ staining of fetal and neonatal hearts for ß-gal showed that retinoid signaling persists in the ductus throughout the late stages of development and into early neonatal life (Fig 3). At 17.5 dpc, ß-gal staining of the ductus remained as intense as at 15.5 dpc and appeared as a darkly stained circumferential ring when transected and viewed on end (Fig 3A). To determine the cellular location of the ß-gal signal more clearly, stained, postfixed viscera were sectioned and counterstained with neutral red. On longitudinal and cross section, the ß-gal signal was absolutely restricted to the tunica media within the ductus (Fig 3B and 3C).

View larger version (81K): [in this window] [in a new window]   Figure 3. ß-Gal staining associates with the smooth muscle in the tunica media of the ductus arteriosus through fetal and into early neonatal development. Thoracic viscera from 17.5-dpc (A through C) and newborn (D through F) mice were processed for ß-gal staining as described. Tissues were postfixed in 4% paraformaldehyde, infiltrated with sucrose, and processed for frozen (B, C) or vibratome (E, F) sections. The ductus remains intensely stained at both embryonic 17.5 dpc (A) and in newborns (D). At 17.5 dpc, a superior view into the lumen of the ductus arteriosus transected from the aorta shows that the ß-gal staining completely encircles the vessel (A). Transverse (B) and cross (C) sections of the ductus demonstrate that ß-gal staining is limited to the tunica media (B) and appears as spiral layers of intensely stained cells (C). In the newborn heart (D), the ductus has begun to constrict just proximal to the pulmonary trunk (arrow). Staining can be seen to extend laterally along the ventral side of the aorta, where the ductus intersects (arrowhead). E, Longitudinal section indicates that staining extends laterally along the ventral side of the aorta, where the ductus intersects (arrowhead), and is more intense distal to the pulmonary trunk at the region of constriction (arrow). F, Cross section shows that only the tunica media is ß-gal positive. Within this layer, the darkest-stained cells (arrow) are arranged in semicircular patterns around the lumen, suggesting the spiraling arrangement of smooth muscle cells. Ao indicates aorta; d, ductus arteriosus; e, esophagus; i, tunica intima; la, left atrium; lb, left bronchus; m, tunica media; pa, left pulmonary artery; Pt, pulmonary trunk; and t, trachea. Bar=200 µm.

In newborn animals, the ß-gal staining of the ductus was retained, although the intensity was somewhat diminished. At this stage, the ß-gal signal extended distally along the ventral surface of the aorta at the point of intersection (Fig 3D and 3E). In newborns less than 4 hours old, the ductus retained some patency but appeared to be more constricted just distal to the pulmonary trunk (Fig 3D and 3E). It has been reported in humans that the ductus initiates contraction at the pulmonary end, producing a so-called ductus bump.²⁸ Longitudinal thick sections suggested that staining may be more intense in this region proximal to the pulmonary trunk and slightly less intense distally, at the aorta. ß-Gal–positive cells were also seen to extend longitudinally, along the length of the ductus (Fig 3E). On cross section, only cells within the tunica media were ß-gal positive. In addition, some of the darkly stained cells appear to be spirally arranged around the lumen (Fig 3F). This combination of longitudinal and spiral ß-gal–positive cells is consistent with the arrangement of smooth muscle in the ductus.⁹ Examination of ß-gal expression in neonates at 72 hours after birth revealed that the ductus arteriosus was completely closed, forming the ligamentum arteriosum. Few if any ß-gal–positive cells were observed at this stage (data not shown).

Smooth Muscle Myosin Heavy Chain Expression in the Ductus Arteriosus
Several studies have shown that in rabbits, the smooth muscle cells of the ductus arteriosus express the mature myosin heavy chain isoform, SM2, and differentiate in advance of other thoracic arteries.^{4 29} To determine whether and when this advanced differentiation occurs in mice, we examined the distribution of SM1 and SM2 by immunofluorescence in the thoracic vasculature.

Immunostaining of 17.5-dpc embryo sections with anti-SM1 demonstrated that vascular smooth muscle myosin is present in all of the embryonic arteries, including the aorta, the pulmonary artery, and the subclavian artery (Fig 4A). A slightly more distal section stained with anti-SM2 showed immunoreactivity with the mature isoform only in the ductus (Fig 4B). Longitudinal sections of the ductus, which include its distal intersection with the arch of the aorta and proximal junction with the pulmonary artery, revealed that immunoreactivity with anti-SM2 is absolutely restricted to the ductus (Fig 4C). The staining boundary was extremely sharp and discrete, indicating that this more mature phenotype was restricted to the ductus and did not extend into either adjoining vessel at this developmental stage, although both esophageal and tracheobronchial smooth muscle were positive. To determine whether the SM2 isoform could be detected earlier, we examined the immunoreactivity of coronal sections of 15.5-dpc embryos. A serial section, slightly more distal to the one shown in Fig 2B, stained with anti-SM2 revealed that even at this stage, the mature myosin heavy chain isoform, SM2, was found in the tunica media of the ductus arteriosus (Fig 4D). Furthermore, these results suggested an overlap of expression between the RA-mediated ß-gal signal and expression of SM2.

