Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 1995;76:584-591

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Linn, S. C.
Right arrow Articles by Shull, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linn, S. C.
Right arrow Articles by Shull, G. E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
(Circulation Research. 1995;76:584-591.)
© 1995 American Heart Association, Inc.


Articles

Conservation of an AE3 Cl-/HCO3- Exchanger Cardiac-Specific Exon and Promoter Region and AE3 mRNA Expression Patterns in Murine and Human Hearts

Stephen C. Linn, G. Roger Askew, Anil G. Menon, Gary E. Shull

From the Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati (Ohio) College of Medicine.

Correspondence to Dr Gary E. Shull, Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine, 231 Bethesda Ave, Cincinnati, OH 45267-0524.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract A cardiac-specific variant of the rat AE3 Cl-/HCO3- exchanger mRNA is transcribed from a promoter located in the sixth intron of a larger transcription unit expressed in brain and other tissues. The cardiac mRNA contains an alternative first exon encoding a 73–amino acid NH2-terminal sequence that replaces the first 270 amino acids of the brain AE3 variant. The present study was conducted to determine whether the cardiac-specific promoter region and exon are conserved in other species and to examine the expression patterns of AE3 mRNAs in adult tissues and during development. Analysis of murine and human genomic clones showed that both contain counterparts of the rat alternative exon. The cardiac promoter region is highly conserved in all three species and contains several potential transcription factor binding sites, including consensus MCAT and E-box sequences. Tissue-specific and developmental patterns of AE3 gene expression were examined by Northern blot hybridization. Mouse and human, like the rat, express both the 3.6-kb cardiac-specific AE3 mRNA and a 4.4-kb AE3 transcript found in brain, heart, and other tissues. Levels of the cardiac-specific transcript in mouse heart increase 17-fold between the fetal and adult stages, while the amount of the longer AE3 mRNA in heart decreases substantially. Furthermore, although the cardiac-specific mRNA is expressed in both atria and ventricles of mouse heart, the longer transcript is confined to the atria. These results suggest that the two AE3 variants have distinct roles in cardiac function and that the mechanisms regulating their expression are different.


Key Words: anion exchange • alternative exon • tissue specificity • developmental regulation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Sodium-independent chloride-bicarbonate exchangers are present in the plasma membranes of many vertebrate cell types and function in the regulation of pHi, [Cl-]i, and cell volume. Available evidence suggests that the nonerythroid Cl-/HCO3- exchangers are related to the erythrocyte band-3 protein (AE1), which belongs to a family that includes at least two other members, AE2 and AE3.1 Vertebrate heart muscle contains a sodium-independent Cl-/HCO3- exchange pathway that counters an alkaline stress on the cell by exchanging extracellular chloride for intracellular bicarbonate.2 3 4 In addition to functioning in cellular pH regulation, it has been proposed that Cl-/HCO3- exchange contributes to maintenance of [Cl-]i in cardiac muscle at a level above electrochemical equilibrium.5 This nonpassive distribution of chloride may be important in determining the overall electrical properties of the heart, since the sarcolemma of ventricular myocytes contains a cAMP-regulated Cl- channel that has been postulated to play a role in determining action potential duration and resting membrane potential.6

All three of the known AE genes are expressed in adult rat heart,7 although the cellular locations and functions of individual protein products have not been established. The most abundant mRNA, as judged by Northern blot hybridization, is a 3.6-kb AE3 transcript that is almost entirely cardiac specific. A second AE3 mRNA, 4.4 kb in length, is expressed at equivalent levels in rat heart and brain and at lower levels in other tissues. Both AE3 transcripts encode polypeptides containing the COOH-terminal transmembrane region required for anion exchange activity.7 8 9 The NH2-terminal 270 amino acids encoded by the longer mRNA, however, are replaced in the cardiac-specific AE3 variant by a dissimilar 73–amino acid sequence. This is encoded by an alternative exon (C1) that is located within the sixth intron of the gene and contains the transcription initiation site of the 3.6-kb mRNA.8 Because of the abundance of its mRNA, the cardiac-specific AE3 variant is a strong candidate for the Cl-/HCO3- exchanger involved in regulation of pH and [Cl-] in heart muscle.5

The major objectives of the present study were to determine whether the cardiac-specific promoter region and exon C1 are conserved in the AE3 genes of mouse and human and to obtain detailed information regarding the expression of the two AE3 mRNAs during development. Mouse heart has been shown to contain a cardiac-specific AE3 transcript,9 but the structure and genetic basis of this mRNA have not been determined. Clones containing the human AE3 gene have recently been isolated, and the gene has been mapped to chromosome 2q3610 ; however, there have been no published reports of a human exon C1 homologue or a human cardiac-specific AE3 mRNA similar to that of the rat.* In the present study, we report the characterization of murine and human AE3 genomic clones and the analysis of AE3 gene expression in both species. We find that the rat cardiac-specific promoter region and exon C1, containing the alternative NH2-terminal coding sequence, are conserved in murine and human AE3 genes. Both species express an AE3 mRNA that contains the alternative exon and appears to be confined to the heart. Finally, we report that the brain and cardiac AE3 transcripts are distributed differently between the atria and ventricles of the heart and exhibit distinct patterns of expression during murine development.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
DNA Preparation, Radiolabeling, and Sequence Analysis
Plasmid and bacteriophage {lambda} DNAs were prepared by using Qiagen Plasmid and Lambda Maxi kits (Qiagen, Inc). Oligonucleotide primers were synthesized by the University of Cincinnati DNA Core Facility. The polymerase chain reaction (PCR) was performed by using a Perkin-Elmer Cetus DNA thermal cycler. All DNA modification enzymes and restriction endonucleases were obtained either from New England Biolabs or GIBCO-BRL. DNA probes were radiolabeled by random priming (Pharmacia). Except as noted, the Sequenase v.2.0 kit (United States Biochemical) was used for all nucleotide sequencing. Computer analyses of nucleotide and amino acid sequences were performed by using the DNANALYZE12 and ALIGN (Scientific & Educational Software) programs.

