Articles |
From the Department of Pediatrics, Division of Molecular Cardiovascular Biology, Children's Hospital Research Foundation, Children's Hospital Medical Center, Cincinnati, Ohio, and the Heart Development Group, Department of Cellular Biology and Anatomy, Medical College of Georgia, Augusta (M.L.K.).
Correspondence to Jeffrey Robbins, Department of Pediatrics, Division of Molecular Cardiovascular Biology, Children's Hospital Research Foundation, Children's Hospital Medical Center, 3333 Burnet Ave, Cincinnati, OH 45229. E-mail teachdna@aol.com.
| Abstract |
|---|
|
|
|---|
Key Words: retinoic acid ductus arteriosus smooth muscle myosin heavy chain mouse development
| Introduction |
|---|
|
|
|---|
The ductus differs from the other embryonic great vessels in that it is a muscular rather than an elastic artery. Histological differences are apparent early in fetal development, and fully differentiated smooth muscle cells containing prominent myofilaments are already present at birth.4 Expression of the adult-specific vascular smooth muscle myosin heavy chain isoform, SM2, is developmentally regulated and not detected in the aorta of the rabbit until nearly 3 weeks after birth.5 In contrast, SM2 is expressed in the ductus at term. In fact, this isoform is present in the rabbit ductus by 28 days of gestation.4 Thus, a precociously mature vascular smooth muscle phenotype is apparently established well before birth.
Although the muscular nature of the ductus is well characterized, the reasons for this unique phenotype and the signals for precocious smooth muscle differentiation are somewhat controversial. On the basis of observations by Le Livère and Le Douarin,6 De Ruiter et al7 speculated that the muscular character of the ductus may arise from mesoderm of mixed origins and hypothesized that the splanchnopleuric mesoderm, as well as the neural crest, may contribute mesenchymal cells to the pulmonary plexus and sixth arch progenitors of the ductus. Leonard et al8 proposed that mechanical support from the recurrent laryngeal branch of the vagus nerve allows for muscular differentiation of the ductus. Brezinka et al9 further speculated that neurotransmitters from the laryngeal nerve might provide signals for muscle differentiation, citing vagal innervation of the ductus in the lungfish.10 Consistent with this hypothesis, stimulation of the vagus in guinea pigs has been shown to induce contraction of the ductus arteriosus.11
The association of vitamin A with development of the
cardiovascular system has long been recognized in
mammals; VAD produces a variety of aortic arch
malformations.12 13 However, the molecular underpinnings
of the effects of RA, the active metabolite of vitamin A, have only
recently been elucidated. The actions of RA are mediated by two
families of nuclear receptors, the RARs and the RXRs, both of which are
members of the steroid hormone superfamily of
receptors.14 15 The RARs and RXRs heterodimerize and
function as ligand-activated transcription factors. Each
family is composed of three different receptor subtypes,
, ß, and
, encoded by separate and distinct genes. The RXRs dimerize with a
host of other related nuclear receptors as well, and it is this overall
variety of receptor combinations that results in the pleiotropic
actions of retinoids on cells and tissues.16 17 Recent
ablation of RARs and RXRs by homologous recombination, furthermore,
recapitulated the VAD-associated aortic arch anomalies described more
than 40 years ago, which included absence of the ductus
arteriosus.18 19 20 Therefore, RA may play a role in the
development or maturation of the ductus.
We have evaluated retinoid signaling during cardiovascular development, using a transgenic mouse model that responds to a distinct subset of RA-mediated signals.21 22 23 RA-responsive genes contain elements with specific DNA sequence, RAREs, that bind the receptor dimers.15 These binding sites, generally located within the proximal promoter of a gene, provide an effective means for both positive and negative regulation of transcription via retinoid signals. Our transgene contains three copies of an RARE placed upstream of the herpes simplex virus thymidine kinase promoter/lacZ reporter gene.21 By exploiting these well-characterized interactions between RA-RAR/RXR trans-activators and a cis RARE to regulate the expression of a lacZ gene in response to endogenous RA, this model serves as an indicator of sites of RA signaling.
We have also examined the distribution of mRNA for RARs, RXRs, and other proteins involved in retinoid signaling by in situ hybridization in these transgenic animals.22 While these assays show distinct temporal- and spatial-expression patterns for specific receptors, we have found that this distribution alone is insufficient to predict the significance of any particular receptor in signaling or the likelihood of a retinoid-mediated response. This unpredictability is due to a variety of factors, including the apparent redundancy of the signaling system, the limitations on availability of endogenous RA, the characteristics of the responding genes, and the presence of other indeterminate factors (see References 22 and 24 for further discussion).