View larger version (155K): [in this window] [in a new window]   Figure 4. Adult-specific smooth muscle myosin, SM2, is expressed in the ductus arteriosus from midgestation onward. Both 15.5-dpc embryos and 17.5-dpc fetuses were prepared for indirect immunofluorescence, and serial sections were stained with anti-SM1 and/or anti-SM2 polyclonal antibodies. Serial sections of nontransgenic mice at 17.5 dpc show that anti-SM1 reacts with all embryonic vessels (A), whereas SM2 immunostains only the ductus arteriosus (B). The section in A is slightly distal to that in B. C, A transverse section at 17.5 dpc shows the distal communication of the ductus arteriosus with the aorta and its proximal junction at the pulmonary trunk. SM2 immunoreactivity is restricted to the ductus arteriosus and shows little staining of either the aorta or pulmonary artery. The left subclavian artery is also not stained. D, On coronal sections of 15.5-dpc embryos cut from the same block as those shown in Fig 2B, the SM2 antibody reacts strongly with smooth muscle myosin in the ductus arteriosus and in the trachea and bronchi (arrow); the pulmonary arteries and aorta were not immunostained. Ao indicates aorta; d, ductus arteriosus; e, esophagus; l, lung; lcc, left common carotid; lsa, left subclavian artery; pa, pulmonary artery; Pt, pulmonary trunk; and t, trachea. Bar=100 µm.

Colocalization of RA Signal and Adult Vascular Smooth Muscle Myosin
To determine whether SM2 and ß-gal were coexpressed, we immunostained serial sections of the ductus in the newborn using each antibody. Longitudinal sections of the ductus showed that even in the newborn animal, anti-SM2 expression was more limited to the ductus (Fig 5A), whereas anti-SM1 recognized all the neonatal vasculature (data not shown; see also Reference 5). Similar to in situ staining for ß-gal on whole hearts, immunostaining of newborn hearts detected ß-gal reactivity in the ductus, which colocalized with SM2 reactivity (Fig 5B). Higher magnification showed that ß-gal immunoreactivity appeared to be in the smooth muscle of the tunica media (Fig 5C). We have previously reported that even in regions of intense ß-gal staining, every cell within that region may not be positive concomitantly for ß-gal.²² This cell-to-cell variability in signaling has been seen not only in transgenic mice but also with RAR ablation³⁰ and is a result of the dynamic and stochastic nature of the signaling mechanism (see Reference 22 for more detailed discussion). Nevertheless, these results show that RA signaling in the ductus arteriosus occurs in the smooth muscle and coincides temporally as well as spatially with the appearance of SM2, the mature smooth muscle myosin heavy chain isoform.

View larger version (76K): [in this window] [in a new window]   Figure 5. The ß-gal signal colocalizes with SM2 staining in the ductus arteriosus. Serial transverse sections of the ductus arteriosus from newborn hearts showing the connection between the arch of the aorta and the pulmonary trunk were processed for immunofluorescence with either anti-SM2 (A) or anti–ß-gal (B and C) antibodies. A, Positive staining for SM2 in the newborn is most intense in the ductus arteriosus, with little immunoreactivity in the adjacent arteries. B, Immunoreactivity with anti–ß-gal is restricted to the ductus. C, Higher magnification shows that the ß-gal signal is localized within the smooth muscle cells in the tunica media of the ductus. The section shown in B and C was cut deeper than that in A, and hence more of the intima and the lumen can be seen. Panel A was more superficial and oblique and consequently contains a higher proportion of muscle fibers obscuring the lumen. During processing, the aorta looped over to the right side and as a result is misaligned. Ao indicates aorta; Pt, pulmonary trunk. In A and B, bar=130 µm; in C, bar=260 µm.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Our data show a striking correlation between RA and the development of smooth muscle in the ductus arteriosus. RA signaling, as detected by RA-dependent expression of the ß-gal reporter gene, occurs in the developing ductus as early as 12.5 dpc and persists until after birth. This signal is localized in the smooth muscle layers of the tunica media and coincides with precocious expression of the adult vascular smooth muscle myosin SM2. These results suggest that RA may play a thus far unrecognized role in determining the unique phenotype and neonatal function of smooth muscle in the ductus arteriosus.

