© 1995 American Heart Association, Inc.
Articles |
Human Cardiac Troponin T: Cloning and Expression of New Isoforms in the Normal and Failing Heart
From the Laboratoire de Cardiologie Moléculaire et Cellulaire (L.M., D.L., J.J.M., F.S.), Université de Paris XI, CNRS URA 1159, Hôpital Marie Lannelongue, Le Plessis Robinson, France, and the Centre de Recherches de Biochimie Macromoléculaire (S.T., S.D.), CNRS UPR 9008, Montpellier, France.
Correspondence to Dr J.J. Mercadier, CNRS URA 1159, Hôpital Marie Lannelongue, 133 Avenue de la Résistance, 92350 Le Plessis Robinson, France.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract Troponin T, like many myofibrillar proteins, exists as multiple isoforms encoded by distinct genes or generated by splicing of the same primary RNA transcript. We have previously cloned the first human cardiac troponin T (cTnT) cDNA and showed the differential expression of cTnT in cardiac and skeletal muscle during ontogenic development. In this work we located the human cTnT gene by means of fluorescent in situ hybridization to 1q32 and, by sequencing thirteen cDNAs isolated from a human fetal heart cDNA library, identified three new isoforms resulting from specific combinations of three variable regions in human cTnT cDNA. The first variable region is a 30-bp box located at the 5' end of the cDNA, which can be excised either totally or only from the first 3 bp onwards; the second is a codon which can be completely excised; and the third is a 9-bp box in the 3' half of the cDNA, which can also be excised either totally or only from the first 3 bp. The existence of the corresponding RNAs in fetal and adult ventricles was confirmed by RNase protection studies. No accumulation of the fetal isoforms was found in failing ventricles compared with controls.
Key Words: troponin T • human heart • alternative splicing
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Troponin T (TnT) is a protein of the thin filament of the sarcomere which, together with troponins C and I and tropomyosin, plays an important role in the interaction between actin and myosin and in modulating the sensitivity of the myofibrillar apparatus to calcium.1 2 3 Like many myofibrillar proteins, TnT exists as a number of different isoforms, which are either encoded by distinct genes or generated by splicing of the same primary RNA transcript. In rat fast skeletal muscle, 10 (potentially 64) isoforms can be generated by splicing of the same transcript.4 TnT isoforms in human striated muscle are poorly documented. Two slow skeletal TnT isoforms have been isolated by Gahlmann et al,5 while we have isolated a third isoform and found evidence of a fourth in RNase protection studies6 and localized the gene to 19q13.4.7 8
In many species, cardiac muscle also comprises several TnT (cTnT) isoforms, differing in both their amino-terminal and carboxy-terminal regions. Relative to the adult isoform, an additional acidic domain of approximately 10 amino acids has been identified in the amino-terminal region of fetal cTnT isoforms of chick,9 rat,10 and rabbit11 origin. Another variable domain of 6 amino acids, located one amino acid upstream from the former domain, was identified in rabbit heart, giving rise to 4 isoforms on western blot.11 A third variable domain was also identified in the carboxy-terminal region of cTnT, and it can generate three forms by partial or complete splicing of a 9-amino-acid domain. This domain, first described in rat heart, seems to be specific for mammalian hearts, and the three resulting forms were found in embryonic and adult rat heart.12 Therefore, in rabbit heart as many as 12 isoforms can potentially be generated from the three variable domains described above.11 The physiological significance of these variable domains is still poorly understood. The stabilizing nature of the 10-amino-acid domain and its position just upstream from the region that binds strongly to the head-to-tail junction of adjacent tropomyosin molecules suggested that it might be essential for new sarcomere assembly during myofibrillogenesis.10 The recent discovery of three mutations in the human cTnT gene, leading to familial hypertrophic cardiomyopathies linked to chromosome 1, also supports the hypothesis that TnT may play an important role, not only in the contractile function of the sarcomere but also in sarcomere assembly.13