In this study, we present evidence that RA provides an endogenous signal that may contribute to smooth muscle differentiation and maturation during the development of the ductus arteriosus. The transgene is expressed specifically in the ductus arteriosus during embryonic, fetal, and early neonatal development. Furthermore, ß-galpositive cells are present in the muscle of the tunica media of the ductus and appear coincident with expression of the mature SM2 myosin isoform, both in the fetus and in the neonate. These data suggest that RA may play a part in promoting and maintaining advanced smooth muscle differentiation in the developing ductus arteriosus.
| Materials and Methods |
|---|
|
|
|---|
LacZ Staining
Embryos were prepared and processed for lacZ staining
as previously described.21 22 Briefly, the thoracic
viscera were removed from embryos and drop fixed in ice-cold 0.25%
glutaraldehyde in PBS. Tissues were washed extensively
with PBS and immersed in a PBS/substrate solution containing 2 mmol/L
MgCl2, 0.01% sodium desoxycholate, 0.02% NP-40, 4
mg/mL spermidine, 25 mmol/L potassium ferricyanide, 25 mmol/L potassium
ferrocyanide, and 0.1% X-gal dissolved in dimethyl formamide. The
reactions were allowed to proceed overnight in a humidified chamber at
30°C. The substrate was removed, and the samples were washed
extensively with PBS and stored in 50% glycerol in PBS containing
0.01% sodium azide or were processed for sectioning.
For vibratome sections, lacZ-stained tissue was removed from fixative, rinsed with PBS, and embedded in 4% agar in PBS. Sections of 200 to 300 µm were cut on a Vibratome 1000 and placed into wells containing PBS. Photographs were taken on a Zeiss Photostereomicroscope. For frozen sections, the stained tissue was postfixed in 4% paraformaldehyde in PBS, infiltrated with sucrose, embedded in OCT, and frozen in isopentane cooled with liquid nitrogen. Twenty-fiveµm sections were cut, air dried, and counterstained with fast red.25
Immunohistochemistry
Transgenic embryos were identified for immunohistochemistry by
PCR analysis using primers specific for ß-gal (5' primer,
5'TGGGGAATGAATCAGGCCACGG3', and 3' primer, 5'GCGTGGGCGTATTCGCCAAGGA3').
Midgestation embryos (13 to 15 dpc) were fixed in ice-cold freshly
prepared 4% paraformaldehyde in 0.1 mol/L phosphate
buffer, pH 7.2, containing 4% sucrose as previously
described.22 23 They were then infiltrated with 30%
sucrose at 4°C and embedded in 3.5% agar/4% sucrose. Agar blocks
containing the embryos were cut and positioned in cryomolds, which were
then filled with OCT embedding media. Unfixed fetal (17 dpc) or newborn
tissues were sucrose infiltrated and placed into OCT-filled cryomolds.
The blocks were frozen in isopentane cooled with liquid nitrogen for 2
minutes and stored at -80°C. Serial 10-µm sections were
mounted onto Superfrost/Plus (Fisher) slides and processed for
immunohistochemistry as previously described.
Sections were blocked in 2% BSA/10% normal goat serum in 0.1 mol/L phosphate buffer. Polyclonal rabbit antibodies against ß-gal (1:500, provided by Dr J.R. Sanes, Washington University School of Medicine, St Louis, Mo) and smooth muscle myosin heavy chain isoform SM1 (1:150, provided by Dr A.F. Martin, University of Illinois at Chicago) or SM2 (1:100, provided by Dr M. Periasamy, University of Cincinnati, Ohio) were diluted in blocking solution and applied to sections at room temperature for 2 hours. After three PBS washes of 10 minutes each, Texas redconjugated goat anti-rabbit secondary antibody (1:100 in blocking solution, Vector, Inc) was used to detect primary antibody reactivity. Sections were photographed using an Olympus BH2-RFCA microscope equipped for epifluorescence.
| Results |
|---|
|
|
|---|
|
To examine the specificity of the staining pattern in the ductus, the
connective tissue was carefully dissected away and the great vessels
with their collateral arteries were exposed. The region of intensely
positive cells was restricted to the ductus arteriosus, although
patches of ß-galpositive cells were also scattered across
the surface of the arch of the aorta, as well as on the
pulmonary trunk (Fig 1B
). This distinctive staining pattern of
the ductus was also apparent at 14.5 dpc (not shown).
ß-galpositive cells could also be detected in whole stained
embryos in the loose mesenchyme surrounding the ductus arteriosus as
early as 12.5 dpc.
By 13.5 dpc, the ductus arteriosus, derived from the left sixth aortic
arch, is a large artery with a lumenal diameter equal to that of the
aorta.26 At this developmental stage, the tunica media
surrounding the main thoracic arteries in rodents is well
formed.27 To examine the distribution and specific
localization of the ß-galpositive cells, we
analyzed the pattern of ß-gal
immunostaining on frozen sections of 13.5- and 15.5-dpc
embryos (Fig 2
). On transverse section, the antibody
detected ß-galpositive cells in the thick circular layers
of mesenchyme surrounding the ductus and the arch of the aorta (Fig 2A
). Occasional ß-galpositive cells were also seen in the
pulmonary trunk and the aorta distal to the aortic valves.