Isolation and Characterization of Murine and Human AE3 Genomic Clones
AE3 genomic clones were isolated from a 129SvJ mouse {lambda}DASH II library13 by screening with a 32P-labeled 2.2-kb Bsu36 I fragment (exons 11 to 23) of a rat cardiac AE3 cDNA.8 BamHI fragments containing sequences from exons 1 through 21 were identified by Southern blot hybridization.14 The Bsu36 I fragment described above and a 352-nt Ava I fragment (alternative first exon C1) of the same cDNA were used as probes. BamHI fragments were subcloned into pBluescript II (Stratagene) to facilitate nucleotide sequence analysis. The sequence of a 0.2-kb region between BamHI sites in introns 6 and 7 was obtained directly from a genomic clone by using the PCR-based dsDNA cycle sequencing kit (GIBCO-BRL). The isolation of cosmid clone HP 12-1a, containing the human AE3 gene, and the production of random subclones have been described previously.10 Contiguous subclones, spanning intron 6 through exon 8 by analogy with the rat gene, were identified by screening with the rat heart AE3 cDNA Ava I fragment described above. A portion of the human AE3 sequence, including all of exon 6 and the first 446 nucleotides of intron 6, was determined directly from the original cosmid clone by using the Sequenase method.

Reverse Transcription–PCR Analysis of Mouse and Human Cardiac AE3 mRNAs
Double-stranded cDNA prepared from normal human heart poly(A)+ RNA (source, 46-year-old Caucasian female; cause of death, trauma) was purchased from Clontech Laboratories, Inc. Total RNA was isolated from adult CF1 mouse heart by the guanidinium isothiocyanate procedure,15 and first-strand cDNA was prepared according to published methods16 by using random hexamers and oligo-dT12-18 in a 2:1 ratio. The collection of mouse tissues for these experiments and experiments described in other sections was performed according to institutional guidelines. PCR analysis was carried out by using primers containing the translation initiation site in the cardiac first exon and a portion of the downstream sequence of exon 7. The mouse and human sense-strand primers were GAATGACAAGCCCGCTGGAC and GAATGACGAGCCCACTGGAG (5' to 3'), respectively. The antisense primers were ACCTCATGAGGCCTCCGATC (mouse) and ACCTCATGAGGCCTCCGGTC (human). Reactions contained 10 µL mouse first-strand cDNA or 1 ng double-stranded human cDNA, 20 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 2 mmol/L MgCl2, 0.25 µmol/L each primer, 200 µmol/L each dNTP, and 5 U Taq DNA polymerase (GIBCO-BRL) in a volume of 100 µL. PCR was performed for 30 cycles (94°C, 45 seconds; 58°C, 1 minute; and 72°C, 2 minutes), with a final 7-minute incubation at 72°C. A portion of each reaction was analyzed by agarose gel electrophoresis to verify that the expected 370-bp products were obtained. Reaction products were cloned for sequence analysis using the TA cloning system from Invitrogen Corp.

Northern Hybridization Analysis of AE3 mRNA Tissue Distribution
Multiple-tissue Northern blots of murine adult (BALB/c), human adult, and human fetal poly(A)+ RNAs (2 µg per lane) were purchased from Clontech Laboratories, Inc. All RNAs were prepared from normal (undiseased) tissues. Blots were screened with 32P-labeled probes containing the complete mouse or human exon C1 sequence. These were prepared by PCR amplification from a murine BamHI genomic subclone and the human AE3 cosmid clone HP12-1a,10 respectively, and purified by agarose gel electrophoresis before radiolabeling. Blots were prehybridized 18 to 20 hours at 42°C in 10 mL of a solution containing 50% formamide, 5x SSPE,17 5x Denhardt's solution,17 0.1% sodium dodecyl sulfate (SDS), and 100 µg denatured salmon sperm DNA per milliliter. The prehybridization solution was replaced with 10 mL fresh solution of the same composition, and 50 ng of denatured radiolabeled probe DNA was added. Membranes were incubated for 20 hours at 42°C and then washed twice, for 15 minutes each, in 6x standard saline citrate (SSC)17 and 0.1% SDS at room temperature, followed by 30 minutes each in 2x SSC/0.1% SDS and 0.2x SSC/0.1% SDS at 58°C. Blots were covered with plastic wrap and autoradiographed. After the initial screening, all membranes were stripped and reprobed with the 2.2-kb Bsu36 I rat heart AE3 cDNA fragment described previously. Prehybridization, hybridization, and washing conditions were the same as described above.