Four human cTnT isoforms were identified at the protein level by Anderson et al,14 suggesting the existence of variable domains similar to those found in rabbit cTnT.11 The expression of the four human cTnT isoforms is differentially regulated during development, and one of the fetal isoforms has been shown to be upregulated during heart failure.14 We have previously isolated the first human cTnT cDNA from an adult heart cDNA library and demonstrated the coexpression of cardiac and skeletal TnT RNAs in fetal heart and skeletal muscle, together with increased and decreased accumulation of cTnT RNAs during development in cardiac and skeletal muscle, respectively.15 In addition, this work, based on sequence analysis, provided evidence that cardiac and skeletal TnTs were encoded by distinct genes. The aim of the present study was to locate the cTnT gene, to clone new cTnT isoforms from a fetal heart cDNA library, to look for the existence of the corresponding RNAs in fetal and adult ventricles by RNase protection studies, and to compare their expression in normal and failing ventricles.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Materials
Human heart tissues were obtained in accordance with the guidelines of our institutional ethics committee. A ventricular sample was obtained from a 29-week-old fetus after therapeutic abortion. Adult ventricular samples were obtained either from patients with end-stage heart failure at the time of transplantation (n=6: 3 ischemic heart disease, 1 idiopathic dilated cardiomyopathy, 1 postadriamycin cardiomyopathy, 1 multivalvular heart disease; mean age=46.5±18.7 years) or from potential donors whose hearts were unacceptable for transplantation for noncardiac reasons (n=8; mean age=31.2±6.7 years). Tissues were rapidly frozen in liquid nitrogen and stored at -80°C.
Isolation of Human cTnT cDNAs
A 1087-bp polymerase chain reaction (PCR) product of the first
human cTnT cDNA (HCTNT1)15 was used as a probe to screen a
commercial fetal human heart cDNA library constructed in 
gt11 using
22-week-old fetuses (Clontech). The library was screened by plating
50x103 plaque-forming units (pfu) according to Benton and
Davis.16 Hybridization was carried out at 65°C for 3
hours in Rapid Hybridization Buffer (Amersham), with the
[
-32P]dCTP-labeled probe (0.6x106
cpm/mL). Filters were washed three times in 2xSSC for 15 minutes and
once in 1xSSC/0.1% SDS for 15 minutes at room temperature, then in
1xSSC/0.1% SDS at 50°C for 10 minutes. If necessary, a final wash
was performed in 0.1xSSC/0.1% SDS at 50°C for 10 minutes. Filters
were then autoradiographed with intensifying screens (Du Pont).
Isoform Selection and Characterization
The specificity of isolated clones was assessed by means of PCR
with the cTnT-specific primers 1F-1R or 2F-2R (1F=
-1GGAGAGCAGAGACCATGT16;
1R=266ACTCTCTCTCCATCGGGGATC246;
2F=377CTCTCAAAGACAGGATCGAG396;
2R=885CAGGCTCTATTTCCAGCG868; numbers refer to
the sequence published by Mesnard et al.15 ). Human cTnT
cDNAs were screened for variable boxes in the 5' and 3' halves, based
on PCR product lengths with primers 1F-1R and 3F-3R
(3F=521ATGAGGCCCGGAAGAAGAAGG541; 3R=
667GCACCTTCCTCCTCTCAGCCAG646), respectively.
PCR products obtained with primers 1F-1R and that were expected
to differ by 30 bp were separated on 1% agarose gel. PCR products
obtained with primers 3F-3R and expected to differ by a few base pairs
were separated on 3.5% MetaPhor gel (FMC BioProducts).
cDNA Sequencing
PCR products amplified between nucleotides -1 to 888 and 376 to
888, using primers 1F-2R and 2F-2R, respectively, and cDNA clones
isolated from the fetal library as templates were sequenced either
directly or after subcloning in pCR II plasmid using the TA Cloning kit
(Invitrogen). The Taq DyeDeoxy Terminator Cycle Sequencing kit (Applied
Biosystems) was used for sequencing reactions in an automated sequencer
driven by Applied Biosystems model 373A.