These stained cells in the great vessels were few in number and only
observed during midgestation. A coronal section at 15.5 days of
gestation showed ß-galpositive cells in the loose
mesenchyme surrounding the ductus, as well as in the condensed
circular layers of mesenchyme in the tunica media (Fig 2B
).
|
Localization of the ß-Gal Signal in the Fetal and Neonatal Ductus
to the Medial Layer
In situ staining of fetal and neonatal hearts for ß-gal
showed that retinoid signaling persists in the ductus throughout the
late stages of development and into early neonatal life (Fig 3
). At 17.5 dpc, ß-gal staining of the ductus
remained as intense as at 15.5 dpc and appeared as a darkly stained
circumferential ring when transected and viewed on end (Fig 3A
). To
determine the cellular location of the ß-gal signal more clearly,
stained, postfixed viscera were sectioned and counterstained with
neutral red. On longitudinal and cross section, the ß-gal signal
was absolutely restricted to the tunica media within the ductus (Fig 3B
and 3C
).
|
In newborn animals, the ß-gal staining of the ductus was
retained, although the intensity was somewhat diminished. At this
stage, the ß-gal signal extended distally along the ventral
surface of the aorta at the point of intersection (Fig 3D
and 3E
). In
newborns less than 4 hours old, the ductus retained some patency but
appeared to be more constricted just distal to the pulmonary
trunk (Fig 3D
and 3E
). It has been reported in humans that the ductus
initiates contraction at the pulmonary end, producing a
so-called ductus bump.28 Longitudinal thick sections
suggested that staining may be more intense in this region proximal to
the pulmonary trunk and slightly less intense distally, at the
aorta. ß-Galpositive cells were also seen to extend
longitudinally, along the length of the ductus (Fig 3E
). On cross
section, only cells within the tunica media were ß-gal positive.
In addition, some of the darkly stained cells appear to be spirally
arranged around the lumen (Fig 3F
). This combination of longitudinal
and spiral ß-galpositive cells is consistent with
the arrangement of smooth muscle in the ductus.9
Examination of ß-gal expression in neonates at 72 hours after
birth revealed that the ductus arteriosus was completely closed,
forming the ligamentum arteriosum. Few if any
ß-galpositive cells were observed at this stage (data not
shown).
Smooth Muscle Myosin Heavy Chain Expression in the Ductus
Arteriosus
Several studies have shown that in rabbits, the smooth muscle
cells of the ductus arteriosus express the mature myosin heavy chain
isoform, SM2, and differentiate in advance of other thoracic
arteries.4 29 To determine whether and when this advanced
differentiation occurs in mice, we examined the distribution of SM1 and
SM2 by immunofluorescence in the thoracic
vasculature.
Immunostaining of 17.5-dpc embryo sections with
anti-SM1 demonstrated that vascular smooth muscle myosin is present
in all of the embryonic arteries, including the aorta, the
pulmonary artery, and the subclavian artery (Fig 4A
). A slightly more distal section stained with
anti-SM2 showed immunoreactivity with the mature isoform only in the
ductus (Fig 4B
). Longitudinal sections of the ductus, which include its
distal intersection with the arch of the aorta and proximal junction
with the pulmonary artery, revealed that immunoreactivity with
anti-SM2 is absolutely restricted to the ductus (Fig 4C
). The staining
boundary was extremely sharp and discrete, indicating that this more
mature phenotype was restricted to the ductus and did not
extend into either adjoining vessel at this developmental stage,
although both esophageal and tracheobronchial smooth muscle were
positive. To determine whether the SM2 isoform could be detected
earlier, we examined the immunoreactivity of coronal sections of
15.5-dpc embryos. A serial section, slightly more distal to the one
shown in Fig 2B
, stained with anti-SM2 revealed that even at this
stage, the mature myosin heavy chain isoform, SM2, was found in the
tunica media of the ductus arteriosus (Fig 4D
). Furthermore, these
results suggested an overlap of expression between the RA-mediated
ß-gal signal and expression of SM2.
|
Colocalization of RA Signal and Adult Vascular Smooth Muscle
Myosin
To determine whether SM2 and ß-gal were coexpressed, we
immunostained serial sections of the ductus in the newborn
using each antibody. Longitudinal sections of the ductus showed that
even in the newborn animal, anti-SM2 expression was more limited to the
ductus (Fig 5A
), whereas anti-SM1 recognized all the
neonatal vasculature (data not shown; see also Reference 5). Similar to
in situ staining for ß-gal on whole hearts,
immunostaining of newborn hearts detected ß-gal
reactivity in the ductus, which colocalized with SM2 reactivity (Fig 5B
). Higher magnification showed that ß-gal immunoreactivity
appeared to be in the smooth muscle of the tunica media (Fig 5C
). We
have previously reported that even in regions of intense ß-gal
staining, every cell within that region may not be positive
concomitantly for ß-gal.22 This cell-to-cell
variability in signaling has been seen not only in transgenic mice but
also with RAR ablation30 and is a result of the dynamic
and stochastic nature of the signaling mechanism (see Reference 22 for
more detailed discussion). Nevertheless, these results show that RA
signaling in the ductus arteriosus occurs in the smooth muscle and
coincides temporally as well as spatially with the appearance of SM2,
the mature smooth muscle myosin heavy chain isoform.