Analysis of AE3 mRNA Expression During Murine Development
Total RNA was prepared according to the guanidinium isothiocyanate procedure from whole heart, brain, lung, liver, skeletal muscle, and kidney obtained from fetal (15 postcoital days), neonatal (2 days), juvenile (3 weeks), and adult (8 weeks) mice (strain FVB/N). Tissues were collected from four litters of fetal mice, three litters of neonatal mice, 10 juvenile mice, and three adult mice. RNA (10 µg per lane) was denatured by the glyoxal–dimethyl sulfoxide (DMSO) method,18 fractionated in neutral agarose gels, and transferred to charged nylon membranes (Magna NT, MSI). Membranes were prehybridized, hybridized, and washed as described for the multiple-tissue Northern blots. The probe used was the 2.2-kb Bsu36 I rat heart AE3 cDNA fragment described previously. Signals were detected by autoradiography and then quantified by using a series 400 PhosphorImager and IMAGEQUANT software (Molecular Dynamics). After the initial hybridization, blots were stripped and rescreened with the murine exon C1 probe and then with the 32P-labeled oligonucleotide 5'-GACAAGCATATGCTACTGGC-3', which is complementary to a sequence conserved in rat, mouse, and human 18S RNAs. For the oligonucleotide probe, blots were prehybridized overnight at 42°C in 10 mL of a solution containing 6x SSC/1% SDS and then incubated 18 hours at 42°C in 10 mL of a solution of the same composition containing 1x107 cpm of the end-labeled probe (total oligonucleotide concentration, 120 pmol/mL). Membranes were washed once at room temperature for 5 minutes and twice at 50°C for 15 minutes in 3x SSC/0.1% SDS. Signals were detected by autoradiography and quantified by PhosphorImager analysis as described above.

Analysis of AE3 mRNA Distribution in Murine Heart
Total RNA, prepared from atria and ventricles of 20 adult FVB/N mice as described for reverse transcription–PCR analysis above, was denatured with glyoxal-DMSO, fractionated in neutral agarose gels, and transferred to charged nylon membranes (Nytran+, Schleicher & Schuell). Each lane contained 5, 10, or 20 µg of RNA. The blots were first screened with the murine exon C1 probe described above, then stripped, and reprobed with the 2.2-kb Bsu36 I rat heart AE3 cDNA fragment. Signals were detected by autoradiography and quantified by PhosphorImager analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Characterization of Mouse and Human Genomic Sequences Corresponding to the Rat AE3 Cardiac-Specific First Exon and Promoter Region
Murine and human AE3 genomic clones were partially characterized to determine whether they contained counterparts of the rat AE3 cardiac-specific exon C1. The mouse gene was isolated from a bacteriophage lambda library by using a rat AE3 cDNA probe containing COOH-terminal coding and 3' untranslated sequences. Three contiguous random subclones of the human AE3 cosmid 12-1a,10 containing sequences extending from intron 6 through the end of exon 8, were isolated by screening with a rat exon C1 probe. Nucleotide sequences corresponding to rat exon 6 and a portion of intron 6 were obtained from the original cosmid. Throughout the remainder of this article, exon and intron sequences of the mouse and human AE3 genes are numbered by analogy with their rat counterparts.

Analysis of the mouse and human AE3 genes demonstrated that both contain sequences within the sixth intron that correspond to the rat cardiac-specific first exon, C1. As illustrated in Fig 1Down, the conserved region includes the rat cardiac transcription initiation site, presumptive translation initiation codon, and NH2-terminal coding sequence. The lengths of the mouse and human cardiac-specific exons are greater than that of the rat because of the presence of insertions in the 5' untranslated region. The rat and mouse exon C1 nucleotide sequences are 83% identical, and sequence identity between the rat and human exons is 66% (Fig 2Down). Several features of exon C1 are conserved in all three species. The first 36 nucleotides of the rat exon, including the transcription initiation site, are completely retained in the human sequence, and the corresponding portion of the murine exon contains only two nucleotide substitutions. The putative translation start codon is located in the same position in each species and is in an acceptable context for initiation of protein synthesis.19 The open reading frames of all three sequences are the same length, with each containing 72 codons plus the first nucleotide of codon 73. The splice donor sequence adjoining the 3' end of exon C1 is also conserved.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Exon C1 of the rat AE3 gene and the corresponding regions of the mouse and human genes. The isolation of murine and human AE3 genomic clones is described in "Materials and Methods." The exon C1 sequence in each gene is indicated by a hatched bar. Open segments in the mouse and human exons represent insertions relative to the rat sequence. The position of the rat cardiac-specific transcription initiation site and the presumptive ATG translation start codons of all three genes are labeled.



View larger version (86K):
[in this window]
[in a new window]
 
Figure 2. Nucleotide sequences of the rat, mouse, and human AE3 genes from exon 6 through exon 7. The rat AE3 gene is described in Reference 8. Murine and human sequences were obtained from subclones or directly from the original genomic isolates as described in "Materials and Methods." Exon sequences are shown in uppercase letters; intron sequences, in lowercase letters. Identical nucleotides are highlighted by solid bars within exons and by gray bars within introns. Gaps introduced to maintain alignment are indicated by dashes. The rat cardiac-specific transcription initiation site and conserved MCAT, E-box, CACCC, and Sp1 motifs are labeled. The presumptive ATG translation initiation codon is boxed and indicated by asterisks.

Nucleotide sequences immediately upstream and downstream from the rat cardiac transcription initiation site are highly conserved in both the mouse and human AE3 genes. The region from positions -38 through +29 relative to the transcription initiation site is identical in all three species, and identity between the rat and mouse sequences extends to -50. Overall, the rat sequence from positions -239 through +36 is 97% conserved in the mouse AE3 gene and 85% conserved in the human gene. An 8-bp deletion in the human gene, relative to the rat (nucleotides -94 to -101), constitutes the largest single difference between the three sequences. The presumptive mouse and human promoter regions, like the rat sequence, lack a classic TATA box.20 Several potential cis-acting control elements are conserved in all three species. Both the rat and mouse sequences contain a core consensus binding site for the transcription factor Sp1.21 In the human AE3 gene, the central C of the element is replaced by a T, and two overlapping copies of the sequence are present. The rat 5'-flanking region also contains copies of the CACCC,22 E-box,23 and MCAT24 consensus sequences that are conserved in the mouse and human AE3 genes.