Origins of Smooth Muscle in the Ductus Arteriosus
The ductus arteriosus is derived from the left sixth aortic arch and can be identified in embryonic mice by 10.5 dpc.²⁶ We first observed evidence of RA signaling in the loose mesenchyme surrounding the developing ductus beginning at 12.5 dpc. The identity of these undifferentiated cells responding to the RA signals is not known; however, by 15.5 dpc they appear to exhibit a smooth muscle phenotype. While there are no definitive markers for murine neural crest, it seems likely these ß-gal–expressing cells may represent a subset of neural crest cells. The arterial derivatives of the aortic arches of the chick all arise from neural crest.^{6 31 32} Waldo and Kirby³³ have shown that only neural crest cells populate the sixth arch in birds, and these cells persist even in the later stages of development. Given the correlation between the strong and persistent retinoid signal we observe in the ductus and its neural crest composition, it is tempting to speculate that these ß-gal–expressing cells may constitute a distinct neural crest subset.

Neural crest cells represent a multipotential heterogeneous cell population subject to a variety of inductive signals all along their path of migration. Studies in both birds and mice by Ito and Sieber-Blum^{34 35} and Ito et al ³⁶ have identified several classes of progenitor subtypes whose progeny are variously restricted in their developmental capacity. Each subtype, from the least to the most developmentally restricted, includes smooth muscle cells among the final differentiated phenotypes. The data suggest that a temporally dependent lineage segregation of cells occurs such that final cell-type specification may not take place until the crest cells reach their ultimate destination.³⁵ Furthermore, Ito and Morita have shown in vitro that physiological concentrations of RA altered the developmental options of cranial neural crest cells.³⁷ The localization of a retinoid signal in the neural crest–derived mesenchyme surrounding the ductus suggests that RA may act as a signal influencing the differentiated phenotype.

RA and the Vascular Smooth Muscle Phenotype
We have shown that both the RA-mediated ß-gal signal and SM2, the mature isoform of vascular smooth muscle myosin, are coexpressed in the ductus arteriosus from late midgestation onward into neonatal life. Expression of smooth muscle myosin heavy chain is a stringent marker of the smooth muscle lineage and is temporally and spatially restricted to this tissue type in both embryos and adults.³⁸ Evidence from in vitro studies suggests that an RA signal can promote and maintain a differentiated smooth muscle phenotype. Cell lines with smooth muscle characteristics have been isolated from P19 embryonal carcinoma cells treated with RA.^{39 40} One clone recently isolated, 9E11G, expresses smooth muscle–specific myosin and -actin contractile proteins, as well as the mesodermally restricted homeoprotein MHox, but not myogenin or MyoD. Furthermore, cytosolic calcium levels in these cells change in response to a variety of agonists known to stimulate smooth muscle contraction.⁴¹ The significance of these results lies not in the fact that P19 cells can differentiate into smooth muscle but that RA is the inducing signal that produces this phenotype.

In addition to inducing a smooth muscle phenotype in multipotential cells, RA also maintains the differentiation status of cultured vascular smooth muscle. The plasticity of phenotype and ability to switch between proliferative and differentiated states are hallmarks of smooth muscle cells.^{42 43 44} In culture, RA inhibits smooth muscle proliferation and promotes the expression of differentiation-specific products such as -actin and protein kinase C-. These responses, which include morphological changes accompanied by an increase in stress fibers, all occur at physiological levels of RA.⁴⁵ These data, together with our evidence for endogenous retinoid signaling in the tunica media of the ductus, suggest that RA may play a role in promoting and/or maintaining the mature vascular smooth muscle phenotype of the ductus arteriosus.

Although we have observed SM2 expression in embryonic visceral smooth muscle, such as in the esophagus and bronchioles, we have seen no correlation in these tissues between an RA-mediated ß-gal signal and the presence of SM2. Thus, although RA is associated with the vascular smooth muscle phenotype and SM2 expression in the ductus, it does not appear to be a requirement for SM2 expression in all smooth muscle. While it is unknown whether RA influences the postnatal switch that occurs from SM1 to SM2 in maturing arteries or in the pregnant adult uterus, it is hoped that this study will prompt a more complete examination of these tissues.