|
| Discussion |
|---|
|
|
|---|
Origins of Smooth Muscle in the Ductus Arteriosus
The ductus arteriosus is derived from the left sixth aortic arch
and can be identified in embryonic mice by 10.5 dpc.26 We
first observed evidence of RA signaling in the loose mesenchyme
surrounding the developing ductus beginning at 12.5 dpc. The identity
of these undifferentiated cells responding to the RA signals is not
known; however, by 15.5 dpc they appear to exhibit a smooth muscle
phenotype. While there are no definitive markers for murine
neural crest, it seems likely these ß-galexpressing cells
may represent a subset of neural crest cells. The
arterial derivatives of the aortic arches of the chick all
arise from neural crest.6 31 32 Waldo and
Kirby33 have shown that only neural crest cells populate
the sixth arch in birds, and these cells persist even in the later
stages of development. Given the correlation between the strong and
persistent retinoid signal we observe in the ductus and its neural
crest composition, it is tempting to speculate that these
ß-galexpressing cells may constitute a distinct neural
crest subset.
Neural crest cells represent a multipotential heterogeneous cell population subject to a variety of inductive signals all along their path of migration. Studies in both birds and mice by Ito and Sieber-Blum34 35 and Ito et al 36 have identified several classes of progenitor subtypes whose progeny are variously restricted in their developmental capacity. Each subtype, from the least to the most developmentally restricted, includes smooth muscle cells among the final differentiated phenotypes. The data suggest that a temporally dependent lineage segregation of cells occurs such that final cell-type specification may not take place until the crest cells reach their ultimate destination.35 Furthermore, Ito and Morita have shown in vitro that physiological concentrations of RA altered the developmental options of cranial neural crest cells.37 The localization of a retinoid signal in the neural crestderived mesenchyme surrounding the ductus suggests that RA may act as a signal influencing the differentiated phenotype.
RA and the Vascular Smooth Muscle Phenotype
We have shown that both the RA-mediated ß-gal signal and
SM2, the mature isoform of vascular smooth muscle myosin, are
coexpressed in the ductus arteriosus from late midgestation onward into
neonatal life. Expression of smooth muscle myosin heavy chain is a
stringent marker of the smooth muscle lineage and is temporally and
spatially restricted to this tissue type in both embryos and
adults.38 Evidence from in vitro studies suggests that an
RA signal can promote and maintain a differentiated smooth muscle
phenotype. Cell lines with smooth muscle characteristics have
been isolated from P19 embryonal carcinoma cells treated with
RA.39 40 One clone recently isolated, 9E11G, expresses
smooth musclespecific myosin and
-actin contractile
proteins, as well as the mesodermally restricted homeoprotein MHox, but
not myogenin or MyoD. Furthermore, cytosolic calcium levels in these
cells change in response to a variety of agonists known to stimulate
smooth muscle contraction.41 The significance of these
results lies not in the fact that P19 cells can differentiate into
smooth muscle but that RA is the inducing signal that produces this
phenotype.
In addition to inducing a smooth muscle phenotype in
multipotential cells, RA also maintains the differentiation status of
cultured vascular smooth muscle. The plasticity of phenotype
and ability to switch between proliferative and differentiated states
are hallmarks of smooth muscle cells.42 43 44 In culture, RA
inhibits smooth muscle proliferation and promotes the expression of
differentiation-specific products such as
-actin and
protein kinase C-
. These responses, which include morphological
changes accompanied by an increase in stress fibers, all occur at
physiological levels of RA.45 These
data, together with our evidence for endogenous retinoid
signaling in the tunica media of the ductus, suggest that RA may play a
role in promoting and/or maintaining the mature vascular smooth muscle
phenotype of the ductus arteriosus.
Although we have observed SM2 expression in embryonic visceral smooth muscle, such as in the esophagus and bronchioles, we have seen no correlation in these tissues between an RA-mediated ß-gal signal and the presence of SM2. Thus, although RA is associated with the vascular smooth muscle phenotype and SM2 expression in the ductus, it does not appear to be a requirement for SM2 expression in all smooth muscle. While it is unknown whether RA influences the postnatal switch that occurs from SM1 to SM2 in maturing arteries or in the pregnant adult uterus, it is hoped that this study will prompt a more complete examination of these tissues.
Vitamin A Deficiency, Development of the Ductus Arteriosus, and the
Preterm Infant
Although the need for adequate vitamin A levels during development
of the aortic arches and their derivatives is well
recognized,12 13 no association has been made specifically
for the effects of VAD on the development of the ductus arteriosus. Our
results, which show the presence of a strong, continuous
retinoid-mediated signal in the ductus from midgestation through
early neonatal life, suggest that this relationship warrants further
attention. Although the targeted ablation of any individual RAR has no
apparent effect on cardiovascular
development,19 30 46 47 48 a careful examination of the
literature shows that compound null mutants, which eliminate two or
more receptor isoforms, display the phenotypic
cardiovascular abnormalities associated with VAD,
including in some cases a complete absence of the ductus
arteriosus.18 19 Since this phenotype is
frequently associated with persistent truncus arteriosus, it has been
assumed that hemodynamic changes and reduced blood flow
through the ductus result in an involution of the sixth arch
derivative.49 In light of our finding, a continuous
RA-RAR/RXRmediated signal in the neural crestderived media may
be important for maintenance of the ductus, as well as for the
appropriate development of the great vessels.