Amino acid sequences predicted from exons C1 and 7 of the rat AE3 gene are compared with the corresponding mouse and human sequences in Fig 3Down. The murine and rat exon C1 sequences are 92% identical. The rat and human C1 sequences are only 63% identical, which is considerably lower than the 98% identity between the amino acid sequences predicted from exon 7 or the identity of 96% observed in a survey of 194 codons from human exons 7, 8, 9, 11, 13, and 14.10 Although there are significant differences between the human and rat C1 amino acid sequences, the majority of proline and negatively charged residues, which are relatively abundant, are conserved in the human sequence. Also, a potential casein kinase II phosphorylation site at Ser 3 is present in all three species, as are possible protein kinase A and protein kinase C phosphorylation sites encoded by exon 7.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Comparison of the amino acid sequences deduced from exons C1 and 7 of the rat AE3 gene and their murine and human counterparts. Differences from the rat sequence are shown, with conservative substitutions represented by lowercase letters. The positions of introns 6 and 7 relative to the amino acid sequence are indicated; note that the first nucleotide of codon 73, encoding cysteine, is actually located in exon C1. Three conserved motifs that are potential targets of protein kinases (casein kinase II [CKII], protein kinase C [PKC], and protein kinase A [PKA]) are boxed.

AE3 mRNA Expression Patterns in Mouse and Human Tissues
Results of the genomic cloning studies showed that a counterpart of the rat cardiac-specific exon C1 is present in the mouse and human AE3 genes. To determine whether mRNAs containing the exon C1–exon 7 splice junction are expressed in mouse and human heart, we performed PCR analyses of heart cDNA using species-specific primers corresponding to the translation initiation region in exon C1 and the 3' end of exon 7. The expected 367-bp product was obtained from both the mouse and human cDNAs (data not shown). Sequence analysis showed that both PCR products contained the anticipated splice junction and that the cDNA and genomic sequences were identical. Thus, the structure and expression pattern of the rat cardiac-specific AE3 mRNA appear to be conserved in both mice and humans.

Northern blots of poly(A)+ RNAs from mouse and human tissues were screened with murine and human exon C1 probes to determine the distribution of transcripts containing the alternative exon. As shown in Fig 4Down (upper panels), a 3.6-kb mRNA was present at high levels in adult mouse heart and at low levels in lung. A relatively abundant 3.6-kb mRNA was also detected in both adult and fetal human hearts (Fig 5Down, upper panels). An mRNA of {approx}4.4 kb, which hybridized with the C1 probe at moderate stringency, was detected at low levels in human fetal heart and in adult heart after prolonged autoradiography (114 hours).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. Distribution of AE3 transcripts in adult mouse tissues. A Northern blot of poly(A)+ RNAs from the indicated tissues was first screened with a probe containing the complete murine exon C1 sequence (upper two panels). The blot was then stripped and reprobed with a rat AE3 cDNA fragment containing 3' coding sequences common to the 3.6- and 4.4-kb mRNAs (lower two panels). The positions of RNA size markers (in kilobases) are shown to the left of the figure, and the autoradiographic exposure times are shown on the right.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 5. Distribution of AE3 transcripts in human adult and fetal tissues. Northern blots of poly(A)+ RNAs from the indicated tissues were screened with a probe containing the human exon C1 sequence (upper panels), then stripped, and rescreened with the rat AE3 3' coding probe (lower panels). The positions of RNA size markers (in kilobases) are shown to the left of the figure, and the autoradiographic exposure times are shown on the right.

The blots were stripped and rescreened with a rat AE3 cDNA fragment encoding COOH-terminal sequences common to both of the known AE3 variants. This probe hybridized to the 3.6-kb mRNA recognized by the exon C1 probes and to a 4.4-kb AE3 mRNA that was first identified in rat and mouse brain and in rat stomach.8 9 Relatively high levels of the 4.4-kb transcript were found in adult mouse brain (Fig 4Up, lower panels) and in adult and fetal human hearts and brains (Fig 5Up, lower panels). Low levels of the 4.4-kb mRNA were present in mouse lung, and traces were detected in skeletal muscle, kidney, and testis (Fig 4Up). An mRNA of {approx}5.2 kb was detected at moderate levels in human fetal liver, but not in adult liver, and at trace levels in mouse lung, skeletal muscle, kidney, and testis.

AE3 Expression During Murine Development
To determine whether the expression of either AE3 transcript is developmentally regulated, we performed Northern blot analyses of total RNAs from mouse heart, brain, lung, liver, skeletal muscle, and kidney prepared at the late fetal (15 postcoital days), neonatal (2 days), juvenile (3 weeks), and adult (8 weeks) stages. The murine exon C1 sequence and the rat 3'-terminal AE3 cDNA fragment, which detects both AE3 transcripts, were used as probes in these experiments. As shown in Fig 6Down, steady state levels of the cardiac-specific AE3 mRNA in heart increase significantly between the late fetal and adult stages. In contrast, the 4.4-kb AE3 mRNA is only weakly expressed in heart during the fetal through juvenile stages, and levels of the transcript appear to decrease substantially in the adult. A trace amount of the 3.6-kb mRNA seemed to be present in juvenile and adult lungs (140-hour exposure), consistent with the results shown in Fig 4Up, and low levels of the 4.4-kb mRNA were present throughout development. The 3.6-kb AE3 mRNA was not detected in liver, skeletal muscle, or kidney at any of the time points examined, but after long autoradiographic exposures, we observed trace levels of the 4.4-kb transcript in skeletal muscle and kidney at each developmental stage (data not shown).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 6. Analysis of AE3 mRNA expression during murine development. Total RNAs were prepared from the tissues indicated at 15 postcoital days (F) and at 2 days (N), 3 weeks (J), and 8 weeks (A) after birth. A Northern blot of the RNAs was screened successively with murine exon C1 (upper panel), rat AE3 3' coding (second and third panels), and 18S RNA (lower panel) probes. Positions of the 28S and 18S RNAs are indicated to the left of the figure, and exposure times are shown on the right.

The data for expression of the 3.6- and 4.4-kb AE3 mRNAs in heart and brain are presented quantitatively in Fig 7Down. Steady state levels of the 3.6-kb transcript in heart increase {approx}17-fold, relative to 18S RNA, between the late fetal and adult stages of development, with the greatest change occurring after birth. Levels of the 3.6- and 4.4-kb AE3 mRNAs in heart are similar at 15 postcoital days. By adulthood, however, the steady state level of the 4.4-kb transcript drops {approx}35-fold, with the bulk of the decrease occurring between 3 and 8 weeks after birth. In brain, levels of the 4.4-kb AE3 mRNA increase 4- to 5-fold between the late fetal and adult stages. The greatest change occurs at or near the time of birth, with progressively smaller increases observed between the neonatal and juvenile and the juvenile and adult stages.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Bar graphs showing the relative expression levels of the 3.6- and 4.4-kb AE3 mRNAs in heart and brain during murine development. The Northern hybridization data presented in Fig 6Up were quantified by PhosphorImager (Molecular Dynamics) analysis as described in "Materials and Methods." Levels of the two AE3 transcripts are normalized to 18S RNA to account for loading differences and are presented relative to that of the 3.6-kb mRNA in adult heart, which is assigned a value of 100.

AE3 mRNA Expression in the Atria and Ventricles of Mouse Heart
Although both the 3.6-kb cardiac-specific mRNA and the 4.4-kb AE3 transcript are expressed in rat, mouse, and human heart, there are no published data regarding the distribution of the two mRNAs between atrial and ventricular tissue. To address this question, we isolated total RNAs from mouse atria and ventricles and analyzed these by Northern blot hybridization using exon C1 and 3'-terminal AE3 probes. The 3.6-kb cardiac-specific mRNA, as shown in Fig 8Down, was present in both RNA preparations, whereas the 4.4-kb AE3 transcript was detected only in the atria. Even after prolonged autoradiography, there was no clear evidence of the longer mRNA in ventricle. Because signal from the 3.6-kb transcript might have obscured a weak band, we cannot rule out the possibility that trace levels of the 4.4-kb mRNA were present. It seems clear, however, that this transcript is expressed predominantly, if not exclusively, in atrium.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 8. Expression of the 3.6- and 4.4-kb AE3 mRNAs in atrium (Atr) and ventricle (Vent) of murine heart. Total RNAs prepared from Atr and Vent of adult mouse heart were analyzed by Northern hybridization. The blot was screened successively with the murine exon C1 and rat AE3 3' coding probes as described in "Materials and Methods." Positions of the 28S and 18S RNAs are shown to the left of the figure, and exposure times are shown on the right.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We have demonstrated previously that rat heart contains a cardiac-specific mRNA encoding an NH2-terminal variant of the AE3 anion exchanger8 and have suggested that this protein might be responsible for the sodium-independent Cl-/HCO3- exchange activities detected in cardiac Purkinje fibers and ventricular myocytes.2 3 4 In the present study, we have presented data showing that alternative exon C1, containing the rat cardiac AE3 NH2-terminal coding sequence, is conserved in the mouse and human genes and that both mouse and human heart express a cardiac-specific AE3 mRNA that includes this exon. These findings are consistent with the hypothesis that the cardiac AE3 variant is an important component of the total Cl-/HCO3- exchange system in mammalian heart. We have also shown that the 3.6-kb cardiac-specific AE3 mRNA and the more broadly distributed 4.4-kb AE3 transcript are differentially expressed during murine development and in the atria and ventricles of mouse heart.

Sequence similarity between the NH2 termini of the human and rat cardiac AE3 variants is much less than that observed between rat and mouse and may reflect differences in structural and functional demands on the NH2 terminus in rodent and human hearts. Of possible significance in this regard are potential protein kinase C phosphorylation sites (SPR at residue 34 and SIR at residue 59) that are present in human cardiac AE3, as noted by Yannoukakos et al,11 but absent in the rodent exchangers. On the other hand, certain features of the cardiac-specific NH2 terminus are conserved between the rodent and human proteins. All three NH2 termini include a high proportion of prolines and negatively charged residues, a characteristic also found in AE27 25 and in the brain form of AE3.7 9 All of these amino acids are conserved between the mouse and rat sequences, and most are retained in the human protein. A potential casein kinase II phosphorylation site located at Ser 3 is present in all three sequences, as are consensus phosphorylation sites for protein kinases A and C, encoded by exon 7. There are no data pertaining to the phosphorylation state of the cardiac or brain AE3 proteins in vivo, but the NH2 terminus of band 3 (AE1) is phosphorylated by a membrane-associated tyrosine kinase,26 and it is possible that other AE family members may also be targets for phosphorylation.