Vitamin A Deficiency, Development of the Ductus Arteriosus, and the Preterm Infant
Although the need for adequate vitamin A levels during development of the aortic arches and their derivatives is well recognized,^{12 13} no association has been made specifically for the effects of VAD on the development of the ductus arteriosus. Our results, which show the presence of a strong, continuous retinoid-mediated signal in the ductus from midgestation through early neonatal life, suggest that this relationship warrants further attention. Although the targeted ablation of any individual RAR has no apparent effect on cardiovascular development,^{19 30 46 47 48} a careful examination of the literature shows that compound null mutants, which eliminate two or more receptor isoforms, display the phenotypic cardiovascular abnormalities associated with VAD, including in some cases a complete absence of the ductus arteriosus.^{18 19} Since this phenotype is frequently associated with persistent truncus arteriosus, it has been assumed that hemodynamic changes and reduced blood flow through the ductus result in an involution of the sixth arch derivative.⁴⁹ In light of our finding, a continuous RA-RAR/RXR–mediated signal in the neural crest–derived media may be important for maintenance of the ductus, as well as for the appropriate development of the great vessels.

Adequate vitamin A levels and RA signals may also play a role in the function of the ductus. Failure of the smooth muscle layers of the ductus to contract forcefully in response to environmental changes at birth results in a PDA. Given the association we see between the RA-mediated signal and the mature smooth muscle phenotype of the ductus, as well as the role RA plays in vitro in maintaining the phenotype of vascular cultures, one might speculate that VAD could correlate with PDA in the newborn and more importantly in the preterm infant. This condition, relatively common in very low–birth weight infants,⁵⁰ has also been associated with a genetic predisposition in dogs, where it has been linked with decreased smooth muscle content in the ductus.⁵¹ While most infants with PDA have apparently normal medial musculature, the maturity of the muscle, ie, the level of SM2 expression, in very low–birth weight infants and its ability to sustain contractions has yet to be examined. PDA, respiratory distress associated with lung immaturity, and bronchopulmonary dysplasia are often concomitant findings.^{52 53} It is of interest that the vitamin A status of the preterm infant has been used to evaluate susceptibility to bronchopulmonary dysplasia.^{54 55} Those infants who present with VAD at birth appear to be at higher risk for developing chronic lung disease.⁵⁶ If RA plays some role in establishing the mature phenotype of the vascular smooth muscle in the ductus, then VAD could potentially affect the function and response of ductal smooth muscle at birth. Our results suggest that examination of vitamin A levels in preterm infants with PDA may be of interest.

	Selected Abbreviations and Acronyms

 

ß-gal = ß-galactosidase dpc = days postcoitum PDA = patent ductus arteriosus RA = retinoic acid RAR(s) = RA receptor(s) RARE(s) = RA response element(s) RXR = retinoid X receptor VAD = vitamin A deficiency X-gal = 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside

	Acknowledgments

 
This work was supported by National Institutes of Health (NIH) grants HL-46826, HL-41496, HL-22619, and HL-52318 (Dr Robbins) and NIH grants HL-55904 and HL-41496 and American Heart Association, Ohio affiliate, grant SW-95-11 (Dr Colbert). We wish to thank Lisa Murray for animal care and technical assistance and Harriett Stadt for preparing vibratome sections.

Received November 29, 1995; accepted February 7, 1996.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Coceani F. Control of the ductus arteriosus: a new function for cytochrome P450, endothelin and nitric oxide. Biochem Pharmacol. 1994;48:1315-1318. [Medline] [Order article via Infotrieve]

2. Gittenberger-de Groot A. Morphology of the normal human ductus arteriosus. In: Heyman MA, Rudolph AM, eds. The Ductus Arteriosus: Ross Conferences on Pediatric Research. Columbus, Ohio: Ross Laboratories; 1979:3-9.

3. Corbet AJ. Medical manipulation of the ductus arteriosus. In: Garson A, Bricker JT, McNamara DG, eds. The Science and Practice of Pediatric Cardiology. Philadelphia, Pa: Lea & Febiger; 1990:2108-2125.

4. Kim HS, Aikawa M, Kimura K, Kuro-o M, Nakahara K, Suzuki T, Katoh H, Okamoto E, Yazaki Y, Nagai R. Ductus arteriosus: advanced differentiation of smooth muscle cells demonstrated by myosin heavy chain isoform expression in rabbits. Circulation. 1993;88:1804-1810. [Abstract/Free Full Text]

5. Kuro-o M, Nagai R, Tsuchimochi H, Katoh H, Yazaki Y, Ohkubo A, Takaku F. Developmentally regulated expression of vascular smooth muscle myosin heavy chain isoforms. J Biol Chem. 1989;264:18272-18275. [Abstract/Free Full Text]

6. Le Livère CS, Le Douarin NM. Mesenchymal derivatives of the neural crest: analysis of chimeric quail and chick embryos. J Embryol Exp Morphol. 1975;34:125-154. [Medline] [Order article via Infotrieve]