Location of the Human cTnT Gene
The cTnT gene was located by using fluorescence in situ
hybridization (FISH). Metaphases were obtained from
phytohemagglutinin-stimulated lymphocytes of a healthy donor after
thymidine synchronization and bromodeoxyuridine
incorporation.17 As probe, we used a PCR product of 1054
bp obtained using primers 1F-5R
(5R=1052ATTACTGGTGTGGAGTGGG1034) and as
template, a cDNA isolated from the fetal heart cDNA library (F-II-13,
see below). This PCR product was labeled with biotinyl-11-dUTP (Sigma)
by random priming. In situ hybridization was done using 25 ng/mL of
probe, according to Pinkel et al.18 R bands were obtained
as described by Lemieux et al.19 Slides were examined with
an Axiophot Zeiss microscope. Ektachrome ASA 320 T color slide film was
used throughout.
RNase Protection Assays
Total RNA was prepared according to the method of Chomczynski
and Sacchi20 and quantified densitometrically at 260-280
nm. One riboprobe specific for the 5' half and two riboprobes specific
for the 3' halves of human cTnT were prepared by subcloning (in pCR II)
three PCR products (amplified between nucleotides -1 to 483, 377 to
885, and 521 to 885) obtained using clone F-I-15 (isolated from the
fetal heart cDNA library and identical to clone F-II-13, see below) as
template and primers 1F-4R
(4R=483AGCCCTCTCTTCAGCCAGGC464), 2F-2R, and
3F-2R. The three PCR products were sequenced to check for the absence
of mutations during PCR and the corresponding plasmids were linearized,
prior to in vitro transcription with SP6 or T7 polymerase using the
Gemini II transcription kit (Promega) and [-32P]UTP.
The specific activity of the probes was 2 to 3x108
cpm/µg. RNase protection assay (RPA) was performed using the RPA II
kit (Ambion) according to the manufacturer's instructions. In typical
experiments, 5 µg of total RNA purified from cardiac samples was
hybridized with 0.2 to 0.3 ng of the radiolabeled cRNA probe at 45°C
for 16 hours. Unhybridized RNAs were digested with a mix of RNases A
and T1 for 30 minutes at 37°C. Several dilutions of RNases were used
to reduce artifactual fragments when necessary. The same amount of
yeast total RNA was used as a control and the hybridization reaction
was either digested (+) by RNases or left undigested (-). Protected
probe fragments were separated by electrophoresis in a 5%
polyacrylamide/8 mol/L urea gel at 250 V for 6 hours, and gels were
exposed to Cronex film with intensifying screens (Du Pont) for 6 to 60
hours. A 0.16-1.77 kb ladder (Gibco BRL) was used to determine the size
of protected fragments. After the run, the ladder lane was cut free
from the gel and the RNA bands were visualized using a silver staining
kit (Bio-Rad).
Statistical Analysis
To compare RPA band patterns between control and failing
ventricles, autoradiograms were scanned densitometrically using the
Starwise imaging system (Imstar). The accumulation of bands resulting
from RNase digestion is expressed as the percentage of their optical
density relative to that of the fully protected fragment in the
corresponding lane. Values are mean±SEM. Control and failing
ventricles were compared using the nonparametric Mann-Whitney test. The
threshold of statistical significance was set at P<.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Thirty metaphase spreads were examined to locate the human cTnT gene. Twenty-four of these spreads gave a fluorescent signal in the 1q31-1q32 region. We observed fluorescent spots on four chromatids in one metaphase, three in 4 metaphases, two in 11 metaphases, and one in 8 metaphases. 86% of these fluorescent spots were located on q32 (Fig 1
). Twenty-one nonspecific spots were scattered
throughout the other chromosomes, and no secondary peak was
detected.
