Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1995;76:681-686

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anderson, P. A. W.
Right arrow Articles by Kay, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anderson, P. A. W.
Right arrow Articles by Kay, B. K.
(Circulation Research. 1995;76:681-686.)
© 1995 American Heart Association, Inc.


Articles

Molecular Basis of Human Cardiac Troponin T Isoforms Expressed in the Developing, Adult, and Failing Heart

Page A. W. Anderson, Ann Greig, Trisha M. Mark, Nadia N. Malouf, Annette E. Oakeley, Ross M. Ungerleider, Paul D. Allen, Brian K. Kay

From the Departments of Biology (A.G., T.M.M., B.K.K.) and Pathology (N.N.M.), University of North Carolina, Chapel Hill; the Department of Anesthesiology, Brigham and Women's Hospital (P.D.A.), Boston, Mass; and the Departments of Surgery (R.M.U.) and Pediatrics, Division of Pediatric Cardiology (P.A.W.A., A.E.O.), Duke University, Durham, NC.

Correspondence to Page A.W. Anderson, MD, Professor of Pediatrics, Duke University Medical Center, Box 3218, Durham, NC 27710. E-mail ander005@mc.duke.edu.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Cardiac troponin T (cTnT), a protein essential for calcium-regulated myofibrillar ATPase activity, is expressed in the human heart as four isoforms (cTnT1 through cTnT4, numbered in the order of decreasing molecular size). The expression of these isoforms at the protein level has previously been found by us to differ in the normal and failing adult and fetal human heart. In the present study, we have cloned and sequenced four full-length cDNAs corresponding to the four native cTnT protein isoforms and have expressed these cDNAs in an in vitro transcription and translation system. The cDNAs differ by the variable inclusion of a 15- and a 30-nt exon in the 5' half of the coding region. These cDNAs yielded proteins that comigrate with the native isoforms, cTnT1 through cTnT4. Polyclonal antisera, raised against a synthetic peptide corresponding to the 10-residue peptide encoded by the 30-nt exon, reacted with the two human isoforms largest in molecular size (cTnT1 and cTnT2) and the two largest cTnT isoforms of the rabbit and rat. The isoforms cTnT1 and cTnT2, containing either both peptides encoded by the 30- and 15-nt exons or the peptide encoded by the 30-nt exon alone, are expressed in the fetal heart, with cTnT2 being expressed at a very low level. cTnT4, lacking both of these sequences, is expressed in the fetal heart and is reexpressed in the failing adult heart, whereas cTnT3, containing the 5-residue peptide, is the dominant isoform in the adult heart. The identification and acquisition of these full-length clones that encode the four human cTnT isoforms should prove valuable in analyzing genomic DNA, identifying cTnT mutations in these alternatively spliced coding sequences and their splice sites, and studying the functional role of these isoform sequence differences in the normal and the diseased human heart.


Key Words: fetus • newborn • familial hypertrophic cardiomyopathy • rabbit • rat • alternative splicing


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Troponin T is a component of the troponin complex that regulates cardiac muscle contraction.1 2 The complex also contains troponin I, which inhibits thick- and thin-filament interaction, and troponin C, whose binding of calcium disinhibits this interaction. Troponin T binds the complex to tropomyosin and confers onto the myofilaments their calcium concentration–dependent ATPase activity.2 Multiple cardiac troponin T (cTnT) isoforms are expressed in the mammalian heart,3 4 5 6 7 8 9 10 whereas troponin C11 and troponin I12 are expressed as single isoforms in the adult heart. Interestingly, in the human heart four cTnT isoforms are expressed in a developmentally regulated manner.3 This expression in the human heart is affected by heart failure.3

The importance of troponin T in proper muscle function and myofibril formation has become evident through mutational analysis. In insect flight muscle, troponin T mutations produce abnormal myofibrillogenesis and function.13 In humans, Thierfelder et al14 have recently found that affected members of some families with hypertrophic cardiomyopathy have cTnT mutations.

The functional significance of expressing multiple cTnT isoforms is supported by a correlation between peak myofibrillar ATPase activity and isoform expression in donor and failing human left ventricular myocardium.3 This functional importance is further supported by the correlation between certain rabbit15 and bovine16 cTnT isoforms and the sensitivity of their myofilaments to calcium and between rabbit cTnT isoform expression and its myofilament calcium binding.17

As a first step toward understanding the functional significance of the diversity of cTnT isoform expression in the human heart, we have deduced from four full-length cDNAs the amino acid sequences of the four human cTnT isoforms and demonstrated that the products encoded by these four cDNAs comigrate with the four native isoforms. Based on the existence of a single cTnT gene,18 19 our sequence analysis demonstrates that combinatorial alternative splicing of two 5' exons yields the four human isoforms and suggests that in the mammalian heart combinatorial alternative splicing of these two 5' exons is the general mechanism for producing the four commonly found cTnT isoforms.3 6 20 In light of previous functional assessments, these sequence differences among the isoforms may play a role in modulating myofilament function.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Isolation and Characterization of Human cTnT cDNA
MAb 13-11, a mouse monoclonal antibody that recognizes a cardiac-specific troponin T epitope,6 was used to screen two {lambda} Zap II adult human heart cDNA libraries. Two clones, {approx}2 kb and 1 kb in length, were isolated and sequenced by the dideoxy chain termination method21 and automated fluorescent dideoxy chain termination (UNC DNA Sequencing Facility).

The 2-kb clone contained a 54-nt 5' untranslated sequence and 639-nt coding sequence, whereas the 1-kb clone contained, except for the start codon, an entire cTnT coding sequence and the 3' untranslated region including the polyadenylation signal. Polymerase chain reaction (PCR) was used to introduce the missing first 3 nt of the coding sequence, yielding a full-length cDNA from the 1-kb clone. A full-length cDNA with the same sequence and three additional full-length cDNAs were obtained by using reverse transcriptase (RT)–PCR with primers designed from the 5' and 3' noncoding regions of the consensus cDNA.

RT-PCR and Cloning
Total RNA was isolated from human heart tissue, as previously described.20 RNA was isolated from neonatal cardiac tissue that was removed to surgically repair a congenital heart defect after informed consent was obtained and from fetal heart tissue obtained at the time of therapeutic abortion under protocols approved by Brigham and Women's Hospital Institutional Committee for the Protection of Human Subjects. cDNA was synthesized with oligo dT and AMV reverse transcriptase (Promega), according to the manufacturer's directions. PCR was performed on the newly synthesized cDNAs with Taq DNA polymerase (Promega) and oligonucleotide primers designed from the original cDNA clones (see Fig 1Down legend). Samples were denatured at 94°C for 1 minute, annealed to the primers for 2 minutes at 58°C, and extended at 72°C for 3 minutes for a total of 25 cycles. RT-PCR products were separated on gels composed of 3% Nu-Sieve (FMC Bioproducts) and 1% agarose (United States Biochemicals).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide and deduced amino acid sequence of the human cardiac troponin T3 cDNA (see Fig 2Up). Both strands were sequenced by the dideoxy method.21 Only the coding strand and long open reading frame are shown. Some full-length cDNAs obtained with reverse transcriptase–polymerase chain reaction differed from the 5' region of this sequence by the variable inclusion of 15- and 30-nt exons (Fig 2Up). The underlining identifies the peptide that contains the epitope of MAb 13-11, a mouse monoclonal antibody that recognizes a cardiac-specific troponin T epitope,6 used in the Western blot experiments (see Fig 4Up) and the putative poly(A) addition signal (AATAAA). The 5' untranslated region contains 8 nt more than the sequence of Townsend et al.23 The exact positions of the oligonucleotide primers used for cDNA amplification were as follows: o2820, nucleotides 745 to 725; o3150, nucleotides 46 to 63; o3152, nucleotides 305 to 276; o3153, nucleotides 429 to 449; o3155, nucleotides 1006 to 989; and o3156, nucleotides 59 to 77. The primer sequences in a 5' to 3' orientation are as follows: o2820, CAGCTGATCTTC ATTCAGGTG; o3150, AGCCAATCTAGAAGAGCAGAGACCATGTC; o3152, CCATCGGGG ATCTTGGGAGGC; o3153, AAGACAGGATCGAGAGACGTC; o3155, TGATAACTCGAGGGA GGGCCCGGGAACTG; and o3156, CTATGAAAGCTTATGTCTG ACATAGAA GAG.

To search for heterogeneity in the 5' end of the troponin T coding region, primers o3150 and o3152 (Fig 1Up legend) were used to generate PCR products that were excised from an agarose gel, cleaved at the Xba I restriction site carried by o3150 and at an internal Sau3A restriction site, and cloned into pBluescript KS+ at the Xba I and BamHI sites (Stratagene). Primers o3153 and o2820 (Fig 1Up legend), designed from the 3' region of the full-length clone, were used to generate RT-PCR products that were restricted at internal Sau3A sites and cloned into pBluescript KS+ at the BamHI site. Full-length RT-PCR products were generated by using primers corresponding to 5' and 3' untranslated sequences, o3150 and o3155, respectively. The resulting cDNAs were cleaved at Xba I and Xho I sites, carried by the primers, and cloned into Bluescript KS. Positive transformants of all constructs were identified by color selection and sequenced with Sequenase, following the manufacturer's recommendations (United States Biochemicals).

We found the in vitro translational efficiency of the cTnT3 cDNA, which was derived from the library screen and contained 185 bp of 3' untranslated sequence, including a polyadenylation signal, to be greatly enhanced over the cDNAs generated by RT-PCR. For this reason, we used a Sac I restriction site (nucleotide 417), common to all the isoforms, to construct cDNAs that contained this additional 3' untranslated sequence and used these cDNAs for in vitro translation reactions.

In Vitro Transcription and Translation
Full-length troponin T cDNAs, encoding proteins cTnT1 through cTnT4, were transcribed and translated in vitro (TnT lysate system, Promega) in the presence of [35S]methionine. The translation products were denatured in sodium dodecyl sulfate (SDS) loading buffer and resolved in a 7.5% polyacrylamide gel.

Western Blots
SDS–polyacrylamide gel electrophoresis was used to resolve the proteins of human fetal hearts, adult donor hearts that could not be used for transplantation, failing adult human ventricular myocardium, neonatal and adult rabbit ventricular myocardium, and fetal and adult rat ventricular myocardium.4 The conditions used in the present study were identical to those described previously,4 except that the polyacrylamide concentration was 7.5%. Proteins were transferred to polyvinylidene difluoride (PVDF) and reacted with MAb 13-11 or polyclonal antisera, as previously described.22 Polyclonal antisera were raised against the synthetic peptide KGGEEDWREDEDE, which includes the sequence encoded by the alternatively spliced 30-nt sequence found in human and rabbit cTnT1 and cTnT2 isoforms20 (Fig 2Down). Immune complexes were detected on the blots by using alkaline phosphatase–linked goat anti-mouse immunoglobulin antibodies, nitro blue tetrazolium, and 5-bromo-4-chloro-3-indolyl phosphate.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Human cardiac troponin T (TnT) 5' heterogeneity. Nucleotide and deduced amino acid sequences are shown of the variably included or excluded 15- and 30-nt sequences identified by sequencing reverse transcriptase–polymerase chain reaction products of the 5' end of cardiac TnT cDNA. The sequences were confirmed by sequencing full-length cDNAs.

Human fetal ventricular myocardial proteins and the in vitro–transcribed 35S-translated products of the human cTnT cDNAs were resolved in SDS-polyacrylamide gels. After transfer of the proteins to PVDF and development of the color reaction, the membrane was exposed to autoradiographic film.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
cDNA Isolation and Characterization
A 2-kb cDNA clone (clone 2.9) was isolated from an adult male human heart {lambda} cDNA library by using MAb 13-11.6 The clone contained 58 nt of the 5' noncoding sequence and 639 nt of the coding sequence (residues 1 to 213 of cTnT). The remainder of the clone corresponded to an unrelated sequence. A 1-kb cDNA clone was isolated from an adult female human heart {lambda} cDNA library by using MAb 13-11. This second clone encoded residues 2 to 288 of a cTnT isoform (Fig 1Up) and 185 nt of the 3' untranslated sequence, including the polyadenylation signal. As anticipated, both isolated clones contained the highly conserved sequence (PRSFMPNLVPPKI), which is the epitope of MAb 13-116 (Fig 1Up). The consensus between the two cDNA clones was an 867-nt coding region that encodes a protein of 288 amino acids (Fig 1Up), which matches one and is similar to another previously reported human cTnT cDNA.23 24

To ensure the accuracy of the coding sequence and the deduced amino acid sequence, RT-PCR was used to obtain full-length cDNAs. These full-length clones (see below for identification of other isoforms) confirmed that our consensus sequence and that of Townsend et al23 encode an identical protein while differing by two codons from the sequence reported by Mesnard et al.24 In our sequence and that of Townsend et al, codon 129 is AGA and encodes an arginine, whereas in the sequence of Mesnard et al, the codon is GGA and encodes a lysine. At position 239, AGC encodes a serine in our sequence and that of Townsend et al, whereas Mesnard et al report ACG, which encodes a threonine. RT-PCR, using primer pairs from the 5' and 3' untranslated regions, reproducibly yielded cDNA that encoded an arginine at 129 and a serine at 239, as did our clones obtained from library screening.

RT-PCR Identification of Additional Isoforms
Five full-length cDNAs were isolated by RT-PCR. Oligonucleotide primers positioned in the 5' and 3' untranslated regions (Fig 1Up legend) were used to generate the full-length cDNAs, which were subsequently cloned. Sequencing these cDNAs demonstrated that their length difference was a result of combinatorial alternative inclusion of a 30- and a 15-nt sequence in the coding region. Two clones contained both of the sequences, two contained the 15-nt sequence alone, and one contained neither sequence.

RT-PCR, using primers flanking the 5' half of the coding sequence, was performed to confirm the heterogeneity that was observed in the isolated full-length cDNAs. Four PCR products of different sizes were obtained. A Pvu II site within the alternatively spliced 15-nt sequence provided a convenient method for the assay of length differences among the PCR products. Over 200 cloned PCR products from five RT-PCR reactions were assayed in this manner: the majority comigrated with the Pvu II–cleaved products obtained from the full-length clone containing only the 15-nt exon. The identity of several clones was confirmed by sequencing. Eight clones contained both the 15- and 30-nt exons, 12 clones contained the 15-nt exon alone, 5 clones contained neither exon, and a single clone contained the 30-nt exon alone. It is apparent by Western blot (Fig 4Down) that the cTnT isoform containing only the 30-nt exon is rare. A full-length cDNA containing the 30-nt exon alone was generated by ligating this 5' PCR product to the remainder of the coding sequence from one of the full-length clones. The sequence differences among the four cDNAs are shown in Fig 2Up.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 4. A, The products of four different cardiac troponin T (cTnT) cDNA clones, transcribed and translated in vitro in the presence of [35S]methionine, comigrated with the native-filament isoforms, cTnT1 through cTnT4. The products were loaded with a myofibrillar preparation, from a fetus at 14 weeks of gestation, on 7.5% polyacrylamide gels, resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and transferred to polyvinylidene difluoride (Millipore). The immunoblot was probed with monoclonal antibody (MAb) 13-116 and exposed to X-ray film. In panel AI, the film and the blot were superimposed; lanes a, b, c, and d were loaded with products obtained by using cDNAs that contained the 15- and 30-nt sequences, the 30-nt sequence, the 15-nt sequence, or neither of these sequences, respectively. In panel AII, the autoradiograph was shifted to the right. B, Immunoblots of myofibrillar preparations from normal adult and fetal human hearts, failing adult (secondary to ischemic heart disease) and fetal human hearts, newborn and adult rabbit hearts, and adult and fetal rat hearts probed with MAb 13-11. C, Fetal human, newborn rabbit, and fetal rat heart preparations (which were probed with MAb 13-11 in panel B) probed with polyclonal antisera raised against a synthetic peptide containing the 10-residue sequence that is lost with development.

The 15-nt exon encodes a five-residue peptide, EAAVE, that corresponds to residues 18 to 22 of the predicted amino acid sequence of the consensus cTnT cDNA (Fig 1Up). This peptide sequence is present in sheep cTnT25 and is similar to the sequences present in cow and rabbit isoforms10 20 (Fig 3Down).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 3. Comparison of amino acid sequences in the hypervariable amino-terminal region of cardiac troponin T (cTnT) from six animal species. The 10–amino acid peptide encoded by a 30-nt exon (Fig 2Up) is absent in sheep25 and cows.10 The human cDNA is isoform cTnT1 (see Fig 2Up). The rabbit isoform is cTnT1 from Greig et al.20 The bovine sequence is from isoform TnT1 reported by Leszyk et al.10 The chicken and rat sequences were obtained from analyses of the chicken and rat cTnT genes.18 19 The chicken sequence is from the embryonic isoform reported by Cooper and Ordahl.18 The rat sequence is from the embryonic isoform reported by Jin and Lin,7 to which has been added, on the basis of our analysis of the rat cTnT gene, a five-residue peptide (underlined) encoded by an exon just 5' to the 30-nt exon, similar to the human 15-nt exon. The rabbit and sheep sequences were derived from cDNA analysis.20 25 Dashes are introduced to produce maximal matching of the sequences.

The 30-nt sequence encodes a peptide, EEEDWREDED, falling between residues 22 and 23 deduced from the consensus sequence (Fig 1Up). A previously reported RT-PCR fragment of human cTnT contained a 27-nt insertion in the same position.23 In our nine sequenced 5' RT-PCR clones that contained an additional sequence in this position, the sequence was always 30 nt in length. This cTnT 30-nt sequence encodes a 10-residue peptide that is identical to a peptide encoded by a 5' alternatively spliced 30-nt exon reported in rabbit20 and similar to the 10-residue peptides encoded by rat cTnT exon 47 19 and chicken cTnT exon 518 (Fig 3Up, and see below). From these data, we concluded that in human cTnT cDNA the sequence variably included in this position was 30 nt in length.

PCR reactions over the remainder of the coding sequence revealed no length heterogeneity. This differs from the rabbit and the rat, in which variable expression of a 9-nt exon, encoding QAQ and identified as exon 12 in the rat gene, yields QAQ, AQ, or complete exclusion of the exon.19 20 Sequencing 12 products from two fetal and newborn RT-PCR reactions revealed they all contained the 9-nt region, encoding QAQ. In five full-length cDNAs from RT-PCR and the two clones from the adult libraries, the 9-nt exon was always present. Thus, we found no variability in the splicing pattern of this exon in human cTnT cDNA. Although variable expression was not found, its presence in the rabbit and rat suggest that variable expression of this sequence may occur in the human heart, albeit with a low frequency.

In Vitro Expression of the Full-Length cDNAs
The four full-length cDNAs were expressed in vitro. The comigration of the native proteins with the translated products of the cDNAs is illustrated in Fig 4Up. The full-length cDNAs containing the 30- and 15-nt sequences, the 30-nt sequence alone, the 15-nt sequence alone, and neither of the two sequences yielded cTnT1, cTnT2, cTnT3, and cTnT4, respectively (Figs 2Up and 4Up). cTnT3 is the dominantly expressed isoform in the adult heart3 (Fig 4Up). cTnT4, which contains neither the 30-nt nor the 15-nt sequence, is a fetal isoform whose expression is increased in the failing human heart (Fig 4Up). The fetal isoform cTnT1 appears at a similar level with cTnT4 in the fetal heart (Fig 4Up), whereas cTnT2 appears at a very low level (Fig 4Up).

Polyclonal antisera, raised against the 10-residue peptide, EEDWREDEDE, reacted with the two largest isoforms in Western blots of immature human, rabbit, and rat myocardium. We were not able to test immunologically for the presence of the five-residue peptide, encoded by the 15-nt exon (Fig 2Up), because of the apparent lack of antigenicity of this short peptide.20 On the other hand, the cardiac-specific MAb 13-11 recognized all the isoforms in the human, rabbit, and rat myocardium, as the epitope is encoded by a portion of the coding sequence shared across several vertebrate species.

Analysis of the Rat cTnT Gene
Previous analysis of the rat cTnT gene19 provided an exonic pattern that differed from that of the chicken gene by the absence of an exon homologous to chicken exon 4. The chicken sequence encodes a six-residue peptide, EEYVEE, which is similar to five- and six-residue peptides found in the same position in cow, sheep, and rabbit cTnT isoform sequences (Fig 3Up). Our finding an alternatively spliced 15-nt sequence in human cTnT cDNA that encoded a peptide similar or identical to five- or six-residue peptides found in the same position in cow, sheep, and rabbit cTnT suggested that such an exon may be a common feature of vertebrate cTnTs. Searching of the intronic sequences between exons 4 and 5 of the published rat gene sequence19 revealed the potential for an additional exon that encodes a five-residue peptide, AEAVE. The putative coding sequence was flanked by the canonical 3' splice donor site (AG) and 5' splice donor site (GT) sequences26 as well as a polypyrimidine tract and a natural branch-point sequence for lariat formation. Finding all of these sequence features suggests that alternative combinatorial splicing of this novel exon and the previously recognized rat 30-nt coding sequence will yield four rat cTnT isoforms, the two largest containing the 10-residue peptide, consistent with our Western blot analysis of fetal and adult rat myocardial proteins (Fig 4Up).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The sequences of the four human cTnT isoforms that are differentially expressed in the fetal and normal and failing adult hearts are identified in the present study. The functional significance of the altered cTnT isoform expression and decreased myofibrillar ATPase activity in the failing human heart3 27 can now be considered in context of the sequence differences among the isoforms. These cDNAs and their translational products will be useful in future tests of these functional relations.

We have determined that the four cTnT isoforms observed in human heart are generated by combinatorial alternative splicing of two 5' exons, a 15- and a 30-nt 5' sequence. Both exons encode highly acidic peptides; the inclusion of either peptide would add overall negative charge to the cTnT protein. A consensus full-length cDNA, which we obtained from adult heart cDNA libraries, and a full length cDNA, obtained from RT-PCR, contain the five-residue peptide encoded by the 15-nt exon and confirm the sequence of an adult cTnT isoform deduced from previously published sequences.23 24 This isoform, which we have named cTnT3, is the dominant isoform expressed in the adult human heart, on the basis of Western blot analysis. We have confirmed that this 15-nt exon is alternatively spliced; it is excluded from two isoforms (cTnT2 and cTnT4) that are expressed in the fetal heart, with cTnT4 being reexpressed in the failing adult heart. Although Townsend et al23 previously described a 27-nt sequence obtained from an RT-PCR product generated from the 5' region, our 30-nt sequence is consistent with the length of the alternatively spliced exon found in rabbit, rat, and chicken cDNAs and in the rat and chicken cTnT gene.7 18 19 20 The 30-nt sequence is most likely the actual size, in that it encodes the identical peptide deduced from an alternatively spliced rabbit 30-nt sequence20 and that the two largest human cTnT isoforms that are expressed in the human fetal heart (cTnT1 and cTnT2) are recognized by a polyclonal antiserum raised against the deduced 10-residue peptide.

The human cTnT isoform cDNA sequences, the previously analyzed rabbit and rat cTnT cDNAs,19 20 and the results of reexamining the sequence of the rat cTnT gene demonstrate in the mammal a general pattern of combinatorial alternative splicing of the primary cTnT transcript. Fig 2Up illustrates the combinatorial alternative splicing of a 15-nt sequence (in the rabbit, an 18-nt sequence; Fig 3Up) and a 30-nt sequence in the amino-terminal region. We have not identified in the human cTnT molecule any other regions in which alternative splicing occurs. A 3' sequence encoding QAQ has been shown in rat and rabbit cDNA to be variably expressed as QAQ, AQ, or not at all.19 20 We searched for this polymorphism in the human cTnT mRNA population and consistently found only the 9-nt exon encoding QAQ. The possibility of a variable expression of QAQ must be considered when human cTnT mutants are sought.

The finding of Thierfelder et al,14 who reported that mutations in the cTnT gene are present in affected members of some families with hypertrophic cardiomyopathy, makes it important to know the sequences that are alternatively spliced as well as allelic differences when screening for further mutations in human cTnT.14 The identification of alternatively spliced sequences will be useful in analyzing genomic DNA to establish gene organization and RNA to search for mutations. If screening approaches based on RNA analysis are used, the sequence variability identified in the present study could lead to results that suggest cTnT mutations. Additionally, the identification of these exons suggests that nonsense mutations in these alternatively expressed sequences could result in truncated translational products and loss of an isoform or loss of isoform-specific function and produce the hypertrophic cardiomyopathy phenotype. In addition, recognizing the presence of these exons allows mutations to be sought in their splice donor or acceptor sites that could yield incorrectly spliced transcripts and protein products.14 28 29

The functional significance of the variable inclusion of the 5- and 10-residue peptides in the various cTnT isoforms is suggested by previous studies. The previous studies of Nassar et al15 and McAuliffe et al17 suggest that the presence of isoforms containing the 10-residue peptide increases myofilament sensitivity to calcium. In the human heart, cTnT2, which contains the alternatively spliced 10-residue peptide, is found in very small amounts throughout development. However, cTnT1, which contains both the 10- and 5-residue peptide, is expressed at a high level in the fetal human heart. This high expression of an isoform containing the 10-residue peptide may be functionally important in the immature myocardium, where the peak cytosolic calcium concentration transient is significantly less than that of the adult.30

The predominantly expressed adult human isoform, cTnT3, contains the 5-residue peptide and lacks the 10-residue peptide, whereas the fetal isoform, cTnT4, which is reexpressed in the presence of heart failure, lacks both peptides (Fig 2Up).3 A study using a protein assay reconstituted with either of the two bovine cTnT isoforms10 demonstrated that an amino-terminal 5-residue peptide similar in charge and position to that of the human 5-residue peptide altered the sensitivity of ATPase activity to calcium.16 We have found that in human left ventricular myocardium, peak myofibrillar ATPase activity is correlated with cTnT4 expression.3 Altogether, these results are consistent with the disease-associated shift in cTnT isoform expression in the human heart altering myofilament function. Moreover, these data identify specific sequences whose effects on myofilament function should be tested.

Given the role of troponin T in myofibril function, myofibrillogenesis, and hypertrophic cardiomyopathy and the effects of development and disease on human cTnT expression, the data provided by the present study should prove useful in testing how cTnT isoform expression affects hearts of patients of different ages, hearts with different cardiac defects, and hearts exposed to abnormal hemodynamic states. The cDNAs of these human cTnT isoforms will prove useful in searching for cTnT mutations among patients, and the recombinant proteins generated from these cDNAs will prove useful in testing the functional significance of these isoforms.


*    Acknowledgments
 
This study was supported in part by the Gustavus and Louise Pfeiffer Research Foundation and the National Institutes of Health (grants HL-42250 and HL-20749). The authors thank Dr Nils B. Adey for his technical advice on cloning.

Received October 24, 1994; accepted December 13, 1994.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Ebashi S. Ca2+ and the contractile proteins. J Mol Cell Cardiol. 1984;16:129-136. [Medline] [Order article via Infotrieve]

2. Zot AS, Potter JD. Structural aspects of troponin-tropomyosin regulation of skeletal muscle contraction. Annu Rev Biophys Biophys Chem. 1987;16:535-559. [Medline] [Order article via Infotrieve]

3. Anderson PAW, Malouf NN, Oakeley AE, Pagani ED, Allen PD. Troponin T isoform expression in humans: a comparison among normal and failing adult heart, fetal heart, and adult and fetal skeletal muscle. Circ Res. 1991;69:1226-1233. [Abstract/Free Full Text]

4. Anderson PAW, Moore GE, Nassar RN. Developmental changes in the expression of rabbit left ventricular troponin T. Circ Res. 1988;63:742-747. [Abstract/Free Full Text]

5. Sabry MA, Dhoot GK. Identification of and changes in the expression of troponin T isoforms in developing avian and mammalian heart. J Mol Cell Cardiol. 1989;21:85-91.

6. Malouf NN, McMahon D, Oakeley AE, Anderson PAW. A cardiac troponin T epitope conserved across phyla. J Biol Chem. 1992;267:9269-9274. [Abstract/Free Full Text]

7. Jin J-P, Lin JJ-C. Isolation and characterization of cDNA clones encoding embryonic and adult isoforms of rat cardiac troponin T. J Biol Chem. 1989;264:14471-14477. [Abstract/Free Full Text]

8. Saggin L, Ausoni S, Gorza L, Sartore S, Schiaffino S. Troponin T switching in the developing rat heart. J Biol Chem. 1988;263:18488-18492. [Abstract/Free Full Text]

9. Westfall MV, Reiser PJ, Schiaffino S, Solaro RJ. Developmental isoform switching of TnT and TnI in rat ventricle and atria. Biophys J. 1992;61:A20. Abstract.

10. Leszyk J, Dumaswala R, Potter JD, Gusev NB, Verin AD, Tobacman LS, Collins JH. Bovine cardiac troponin T: amino acid sequences of the two isoforms. Biochemistry. 1987;26:7035-7042. [Medline] [Order article via Infotrieve]

11. Toyota N, Shimada Y, Bader D. Molecular cloning and expression of chicken cardiac troponin C. Circ Res. 1989;65:1241-1246. [Abstract/Free Full Text]

12. Murphy AM, Jones L II, Sims HF, Strauss AW. Molecular cloning of rat cardiac troponin I and analysis of troponin I isoform expression in developing rat heart. Biochemistry. 1991;30:707-712. [Medline] [Order article via Infotrieve]

13. Fyrberg E, Fyrberg CC, Beall C, Saville DL. Drosophila melanogaster troponin T mutations engender three distinct syndromes of myofibrillar abnormalities. J Mol Biol. 1990;216:657-675. [Medline] [Order article via Infotrieve]

14. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg H-P, Seidman JG, Seidman CE. {alpha}-Tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701-712. [Medline] [Order article via Infotrieve]

15. Nassar R, Malouf NN, Kelly MB, Oakeley AE, Anderson PAW. Force–pCa relation and troponin T isoforms of rabbit myocardium. Circ Res. 1991;69:1470-1475. [Abstract/Free Full Text]

16. Tobacman LS, Lee R. Isolation and functional comparison of bovine cardiac troponin T isoforms. J Biol Chem. 1987;262:4059-4064. [Abstract/Free Full Text]

17. McAuliffe JJ, Gao L, Solaro RJ. Changes in myofibrillar activation and troponin C Ca2+ binding associated with troponin T isoform switching in developing rabbit heart. Circ Res. 1990;66:1204-1216. [Abstract/Free Full Text]

18. Cooper TA, Ordahl CP. A single cardiac troponin T gene generates embryonic and adult isoforms via developmentally regulated alternate splicing. J Biol Chem. 1985;260:11140-11148. [Abstract/Free Full Text]

19. Jin J-P, Huang Q-Q, Yeh H-I, Lin JJ-C. Complete nucleotide sequence and structural organization of rat cardiac troponin T gene. J Mol Biol. 1992;227:1269-1276. [Medline] [Order article via Infotrieve]

20. Greig A, Hirschberg Y, Anderson PAW, Hainsworth C, Malouf NN, Oakeley AE, Kay BK. Molecular basis of cardiac troponin T isoform heterogeneity in rabbit heart. Circ Res. 1994;74:41-47. [Abstract/Free Full Text]

21. Sanger F. Determination of nucleotide sequences in DNA. Science. 1981;214:1205-1210. [Free Full Text]

22. Anderson PAW, Oakeley AE. Immunological identification of five troponin T isoforms reveals an elaborate maturational troponin T profile in rabbit myocardium. Circ Res. 1989;65:1087-1093. [Abstract/Free Full Text]

23. Townsend PJ, Farza H, MacGeoch C, Spurr NK, Wade R, Gahlmann R, Yacoub MH, Barton PJR. Human cardiac troponin T: identification of fetal isoforms and assignment of the TNNT2 locus to chromosome 1q. Genomics. 1994;21:311-316. [Medline] [Order article via Infotrieve]

24. Mesnard L, Samson F, Espinasse I, Durand J, Neveux J-Y, Mercadier J-J. Molecular cloning and developmental expression of human cardiac troponin T. FEBS Lett. 1993;328:139-144. [Medline] [Order article via Infotrieve]

25. McAuliffe JJ, Robbins J. Troponin T expression in normal and pressure-loaded fetal sheep heart. Pediatr Res. 1991;29:580-585. [Medline] [Order article via Infotrieve]

26. Hames BD, Glover DM. Transcription and Splicing, Frontiers in Molecular Biology. Oxford, England: IRL Press Ltd; 1988.

27. Pagani ED, Alousi AA, Grant AM, Older TM, Dziuban SW Jr, Allen PD. Changes in myofibrillar content and Mg-ATPase activity in ventricular tissues from patients with heart failure caused by coronary artery disease, cardiomyopathy, or mitral valve insufficiency. Circ Res. 1988;63:380-385. [Abstract/Free Full Text]

28. Schneider S, Wildhardt G, Ludwig R, Royer-Pokora B. Exon skipping due to a mutation in a donor splice site in the WT-1 gene is associated with Wilms' tumor and severe genital malformations. Hum Genet. 1993;91:599-604. [Medline] [Order article via Infotrieve]

29. Kronert WA, Edwards KA, Roche ES, Wells L, Bernstein SI. Muscle-specific accumulation of Drosophila myosin heavy chains: a splicing mutation in an alternative exon results in an isoform substitution. EMBO J. 1991;10:2479-2488. [Medline] [Order article via Infotrieve]

30. Anderson PAW, Henderson PM, Nassar R. The calcium transient in cardiac myocytes increases with development. Circulation. 1993;88(suppl I):I-436. Abstract.




This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Larsson, X. Wang, F. Yu, P. Hook, K. Borg, S. M. Chong, and J.-P. Jin
Adaptation by alternative RNA splicing of slow troponin T isoforms in type 1 but not type 2 Charcot-Marie-Tooth disease
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C722 - C731.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Yuan, Q. Sheng, H. Tang, Y. Li, R. Zeng, and R. J. Solaro
Quantitative comparison of sarcomeric phosphoproteomes of neonatal and adult rat hearts
Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H647 - H656.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H.-Z. Feng, B. J. Biesiadecki, Z.-B. Yu, M. M. Hossain, and J.-P. Jin
Restricted N-terminal truncation of cardiac troponin T: a novel mechanism for functional adaptation to energetic crisis
J. Physiol., July 15, 2008; 586(14): 3537 - 3550.
[Abstract] [Full Text] [PDF]


Home page
Ann Clin BiochemHome page
D. C Gaze and P. O Collinson
Multiple molecular forms of circulating cardiac troponin: analytical and clinical significance
Ann Clin Biochem, July 1, 2008; 45(4): 349 - 355.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Pinto, M. S. Parvatiyar, M. A. Jones, J. Liang, and J. D. Potter
A Troponin T Mutation That Causes Infantile Restrictive Cardiomyopathy Increases Ca2+ Sensitivity of Force Development and Impairs the Inhibitory Properties of Troponin
J. Biol. Chem., January 25, 2008; 283(4): 2156 - 2166.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Q.-Q. Huang, H. Z. Feng, J. Liu, J. Du, L. B. Stull, C. S. Moravec, X. Huang, and J.-P. Jin
Co-expression of skeletal and cardiac troponin T decreases mouse cardiac function
Am J Physiol Cell Physiol, January 1, 2008; 294(1): C213 - C222.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. J. Belin, M. P. Sumandea, T. Kobayashi, L. A. Walker, V. L. Rundell, D. Urboniene, M. Yuzhakova, S. H. Ruch, D. L. Geenen, R. J. Solaro, et al.
Left ventricular myofilament dysfunction in rat experimental hypertrophy and congestive heart failure
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2344 - H2353.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Adamcova, M. Sterba, T. Simunek, A. Potacova, O. Popelova, and V. Gersl
Myocardial regulatory proteins and heart failure
Eur J Heart Fail, June 1, 2006; 8(4): 333 - 342.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
N. S. Dhalla, M. R. Dent, P. S. Tappia, R. Sethi, J. Barta, and R. K. Goyal
Subcellular Remodeling as a Viable Target for the Treatment of Congestive Heart Failure
Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2006; 11(1): 31 - 45.
[Abstract] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. E. Jweied, R. D. McKinney, L. A. Walker, I. Brodsky, A. S. Geha, M. G. Massad, P. M. Buttrick, and P. P. de Tombe
Depressed cardiac myofilament function in human diabetes mellitus
Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2478 - H2483.
[Abstract] [Full Text] [PDF]


Home page
CMAJHome page
L. Babuin and A. S. Jaffe
Troponin: the biomarker of choice for the detection of cardiac injury
Can. Med. Assoc. J., November 8, 2005; 173(10): 1191 - 1202.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Venkatraman, A. V. Gomes, W. G. L. Kerrick, and J. D. Potter
Characterization of Troponin T Dilated Cardiomyopathy Mutations in the Fetal Troponin Isoform
J. Biol. Chem., May 6, 2005; 280(18): 17584 - 17592.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Nassar, N. N. Malouf, L. Mao, H. A. Rockman, A. E. Oakeley, J. R. Frye, J. R. Herlong, S. P. Sanders, and P. A. W. Anderson
cTnT1, a cardiac troponin T isoform, decreases myofilament tension and affects the left ventricular pressure waveform
Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1147 - H1156.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
F. S. Korte, E. A. Mokelke, M. Sturek, and K. S. McDonald
Exercise improves impaired ventricular function and alterations of cardiac myofibrillar proteins in diabetic dyslipidemic pigs
J Appl Physiol, February 1, 2005; 98(2): 461 - 467.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. V. Gomes, G. Venkatraman, J. P. Davis, S. B. Tikunova, P. Engel, R. J. Solaro, and J. D. Potter
Cardiac Troponin T Isoforms Affect the Ca2+ Sensitivity of Force Development in the Presence of Slow Skeletal Troponin I: INSIGHTS INTO THE ROLE OF TROPONIN T ISOFORMS IN THE FETAL HEART
J. Biol. Chem., November 26, 2004; 279(48): 49579 - 49587.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. L. Moss, M. Razumova, and D. P. Fitzsimons
Myosin Crossbridge Activation of Cardiac Thin Filaments: Implications for Myocardial Function in Health and Disease
Circ. Res., May 28, 2004; 94(10): 1290 - 1300.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. Sodi, S. Darn, and A. Stott
Time for Troponin T? Implications from Newly Elucidated Structure
Clin. Chem., April 1, 2004; 50(4): 786 - 787.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. B. Marston and C. S. Redwood
Modulation of Thin Filament Activation by Breakdown or Isoform Switching of Thin Filament Proteins: Physiological and Pathological Implications
Circ. Res., December 12, 2003; 93(12): 1170 - 1178.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Biesiadecki, B. D. Elder, Z.-B. Yu, and J.-P. Jin
Cardiac Troponin T Variants Produced by Aberrant Splicing of Multiple Exons in Animals with High Instances of Dilated Cardiomyopathy
J. Biol. Chem., December 20, 2002; 277(52): 50275 - 50285.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Kamitomo, J. Onishi, I. Gutierrez, V. M. Stiffel, and R. D. Gilbert
Effects of Long-Term Hypoxia and Development on Cardiac Contractile Proteins in Fetal and Adult Sheep
Reproductive Sciences, November 1, 2002; 9(6): 335 - 341.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
A. V. Gomes, G. Guzman, J. Zhao, and J. D. Potter
Cardiac Troponin T Isoforms Affect the Ca2+ Sensitivity and Inhibition of Force Development. INSIGHTS INTO THE ROLE OF TROPONIN T ISOFORMS IN THE HEART
J. Biol. Chem., September 13, 2002; 277(38): 35341 - 35349.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Fredericks, J. F. Murray, N. D. Carter, A. M.S. Chesser, S. Papachristou, M. M. Yaqoob, P. O. Collinson, D. Gaze, and D. W. Holt
Cardiac Troponin T and Creatine Kinase MB Content in Skeletal Muscle of the Uremic Rat
Clin. Chem., June 1, 2002; 48(6): 859 - 868.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Biesiadecki and J.-P. Jin
Exon Skipping in Cardiac Troponin T of Turkeys with Inherited Dilated Cardiomyopathy
J. Biol. Chem., May 17, 2002; 277(21): 18459 - 18468.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
U. Wisloff, J. P. Loennechen, S. Currie, G. L. Smith, and O. Ellingsen
Aerobic exercise reduces cardiomyocyte hypertrophy and increases contractility, Ca2+ sensitivity and SERCA-2 in rat after myocardial infarction
Cardiovasc Res, April 1, 2002; 54(1): 162 - 174.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. N Peterson, R. Nassar, P. A W Anderson, and N. R Alpert
Altered cross-bridge characteristics following haemodynamic overload in rabbit hearts expressing V3 myosin
J. Physiol., October 15, 2001; 536(2): 569 - 582.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
G. M. Diffee, E. A. Seversen, and M. M. Titus
Exercise training increases the Ca2+ sensitivity of tension in rat cardiac myocytes
J Appl Physiol, July 1, 2001; 91(1): 309 - 315.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L. G D'CRUZ, C. BABOONIAN, H. E PHILLIMORE, R. TAYLOR, P. M ELLIOTT, A. VARNAVA, F. DAVISON, W. J MCKENNA, and N. D CARTER
Cytosine methylation confers instability on the cardiac troponin T gene in hypertrophic cardiomyopathy
J. Med. Genet., September 1, 2000; 37(9): 18e - 18.
[Full Text]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Sanbe, J. Gulick, E. Hayes, D. Warshaw, H. Osinska, C.-B. Chan, R. Klevitsky, and J. Robbins
Myosin light chain replacement in the heart
Am J Physiol Heart Circ Physiol, September 1, 2000; 279(3): H1355 - H1364.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. J. Hajjar, R. H.G. Schwinger, U. Schmidt, C. S. Kim, D. Lebeche, A. A. Doye, and J. K. Gwathmey
Myofilament Calcium Regulation in Human Myocardium
Circulation, April 11, 2000; 101(14): 1679 - 1685.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Szczesna, R. Zhang, J. Zhao, M. Jones, G. Guzman, and J. D. Potter
Altered Regulation of Cardiac Muscle Contraction by Troponin T Mutations That Cause Familial Hypertrophic Cardiomyopathy
J. Biol. Chem., January 7, 2000; 275(1): 624 - 630.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
V. Ricchiuti and F. S. Apple
RNA Expression of Cardiac Troponin T Isoforms in Diseased Human Skeletal Muscle
Clin. Chem., December 1, 1999; 45(12): 2129 - 2135.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Q.-Q. Huang, F. V Brozovich, and J.-P. Jin
Fast skeletal muscle troponin T increases the cooperativity of transgenic mouse cardiac muscle contraction
J. Physiol., October 1, 1999; 520(1): 231 - 242.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. F Purcell, W. Bing, and S. B Marston
Functional analysis of human cardiac troponin by the in vitro motility assay: comparison of adult, foetal and failing hearts
Cardiovasc Res, September 1, 1999; 43(4): 884 - 891.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
O. Ogut, H. Granzier, and J.-P. Jin
Acidic and basic troponin T isoforms in mature fast-twitch skeletal muscle and effect on contractility
Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1162 - C1170.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Hoch, R. Meyer, R. Hetzer, E.-G. Krause, and P. Karczewski
Identification and Expression of {delta}-Isoforms of the Multifunctional Ca2+/Calmodulin-Dependent Protein Kinase in Failing and Nonfailing Human Myocardium
Circ. Res., April 2, 1999; 84(6): 713 - 721.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. L. McDonough, D. K. Arrell, and J. E. Van Eyk
Troponin I Degradation and Covalent Complex Formation Accompanies Myocardial Ischemia/Reperfusion Injury
Circ. Res., January 22, 1999; 84(1): 9 - 20.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Ogut and J.-P. Jin
Developmentally Regulated, Alternative RNA Splicing-generated Pectoral Muscle-specific Troponin T Isoforms and Role of the NH2-terminal Hypervariable Region in the Tolerance to Acidosis
J. Biol. Chem., October 23, 1998; 273(43): 27858 - 27866.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Bonne, L. Carrier, P. Richard, B. Hainque, and K. Schwartz
Familial Hypertrophic Cardiomyopathy : From Mutations to Functional Defects
Circ. Res., September 21, 1998; 83(6): 580 - 593.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
V. Ricchiuti, E. M. Voss, A. Ney, M. Odland, P. A. W. Anderson, and F. S. Apple
Cardiac troponin T isoforms expressed in renal diseased skeletal muscle will not cause false-positive results by the second generation cardiac troponin T assay by Boehringer Mannheim
Clin. Chem., September 1, 1998; 44(9): 1919 - 1924.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
C. Heeschen, B. U. Goldmann, Robert. H. Moeller, and C. W. Hamm
Analytical performance and clinical application of a new rapid bedside assay for the detection of serum cardiac troponin I
Clin. Chem., September 1, 1998; 44(9): 1925 - 1930.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. K. McConnell, C. S. Moravec, and M. Bond
Troponin I phosphorylation and myofilament calcium sensitivity during decompensated cardiac hypertrophy
Am J Physiol Heart Circ Physiol, February 1, 1998; 274(2): H385 - H396.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
P. P de Tombe
Altered contractile function in heart failure
Cardiovasc Res, February 1, 1998; 37(2): 367 - 380.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. C. Schaub, M. A. Hefti, R. A. Zuellig, and I. Morano
Modulation of contractility in human cardiac hypertrophy by myosin essential light chain isoforms
Cardiovasc Res, February 1, 1998; 37(2): 381 - 404.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. E. Lipshultz, N. Rifai, S. E. Sallan, S. R. Lipsitz, V. Dalton, D. B. Sacks, and M. E. Ottlinger
Predictive Value of Cardiac Troponin T in Pediatric Patients at Risk for Myocardial Injury
Circulation, October 21, 1997; 96(8): 2641 - 2648.
[Abstract] [Full Text]


Home page
Clin. Chem.Home page
P. O. Collinson
To T or Not to T, That Is the Question
Clin. Chem., March 1, 1997; 43(3): 421 - 423.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Ritchie and M. E. Ritchie
Characterization of Human B Creatine Kinase Gene Regulation in the Heart in Vitro and in Vivo
J. Biol. Chem., October 11, 1996; 271(41): 25485 - 25491.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Saba, R. Nassar, R. M. Ungerleider, A. E. Oakeley, and P. A.W. Anderson
Cardiac Troponin T Isoform Expression Correlates With Pathophysiological Descriptors in Patients Who Underwent Corrective Surgery for Congenital Heart Disease
Circulation, August 1, 1996; 94(3): 472 - 476.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C.-M. Hsieh, S. Fukumoto, M. D. Layne, K. Maemura, H. Charles, A. Patel, M. A. Perrella, and M.-E. Lee
Striated Muscle Preferentially Expressed Genes alpha and beta Are Two Serine/Threonine Protein Kinases Derived from the Same Gene as the Aortic Preferentially Expressed Gene-1
J. Biol. Chem., November 17, 2000; 275(47): 36966 - 36973.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Ogut and J.-P. Jin
Cooperative Interaction between Developmentally Regulated Troponin T and Tropomyosin Isoforms in the Absence of F-actin
J. Biol. Chem., August 18, 2000; 275(34): 26089 - 26095.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. VanBuren, S. L. Alix, J. A. Gorga, K. J. Begin, M. M. LeWinter, and N. R. Alpert
Cardiac troponin T isoforms demonstrate similar effects on mechanical performance in a regulated contractile system
Am J Physiol Heart Circ Physiol, May 1, 2002; 282(5): H1665 - H1671.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anderson, P. A. W.
Right arrow Articles by Kay, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anderson, P. A. W.
Right arrow Articles by Kay, B. K.