It is clear from the respective mRNA tissue distributions and developmental expression patterns that the two AE3 variants are subject to different mechanisms of genetic regulation. Since the 3.6- and 4.4-kb mRNAs are transcribed from separate promoters, a portion of this regulation must occur at the transcriptional level. The conservation of sequences extending from -239 through +29 relative to the rat transcription initiation site indicates that this region is likely to contain control elements that regulate transcription of the cardiac AE3 mRNA. Several potential transcription factor binding sites are included among the conserved sequences. The rat and mouse AE3 genes contain a consensus Sp1 motif located {approx}65 bp upstream from the transcription initiation site. In the human sequence, the central C of the element is replaced by a T, and two overlapping copies are present. Although the ability of the human sequence to bind Sp1 is unknown, a statistical analysis of >500 unrelated RNA polymerase II promoters suggests that the C to T substitution is permitted at this position.27 Single copies of the CACCC, E-box, and MCAT consensus sequences are conserved in all three genes. The CACCC element has been identified as a component of the ß-globin22 and other promoters, but a role in directing cardiac-specific transcription has not been described. Both the E-box and MCAT motifs, on the other hand, are involved in regulating transcription of a number of genes encoding skeletal and cardiac muscle proteins.28 Their presence in the cardiac-specific promoter region of the AE3 gene and conservation in the rodent and human sequences are therefore of particular interest.

The cardiac promoter region of the rat AE3 gene and the corresponding portions of the mouse and human genes do not include a consensus TATA box. Nevertheless, transcription of the rat cardiac mRNA precursor begins largely at a single site,8 suggesting that some other sequence motif must be involved in correctly positioning RNA polymerase II. One possibility is that sequences surrounding the transcription start site contain an "initiator" element,29 a hypothesis strengthened by the complete conservation of this region between the rat, mouse, and human AE3 genes. Nucleotide sequences surrounding the AE3 cardiac transcription initiation site, however, are a relatively poor match to the existing mammalian consensus initiator (Py Py A+1 N T/A Py Py).30 A better candidate sequence is located downstream, at positions +18 to +24, but this lies well outside the region (roughly -5 to +5) in which initiator elements are known to be functional when moved relative to the transcription start point.30 It has been noted that activity of several weak nonconsensus initiator sequences is dependent on the presence of an A-T–rich motif {approx}25 bp upstream.30 The cardiac AE3 promoter region contains the sequence TCAATA at this point (Fig 2Up) and could possibly include an initiator of this type.

The specificity of human and mouse AE3 gene expression in adult tissues largely parallels that of the rat gene, although there are some significant differences. As in the rat, the murine and human 3.6-kb transcripts containing exon C1 are confined almost exclusively to the heart, suggesting that the alternative NH2 terminus of the corresponding proteins serves a cardiac-specific function. Trace amounts of the cardiac AE3 mRNA were detected in murine lung, although not in human or rat lung, and may reflect expression in atrial-like myocytes contained in the myocardium of pulmonary and caval veins.31 The low-level expression of cardiac AE3 mRNA that we observed previously in rat skeletal muscle8 was not seen in mouse or human skeletal muscle in the present study. Because the rat muscle preparation in which the cardiac AE3 mRNA was detected contained a mixture of muscle types,8 it is possible that the cardiac AE3 mRNA is restricted to slow-twitch fibers, which share a number of contractile, metabolic, and ion-transporting protein isoforms with cardiac muscle.32

In addition to the 3.6- and 4.4-kb mRNAs, the 3' AE3 probe hybridized with a moderately abundant 5.2-kb transcript in human fetal liver (Fig 5Up) and with an mRNA of the same size expressed at trace levels in mouse lung, skeletal muscle, kidney, and testis. The genetic basis for this transcript is unknown, but one possibility is that it arises by alternative cleavage and polyadenylation at a point located {approx}0.8 kb downstream from the known polyadenylation site. This site is unusual in that it does not contain a consensus AATAAA motif and exhibits some variability in the position of poly A addition. If an alternative polyadenylation site does exist, it might also explain the presence of the low-abundance 4.4-kb mRNA detected with an exon C1 probe in human heart, since this size is 0.8 kb larger than the 3.6-kb cardiac AE3 mRNA.

The 4.4-kb mRNA encoding the larger variant of AE3 is expressed at relatively high levels in brain of all three species, but its expression in heart seems to vary. In the adult rat,8 the transcript is present at similar levels in heart and brain, and the same result was obtained with adult and fetal human hearts in the present study. The 4.4-kb mRNA was clearly detected in intact murine heart during the fetal through juvenile stages of development. In the adult mouse, however, the transcript could only be detected in RNA isolated from atrium and not in RNA from ventricle or whole heart (which would consist predominantly of ventricle), a finding that is consistent with data reported previously by Kopito et al.9 The restriction of the larger AE3 mRNA to atrium and the decrease in its levels during development suggest that at least in the mouse the function of the corresponding protein is distinct from that of the cardiac AE3 variant.

In a recent study, Yannoukakos et al11 observed both the cardiac and brain AE3 mRNAs in human left ventricle. Those results, and possibly our own experiments showing significant levels of the 4.4-kb mRNA in human heart, would appear to differentiate the murine and human systems. However, there are reasons to be cautious in interpreting these data. First, although the commercially obtained Northern blot used in the present study contained RNA prepared from undiseased human heart, there is no information available about whether the tissue contained both atrium and ventricle or ventricle only. In the study by Yannoukakos et al, the RNA used for Northern hybridization analysis was prepared from postmortem left ventricle in congestive failure. The disease state and any pharmacological therapy that preceded death may have had an influence on AE3 gene expression. Additional studies of atrial and ventricular tissues obtained from normal as well as diseased human hearts will be needed to resolve these questions.

The high level of cardiac-specific AE3 mRNA expression observed in both the atrium and ventricle of mouse heart is consistent with the possibility that cardiac AE3 plays a significant role in regulating pH and/or chloride concentration in most cardiac myocytes. The rise in cardiac AE3 mRNA levels that occurs during development, particularly after birth, indicates that the requirement for the exchanger increases as growth progresses. This may reflect heightened demands on systems regulating pH and ion homeostasis as the workload of the heart increases. Such questions concerning the physiological role of the AE3 Cl-/HCO3- exchanger have been difficult to address, since there are no known inhibitors that will clearly differentiate the members of the AE family. With the availability of the mouse AE3 gene, however, it should be possible, by the use of gene targeting and murine embryonic stem cell technologies, to produce animals in which the cardiac AE3 protein is eliminated or modified.33 34


*    Acknowledgments
 
This work was supported by National Institutes of Health Program of Excellence grant HL-41496. We thank Dr S.L. Alper for communicating the results of his study (Reference 11) before publication.


*    Footnotes
 
1 During the preparation of this manuscript, we learned that Yannoukakos et al11 had isolated a human heart AE3 cDNA containing a 5' end similar to exon C1 of the rat AE3 gene. They were kind enough to share their data with us before publication, and we find that these are consistent with the human genomic sequences presented here. Back

Received September 22, 1994; accepted December 14, 1994.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Alper SL. The band 3-related anion exchanger (AE) gene family. Annu Rev Physiol. 1991;53:549-564. [Medline] [Order article via Infotrieve]

2. Polimeni PI, Page E. Chloride distribution and exchange in rat ventricle. Am J Physiol. 1980;238:C169-C176. [Abstract/Free Full Text]

3. Heinemeyer D, Bay W. Intracellular pH in quiescent and stimulated ventricular myocardium: effect of extracellular chloride concentration. Pflugers Arch. 1987;409:142-144. [Medline] [Order article via Infotrieve]

4. Vaughan-Jones RD. An investigation of chloride-bicarbonate exchange in the sheep cardiac Purkinje fibre. J Physiol (Lond). 1986;379:377-406. [Abstract/Free Full Text]

5. Vaughan-Jones RD. Chloride activity and its control in skeletal and cardiac muscle. Phil Trans R Soc Lond. 1982;299:537-548. [Medline] [Order article via Infotrieve]

6. Hume JR, Harvey RD. Chloride conductance pathways in heart. Am J Physiol. 1991;261:C399-C412. [Abstract/Free Full Text]

7. Kudrycki KE, Newman PR, Shull GE. cDNA cloning and tissue distribution of mRNAs for two proteins that are related to the band 3 Cl-/HCO3- exchanger. J Biol Chem. 1990;265:462-471. [Abstract/Free Full Text]

8. Linn SC, Kudrycki KE, Shull GE. The predicted translation product of a cardiac AE3 mRNA contains an N terminus distinct from that of the brain AE3 Cl-/HCO3- exchanger. J Biol Chem. 1992;267:7927-7935. [Abstract/Free Full Text]

9. Kopito RR, Lee BS, Simmons DM, Lindsey AE, Morgans CW, Schneider K. Regulation of intracellular pH by a neuronal homolog of the erythrocyte anion exchanger. Cell. 1989;59:927-937. [Medline] [Order article via Infotrieve]

10. Su Y-R, Klanke CA, Houseal TW, Linn SC, Burk SE, Varvil TS, Otterud BE, Shull GE, Leppert MF, Menon AG. Molecular cloning and physical and genetic mapping of the human anion exchanger isoform 3 (SLC2C) gene to chromosome 2q36. Genomics. 1994;22:605-609. [Medline] [Order article via Infotrieve]

11. Yannoukakos D, Stuart-Tilley A, Fernandez HA, Fey P, Duyk G, Alper SL. Molecular cloning, expression, and chromosomal localization of two isoforms of the AE3 anion exchanger from human heart. Circ Res. 1994;75:603-614. [Abstract/Free Full Text]

12. Wernke GR, Thompson RL. DNANALYZE: a comprehensive nucleotide and amino acid sequence analysis system emphasizing similarity comparisons Biophys J. 1989;55:390a. Abstract.

13. Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D, Annunziata N, Doetschman T. Targeted disruption of the mouse transforming growth factor-ß1 gene results in multifocal inflammatory disease. Nature. 1992;359:693-699. [Medline] [Order article via Infotrieve]

14. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol. 1975;98:503-517. [Medline] [Order article via Infotrieve]

15. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1989;1:4.2.4-4.2.5.

16. Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989;2:14.20.

17. Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989;3:B.13.

18. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1989;1:4.9.8-4.9.9.

19. Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem. 1991;266:19867-19870. [Free Full Text]

20. Breathnach R, Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem. 1981;50:349-383. [Medline] [Order article via Infotrieve]

21. Kadonaga JT, Jones KA, Tjian R. Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem Sci. 1986;11:20-23.

22. Dierks P, van Ooyen A, Cochran MD, Dobkin C, Reiser J, Weissmann C. Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit ß-globin gene in mouse 3T6 cells. Cell. 1983;32:695-706. [Medline] [Order article via Infotrieve]

23. Blackwell TK, Weintraub H. Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science. 1990;250:1104-1110. [Abstract/Free Full Text]

24. Mar JH, Ordahl CP. A conserved CATTCCT motif is required for skeletal muscle-specific activity of the cardiac troponin T gene promoter. Proc Natl Acad Sci U S A. 1988;85:6404-6408.[Abstract/Free Full Text]

25. Alper SL, Kopito RR, Libresco SM, Lodish HF. Cloning and characterization of a murine band 3-related cDNA from kidney and from a lymphoid cell line. J Biol Chem. 1988;263:17092-17099. [Abstract/Free Full Text]

26. Tanner MJA. Molecular and cellular biology of the erythrocyte anion exchanger (AE1). Semin Hematol. 1993;30:34-57. [Medline] [Order article via Infotrieve]

27. Bucher P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J Mol Biol. 1990;212:563-578. [Medline] [Order article via Infotrieve]

28. Van Bilsen M, Chien KR. Growth and hypertrophy of the heart: towards an understanding of cardiac-specific and inducible gene expression. Cardiovasc Res. 1993;27:1140-1149. [Medline] [Order article via Infotrieve]

29. Smale ST, Baltimore D. The initiator as a transcriptional control element. Cell. 1989;57:103-113. [Medline] [Order article via Infotrieve]

30. Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale ST. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol. 1994;14:116-127. [Abstract/Free Full Text]

31. Kramer AW, Marks LS. The occurrence of cardiac muscle in the pulmonary veins of rodents. J Morphol. 1965;117:135-150.[Medline] [Order article via Infotrieve]

32. Olson EN. Regulation of muscle transcription by the MyoD family: the heart of the matter. Circ Res. 1993;72:1-6. [Abstract/Free Full Text]

33. Mansour SL. Gene targeting in murine embryonic stem cells: introduction of specific alterations into the mammalian genome. Genet Anal Tech Appl. 1990;7:219-227. [Medline] [Order article via Infotrieve]

34. Askew GR, Doetschman T, Lingrel JB. Site-directed point mutations in embryonic stem cells: a gene-targeting tag-and-exchange strategy. Mol Cell Biol. 1993;13:4115-4124.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
V. Prasad, I. Bodi, J. W. Meyer, Y. Wang, M. Ashraf, S. J. Engle, T. Doetschman, K. Sisco, M. L. Nieman, M. L. Miller, et al.
Impaired Cardiac Contractility in Mice Lacking Both the AE3 Formula Exchanger and the NKCC1 Na+-K+-2Cl- Cotransporter: EFFECTS ON Ca2+ HANDLING AND PROTEIN PHOSPHATASES
J. Biol. Chem., November 14, 2008; 283(46): 31303 - 31314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. V. Alvarez, D. M. Kieller, A. L. Quon, M. Robertson, and J. R. Casey
Cardiac hypertrophy in anion exchanger 1-null mutant mice with severe hemolytic anemia
Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1301 - H1312.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
B. V Alvarez, D. M Kieller, A. L Quon, D. Markovich, and J. R Casey
Slc26a6: a cardiac chloride-hydroxyl exchanger and predominant chloride-bicarbonate exchanger of the mouse heart
J. Physiol., December 15, 2004; 561(3): 721 - 734.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. E. Cingolani, G. E. Chiappe, I. L. Ennis, P. G. Morgan, B. V. Alvarez, J. R. Casey, R. A. Dulce, N. G. Perez, and M. C. Camilion de Hurtado
Influence of Na+-Independent Cl--HCO3- Exchange on the Slow Force Response to Myocardial Stretch
Circ. Res., November 28, 2003; 93(11): 1082 - 1088.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Sterling, B. V. Alvarez, and J. R. Casey
The Extracellular Component of a Transport Metabolon. EXTRACELLULAR LOOP 4 OF THE HUMAN AE1 Cl-/HCO3- EXCHANGER BINDS CARBONIC ANHYDRASE IV
J. Biol. Chem., July 5, 2002; 277(28): 25239 - 25246.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Chiappe de Cingolani, P. Morgan, C. Mundina-Weilenmann, J. Casey, J. Fujinaga, M. Camilion de Hurtado, and H. Cingolani
Hyperactivity and altered mRNA isoform expression of the Cl-/HCO3- anion-exchanger in the hypertrophied myocardium
Cardiovasc Res, July 1, 2001; 51(1): 71 - 79.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Papageorgiou, B. E. Shmukler, A. K. Stuart-Tilley, L. Jiang, and S. L. Alper
AE anion exchangers in atrial tumor cells
Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H937 - H945.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. R. Hume, D. Duan, M. L. Collier, J. Yamazaki, and B. Horowitz
Anion Transport in Heart
Physiol Rev, January 1, 2000; 80(1): 31 - 81.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. L. Ennis, B. V. Alvarez, M. C. C. de Hurtado, and H. E. Cingolani
Enalapril Induces Regression of Cardiac Hypertrophy and Normalization of pHi Regulatory Mechanisms
Hypertension, April 1, 1998; 31(4): 961 - 967.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Wang, P. J. Schultheis, and G. E. Shull
Three N-terminal Variants of the AE2 Cl[IMAGE]/HCO(3)[IMAGE] Exchanger Are Encoded by mRNAs Transcribed from Alternative Promoters
J. Biol. Chem., March 29, 1996; 271(13): 7835 - 7843.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Linn, S. C.
Right arrow Articles by Shull, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linn, S. C.
Right arrow Articles by Shull, G. E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH