Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1995;77:14-20

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gu, J.-L.
Right arrow Articles by Nadler, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gu, J.-L.
Right arrow Articles by Nadler, J.
(Circulation Research. 1995;77:14-20.)
© 1995 American Heart Association, Inc.


Articles

Ribozyme-Mediated Inhibition of Expression of Leukocyte-type 12-Lipoxygenase in Porcine Aortic Vascular Smooth Muscle Cells

Jia-Li Gu, Dange Veerapanane, John Rossi, Rama Natarajan, Lisa Thomas, Jerry Nadler

From the Department of Diabetes, Endocrinology, and Metabolism, City of Hope Medical Center, and Center for Molecular Biology and Gene Therapy (J.R.), Loma Linda (Calif) University, School of Medicine.

Correspondence to Jerry L. Nadler, MD, Department of Diabetes, Endocrinology, and Metabolism, City of Hope Medical Center, 1500 E Duarte Rd, Duarte, CA 91010.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Activation of a leukocyte-type 12-lipoxygenase (12-LO) has been proposed to be an important mechanism for angiotensin II– and glucose-induced vascular smooth muscle cell growth. Currently, no specific pharmacological inhibitors for the leukocyte-type 12-LO are available to test this hypothesis. We have therefore designed a chimeric DNA-RNA hammerhead ribozyme to produce cleavage at the first GUC sequence at nucleotide 7 of porcine leukocyte 12-LO mRNA. The ribozyme was tested in vitro with a 206-base 12-LO mRNA as substrate. We observed that the ribozyme specifically and dose-dependently cleaved porcine leukocyte 12-LO mRNA at the predicted site under physiological temperature. Furthermore, we also efficiently delivered the ribozyme into porcine aortic vascular smooth muscle cells by transfection with cationic liposomes. The ribozyme caused a dose-dependent decrease in levels of porcine leukocyte-type 12-LO mRNA in these cells and was more potent than an antisense oligonucleotide directed against porcine leukocyte 12-LO. The 12-LO ribozyme also attenuated 12-LO protein levels in the cells. The action of the ribozyme was primarily a result of its catalytic activity, since a modified ribozyme that lacks catalytic activity showed reduced effects. This represents the first ribozyme directed against a mammalian LO pathway. These results demonstrate the potential utility of new ribozyme technology to generate novel agents for gene modulation experiments to modify the development or progression of vascular disease in humans.


Key Words: lipoxygenase • ribozyme • vascular smooth muscle • atherosclerosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Angiotensin II (Ang II) plays an important role in the development of hypertension and atherosclerosis by inducing vascular smooth muscle cell growth and synthesis of aldosterone. Recent studies indicate that activation of leukocyte-type 12-lipoxygenase (12-LO) activity is involved in Ang II–induced steroidogenic actions in the adrenal glomerulosa and vascular actions in vascular smooth muscle cells (VSMCs).1 2 3 Furthermore, pharmacological inhibition of 12-LO activity can reduce Ang II–induced cellular growth in the adrenal gland and VSMCs.2 4 New studies also show that a leukocyte-type 12-LO is present in porcine VSMC cells and in human adrenal glomerulosa and that this form of 12-LO mRNA and protein levels are upregulated by Ang II in both of these tissues.5 6 Additional studies implicate the 12-LO pathway in glucose-mediated VSMC growth.7 12-LO products therefore have important cardiovascular and growth-promoting effects. However, there are currently no specific pharmacological inhibitors that are selective for the leukocyte-type 12-LO.

Ribozymes are newly discovered RNA enzymes that catalytically cleave specific RNA sequences.8 In vivo studies have shown that inhibition of gene expression by ribozymes can be achieved in the HIV virus and in cancer.9 10 In addition, ribozymes can be successfully delivered exogenously by transfection of cells with cationic liposomes.11 A recent study showed that a chimeric DNA-RNA hammerhead ribozyme had enhanced catalytic turnover and stability.12 In addition, a chimeric ribozyme containing phosphorothioate linkage further improved its resistance to nucleases.13 14 However, there have been no studies evaluating the effects or utility of a ribozyme to cleave an RNA sequence linked to eicosanoid metabolism in vascular tissue.

In this study, we designed and synthesized a 42-mer chimeric DNA-RNA hammerhead ribozyme with two phosphorothioate linkages at the 3' terminal to cleave the GUC sequence at nucleotide 7 of porcine leukocyte 12-LO RNA.15 The catalytic activity of the ribozyme was first tested in a cell-free system. The effects of the ribozyme on porcine leukocyte-type 12-LO gene and protein expression were then evaluated in primary cultures of porcine VSMCs (PVSMCs). These effects were compared with those obtained with a modified ribozyme that lacks catalytic activity. The results suggest that this 12-LO catalytic ribozyme can dose-dependently decrease 12-LO mRNA and protein expression in PVSMCs. These results indicate the feasibility of using new ribozyme technology to study the specific effects of a gene pathway in vascular disease.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Oligonucleotide Synthesis
A 42-mer chimeric DNA-RNA hammerhead ribozyme (Rz) with two phosphorothioate linkages at the 3' terminal was designed to cleave the GUC sequence at nucleotide 7 of porcine leukocyte 12-LO mRNA.15 As controls for the ribozyme, a modified ribozyme (MRz) lacking catalytic activity,16 12-LO sense (S) and antisense (AS) oligodeoxynucleotides (oligos) were also designed. The sequences of these oligos are as follows in 5' to 3' (* indicates phosphorothioate internucleotide linkage; ribonucleotides are identified by bold letters): Rz:ACGCGGTAGACUGAUGAGTCCGTGAGGACGA-AACCCATCT*G*G MRz: ACGCGGTAGACUAAUGAGTCCGTGAGGACGAA-ACCCATCT*G*G S:CAAGATGGGTCTCTACCGCGT AS:ACGCGGTAGAGACCCATCT*T*G All the oligos used in the study, including polymerase chain reaction (PCR) primers and probes of the porcine leukocyte 12-LO and human GAPDH,6 were synthesized by the City of Hope DNA synthesis core facility. End labeling of these oligos was performed with [{gamma}-32P]ATP (6000 Ci/mmol; DuPont) and T4 polynucleotide kinase (New England Biolabs).

Construction of Substrate RNA
Plasmid PUC19 containing porcine leukocyte 12-LO cDNA was a generous gift from Dr T. Yoshimoto (Tokoshima University, Japan). The entire 12-LO cDNA insert was subcloned into the Sal I site of pcDNA1neo plasmid (Invitrogen), resulting in plasmid pcDNA1neo-12LO. The orientation of the 12-LO cDNA insert was such that an in vitro transcription from the SP6 promoter could produce sense RNA. The plasmid was used as template for the in vitro transcription reaction to generate the RNA as substrate for in vitro cleavage reaction.

In Vitro 12-LO RNA Transcription Reaction
RNA (206 bases) that included the 12-LO mRNA target of the ribozyme and a portion of the plasmid was transcribed from EcoRI linearized pcDNA1neo-12LO plasmid with SP6 RNA polymerase (Promega) by use of the procedure described by Promega. After synthesis, the template DNA was removed. The 206 bases of transcribed RNA were subjected to 10% polyacrylamide/7 mol/L urea gel electrophoresis and purified by crash-and-soak methods.17 Two types of labeled transcript RNA were used in this study. The internally labeled RNA was obtained during transcript with [{alpha}-32P]UTP (3000 Ci/mmol, Du Pont), and the 5' end-labeled, transcribed RNA was accomplished by dephosphorylation of the purified transcript RNA with calf intestinal alkaline phosphatase (Boehringer Mannheim), then labeling with [{gamma}-32P]ATP and T4 polynucleotide kinase.

In Vitro Cleavage of Target Porcine Leukocyte 12-LO RNA by the Ribozyme
The standard reaction was carried out as described18 unless specified otherwise in the figure legend. To a total reaction volume of 10 µL containing 50 mmol/L Tris-HCl, pH 8.0, labeled RNA substrate, either labeled or unlabeled 12-LO ribozyme, and 20 mmol/L MgCl2 was added to initiate the reaction, followed by incubation at 37°C for 14 hours. Reactions were stopped by addition of an 80% formamide loading buffer. Substrate and cleavage products were separated by 10% polyacrylamide/7 mol/L urea gel electrophoresis and were detected by autoradiography. The effects of the ribozyme were compared with an antisense oligonucleotide and modified ribozyme that was designed to be catalytically inactive.

Ribozyme Delivery to PVSMCs
We used cationic liposome-mediated transfection to deliver the ribozyme into cells. PVSMCs were maintained as described.7 Cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing high glucose (25 mmol/L) and 10% fetal calf serum (FCS); we previously showed that this high-glucose culture condition induced 12-LO expression in these cells.5 Cells between passages 2 and 5 were used in this study. Ribozymes or oligos were transfected as previously described.19 Briefly, cells were plated in 60-mm dishes so as to achieve 60% to 80% confluence on the next day in readiness for transfection. Cells were washed with OPTI-MEM1 reduced serum medium (Gibco) and incubated for 1 hour in the same medium. Then fresh medium and premixed ribozymes or oligos (1 to 2 µmol/L) with 37.5 µg of Transfectam reagent (Promega) were added to cells at final volume of 1.5 mL in each dish and incubated at 37°C. The transfection initiation time was considered to be time zero. At 4, 24, and 40 hours after transfection, additional oligos or ribozymes were added as follows: 0.5 to 1 µmol/L at 4 hours and 0.25 to 0.5 µmol/L at 24 hours and 40 hours, to a final concentration of 2 to 4 µmol/L at 40 hours; FCS was added to a final concentration of 4% at 4 hours after transfection. Control cells were treated identically, without oligos or ribozymes.

Stability of Ribozymes
The intracellular stability of the ribozyme was tested as follows: PVSMCs were plated at 70% confluence in 35-mm dishes. 32P-labeled ribozyme (2.5x106 cpm) was introduced into the cells at time zero with Transfectam reagent as described earlier. The stability measurements were carried out at 1, 6, 18, 24, and 42 hours after transfection. Cell monolayers were washed twice in cold PBS, then total RNA, including ribozyme, was extracted from cells by RNA Stat 60 reagent (Tel-Test "B"). The entire sample of RNA was electrophoresed in a 20% polyacrylamide/7 mol/L urea gel, followed by autoradiography. To examine the stability of the ribozyme in FCS, under cell-free conditions, 5 µL of 32P-labeled ribozyme (1x106 cpm) was preheated at 90°C for 1 minute and chilled on ice, mixed with 10 µL cell culture supernatant containing DMEM/10% FCS in the presence or absence of Transfectam reagent (0.5 µg), and then incubated at 37°C. Samples were removed at indicated time points and analyzed on a denatured polyacrylamide, as described above.

Reverse Transcriptase-PCR Analysis
At 48 hours after transfection with 2 to 4 µmol/L of oligos or ribozymes, total cellular RNA was extracted from PVSMCs. The reverse transcriptase (RT)-PCR of porcine leukocyte-type 12-LO was performed as described previously5 6 with some modification, as follows: cDNA was synthesized from 1 µg of total RNA by Moloney murine leukemia virus RT (Gibco) and random hexamer (Perkin-Elmer). Porcine leukocyte-type 12-LO was then amplified from this cDNA by use of Taq polymerase (Perkin-Elmer), with oligonucleotide primers of porcine leukocyte 12-LO (5'-TTCAGTGTAGACGTGTCGGAG-3') and (5'-ATGTATGCCGGTGCTGGCTATATTTAG-3') at cycling conditions of 94°C for 0.5 minute, 50°C for 1 minute, and 72°C for 1 minute for 30 cycles. For normalizing samples in RT-PCR analysis, GAPDH mRNA was coamplified by addition of GAPDH primers (5'CCCATCACCATCTTCCAGGAG-3') and (5-'GTTGTCATGGATGACCTTGGC-3'). The PCR products were identified by Southern blot analysis and hybridization with 32P-labeled 12-LO probe (5'-TCAGGATGCGGTGCCCTCCAC-3'). Autoradiograms obtained after hybridization were quantified as described below.

Western Immunoblotting
At 72 hours after transfection with 4 µmol/L of intact or modified ribozymes, PVSMCs were extracted for cellular proteins. Electrophoresis and immunoblotting were performed as described earlier.5 A polyclonal antibody against a specific porcine leukocyte-type 12-LO peptide was used at a 1:400 dilution. This specific antibody has been characterized and used previously for evaluation of 12-LO expression.6 In addition, preincubation of the antisera with the corresponding porcine leukocyte 12-LO peptide blocks detection of the 72-kDa 12-LO band. The second antibody conjugated with alkaline phosphatase (Tropix) was used at a 1:20 000 dilution. Detection was by chemiluminescence using CSPD substrate and the Western-light chemiluminescent detection system (Tropix Inc).

Data Analysis
Gel quantification was performed with a computerized densitometer similar to one previously described5 6 but now using the SCISCAN 5000 (US Biochemical). Measurements were made in the linear region for Western and Southern blot analyses. Values in figure legends are expressed in arbitrary optical density units.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Structure of the Ribozyme
A 42-nucleotide DNA-RNA chimeric hammerhead ribozyme was designed to cleave the GUC sequence at nucleotide 7 in the porcine leukocyte 12-LO mRNA. This cleavage site is the first GUC site of the porcine leukocyte 12-LO mRNA. The catalytic center of the ribozyme contains ribonucleotides, whereas the three stems contain deoxyribonucleotides. At the 3' end of the ribozyme are two phosphorothioate linkages (Fig 1Down). As previously described,12 13 14 this ribozyme may display improved stability in vivo and enhanced cellular delivery. This ribozyme has some in vitro activity against the highly homologous 15-LO but will not react with the platelet form of 12-LO because of a lack of a cleavage site 5'-GUC-3' at the complementary sequence to the ribozyme.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Sequence of the porcine leukocyte 12-lipoxygenase (12-LO) DNA-RNA hammerhead ribozyme and the complementary 12-LO mRNA. The ribozyme (bottom) cleaves the GUC codon of leukocyte-type 12-LO mRNA (top) as indicated by arrows. Ribonucleotides of ribozyme are underlined. Phosphorothioate linkages are marked S.

Cleavage of Porcine Leukocyte 12-LO mRNA In Vitro
A transcribed 206-base fragment of 12-LO RNA served as an in vitro substrate for the ribozyme. It contained a small segment of pcDNA1neo plasmid sequence and a 5' segment of 12-LO sequence. As a result of cleavage, two fragments were produced that were consistent with the predicted size, as shown in Fig 2ADown. A 135- and 71-base cleavage fragment was detected when the 206-base substrate was internally labeled, while only the 71-base fragment was produced when the substrate was 5' end-labeled (Fig 2BDown). The amount of cleavage product increased with increased ribozyme addition. No cleavage occurred in the absence of either magnesium or ribozyme, indicating that the cleavage reactions are magnesium and ribozyme dependent. Furthermore, neither the antisense oligonucleotide (Fig 2BDown, lane 2) nor the modified catalytic negative ribozyme produced any cleavage products (data not shown). To evaluate the condition at which the ribozyme optimally cleaved the RNA substrate, the reactions were performed under a wide range of incubation conditions. To assess the optimum temperature of reaction, we performed reactions at temperatures from 25°C to 65°C. Fig 3Down, left panel, illustrates that the temperature optimum for RNA cleavage was at the physiological temperature of 37°C. At 42°C, the amount of product was diminished; at 55°C, no cleavage products were detected. The time course of the reaction showed that the cleavage product formation was detected after 15 minutes of incubation at 37°C with a 15-fold increase after 3 hours of incubation. The effect of preheating on the cleavage reaction activity was also examined. As shown in Fig 3Down, right panel, a 71-base product was observed in each ribozyme reaction either with or without preheating, and the result again showed that with an increasing amount of ribozyme, the cleavage product was greater. However, the amount of product obtained without preheating was at least equal to or greater than that obtained with preheating.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 2. The autoradiograph of PAGE shows the cleavage of porcine leukocyte 12-lipoxygenase mRNA substrate by the ribozyme in vitro. Cleavage reaction was run overnight at 37°C in the presence of 20 mmol/L MgCl2 and 1x105 cpm of 32P-labeled substrate. A, Substrate was internally labeled. Reactions were performed using 400 ng of ribozyme in the absence of magnesium (lane 1) or with magnesium and reduced amounts of ribozyme from 400, 200, 100, 50, 25, and 10 ng (lanes 3 through 8) to 0 (lane 2). B, Substrate was 5' end-labeled. Reactions were performed in the absence of ribozyme (lane 1), with 100 ng of antisense oligo (lane 2), or with 100 ng of ribozyme (lane 3). The appropriate cleavage product was seen in lane 3.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. The autoradiograph of PAGE shows the optimization of conditions of cleavage reaction. Left, Time course and incubation temperatures of the ribozyme reaction. Ribozyme (25 ng) with 5x104 cpm of internally labeled substrate was incubated either at 37°C for the given time points or overnight at indicated temperatures. Right, Effect of preheating on the ribozyme cleavage efficiency. In this experiment, both ribozyme and substrate were 5' end-labeled. Cleavage reactions were run at 37°C overnight in the presence of 5x104 cpm of substrate and increasing amounts of ribozyme/RNA substrate with either preheating (A and B) or no preheating (C). Samples in A were preheated at 85°C for 5 minutes, followed by cooling to room temperature and incubation for an additional 15 minutes at 55°C. Samples in B were chilled on ice after preheating at 85°C. Samples in C were directly incubated at 37°C overnight.

Stability of the Ribozyme
Ribozymes are susceptible to serum and cytoplasmic nuclease activity. Ribozymes rapidly degrade within 2 minutes of incubation in the cell culture supernatant.13 Similar results were obtained in this study when the ribozyme was incubated with the cell supernatant containing 10% FCS (Fig 4ADown). However, the stability was markedly increased when Transfectam reagent was present. A cell-free stability assay showed that >30% of ribozyme remained intact after 60 minutes of incubation (Fig 4BDown). The intracellular stability assay showed that about 10% of the ribozyme remained after 42 hours, compared with 1 hour after transfection (Fig 4CDown).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. The autoradiograph of PAGE shows the stability of 12-lipoxygenase ribozyme in cell-free system (A and B) and in porcine vascular smooth muscle cells (PVSMCs) (C). Experimental details are described under "Methods." 32P-labeled ribozyme was incubated as described, and samples were taken at the indicated time points. A, With supernatant of cultured PVSMCs. B, Same media as in A with additional Transfectam reagent. C, With PVSMCs. Time marked on top represents hours after transfection.

Ribozyme Effect on Porcine Leukocyte-Type 12-LO mRNA Level in PVSMCs
Our recent study revealed that a low level of porcine leukocyte-type 12-LO was present in PVSMCs and was upregulated by glucose and Ang II.5 In the present study, the ribozyme effect on 12-LO mRNA level in PVSMCs grown in high-glucose conditions was evaluated by the RT-PCR method, since 12-LO mRNA expression is too low to be detected by Northern analysis. These results are shown in Fig 5Down. As shown, almost complete inhibition of 12-LO mRNA expression was produced by 2 µmol/L of ribozyme (lane 1) compared with control cells treated with the same reagents but without the ribozyme or oligos (lane 3). However, at this same concentration, neither the antisense nor sense oligos inhibited 12-LO mRNA (lanes 2, 4, and 9). At 4 µmol/L, the antisense oligo also inhibited 12-LO mRNA by about 80% (lane 8). To further confirm the effect of the catalytic activity of the ribozyme, a modified ribozyme was produced that contained a single nucleotide substitution at the catalytic center to eliminate its catalytic activity. The effect of the modified ribozyme on inhibition of 12-LO mRNA was also examined (lane 10). This modified ribozyme showed less inhibition than the intact ribozyme (lane 11) at the same concentration of 4 µmol/L (Fig 5ADown). These data indicate that the ribozyme has greater inhibition of 12-LO mRNA expression than the antisense or the modified ribozyme. The ribozyme-induced inhibition of 12-LO mRNA was also dose dependent (Fig 5BDown), with definite inhibition seen at concentrations of ribozyme as low as 1 µmol/L.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Analysis of ribozyme effect on porcine leukocyte-type 12-lipoxygenase (12-LO) mRNA level in porcine vascular smooth muscle cells (PVSMCs). Transfection was carried out as described in the "Materials and Methods" section under "Ribozyme Delivery." Porcine leukocyte-type 12-LO mRNA levels were determined by reverse transcriptase–polymerase chain reaction. Top, Autoradiograms of Southern blots hybridized with the porcine leukocyte 12-LO probe; bottom, ethidium bromide–stained agarose gels, which show amplified GAPDH product (284 bp). Total RNA was extracted from PVSMCs treated with ribozymes or oligos. Rz indicates intact ribozyme; MRz, modified catalytically negative ribozyme; AS, antisense oligo DNA; and S, sense oligo DNA. A, Lanes 1 through 4, 5 through 9, and 10 through 12 are from three separate experiments. Lanes 3, 5, and 12 are control; lanes 1, 2, 4, 7, and 9 are treated with 2 µmol/L; and lanes 6, 8, 10, and 11 are treated with 4 µmol/L of oligos or ribozymes. Optical densities of the 72-kD 12-LO bands in arbitrary units: lanes 1 through 4, 1.82, 32.74, 34.63, and 30.81; lanes 5 through 9, 40.29, 4.16, 4.99, 9.79, and 40.77; and lanes 10 through 12, 40.71, 6.98, and 52.31. B, Dose-dependent effect of intact ribozyme on 12-LO mRNA level. Lanes 2 through 6 are 4, 2, 1, 0.5, and 0.25 µmol/L ribozyme, respectively; lane 1, Transfectam reagent alone. Results are representative of two similar experiments.

Ribozyme Effect on Leukocyte-Type 12-LO Protein Levels in PVSMCs
The 12-LO protein was evaluated by immunoblotting with a specific antibody to the leukocyte-type 12-LO (Fig 6Down). A distinct band was detected from treated PVSMCs with a molecular mass of nearly 72 kD and the same electrophoretic migration as partial purified porcine leukocyte-type 12-LO protein (lane 4). 12-LO protein expression was inhibited by approximately 50% in cells treated with the ribozyme (lane 3) compared with control (lane 1). In contrast, 12-LO protein expression was only slightly reduced in cells treated by the modified ribozyme (lane 2). The band below 72 kD also is likely to be derived from 12-LO, on the basis of blocking experiments and the presence of a similar band in partially purified porcine leukocyte-type 12-LO protein samples. The results in Fig 6Down demonstrate that the intensity of this lower band is also reduced by the ribozyme.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 6. Western blot analysis of porcine leukocyte 12-lipoxygenase (12-LO) inhibition by ribozyme. The cellular protein was extracted from porcine vascular smooth muscle cells (PVSMCs) that had been treated with 4 µmol/L of intact ribozyme (Rz) (lane 3) or modified ribozyme (MRz) (lane 2). Western blot analysis was performed as described in the "Methods" section. Top band represents 72-kD 12-LO. Western analysis often shows a slightly lower band in PVSMCs. Both bands can be blocked by preincubating the 12-LO antibody with the porcine leukocyte 12-LO peptide against which this antibody was raised, suggesting that the lower band also derives from 12-LO. Both the upper and lower 12-LO band intensities were reduced by the intact ribozyme, whereas the modified catalytic negative ribozyme was less effective. The ODs of the 12-LO bands, in arbitrary units, were control, 42.58; MRz, 35.36; and Rz, 22.05. The results shown are representative of three separate experiments. Each lane contained 50 µg of protein except the standard lane, which contained 0.8 µg of partially purified authentic porcine leukocyte 12-LO (Oxford Biomedical Research Inc).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We demonstrated previously that activation of a 12-LO enzyme plays a key role in mediating both Ang II–induced steroidogenic and mitogenic responses in the adrenal cortex.1 4 Furthermore, Ang II increases both the activity and expression of a leukocyte-type 12-LO enzyme in PVSMCs.5 We also recently showed that the 12-LO pathway is particularly involved in Ang II–induced hypertrophy in PVSMCs.2 This was supported by results showing that a 12-LO inhibitor but not a cyclooxygenase inhibitor completely blocked Ang II responses. Furthermore, a 12-LO product, 12-HETE, reproduced Ang II effects by directly increasing protein and fibronectin content. In addition, high glucose can increase the activity of the 12-LO pathway, and glucose-induced PVSMC growth is associated with increased 12-LO activity.5 7 The 12-LO pathway and its product 12-HETE have also been implicated in VSMC migration.20 12-HETE at concentrations as low as 10-12 mol/L have been shown to lead to smooth muscle cell migration. Moreover, the lipoxygenase pathway has been reported to be involved in the oxidative modification of LDL21 and inhibition of renin release in the kidney.22 Additional studies have demonstrated that 12-LO products can activate specific isoforms of protein kinase C and oncogenes, including ras and c-fos.23 24 25 26 Therefore, increased 12-LO activity and expression by Ang II or glucose may be a previously unrecognized mechanism for Ang II– and glucose-induced vascular effects, and blockade of the 12-LO pathway may be a novel therapeutic modality to reduce Ang II– or glucose-related cardiovascular disease.

The determination of the precise role of leukocyte-type 12-LO in mediating Ang II– and glucose-induced vascular disease will depend on highly selective methods to block expression and/or activation of this enzyme. Several pharmacological inhibitors such as the flavonoid baicalein,27 antioxidants, BW755c, or phenidone28 29 or other inhibitors such as cinnamoyl-3,4-dihydroxy-{alpha}-cyanocinnamate30 are commercially available and relatively nontoxic agents that can reduce the activity of 12-LO. However, these agents may produce effects independent of their actions or LO, such as reducing free radicals. In addition, these agents are unlikely to selectively block the leukocyte-type 12-LO, since they may also block related LO enzymes such as the platelet form of 12-LO. Therefore, additional approaches to inhibit the leukocyte-type 12-LO are clearly needed to fully evaluate its role in disease states.

In the present study, we designed and produced a chimeric RNA-DNA hammerhead type of ribozyme to specifically cleave the porcine leukocyte-type 12-LO. The results in vitro demonstrated that the ribozyme produced the expected cleavage products in a Mg2++-dependent manner, demonstrating that the ribozyme, unlike traditional antisense oligonucleotides, has potent RNA catalytic activity. This was confirmed by showing that an appropriate antisense 12-LO oligonucleotide had no 12-LO mRNA catalytic activity in vitro. Furthermore, the ribozyme was active at a physiological temperature and at low concentrations, suggesting its potential utility in cells and tissues. The ribozyme was modified to include 3' phosphorothioate groups for added stability from cellular and circulating nucleases, as has been described for other ribozymes.12 13 14 The results using the cationic liposome reagent demonstrated that this ribozyme was indeed relatively stable in serum-containing media and remained intact for a sufficient time after transfection into cultured PVSMCs.

The most striking finding of the present study was the profound efficiency of this ribozyme in blocking porcine leukocyte 12-LO RNA expression at a concentration at which an antisense oligonucleotide for porcine leukocyte 12-LO RNA expression was completely ineffective. At higher concentrations, approaching 4 µmol/L, the antisense oligonucleotide produced similar inhibitory actions on 12-LO mRNA expression in the porcine VSMCs. The greater concentration of antisense oligo required was unlikely to be due to its poor stability, because it contained the same DNA sequence and two phosphorothioate linkages at the 3' terminal as the flanking sequence of the ribozyme.

It is possible that some of the effects of the ribozyme on 12-LO expression may be mediated by an antisense effect. However, the results suggest that a major action is due to the ability of the ribozyme to cleave porcine leukocyte-type 12-LO RNA in PVSMCs. This conclusion is based on the results of using a "catalytically negative" modified 12-LO ribozyme in the cell-free studies and greater potency of the ribozyme in reducing cellular 12-LO RNA and protein over the antisense oligonucleotide or the modified catalytically negative ribozyme. The most direct approach to address this issue would be to measure the cleavage products in the PVSMCs. Unfortunately, this approach cannot be used, because the RNA cleavage products are highly unstable and are degraded extremely rapidly in mammalian cells.

The results demonstrate that the ribozyme produces a dose-dependent inhibition of 12-LO RNA expression in VSMCs. Furthermore, the ribozyme can reduce 12-LO protein expression in PVSMCs. Preliminary experiments demonstrate that this 12-LO ribozyme transiently transfected into PVSMCs can also reduce fibronectin content (unpublished observations). Additional studies using methods of producing sustained levels of the ribozyme in PVSMCs will be needed to fully evaluate the in vivo effects of the ribozyme on glucose- and Ang II–induced vascular actions.

In summary, we have described the first chimeric hammerhead ribozyme active against an eicosanoid-generating RNA. The results demonstrate the potential utility of this new ribozyme technology to generate novel agents for gene transfer experiments to modify the development or progression of vascular diseases in humans.


*    Acknowledgments
 
This work was supported by the American Heart Association, Los Angeles Affiliate, Grant-in-Aid 1030 GI-1 (to Dr Gu) and National Institutes of Health grants R01-DK-39721 (to Dr Nadler) and R29-HL-48920 (to Dr Natarajan). The authors would like to thank Dr Wei Bai for assisting in the Western immunoblotting blocking studies. We acknowledge the excellent secretarial assistance of Elizabeth D. Rees in preparation of the manuscript.

Received May 10, 1994; accepted February 6, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Nadler JL, Natarajan R, Stern N. Specific action of the lipoxygenase pathway in mediating angiotensin II-induced aldosterone synthesis in isolated adrenal glomerulosa cells. J Clin Invest. 1987;80:1763-1769.

2. Natarajan R, Gonzales N, Lanting L, Nadler J. Role of the lipoxygenase pathway in angiotensin II–induced vascular smooth muscle cell hypertrophy. Hypertension. 1994;23(suppl I):I-142-I-147.

3. Stern N, Golub M, Nozawa K, Berger M, Knoll E, Yanagawa N, Natarajan R, Nadler JL, Tuck M. Selective inhibition of angiotensin II-mediated vasoconstriction by lipoxygenase blockade. Am J Physiol. 1989;257:H434-H443. [Abstract/Free Full Text]

4. Natarajan R, Gonzales N, Hornsby PJ, Nadler J. Mechanism of angiotensin II-induced proliferation in bovine adrenocortical cells. Endocrinology. 1992;131:1174-1180. [Abstract/Free Full Text]

5. Natarajan R, Gu J, Rossi J, Gonzales N, Lanting L, Xu L, Nadler J. Elevated glucose and angiotensin II increase 12-lipoxygenase activity and expression in porcine aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1993;90:4947-4951. [Abstract/Free Full Text]

6. Gu J, Natarajan R, Ben-Ezra J, Valente G, Scott S, Yosimoto T, Yamamoto S, Rossi J, Nadler JL. Evidence that a leukocyte type of 12-lipoxygenase is expressed and regulated by angiotensin II in human adrenal glomerulosa cells. Endocrinology. 1994;134:70-77. [Abstract/Free Full Text]

7. Natarajan R, Gonzales N, Xu L, Nadler JL. Vascular smooth muscle cells exhibit increased growth response to elevated glucose. Biochem Biophys Res Commun. 1992;187:552-560. [Medline] [Order article via Infotrieve]

8. Cech TR, Bass BL. Biological catalysis by RNA. Annu Rev Biochem. 1986;55:599-629. [Medline] [Order article via Infotrieve]

9. Sarver M, Cantin E, Chang P, Ladne P, Stephens D, Zaia J, Rossi J. Ribozymes as potential anti-HIV-1 therapeutic agents. Science. 1990;247:1222-1224. [Abstract/Free Full Text]

10. Funato T, Yoshida E, Jiao L, Tone T, Kashani-Sabet M, Scanlon KJ. The utility of an anti fos ribozyme in reversing cisplatin resistance in human carcinomas. Adv Enzyme Regul. 1992;32:195-209. [Medline] [Order article via Infotrieve]

11. Sioud M, Natvig JB, Forre O. Preformed ribozyme destroys tumour necrosis factor mRNA in human cells. J Mol Biol. 1992;223:831-835. [Medline] [Order article via Infotrieve]

12. Taylor NR, Kaplan BE, Swidersk P, Li H, Rossi JJ. Chimeric DNA-RNA hammerhead ribozymes have enhanced in vitro catalytic efficiency and increased stability in vivo. Nucleic Acid Res. 1992;20:4559-4564. [Abstract/Free Full Text]

13. Heidenreich O, Eckstein F. Hammerhead ribozyme-mediated cleavage of the long terminal repeat RNA of human immunodeficiency virus type 1. J Biol Chem. 1992;267:1904-1909. [Abstract/Free Full Text]

14. Shimayama T, Nishikawa F, Nishikawa S, Taira K. Nuclease-resistant chimeric ribozymes containing deoxyribonucleotides and phosphorothioate linkages. Nucleic Acid Res. 1993;21:2605-2611. [Abstract/Free Full Text]

15. Yoshimoto T, Suzuki H, Yamamoto S, Takai T, Yokoyama C, Tanabe T. Cloning and sequence analysis of the cDNA for arachidonate lipoxygenase of porcine leukocytes. Proc Natl Acad Sci U S A. 1990;46:2142-2146.

16. Ruffner DE, Stormo GD, Uhlenbeck OC. Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 1990;29:10695-10702. [Medline] [Order article via Infotrieve]

17. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Press; 1989:11.23-11.28.

18. Chang PS, Cantin E, Zaia JA, Ladne PA, Stephens DA, Sarver N, Rossi JJ. Ribozyme-mediated site-specific cleavage of the HIV-1 genome. Clin Biotech. 1990;2:23-31.

19. Snyder OS, Wu Y, Wang J, Rossi JJ, Swiderski P, Kaplan BZ, Forman SJ. Ribozyme-mediated inhibition of bcr-abl gene expression in a Philadelphia chromosome-positive cell line. Blood. 1993;82:600-605. [Abstract/Free Full Text]

20. Nakao J, Ooyama T, Ito H, Chang WC, Murota S. Comparative effect of lipoxygenase products of arachidonic acid on rat aortic smooth muscle cell migration. Atherosclerosis. 1982;44:339-342. [Medline] [Order article via Infotrieve]

21. Parthasarathy S, Wieland E, Steinberg D. A role for endothelial cell lipoxygenase in the oxidative modification of low density lipoprotein. Proc Natl Acad Sci U S A. 1989;86:1046-1050. [Abstract/Free Full Text]

22. Antonipillai I, Nadler JL, Robin EC, Horton R. The inhibitory role of 12 and 15-lipoxygenase products on renin release. Hypertension. 1987;10:61-66. [Abstract/Free Full Text]

23. Natarajan R, Lanting L, Xu L, Nadler J. Role of specific isoforms of protein kinase C in angiotensin II and lipoxygenase action in rat adrenal glomerulosa cells. Mol Cell Endocrinol. 1994;101:59-66. [Medline] [Order article via Infotrieve]

24. Liu B, Timar J, Howlet J, Diglio CA, Honn KV. Lipoxygenase metabolites of arachidonic and linoleic acids modulate the adhesion of tumor cells to endothelium via regulation of protein kinase C. Cell Regul. 1991;2:1045-1055. [Medline] [Order article via Infotrieve]

25. Haliday EM, Ramesha CS, Ringold G. TNF induced c-fos via a novel pathway requiring conversion of arachidonic acid to a lipoxygenase metabolite. EMBO J. 1991;10:109-115. [Medline] [Order article via Infotrieve]

26. Yu CL, Tsai M, Stacey DW. Serum stimulation of NIH 3T3 cells induces the production of lipids able to inhibit GTPase-activating protein activity. Mol Cell Biol. 1990;10:6683-6689. [Abstract/Free Full Text]

27. Sekiya K, Okuda H. Selective inhibition of platelet lipoxygenase by baicalein. Biochem Biophys Res Commun. 1982;105:1090-1095. [Medline] [Order article via Infotrieve]

28. Higgs GA, Hower RJ, Vane JR. New approach to anti-inflammatory drugs. Biochem Pharmacol. 1979;28:1959-1961. [Medline] [Order article via Infotrieve]

29. Hageman W, Rose M, Persico F. Antagonism by ETYA of the effects of leukotrienes on ileum and lung parenchymal strips independent of effects on arachidonic acid metabolism. Prostaglandins. 1986;32:563-578. [Medline] [Order article via Infotrieve]

30. Cho H, Ueda M, Tamaoka M, Hamaguchi M, Aisaka K, Kiso Y, Inoue T, Ogino R, Tatsuoka T, Ishihara T, Noguchi T, Morita I, Murota S. Novel caffeic acid derivatives: extremely potent inhibitors of 12-lipoxygenase. J Med Chem. 1991;34:1503-1505.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J. Lipid Res.Home page
J. Huber, A. Furnkranz, V. N. Bochkov, M. K. Patricia, H. Lee, C. C. Hedrick, J. A. Berliner, B. R. Binder, and N. Leitinger
Specific monocyte adhesion to endothelial cells induced by oxidized phospholipids involves activation of cPLA2 and lipoxygenase
J. Lipid Res., May 1, 2006; 47(5): 1054 - 1062.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Srinivasan, M. E. Hatley, K. B. Reilly, E. C. Danziger, and C. C. Hedrick
Modulation of PPAR{alpha} Expression and Inflammatory Interleukin-6 Production by Chronic Glucose Increases Monocyte/Endothelial Adhesion
Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 851 - 857.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. A. Reddy, S. G. Adler, Y.-S. Kim, L. Lanting, J. Rossi, S.-W. Kang, J. L. Nadler, A. Shahed, and R. Natarajan
Interaction of MAPK and 12-lipoxygenase pathways in growth and matrix protein expression in mesangial cells
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F985 - F994.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wang, M. Liu, B. Mullah, D. P. Siderovski, and R. R. Neubig
Receptor-selective Effects of Endogenous RGS3 and RGS5 to Regulate Mitogen-activated Protein Kinase Activation in Rat Vascular Smooth Muscle Cells
J. Biol. Chem., July 5, 2002; 277(28): 24949 - 24958.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J.-L. Gu, H. Pei, L. Thomas, J. L. Nadler, J. J. Rossi, L. Lanting, and R. Natarajan
Ribozyme-Mediated Inhibition of Rat Leukocyte-Type 12-Lipoxygenase Prevents Intimal Hyperplasia in Balloon-Injured Rat Carotid Arteries
Circulation, March 13, 2001; 103(10): 1446 - 1452.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
S. P. lyngstadaas
Synthetic Hammerhead Ribozymes as Tools in Gene Expression
Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(6): 469 - 478.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Amarzguioui, G. Brede, E. Babaie, M. Grotli, B. Sproat, and H. Prydz
Secondary structure prediction and in vitro accessibility of mRNA as tools in the selection of target sites for ribozymes
Nucleic Acids Res., November 1, 2000; 28(21): 4113 - 4124.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-P. Wang, M. Enjoji, M. Tiebel, S. Ochsner, L. Chan, and B.-B. Teng
Hammerhead Ribozyme Cleavage of Apolipoprotein B mRNA Generates a Truncated Protein
J. Biol. Chem., August 20, 1999; 274(34): 24161 - 24170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Nakaar, B. U. Samuel, E. O. Ngo, and K. A. Joiner
Targeted Reduction of Nucleoside Triphosphate Hydrolase by Antisense RNA Inhibits Toxoplasma gondii Proliferation
J. Biol. Chem., February 19, 1999; 274(8): 5083 - 5087.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Frimerman, P. J. Welch, X. Jin, N. Eigler, S. Yei, J. Forrester, H. Honda, R. Makkar, J. Barber, and F. Litvack
Chimeric DNA-RNA Hammerhead Ribozyme to Proliferating Cell Nuclear Antigen Reduces Stent-Induced Stenosis in a Porcine Coronary Model
Circulation, February 9, 1999; 99(5): 697 - 703.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Natarajan, H. Pei, J.-L. Gu, J. M. Sarma, and J. Nadler
Evidence for 12-lipoxygenase induction in the vessel wall following balloon injury
Cardiovasc Res, February 1, 1999; 41(2): 489 - 499.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wang, B. Mullah, C. Hansen, J. Asundi, and J. D. Robishaw
Ribozyme-mediated Suppression of the G Protein gamma 7 Subunit Suggests a Role in Hormone Regulation of Adenylylcyclase Activity
J. Biol. Chem., October 10, 1997; 272(41): 26040 - 26048.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. Natarajan, J. Rosdahl, N. Gonzales, and W. Bai
Regulation of 12-Lipoxygenase by Cytokines in Vascular Smooth Muscle Cells
Hypertension, October 1, 1997; 30(4): 873 - 879.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
M. K. Patricia, R. Natarajan, A. N. Dooley, F. Hernandez, J.-L. Gu, J. A. Berliner, J. J. Rossi, J. L. Nadler, R. S. Meidell, and C. C. Hedrick
Adenoviral Delivery of a Leukocyte-Type 12 Lipoxygenase Ribozyme Inhibits Effects of Glucose and Platelet-Derived Growth Factor in Vascular Endothelial and Smooth Muscle Cells
Circ. Res., April 13, 2001; 88(7): 659 - 665.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gu, J.-L.
Right arrow Articles by Nadler, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gu, J.-L.
Right arrow Articles by Nadler, J.