Adequate vitamin A levels and RA signals may also play a role in the function of the ductus. Failure of the smooth muscle layers of the ductus to contract forcefully in response to environmental changes at birth results in a PDA. Given the association we see between the RA-mediated signal and the mature smooth muscle phenotype of the ductus, as well as the role RA plays in vitro in maintaining the phenotype of vascular cultures, one might speculate that VAD could correlate with PDA in the newborn and more importantly in the preterm infant. This condition, relatively common in very lowbirth weight infants,50 has also been associated with a genetic predisposition in dogs, where it has been linked with decreased smooth muscle content in the ductus.51 While most infants with PDA have apparently normal medial musculature, the maturity of the muscle, ie, the level of SM2 expression, in very lowbirth weight infants and its ability to sustain contractions has yet to be examined. PDA, respiratory distress associated with lung immaturity, and bronchopulmonary dysplasia are often concomitant findings.52 53 It is of interest that the vitamin A status of the preterm infant has been used to evaluate susceptibility to bronchopulmonary dysplasia.54 55 Those infants who present with VAD at birth appear to be at higher risk for developing chronic lung disease.56 If RA plays some role in establishing the mature phenotype of the vascular smooth muscle in the ductus, then VAD could potentially affect the function and response of ductal smooth muscle at birth. Our results suggest that examination of vitamin A levels in preterm infants with PDA may be of interest.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received November 29, 1995; accepted February 7, 1996.
| References |
|---|
|
|
|---|
2. Gittenberger-de Groot A. Morphology of the normal human ductus arteriosus. In: Heyman MA, Rudolph AM, eds. The Ductus Arteriosus: Ross Conferences on Pediatric Research. Columbus, Ohio: Ross Laboratories; 1979:3-9.
3. Corbet AJ. Medical manipulation of the ductus arteriosus. In: Garson A, Bricker JT, McNamara DG, eds. The Science and Practice of Pediatric Cardiology. Philadelphia, Pa: Lea & Febiger; 1990:2108-2125.
4.
Kim HS, Aikawa M, Kimura K, Kuro-o M, Nakahara K,
Suzuki T, Katoh H, Okamoto E, Yazaki Y, Nagai R. Ductus
arteriosus: advanced differentiation of smooth muscle cells
demonstrated by myosin heavy chain isoform expression in
rabbits. Circulation. 1993;88:1804-1810.
5.
Kuro-o M, Nagai R, Tsuchimochi H, Katoh H, Yazaki
Y, Ohkubo A, Takaku F. Developmentally regulated expression of
vascular smooth muscle myosin heavy chain isoforms.
J Biol Chem. 1989;264:18272-18275.
6. Le Livère CS, Le Douarin NM. Mesenchymal derivatives of the neural crest: analysis of chimeric quail and chick embryos. J Embryol Exp Morphol. 1975;34:125-154. [Medline] [Order article via Infotrieve]
7. de Ruiter MC, Gittenberger-de Groot AC, Rammos S, Poelmann RE. The special status of the pulmonary arch artery in the branchial arch system of the rat. Anat Embryol (Berl). 1989;179:319-325. [Medline] [Order article via Infotrieve]
8. Leonard ME, Hutchins GM, Moore GW. Role of the vagus nerve and its recurrent laryngeal branch in the development of the human ductus arteriosus. Am J Anat. 1983;167:313-327. [Medline] [Order article via Infotrieve]
9. Brezinka C, Gittenberger-de Groot AC, Waldimiroff JW. The fetal ductus arteriosus: a review. Zentralbl Gynakol. 1993;115:423-432. [Medline] [Order article via Infotrieve]
10.
Fishman AP, DeLaney RG, Laurent P. Circulatory
adaptation to bimodal respiration in the dipnoan lungfish.
J Appl Physiol. 1985;59:285-294.
11. Barcroft J, Kennedy J, Mason MF. The relations of the vagus nerve to the ductus arteriosus in the guinea pig. J Physiol. 1938;92:1P-2P.
12. Wilson JG, Warkany J. Aortic-arch and cardiac anomalies in the offspring of vitamin A deficient rats. Am J Anat. 1949;85:113-155. [Medline] [Order article via Infotrieve]
13. Wilson JG, Roth CB, Warkany J. An analysis of the syndrome of malformations induced by maternal vitamin A deficiency: effects of restoration of vitamin A at various times during gestation. Am J Anat. 1953;92:189-217. [Medline] [Order article via Infotrieve]
14. Linney E. Retinoic acid receptors: transcription factors modulating gene regulation, development and differentiation. In: Pedersen RA, ed. Current Topics in Developmental Biology. San Diego, Calif: Academic Press; 1992:309-350.
15. Mangelsdorf DJ, Umesono K, Evans RM. The retinoid receptors. In: Sporn MB, Roberts AB, Goodman DS, eds. The Retinoids. 2nd ed. New York, NY: Raven Press; 1994:319-350.
16. Leid M, Kastner P, Chambon P. Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem Sci. 1992;17:427-433. [Medline] [Order article via Infotrieve]
17.