7. de Ruiter MC, Gittenberger-de Groot AC, Rammos S, Poelmann RE. The special status of the pulmonary arch artery in the branchial arch system of the rat. Anat Embryol (Berl). 1989;179:319-325. [Medline] [Order article via Infotrieve]

8. Leonard ME, Hutchins GM, Moore GW. Role of the vagus nerve and its recurrent laryngeal branch in the development of the human ductus arteriosus. Am J Anat. 1983;167:313-327. [Medline] [Order article via Infotrieve]

9. Brezinka C, Gittenberger-de Groot AC, Waldimiroff JW. The fetal ductus arteriosus: a review. Zentralbl Gynakol. 1993;115:423-432. [Medline] [Order article via Infotrieve]

10. Fishman AP, DeLaney RG, Laurent P. Circulatory adaptation to bimodal respiration in the dipnoan lungfish. J Appl Physiol. 1985;59:285-294. [Abstract/Free Full Text]

11. Barcroft J, Kennedy J, Mason MF. The relations of the vagus nerve to the ductus arteriosus in the guinea pig. J Physiol. 1938;92:1P-2P.

12. Wilson JG, Warkany J. Aortic-arch and cardiac anomalies in the offspring of vitamin A deficient rats. Am J Anat. 1949;85:113-155. [Medline] [Order article via Infotrieve]

13. Wilson JG, Roth CB, Warkany J. An analysis of the syndrome of malformations induced by maternal vitamin A deficiency: effects of restoration of vitamin A at various times during gestation. Am J Anat. 1953;92:189-217. [Medline] [Order article via Infotrieve]

14. Linney E. Retinoic acid receptors: transcription factors modulating gene regulation, development and differentiation. In: Pedersen RA, ed. Current Topics in Developmental Biology. San Diego, Calif: Academic Press; 1992:309-350.

15. Mangelsdorf DJ, Umesono K, Evans RM. The retinoid receptors. In: Sporn MB, Roberts AB, Goodman DS, eds. The Retinoids. 2nd ed. New York, NY: Raven Press; 1994:319-350.

16. Leid M, Kastner P, Chambon P. Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem Sci. 1992;17:427-433. [Medline] [Order article via Infotrieve]

17. Giguère V. Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signaling. Endocr Rev. 1994;15:61-79. [Abstract/Free Full Text]

18. Kastner P, Grondona JM, Mark M, Gansmuller A, LeMeur M, Decimo D, Vonesch JL, Dollé P, Chambon P. Genetic analysis of RXR developmental function: convergence of RXR and RAR signaling pathways in heart and eye morphogenesis. Cell. 1994;78:987-1003. [Medline] [Order article via Infotrieve]

19. Mendelsohn C, Lohnes D, Decimo D, Lufkin T, LeMeur M, Chambon P, Mark M. Function of the retinoic acid receptors (RARs) during development, II: multiple abnormalities at various stages of organogenesis in RAR double mutants. Development. 1994;120:2749-2771. [Abstract]

20. Sucov HM, Dyson E, Gumeringer CL, Price J, Chien KR, Evans RM. RXR mutant mice establish a genetic basis for vitamin A signaling in heart morphogenesis. Genes Dev. 1994;8:1007-1018. [Abstract/Free Full Text]

21. Balkan W, Colbert M, Bock C, Linney E. Transgenic indicator mice for studying activated retinoic acid receptors during development. Proc Natl Acad Sci U S A. 1992;89:3347-3351. [Abstract/Free Full Text]

22. Colbert MC, Rubin WW, Linney E, LaMantia A-S. Retinoid signaling and the generation of regional and cellular diversity in the embryonic mouse spinal cord. Dev Dyn. 1995;204:1-12. [Medline] [Order article via Infotrieve]

23. LaMantia A-S, Colbert MC, Linney E. Retinoic acid induction and regional differentiation prefigure olfactory pathway formation in the mammalian forebrain. Neuron. 1993;10:1035-1048. [Medline] [Order article via Infotrieve]

24. LaMantia A-S, Colbert MC, Linney E. Induction and the generation of regional and cellular diversity in the developing mammalian brain. In: Juurlink B, Kulyk W, Krone P, Verge V, Doucette R, eds. Neural Cell Specification: Molecular Mechanisms and Neurotherapeutic Implications. New York, NY: Plenum Press; 1995.

25. Zimmer A, Zimmer AM, Reynolds K. Tissue specific expression of the retinoic acid receptor-ß2: regulation by short open reading frames in the 5'-noncoding region. J Cell Biol. 1994;127:1111-1119. [Abstract/Free Full Text]

26. Kaufman MH. The Atlas of Mouse Development. London, England: Harcourt Brace Jovanovich; 1992.

27. De Ruiter MC, Poelmann RE, van Iperen L, Gittenberger-de Groot AC. The early development of the tunica media in the vascular system of rat embryos. Anat Embryol (Berl). 1990;181:341-349. [Medline] [Order article via Infotrieve]

28. Baden M, Kirks DR. Transient dilation of the ductus arteriosus: the ductus bump. J Pediatr. 1974;84:858-860. [Medline] [Order article via Infotrieve]

29. Matsuoka R, Sakurai H, Imamura S, Furutani Y, Takao A, Momma K. Changes in myosin heavy chain gene expression of rabbit ductus arteriosus smooth muscle during development and exposure to cyclic adenosine monophosphate. In: Clark EB, Markwald RR, Takao A, eds. Developmental Mechanisms of Heart Disease. Armonk, NY: Futura Publishing Co Inc; 1995:143-146.

30. Lohnes D, Kastner P, Dierich A, Mark M, LeMeur M, Chambon P. Function of retinoic acid receptor in the mouse. Cell. 1993;73:643-658. [Medline] [Order article via Infotrieve]

31. Noden DM. An analysis of the migratory behavior of avian cephalic neural crest cells. Dev Biol. 1975;96:144-165.

32. Miyagawa-Tomita S, Waldo K, Tomita H, Kirby ML. Temporospatial study of the migration and distribution of cardiac neural crest in quail-chick chimeras. Am J Anat. 1991;129:79-88.

33. Waldo KL, Kirby ML. Cardiac neural crest contribution to the pulmonary artery and sixth aortic arch artery complex in chick embryos aged 6 to 18 days. Anat Rec. 1993;237:385-399. [Medline] [Order article via Infotrieve]

34. Ito K, Sieber-Blum M. In vitro clonal analysis of quail cardiac neural crest development. Dev Biol. 1991;148:95-106. [Medline] [Order article via Infotrieve]

35. Ito K, Sieber-Blum M. Pluripotent and developmentally restricted neural crest–derived cells in posterior visceral arches. Dev Biol. 1993;156:191-200. [Medline] [Order article via Infotrieve]

36. Ito K, Morita T, Sieber-Blum M. In vitro clonal analysis of mouse neural crest development. Dev Biol. 1993;157:517-525. [Medline] [Order article via Infotrieve]

37. Ito K, Morita T. Role of retinoic acid in mouse neural crest cell development in vitro. Dev Dyn. 1995;204:211-218. [Medline] [Order article via Infotrieve]

38. Miano JM, Cserjisi P, Ligon KL, Periasamy M, Olson EN. Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis. Circ Res. 1994;75:803-812. [Abstract/Free Full Text]

39. Rudnicki MA, Reyhl KR, McBurney MW. Cell lines with developmental potential restricted to mesodermal lineages isolated from differentiation cultures of pluripotential P19 embryonal carcinoma cells. Development. 1989;107:361-372. [Abstract]

40. Rudnicki MA, Sawtell NM, Reuhl KR, Berg R, Craig JC, Jardine K, Lessard JL, McBurney MW. Smooth muscle actin expression during P19 embryonal carcinoma differentiation in cell culture. J Cell Physiol. 1990;142:89-98. [Medline] [Order article via Infotrieve]

41. Blank RS, Swartz EA, Thompson MM, Olson EN, Owens GK. A retinoic acid–induced clonal cell line derived from multipotential P19 embryonal carcinoma cells expresses smooth muscle characteristics. Circ Res. 1995;76:742-749. [Abstract/Free Full Text]

42. Chamley-Campbell J, Campbell GR, Ross R. The smooth muscle cell in culture. Physiol Rev. 1979;59:1-6. [Free Full Text]

43. Kocher O, Gabbiani G. Expression of actin mRNAs in rat aortic smooth muscle cells during development, experimental intimal thickening, and culture. Differentiation. 1990;32:289-298.

44. Thyberg J, Hedin U, Sjolund M, Palmberg L, Bottger B. Regulation of differentiated properties and proliferation of arterial smooth muscle cells. Arteriosclerosis. 1990;10:966-990. [Free Full Text]

45. Haller H, Lindschau C, Quass P, Distler A, Luft FC. Differentiation of vascular smooth muscle cells and the regulation of protein kinase C-. Circ Res. 1995;76:21-29. [Abstract/Free Full Text]

46. Li E, Sucov HM, Lee K-F, Evans RM, Jaenisch R. Normal development and growth of mice carrying a targeted disruption of the 1 retinoic acid receptor gene. Proc Natl Acad Sci U S A. 1993;90:1590-1594. [Abstract/Free Full Text]

47. Lufkin T, Lohnes D, Mark M, Dierich A, Gorry P, Gaub MP, LeMeur M, Chambon P. High postnatal lethality and testis degeneration in retinoic acid receptor mutant mice. Proc Natl Acad Sci U S A. 1993;90:7225-7229. [Abstract/Free Full Text]

48. Luo J, Pasceri P, Conlon RA, Rossant J, Giguère V. Mice lacking all isoforms of retinoic acid receptor ß develop normally and are susceptible to the teratogenic effects of retinoic acid. Mech Dev. 1995;53:61-67. [Medline] [Order article via Infotrieve]

49. Skandalakis JE, Gray SW, Symbas P. The thoracic and abdominal aorta. In: Skandalakis JE, Gray SW, eds. Embryology for Surgeons. 2nd ed. Baltimore, Md: Williams & Wilkins; 1994:796-1030.

50. Danilowicz D, Rudolph AM, Hoffman JIE. Delayed closure of the ductus arteriosus in premature infants. Pediatrics. 1966;57:74-78.

51. Patterson DF, Pyle RL, Buchanan JW, Trautvetter E, Abt DA. Hereditary patent ductus arteriosus and its sequelae in the dog. Circ Res. 1971;29:1-13. [Abstract/Free Full Text]

52. Clyman R. The role of patent ductus arteriosus in respiratory distress syndrome. Semin Perinatol. 1984;8:293-299. [Medline] [Order article via Infotrieve]

53. Dudell GG, Gersony WM. Patent ductus arteriosus in neonates with severe respiratory disease. J Pediatr. 1984;104:915-920. [Medline] [Order article via Infotrieve]

54. Shenai JP, Chytil F, Stahlman MT. Vitamin A status of neonates with bronchopulmonary dysplasia. Pediatr Res. 1985;19:185-188. [Medline] [Order article via Infotrieve]

55. Zachman RD. Retinol (vitamin A) and the neonate: special problems of the human premature infant. J Clin Nutr. 1989;50:413-424.

56. Hustead VA, Gutcher GR, Anderson SA, Zachman RD. Relationship of vitamin A (retinol) status to lung disease in the preterm infant. J Pediatr. 1984;105:610-615.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				U. Yokoyama, Y. Sato, T. Akaike, S. Ishida, J. Sawada, T. Nagao, H. Quan, M. Jin, M. Iwamoto, S. Yokota, et al. Maternal vitamin A alters gene profiles and structural maturation of the rat ductus arteriosus Physiol Genomics, September 11, 2007; 31(1): 139 - 157. [Abstract] [Full Text] [PDF]

				L. Kota, M. Osborne-Pellegrin, H. Schulz, J. Behmoaras, M. Coutard, M. Gong, and N. Hubner Quantitative genetic basis of arterial phenotypes in the Brown Norway rat Physiol Genomics, June 19, 2007; 30(1): 17 - 25. [Abstract] [Full Text] [PDF]

				P. Agren, A. L. Cogolludo, C. G. A. Kessels, F. Perez-Vizcaino, J. G. R. De Mey, C. E. Blanco, and E. Villamor Ontogeny of chicken ductus arteriosus response to oxygen and vasoconstrictors Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R485 - R496. [Abstract] [Full Text] [PDF]

				T. Nakamura, M. C. Colbert, and J. Robbins Neural Crest Cells Retain Multipotential Characteristics in the Developing Valves and Label the Cardiac Conduction System Circ. Res., June 23, 2006; 98(12): 1547 - 1554. [Abstract] [Full Text] [PDF]

				U. Yokoyama, S. Minamisawa, S. Adachi-Akahane, T. Akaike, I. Naguro, K. Funakoshi, M. Iwamoto, M. Nakagome, N. Uemura, H. Hori, et al. Multiple transcripts of Ca2+ channel {alpha}1-subunits and a novel spliced variant of the {alpha}1C-subunit in rat ductus arteriosus Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1660 - H1670. [Abstract] [Full Text] [PDF]

				S. A. R. Paiva, L. S. Matsubara, B. B. Matsubara, M. F. Minicucci, P. S. Azevedo, A. O. Campana, and L. A. M. Zornoff Retinoic Acid Supplementation Attenuates Ventricular Remodeling after Myocardial Infarction in Rats J. Nutr., October 1, 2005; 135(10): 2326 - 2328. [Abstract] [Full Text] [PDF]

				B. Thebaud, E. D. Michelakis, X.-C. Wu, R. Moudgil, M. Kuzyk, J. R.B. Dyck, G. Harry, K. Hashimoto, A. Haromy, I. Rebeyka, et al. Oxygen-Sensitive Kv Channel Gene Transfer Confers Oxygen Responsiveness to Preterm Rabbit and Remodeled Human Ductus Arteriosus: Implications for Infants With Patent Ductus Arteriosus Circulation, September 14, 2004; 110(11): 1372 - 1379. [Abstract] [Full Text] [PDF]

				S. A. R. de Paiva, L. A. M. Zornoff, M. P. Okoshi, K. Okoshi, L. S. Matsubara, B. B. Matsubara, A. C. Cicogna, and A. O. Campana Ventricular remodeling induced by retinoic acid supplementation in adult rats Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2242 - H2246. [Abstract] [Full Text] [PDF]

				J. M. Miano and B. C. Berk Retinoids : Versatile Biological Response Modifiers of Vascular Smooth Muscle Phenotype Circ. Res., September 1, 2000; 87(5): 355 - 362. [Full Text] [PDF]

				P. Neuville, M.-L. Bochaton-Piallat, and G. Gabbiani Retinoids and Arterial Smooth Muscle Cells Arterioscler. Thromb. Vasc. Biol., August 1, 2000; 20(8): 1882 - 1888. [Full Text] [PDF]

				S.-i. Imamura, T. Nishikawa, E. Hiratsuka, A. Takao, and R. Matsuoka Behavior of Smooth Muscle Cells during Arterial Ductal Closure at Birth J. Histochem. Cytochem., January 1, 2000; 48(1): 35 - 44. [Abstract] [Full Text]

				Q. Yang, A. Sanbe, H. Osinska, T. E. Hewett, R. Klevitsky, and J. Robbins In Vivo Modeling of Myosin Binding Protein C Familial Hypertrophic Cardiomyopathy Circ. Res., October 29, 1999; 85(9): 841 - 847. [Abstract] [Full Text] [PDF]

				M. Bergwerff, M. C. DeRuiter, S. Hall, R. E. Poelmann, and A. C. Gittenberger-de Groot Unique vascular morphology of the fourth aortic arches: possible implications for pathogenesis of type-B aortic arch interruption and anomalous right subclavian artery Cardiovasc Res, October 1, 1999; 44(1): 185 - 196. [Abstract] [Full Text] [PDF]

				T. Christen, M.-L. Bochaton-Piallat, P. Neuville, S. Rensen, M. Redard, G. van Eys, and G. Gabbiani Cultured Porcine Coronary Artery Smooth Muscle Cells : A New Model With Advanced Differentiation Circ. Res., July 9, 1999; 85(1): 99 - 107. [Abstract] [Full Text] [PDF]

				P. Neuville, Z.-q Yan, A. Gidlof, M. S. Pepper, G. K. Hansson, G. Gabbiani, and A. Sirsjo Retinoic Acid Regulates Arterial Smooth Muscle Cell Proliferation and Phenotypic Features In Vivo and In Vitro Through an RAR{alpha}-Dependent Signaling Pathway Arterioscler. Thromb. Vasc. Biol., June 1, 1999; 19(6): 1430 - 1436. [Abstract] [Full Text] [PDF]

				Y. Arens, R. A. Chapados, B. E. Cox, K. E. Kamm, and C. R. Rosenfeld Differential development of umbilical and systemic arteries. II. Contractile proteins Am J Physiol Regulatory Integrative Comp Physiol, June 1, 1998; 274(6): R1815 - R1823. [Abstract] [Full Text] [PDF]

				G. C. S. Smith The Pharmacology of the Ductus Arteriosus Pharmacol. Rev., March 1, 1998; 50(1): 35 - 58. [Abstract] [Full Text] [PDF]

				R. Searcy, E. Vincent, C. Liberatore, and K. Yutzey A GATA-dependent nkx-2.5 regulatory element activates early cardiac gene expression in transgenic mice Development, January 11, 1998; 125(22): 4461 - 4470. [Abstract] [PDF]

				S. Sartore, A. Chiavegato, R. Franch, E. Faggin, and P. Pauletto Myosin Gene Expression and Cell Phenotypes in Vascular Smooth Muscle During Development, in Experimental Models, and in Vascular Disease Arterioscler. Thromb. Vasc. Biol., July 1, 1997; 17(7): 1210 - 1215. [Abstract] [Full Text]

				J. Gulick, T. E. Hewett, R. Klevitsky, S. H. Buck, R. L. Moss, and J. Robbins Transgenic Remodeling of the Regulatory Myosin Light Chains in the Mammalian Heart Circ. Res., May 19, 1997; 80(5): 655 - 664. [Abstract] [Full Text]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Colbert, M. C. Articles by Robbins, J. Search for Related Content PubMed PubMed Citation Articles by Colbert, M. C. Articles by Robbins, J.