|
TnT clones were isolated by screening the fetal human heart cDNA
library, with a 1087-bp HCTNT1 PCR product as probe.15 To
ensure cTnT specificity and insert length, PCR using cTnT primers and
two gt11-specific primers, respectively, were performed. Among 16
selected clones, 8 were full-length clones (ie, amplified using primers
1F and 2R complementary to the 5' and 3' ends of the cDNA coding
sequence, respectively) and 8 lacked 
200 bp of the 5' end. The
clones were checked for 5' and 3' variability by PCR with cTnT-specific
primers 1F-1R and 3F-3R (data not shown). Three of the 8 full-length
clones yielded a PCR product longer than that obtained with clone
HCTNT2,15 with about 30 extra bp in the 5' half of the
cTnT coding sequence. The entire coding region of five of these eight
full-length clones was amplified using primers 1F-2R (nucleotides -1
to 885) and then directly sequenced (Fig 2). Two clones,
designated F-I-15 and F-II-13, were identical to the previously
published sequence,15 except for two nucleotide
substitutions (G
A and GCCG) resulting in ArgLys and SerThr
amino acid substitutions at positions 129 and 239, respectively. These
substitutions were also found in all the sequenced TnT clones isolated
from the fetal heart cDNA library, which allowed us to correct our
previously published sequence.15 This is in agreement with
the cTnT sequence recently published by Townsend et al.21
Interestingly, we identified between nucleotides 78 and 79 of the
published sequence15 an additional box of either 30 bp
coding for EEEDWREDED in clones F-II-10 and F-II-16 or 27 bp coding for
EEDWREDED in clone F-II-18. In addition, codon 45 (GAA, comprising
nucleotides 145 to 147) was lacking in clones F-II-16 and F-II-18 but
present in clones F-II-10, F-II-13, and F-I-15. Finally, PCR
products obtained using primers 3F-3R in the 3' half of the cDNAs
separated into fragments of three different lengths on 3.5% MetaPhor
gel, suggesting the existence of a variable domain in the 3' half.
These PCR products were subcloned in pCR II and sequenced. This allowed
us to identify three types of clones differing with respect to a 9-bp
box (CAG GCC CAG, nucleotides 583 to 591 of the HCTNT1 clone sequence),
as follows: eight clones possessing the entire 9-bp box in HCTNT1
(F-I-15, F-II-13, F-II-18, F-II-16, and four truncated clones), three
clones lacking the 9-bp box (all truncated), and two clones lacking
only the first three bp (F-II-10 and one truncated clone).
|
To confirm the existence of these variable regions, we performed RPA
with riboprobes, each complementary to one half of the cTnT mRNA
isoform encoded by clone F-I-15. The 5' riboprobe was first hybridized
with RNAs purified from fetal and both normal and failing adult left
ventricles; RNA-RNA duplexes were digested and separated on gel (Fig 3A). Four protected fragments were detected in all the
samples tested: one was a major fragment of 480 bp, while three were
minor fragments of 400, 330, and 150 bp. This result showed the
existence, at the RNA level, of the two variable regions in the 5' half
of the cDNA, ie, the 30-bp box and codon 45 beginning at nucleotide 145
(Fig 3B). The 3' riboprobe, containing the entire 9-bp variable box,
was then hybridized to RNAs purified from adult ventricles. After
digestion of the RNA-RNA duplexes with various RNase concentrations
(1/100, 1/500, and 1/1000), four fragments of 510, 300, 290, and 200
bp were detected (Fig 4A), corresponding to those
expected from the three forms potentially engendered by the 3' variable
box (Fig 4B). A similar band pattern was observed with RNA from the
fetal ventricle (not shown).
|
|
To look for differential expression of mRNAs corresponding to the three
variable regions described above (see Fig 2
), we compared protected
fragments obtained separately after hybridization of the two 5' and 3'
riboprobes with RNAs purified from six failing and eight control adult
left ventricles (Fig 5). The 5' riboprobe yielded a
slight increase in the intensity of the 405-bp band corresponding to
fetal isoforms in some failing samples compared with several normal
samples (Fig 5A; samples P1, P2, and P3 vs samples C4 and C5). However,
because of heterogeneity within control samples, there was no
significant difference ([OD band 405/OD band 485]x100=5.4±1.0% in
control vs 5.8±1.2% in failing ventricles, P=NS). Similar
results were obtained for the 336-bp band. Finally, no difference in
the intensity of protected fragments between control and failing
samples was found using the 3' riboprobe (Fig 5B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study confirms the recent assignment of the human cTnT gene to chromosome 1q21 and refines the location of the gene to 1q32 by physical mapping. No signal was observed on any other chromosome that might be accounted for by another troponin family gene. This chromosomal location supports our previous hypothesis that cardiac and slow skeletal TnT are encoded by distinct genes.15
Sequencing of five clones isolated from the fetal human heart cDNA
library identified two variable boxes in the 5' half of cTnT cDNA. The
first box is composed of 30 bp coding for 10 amino acids (EEEDWREDED)
and defining a highly acidic domain, which can be excised of the first
amino acid (E) (Fig 2). The resulting 27-bp box in the 5' region of
F-II-18 is identical to that recently reported by Townsend et
al,21 but the existence of an additional amino acid at the
5' end of this box in two other cDNAs (F-II-10 and F-II-16) shifts the
limits of the variable domain by one amino acid (between amino acids 22
and 23 of the sequence published by Mesnard et al15 ). This
variability in the additional box in the fetal ventricle has not been
described in any fetal isoform so far isolated from other species, and
we still do not know whether the first amino acid (E) and the other
nine (EEDWREDED) belong to the same exon. A second region of
variability was identified in the 5' half of the cDNA in two of the
three fetal cTnT clones (F-II-16 and F-II-18), comprising a deletion of
amino acid 45 located at position 145 of the HCTNT2 sequence (Fig 2).
The existence of these two variable boxes in the 5' half of the cTnT
cDNA (the 30-bp box and amino acid 45) was confirmed by RPA in both
fetal and adult hearts (Fig 3). This RPA did not discriminate forms
with the additional 30-bp box from those with the additional 27-bp box.
However, the facts that the additional 27-bp box was recently described
by Townsend et al21 and that two independent clones
isolated from our human heart cDNA library contained the 30-bp box
suggest that these isoforms are expressed at the RNA level.
Interestingly, the existence of a protected fragment of approximately
150 bp points to the existence of a new form lacking the 30- or 27-bp
box and amino acid 45 (Fig 3). This demonstrates that splicing of the 3
bp coding for amino acid 45 is not specific to forms containing the
additional 27- or 30-bp box.
Anderson et al14 and Townsend et al21 (at the
protein level and at RNA level, respectively) detected a fetal isoform
which is apparently shorter than that lacking the 27- or 30-bp box and
which could correspond to a fetal isoform described in rabbit heart
which lacks the 30 bp plus an 18-bp box located 3 bp upstream of the
latter.11 Townsend et al21 found that this
isoform was no longer detected, at the RNA level by RT-PCR, in fetuses
older than 16 weeks. This could explain why we did not isolate the
corresponding cDNA by screening our fetal heart cDNA library, since it
was constructed using hearts from 22-week fetuses. Moreover, this
latter form should give a protected fragment of 408 bp in RPA with the
613-bp 5' riboprobe, which probably could not be separated from the
405-bp protected fragment (Fig 3).
A third variable region was identified in the 3' half of the cDNA (CAG
GCC CAG) which can be totally or partially excised (GCC CAG). The
presence of the three resulting forms in adult and fetal ventricles was
confirmed by RPA. This variable box codes for three nonpolar amino
acids (Gln-Ala-Gln) identical to those encoded by the 3' variable
region described in rat12 and rabbit11
hearts. It would be interesting to determine the relative amounts of
these various isoforms at a given age and whether or not their
expression is regulated during development. The physiological
significance of such a small variable domain is unknown, but this
domain may be specific for mammalian cTnT, since it was found in
bovine,22 rabbit,23 and rat12
hearts, but not in chick heart9 or in skeletal muscles
from quail,24 chicken,25 rat,26
and human.5 If, in man as in rat, the 9-bp box constitutes
a single exon, the splicing of its first 3 bp may involve an internal
splice site.12 This could also be the case for the first 3
bp of the 30-bp box in the 5' half of TnT cDNA if the 30-bp box belongs
to the same exon. Finally, a total of 18 potential isoforms could be
generated by combining the three alternatively spliced boxes
characterized above. Five have so far been identified at the RNA level:
the first by our team,15 the second by Townsend et
al,21 and the remaining three in this study (F-II-10,
F-II-16, F-II-18; see Fig 2).
Anderson et al,14 studying protein expression, reported a
10% to 20% accumulation of one fetal isoform (TnT2) in failing
ventricles compared with controls. Later, Solaro et al27
found an accumulation of this fetal isoform, again at the protein
level, in only 1 of 10 failing ventricles. Recently, Gulati et
al28 have shown, in a model of pressure overload
hypertrophy in the guinea pig, a shift from the higher molecular weight
toward the lower molecular weight TnT bands. We studied the expression
of the isoforms described above at the RNA level by means of RPA with
the two riboprobes complementary to the 5' and 3' halves of cTnT RNAs,
in six failing and eight control ventricles. No difference in the
expression of the 9-bp box between normal and failing ventricles was
found in the 3' half (Fig 5B). In the 5' half, despite a slight
increase in the intensity of the bands corresponding to fetal isoforms
(405 and 336 bp, Fig 5) in some failing ventricles compared with some
controls, no significant difference was observed between the two
groups. On the basis of the various TnT cDNA isoforms described by
Greig et al11 in rabbit heart and the electrophoretic
pattern of expressed isoforms, cDNA coding for TnT2 should lack the two
cassettes of approximately 15 bp and 30 bp in the 5' half. Therefore,
if present at the RNA level, TnT2 should yield, when hybridized
with the 5' riboprobe, protected fragments of 408 and 336 bp if codon
45 is present or absent, respectively. If the 408-bp fragment was
produced during our RPA experiments, it was probably inseparable from
the 405-bp fragment. We observed no significant increase in 405-408–bp
or 336-bp bands in failing human ventricles relative to controls. This
may be due to the noticeable variability in the intensity of the bands
corresponding to fetal isoforms within each patient group (5.4±1.0%
[range, 1.9–11] in control vs 5.8±1.2% [range, 3–9] in failing
ventricles). The reason for such variability is unclear, although it is
worth noting that patients in the control group underwent life supports
of markedly variable durations. It is also possible that our RPA
technique is not sufficiently sensitive to detect small differences. In
any event, no major accumulation of fetal TnT mRNA isoforms appears to
occur in the human ventricle during end-stage heart failure.
In conclusion, these results point to the multiplicity of TnT isoforms in the human heart and to an even greater number of potential isoforms that may be generated by combining variable cassettes. Up to 36 isoforms could be produced by splicing of the three variable boxes described above and the putative fourth variable box.14 21 Recently, Thierfelder et al13 have identified, in familial hypertrophic cardiomyopathies linked to chromosome 1, three point mutations in the cTnT gene, one of which involves a splice donor sequence. Interestingly, these mutations do not involve any of the variable regions reported in the present paper and especially the region of the acidic domain assumed to play an important role in myofibrillogenesis. This emphasizes the importance of keeping on with studies on the human cTnT gene and its expression, in order to elucidate the mechanisms that lead to pathological cardiac phenotypes.
|
Acknowledgments |
|---|
This work was supported in part by grants from the Association Française contre les Myopathies, the Fédération Française de Cardiologie, the Fondation pour la Recherche Médicale, the Fondation de France, and the Caisse Régionale d'Assurance Maladie de I'lle de France (CRAMIF). The authors are grateful to Dr P.D. Allen, Department of Anesthesiology, Brigham and Women's Hospital, Boston, Mass, and to the surgical team of Pr J.Y. Neveux, Hôpital Marie Lannelongue, for their assistance in obtaining the tissues used in these experiments. The authors also thank Dr Marc Fiszman for his constructive comments and David Young for his help in preparing this manuscript.
Received November 8, 1994; accepted December 27, 1994.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. McAuliffe JJ, Gao L, Solaro RJ. Changes in myofibrillar activation and troponin C Ca2+ binding associated with troponin T isoform switching in developing rabbit heart. Circ Res. 1990;66:1204-1216.
2.
Nassar R, Malouf NN, Kelly MB, Oakeley AE, Anderson PAW.
Force-pCa relation and troponin T isoforms of rabbit myocardium.
Circ Res. 1991;69:1470-1475.
3. Schiaffino S, Gorza L, Ausoni S. Troponin isoform switching in the developing heart and its functional consequences. Trends Cardiovasc Med. 1993;3:12-17.
4. Breitbart RE, Nguyen HT, Medford RM, Destree AT, Mahdavi V, Nadal-Ginard B. Intricate combinatorial patterns of exon splicing generate multiple regulated troponin T isoforms from a single gene. Cell. 1985;41:67-82. [Medline] [Order article via Infotrieve]
5.
Gahlmann R, Troutt AB, Wade RP, Gunning P, Kedes L.
Alternative splicing generates variants in important functional domains
of human slow skeletal troponin T. J Biol Chem. 1987;262:16122-16126.
6. Samson F, Mesnard L, Mihovilovic M, Potter TG, Mercadier JJ, Roses AD, Gilbert JR. A new human slow skeletal troponin T (TnTs) mRNA isoform derived from alternative splicing of a single gene. Biochem Biophys Res Commun. 1994;199:841-847. [Medline] [Order article via Infotrieve]
7. Samson F, Lee JE, Hung WY, Potter TG, Herbstreith M, Roses AD, Gilbert JR. Isolation and localization of a slow troponin (TnT) gene on chromosome 19 by subtraction hybridization of a cDNA muscle library using myotonic dystrophy muscle cDNA. J Neurosci Res. 1990;27:441-451. [Medline] [Order article via Infotrieve]
8. Samson F, De Jong PJ, Trask BJ, Koza-Taylor P, Speer MC, Potter T, Roses AD, Gilbert JR. Assignment of the human slow skeletal troponin T gene to 19q13.4 using somatic cell hybrids and fluorescence in situ hybridization analysis. Genomics. 1992;13:1374-1375. [Medline] [Order article via Infotrieve]
9.
Cooper TA, Ordahl CP. A single cardiac troponin T gene
generates embryonic and adult isoforms via developmentally regulated
alternate splicing. J Biol Chem. 1985;260:11140-11148.
10.
Jin JP, Lin JJC. Isolation and characterization of cDNA clones
encoding embryonic and adult isoforms of rat cardiac troponin T.
J Biol Chem. 1989;264:14471-14477.
11.
Greig A, Hirschberg Y, Anderson PAW, Hainsworth C, Malouf NN,
Oakeley AE, Kay BK. Molecular basis of cardiac troponin T isoform
heterogeneity in rabbit heart. Circ Res. 1994;74:41-47.
12. Jin JP, Huang QQ, Yeh HI, Lin JJC. Complete nucleotide sequence and structural organization of rat cardiac troponin T gene. J Mol Biol. 1992;227:1269-1276. [Medline] [Order article via Infotrieve]
13.
Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W,
Vosberg HP, Seidman JG, Seidman CE. -Tropomyosin and cardiac
troponin T mutations cause familial hypertrophic cardiomyopathy: a
disease of the sarcomere. Cell. 1994;77:701-712. [Medline]
[Order article via Infotrieve]
14.
Anderson PAW, Malouf NN, Oakeley AE, Pagani ED, Allen PD.
Troponin T isoform expression in humans. Circ
Res. 1991;69:1226-1233.
15. Mesnard L, Samson F, Espinasse I, Durand J, Neveux JY, Mercadier JJ. Molecular cloning and developmental expression of human cardiac troponin T. FEBS Lett. 1993;328:139-144. [Medline] [Order article via Infotrieve]
16.
Benton WD, Davis RW. Screening gt recombinant clones by
hybridization to single plaques in situ. Science. 1977;196:180-182.
17. Viegas-Pequignot E, Dutrillaux B. Une méthode simple pour obtenir des prométaphases. Ann Genet. 1978;21:121-125.
18.
Pinkel D, Straume T, Gray JW. Cytogenetic analysis using
quantitative, high-sensitivity, fluorescence hybridization. Proc
Natl Acad Sci U S A. 1986;83:2934-2938.
19. Lemieux N, Dutrillaux B, Viegas-Pequignot E. A simple method for simultaneous R- or G-banding and fluorescence in situ hybridization of small single-copy genes. Cytogenet Cell Genet. 1992;59:311-312. [Medline] [Order article via Infotrieve]
20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159. [Medline] [Order article via Infotrieve]
21. Townsend PJ, Farza H, MacGeoch C, Spurr NK, Wade R, Gahlmann R, Yacoub MH, Barton PJR. Human cardiac troponin T: identification of fetal isoforms and assignment of the TNNT2 locus to chromosome 1q. Genomics. 1994;21:311-316. [Medline] [Order article via Infotrieve]
22. Leszyk J, Dumaswala R, Potter JD, Gusev NB, Verin AD, Tobacman LS, Collins JH. Bovine cardiac troponin T: amino acid sequences of the two isoforms. Biochemistry. 1987;26:7035-7042. [Medline] [Order article via Infotrieve]
23.
Pearlstone JR, Carpenter MR, Smillie LB. Amino acid sequence
of rabbit cardiac troponin T. J Biol Chem. 1986;261:16795-16810.
24.
Hastings KEM, Bucher EA, Emerson CP. Generation of troponin T
isoforms by alternative RNA splicing in avian skeletal muscle.
J Biol Chem. 1985;260:13699-13703.
25.
Smillie LB, Golosinska K, Reinando F. Sequences of complete
cDNAs encoding four variants of chicken skeletal muscle troponin T.
J Biol Chem. 1988;263:18816-18820.
26. Breitbart RE, Nadal-Ginard B. Complete nucleotide sequence of the fast skeletal troponin T gene: alternative spliced exons inhibit unusual interspecies divergence. J Mol Biol. 1986;188:313-324. [Medline] [Order article via Infotrieve]
27. Solaro RJ, Powers FM, Gao L, Gwathmey JK. Control of myofilament activation in heart failure. Circulation. 1993;87(suppl VII):38-43.
28. Gulati J, Babu A, Nikolic SD, Starc V, Siri F. Shifts in contractile regulatory protein subunits troponin T and troponin I in cardiac hypertrophy. Biochem Biophys Res Commun. 1994;202:384-390.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  D. C Gaze and P. O Collinson Multiple molecular forms of circulating cardiac troponin: analytical and clinical significance Ann Clin Biochem, July 1, 2008; 45(4): 349 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Adamcova, M. Sterba, T. Simunek, A. Potacova, O. Popelova, and V. Gersl Myocardial regulatory proteins and heart failure Eur J Heart Fail, June 1, 2006; 8(4): 333 - 342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. S. Dhalla, M. R. Dent, P. S. Tappia, R. Sethi, J. Barta, and R. K. Goyal Subcellular Remodeling as a Viable Target for the Treatment of Congestive Heart Failure Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2006; 11(1): 31 - 45. [Abstract] [PDF]
|
|
|
|
 |
|
 S. B. Marston and C. S. Redwood Modulation of Thin Filament Activation by Breakdown or Isoform Switching of Thin Filament Proteins: Physiological and Pathological Implications Circ. Res., December 12, 2003; 93(12): 1170 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Ricchiuti and F. S. Apple RNA Expression of Cardiac Troponin T Isoforms in Diseased Human Skeletal Muscle Clin. Chem., December 1, 1999; 45(12): 2129 - 2135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. F Purcell, W. Bing, and S. B Marston Functional analysis of human cardiac troponin by the in vitro motility assay: comparison of adult, foetal and failing hearts Cardiovasc Res, September 1, 1999; 43(4): 884 - 891. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Bonne, L. Carrier, P. Richard, B. Hainque, and K. Schwartz Familial Hypertrophic Cardiomyopathy : From Mutations to Functional Defects Circ. Res., September 21, 1998; 83(6): 580 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Morimoto, F. Yanaga, R. Minakami, and I. Ohtsuki Ca2+-sensitizing effects of the mutations at Ile-79 and Arg-92 of troponin T in hypertrophic cardiomyopathy Am J Physiol Cell Physiol, July 1, 1998; 275(1): C200 - C207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Schaub, M. A. Hefti, R. A. Zuellig, and I. Morano Modulation of contractility in human cardiac hypertrophy by myosin essential light chain isoforms Cardiovasc Res, February 1, 1998; 37(2): 381 - 404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. O. Collinson To T or Not to T, That Is the Question Clin. Chem., March 1, 1997; 43(3): 421 - 423. [Full Text] [PDF]
|
|
|
|
 |
|
 J.-F. Forissier, L. Carrier, H. Farza, G. Bonne, J. Bercovici, P. Richard, B. Hainque, P. J. Townsend, M. H. Yacoub, S. Faure, et al. Codon 102 of the Cardiac Troponin T Gene Is a Putative Hot Spot for Mutations in Familial Hypertrophic Cardiomyopathy Circulation, December 15, 1996; 94(12): 3069 - 3073. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||