Giguère V. Retinoic acid receptors and
cellular retinoid binding proteins: complex interplay in retinoid
signaling. Endocr Rev. 1994;15:61-79.
18.
Kastner P, Grondona JM, Mark M, Gansmuller A, LeMeur M,
Decimo D, Vonesch JL, Dollé P, Chambon P. Genetic
analysis of RXR
developmental function: convergence of RXR
and RAR signaling pathways in heart and eye morphogenesis.
Cell. 1994;78:987-1003. [Medline]
[Order article via Infotrieve]
19. Mendelsohn C, Lohnes D, Decimo D, Lufkin T, LeMeur M, Chambon P, Mark M. Function of the retinoic acid receptors (RARs) during development, II: multiple abnormalities at various stages of organogenesis in RAR double mutants. Development. 1994;120:2749-2771. [Abstract]
20.
Sucov HM, Dyson E, Gumeringer CL, Price J, Chien KR,
Evans RM. RXR
mutant mice establish a genetic basis for
vitamin A signaling in heart morphogenesis. Genes
Dev. 1994;8:1007-1018.
21.
Balkan W, Colbert M, Bock C, Linney E.
Transgenic indicator mice for studying activated retinoic acid
receptors during development. Proc Natl Acad Sci
U S A. 1992;89:3347-3351.
22. Colbert MC, Rubin WW, Linney E, LaMantia A-S. Retinoid signaling and the generation of regional and cellular diversity in the embryonic mouse spinal cord. Dev Dyn. 1995;204:1-12. [Medline] [Order article via Infotrieve]
23. LaMantia A-S, Colbert MC, Linney E. Retinoic acid induction and regional differentiation prefigure olfactory pathway formation in the mammalian forebrain. Neuron. 1993;10:1035-1048. [Medline] [Order article via Infotrieve]
24. LaMantia A-S, Colbert MC, Linney E. Induction and the generation of regional and cellular diversity in the developing mammalian brain. In: Juurlink B, Kulyk W, Krone P, Verge V, Doucette R, eds. Neural Cell Specification: Molecular Mechanisms and Neurotherapeutic Implications. New York, NY: Plenum Press; 1995.
25.
Zimmer A, Zimmer AM, Reynolds K. Tissue specific
expression of the retinoic acid receptor-ß2: regulation by short open
reading frames in the 5'-noncoding region. J
Cell Biol. 1994;127:1111-1119.
26. Kaufman MH. The Atlas of Mouse Development. London, England: Harcourt Brace Jovanovich; 1992.
27. De Ruiter MC, Poelmann RE, van Iperen L, Gittenberger-de Groot AC. The early development of the tunica media in the vascular system of rat embryos. Anat Embryol (Berl). 1990;181:341-349. [Medline] [Order article via Infotrieve]
28. Baden M, Kirks DR. Transient dilation of the ductus arteriosus: the ductus bump. J Pediatr. 1974;84:858-860. [Medline] [Order article via Infotrieve]
29. Matsuoka R, Sakurai H, Imamura S, Furutani Y, Takao A, Momma K. Changes in myosin heavy chain gene expression of rabbit ductus arteriosus smooth muscle during development and exposure to cyclic adenosine monophosphate. In: Clark EB, Markwald RR, Takao A, eds. Developmental Mechanisms of Heart Disease. Armonk, NY: Futura Publishing Co Inc; 1995:143-146.
30.
Lohnes D, Kastner P, Dierich A, Mark M, LeMeur M,
Chambon P. Function of retinoic acid receptor
in the
mouse. Cell. 1993;73:643-658. [Medline]
[Order article via Infotrieve]
31. Noden DM. An analysis of the migratory behavior of avian cephalic neural crest cells. Dev Biol. 1975;96:144-165.
32. Miyagawa-Tomita S, Waldo K, Tomita H, Kirby ML. Temporospatial study of the migration and distribution of cardiac neural crest in quail-chick chimeras. Am J Anat. 1991;129:79-88.
33. Waldo KL, Kirby ML. Cardiac neural crest contribution to the pulmonary artery and sixth aortic arch artery complex in chick embryos aged 6 to 18 days. Anat Rec. 1993;237:385-399. [Medline] [Order article via Infotrieve]
34. Ito K, Sieber-Blum M. In vitro clonal analysis of quail cardiac neural crest development. Dev Biol. 1991;148:95-106. [Medline] [Order article via Infotrieve]
35. Ito K, Sieber-Blum M. Pluripotent and developmentally restricted neural crestderived cells in posterior visceral arches. Dev Biol. 1993;156:191-200. [Medline] [Order article via Infotrieve]
36. Ito K, Morita T, Sieber-Blum M. In vitro clonal analysis of mouse neural crest development. Dev Biol. 1993;157:517-525. [Medline] [Order article via Infotrieve]
37. Ito K, Morita T. Role of retinoic acid in mouse neural crest cell development in vitro. Dev Dyn. 1995;204:211-218. [Medline] [Order article via Infotrieve]
38.
Miano JM, Cserjisi P, Ligon KL, Periasamy M, Olson
EN. Smooth muscle myosin heavy chain exclusively marks the
smooth muscle lineage during mouse embryogenesis.
Circ Res. 1994;75:803-812.
39. Rudnicki MA, Reyhl KR, McBurney MW. Cell lines with developmental potential restricted to mesodermal lineages isolated from differentiation cultures of pluripotential P19 embryonal carcinoma cells. Development. 1989;107:361-372. [Abstract]
40. Rudnicki MA, Sawtell NM, Reuhl KR, Berg R, Craig JC, Jardine K, Lessard JL, McBurney MW. Smooth muscle actin expression during P19 embryonal carcinoma differentiation in cell culture. J Cell Physiol. 1990;142:89-98. [Medline] [Order article via Infotrieve]
41.
Blank RS, Swartz EA, Thompson MM, Olson EN, Owens
GK. A retinoic acidinduced clonal cell line derived from
multipotential P19 embryonal carcinoma cells expresses smooth muscle
characteristics. Circ Res. 1995;76:742-749.
42.
Chamley-Campbell J, Campbell GR, Ross R. The
smooth muscle cell in culture. Physiol Rev. 1979;59:1-6.
43. Kocher O, Gabbiani G. Expression of actin mRNAs in rat aortic smooth muscle cells during development, experimental intimal thickening, and culture. Differentiation. 1990;32:289-298.
44.
Thyberg J, Hedin U, Sjolund M, Palmberg L, Bottger
B. Regulation of differentiated properties and proliferation of
arterial smooth muscle cells.
Arteriosclerosis. 1990;10:966-990.
45.
Haller H, Lindschau C, Quass P, Distler A, Luft
FC. Differentiation of vascular smooth muscle cells and the
regulation of protein kinase C-
. Circ
Res. 1995;76:21-29.
46.
Li E, Sucov HM, Lee K-F, Evans RM, Jaenisch R.
Normal development and growth of mice carrying a targeted disruption of
the
1 retinoic acid receptor gene. Proc
Natl Acad Sci U S A. 1993;90:1590-1594.
47.
Lufkin T, Lohnes D, Mark M, Dierich A, Gorry P, Gaub
MP, LeMeur M, Chambon P. High postnatal lethality and testis
degeneration in retinoic acid receptor
mutant mice.
Proc Natl Acad Sci U S A. 1993;90:7225-7229.
48. Luo J, Pasceri P, Conlon RA, Rossant J, Giguère V. Mice lacking all isoforms of retinoic acid receptor ß develop normally and are susceptible to the teratogenic effects of retinoic acid. Mech Dev. 1995;53:61-67. [Medline] [Order article via Infotrieve]
49. Skandalakis JE, Gray SW, Symbas P. The thoracic and abdominal aorta. In: Skandalakis JE, Gray SW, eds. Embryology for Surgeons. 2nd ed. Baltimore, Md: Williams & Wilkins; 1994:796-1030.
50. Danilowicz D, Rudolph AM, Hoffman JIE. Delayed closure of the ductus arteriosus in premature infants. Pediatrics. 1966;57:74-78.
51.
Patterson DF, Pyle RL, Buchanan JW, Trautvetter E, Abt
DA. Hereditary patent ductus arteriosus and its sequelae in the
dog. Circ Res. 1971;29:1-13.
52. Clyman R. The role of patent ductus arteriosus in respiratory distress syndrome. Semin Perinatol. 1984;8:293-299. [Medline] [Order article via Infotrieve]
53. Dudell GG, Gersony WM. Patent ductus arteriosus in neonates with severe respiratory disease. J Pediatr. 1984;104:915-920. [Medline] [Order article via Infotrieve]
54. Shenai JP, Chytil F, Stahlman MT. Vitamin A status of neonates with bronchopulmonary dysplasia. Pediatr Res. 1985;19:185-188. [Medline] [Order article via Infotrieve]
55. Zachman RD. Retinol (vitamin A) and the neonate: special problems of the human premature infant. J Clin Nutr. 1989;50:413-424.
56. Hustead VA, Gutcher GR, Anderson SA, Zachman RD. Relationship of vitamin A (retinol) status to lung disease in the preterm infant. J Pediatr. 1984;105:610-615.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
U. Yokoyama, Y. Sato, T. Akaike, S. Ishida, J. Sawada, T. Nagao, H. Quan, M. Jin, M. Iwamoto, S. Yokota, et al. Maternal vitamin A alters gene profiles and structural maturation of the rat ductus arteriosus Physiol Genomics, September 11, 2007; 31(1): 139 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kota, M. Osborne-Pellegrin, H. Schulz, J. Behmoaras, M. Coutard, M. Gong, and N. Hubner Quantitative genetic basis of arterial phenotypes in the Brown Norway rat Physiol Genomics, June 19, 2007; 30(1): 17 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Agren, A. L. Cogolludo, C. G. A. Kessels, F. Perez-Vizcaino, J. G. R. De Mey, C. E. Blanco, and E. Villamor Ontogeny of chicken ductus arteriosus response to oxygen and vasoconstrictors Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R485 - R496. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakamura, M. C. Colbert, and J. Robbins Neural Crest Cells Retain Multipotential Characteristics in the Developing Valves and Label the Cardiac Conduction System Circ. Res., June 23, 2006; 98(12): 1547 - 1554. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Yokoyama, S. Minamisawa, S. Adachi-Akahane, T. Akaike, I. Naguro, K. Funakoshi, M. Iwamoto, M. Nakagome, N. Uemura, H. Hori, et al. Multiple transcripts of Ca2+ channel {alpha}1-subunits and a novel spliced variant of the {alpha}1C-subunit in rat ductus arteriosus Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1660 - H1670. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. R. Paiva, L. S. Matsubara, B. B. Matsubara, M. F. Minicucci, P. S. Azevedo, A. O. Campana, and L. A. M. Zornoff Retinoic Acid Supplementation Attenuates Ventricular Remodeling after Myocardial Infarction in Rats J. Nutr., October 1, 2005; 135(10): 2326 - 2328. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Thebaud, E. D. Michelakis, X.-C. Wu, R. Moudgil, M. Kuzyk, J. R.B. Dyck, G. Harry, K. Hashimoto, A. Haromy, I. Rebeyka, et al. Oxygen-Sensitive Kv Channel Gene Transfer Confers Oxygen Responsiveness to Preterm Rabbit and Remodeled Human Ductus Arteriosus: Implications for Infants With Patent Ductus Arteriosus Circulation, September 14, 2004; 110(11): 1372 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. R. de Paiva, L. A. M. Zornoff, M. P. Okoshi, K. Okoshi, L. S. Matsubara, B. B. Matsubara, A. C. Cicogna, and A. O. Campana Ventricular remodeling induced by retinoic acid supplementation in adult rats Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2242 - H2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Miano and B. C. Berk Retinoids : Versatile Biological Response Modifiers of Vascular Smooth Muscle Phenotype Circ. Res., September 1, 2000; 87(5): 355 - 362. [Full Text] [PDF] |
||||
![]() |
P. Neuville, M.-L. Bochaton-Piallat, and G. Gabbiani Retinoids and Arterial Smooth Muscle Cells Arterioscler Thromb Vasc Biol, August 1, 2000; 20(8): 1882 - 1888. [Full Text] [PDF] |
||||
![]() |
S.-i. Imamura, T. Nishikawa, E. Hiratsuka, A. Takao, and R. Matsuoka Behavior of Smooth Muscle Cells during Arterial Ductal Closure at Birth J. Histochem. Cytochem., January 1, 2000; 48(1): 35 - 44. [Abstract] [Full Text] |
||||
![]() |
Q. Yang, A. Sanbe, H. Osinska, T. E. Hewett, R. Klevitsky, and J. Robbins In Vivo Modeling of Myosin Binding Protein C Familial Hypertrophic Cardiomyopathy Circ. Res., October 29, 1999; 85(9): 841 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bergwerff, M. C. DeRuiter, S. Hall, R. E. Poelmann, and A. C. Gittenberger-de Groot Unique vascular morphology of the fourth aortic arches: possible implications for pathogenesis of type-B aortic arch interruption and anomalous right subclavian artery Cardiovasc Res, October 1, 1999; 44(1): 185 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Christen, M.-L. Bochaton-Piallat, P. Neuville, S. Rensen, M. Redard, G. van Eys, and G. Gabbiani Cultured Porcine Coronary Artery Smooth Muscle Cells : A New Model With Advanced Differentiation Circ. Res., July 9, 1999; 85(1): 99 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Neuville, Z.-q Yan, A. Gidlof, M. S. Pepper, G. K. Hansson, G. Gabbiani, and A. Sirsjo Retinoic Acid Regulates Arterial Smooth Muscle Cell Proliferation and Phenotypic Features In Vivo and In Vitro Through an RAR{alpha}-Dependent Signaling Pathway Arterioscler Thromb Vasc Biol, June 1, 1999; 19(6): 1430 - 1436. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Arens, R. A. Chapados, B. E. Cox, K. E. Kamm, and C. R. Rosenfeld Differential development of umbilical and systemic arteries. II. Contractile proteins Am J Physiol Regulatory Integrative Comp Physiol, June 1, 1998; 274(6): R1815 - R1823. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. S. Smith The Pharmacology of the Ductus Arteriosus Pharmacol. Rev., March 1, 1998; 50(1): 35 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Searcy, E. Vincent, C. Liberatore, and K. Yutzey A GATA-dependent nkx-2.5 regulatory element activates early cardiac gene expression in transgenic mice Development, January 11, 1998; 125(22): 4461 - 4470. [Abstract] [PDF] |
||||
![]() |
S. Sartore, A. Chiavegato, R. Franch, E. Faggin, and P. Pauletto Myosin Gene Expression and Cell Phenotypes in Vascular Smooth Muscle During Development, in Experimental Models, and in Vascular Disease Arterioscler Thromb Vasc Biol, July 1, 1997; 17(7): 1210 - 1215. [Abstract] [Full Text] |
||||
![]() |
J. Gulick, T. E. Hewett, R. Klevitsky, S. H. Buck, R. L. Moss, and J. Robbins Transgenic Remodeling of the Regulatory Myosin Light Chains in the Mammalian Heart Circ. Res., May 19, 1997; 80(5): 655 - 664. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |