Articles |
From the Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati (Ohio) College of Medicine.
Correspondence to Dr Gary E. Shull, Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine, 231 Bethesda Ave, Cincinnati, OH 45267-0524.
| Abstract |
|---|
|
|
|---|
Key Words: anion exchange alternative exon tissue specificity developmental regulation
| Introduction |
|---|
|
|
|---|
All three of the known AE genes are expressed in adult rat heart,7 although the cellular locations and functions of individual protein products have not been established. The most abundant mRNA, as judged by Northern blot hybridization, is a 3.6-kb AE3 transcript that is almost entirely cardiac specific. A second AE3 mRNA, 4.4 kb in length, is expressed at equivalent levels in rat heart and brain and at lower levels in other tissues. Both AE3 transcripts encode polypeptides containing the COOH-terminal transmembrane region required for anion exchange activity.7 8 9 The NH2-terminal 270 amino acids encoded by the longer mRNA, however, are replaced in the cardiac-specific AE3 variant by a dissimilar 73amino acid sequence. This is encoded by an alternative exon (C1) that is located within the sixth intron of the gene and contains the transcription initiation site of the 3.6-kb mRNA.8 Because of the abundance of its mRNA, the cardiac-specific AE3 variant is a strong candidate for the Cl-/HCO3- exchanger involved in regulation of pH and [Cl-] in heart muscle.5
The major objectives of the present study were to determine whether the cardiac-specific promoter region and exon C1 are conserved in the AE3 genes of mouse and human and to obtain detailed information regarding the expression of the two AE3 mRNAs during development. Mouse heart has been shown to contain a cardiac-specific AE3 transcript,9 but the structure and genetic basis of this mRNA have not been determined. Clones containing the human AE3 gene have recently been isolated, and the gene has been mapped to chromosome 2q3610 ; however, there have been no published reports of a human exon C1 homologue or a human cardiac-specific AE3 mRNA similar to that of the rat.* In the present study, we report the characterization of murine and human AE3 genomic clones and the analysis of AE3 gene expression in both species. We find that the rat cardiac-specific promoter region and exon C1, containing the alternative NH2-terminal coding sequence, are conserved in murine and human AE3 genes. Both species express an AE3 mRNA that contains the alternative exon and appears to be confined to the heart. Finally, we report that the brain and cardiac AE3 transcripts are distributed differently between the atria and ventricles of the heart and exhibit distinct patterns of expression during murine development.
| Materials and Methods |
|---|
|
|
|---|
DNAs were prepared by using Qiagen
Plasmid and Lambda Maxi kits (Qiagen, Inc). Oligonucleotide primers
were synthesized by the University of Cincinnati DNA Core Facility. The
polymerase chain reaction (PCR) was performed by using a Perkin-Elmer
Cetus DNA thermal cycler. All DNA modification enzymes and restriction
endonucleases were obtained either from New England Biolabs or
GIBCO-BRL. DNA probes were radiolabeled by random priming (Pharmacia).
Except as noted, the Sequenase v.2.0 kit (United States Biochemical)
was used for all nucleotide sequencing. Computer analyses of nucleotide
and amino acid sequences were performed by using the
DNANALYZE12 and ALIGN
(Scientific & Educational Software) programs.
Isolation and Characterization of Murine and Human AE3 Genomic
Clones
AE3 genomic clones were isolated from a 129SvJ mouse
DASH II
library13 by screening with a 32P-labeled
2.2-kb Bsu36 I fragment (exons 11 to 23) of a rat cardiac
AE3 cDNA.8 BamHI fragments containing sequences
from exons 1 through 21 were identified by Southern blot
hybridization.14 The Bsu36 I fragment described
above and a 352-nt Ava I fragment (alternative first exon
C1) of the same cDNA were used as probes. BamHI fragments
were subcloned into pBluescript II (Stratagene) to facilitate
nucleotide sequence analysis. The sequence of a 0.2-kb region
between BamHI sites in introns 6 and 7 was obtained directly
from a genomic clone by using the PCR-based dsDNA cycle sequencing kit
(GIBCO-BRL). The isolation of cosmid clone HP 12-1a, containing the
human AE3 gene, and the production of random subclones have been
described previously.10 Contiguous subclones, spanning
intron 6 through exon 8 by analogy with the rat gene, were identified
by screening with the rat heart AE3 cDNA Ava I fragment
described above. A portion of the human AE3 sequence, including all of
exon 6 and the first 446 nucleotides of intron 6, was determined
directly from the original cosmid clone by using the Sequenase
method.
Reverse TranscriptionPCR Analysis of Mouse and Human Cardiac AE3
mRNAs
Double-stranded cDNA prepared from normal human heart
poly(A)+ RNA (source, 46-year-old Caucasian female; cause
of death, trauma) was purchased from Clontech Laboratories, Inc. Total
RNA was isolated from adult CF1 mouse heart by the guanidinium
isothiocyanate procedure,15 and first-strand cDNA was
prepared according to published methods16 by using random
hexamers and oligo-dT12-18 in a 2:1 ratio. The collection
of mouse tissues for these experiments and experiments described in
other sections was performed according to institutional guidelines. PCR
analysis was carried out by using primers containing the
translation initiation site in the cardiac first exon and a portion of
the downstream sequence of exon 7. The mouse and human sense-strand
primers were GAATGACAAGCCCGCTGGAC and GAATGACGAGCCCACTGGAG (5'
to 3'), respectively. The antisense primers were ACCTCATGAGGCCTCCGATC
(mouse) and ACCTCATGAGGCCTCCGGTC (human). Reactions contained 10
µL mouse first-strand cDNA or 1 ng double-stranded human cDNA, 20
mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 2 mmol/L
MgCl2, 0.25 µmol/L each primer, 200 µmol/L each
dNTP, and 5 U Taq DNA polymerase (GIBCO-BRL) in a volume of
100 µL. PCR was performed for 30 cycles (94°C, 45 seconds; 58°C,
1 minute; and 72°C, 2 minutes), with a final 7-minute incubation at
72°C. A portion of each reaction was analyzed by agarose gel
electrophoresis to verify that the expected 370-bp products were
obtained. Reaction products were cloned for sequence analysis using
the TA cloning system from Invitrogen Corp.
Northern Hybridization Analysis of AE3 mRNA Tissue Distribution
Multiple-tissue Northern blots of murine adult (BALB/c), human
adult, and human fetal poly(A)+ RNAs (2 µg per lane) were
purchased from Clontech Laboratories, Inc. All RNAs were prepared from
normal (undiseased) tissues. Blots were screened with
32P-labeled probes containing the complete mouse or human
exon C1 sequence. These were prepared by PCR amplification from a
murine BamHI genomic subclone and the human AE3 cosmid clone
HP12-1a,10 respectively, and purified by agarose gel
electrophoresis before radiolabeling. Blots were prehybridized 18 to 20
hours at 42°C in 10 mL of a solution containing 50% formamide, 5x
SSPE,17 5x Denhardt's solution,17 0.1%
sodium dodecyl sulfate (SDS), and 100 µg denatured salmon sperm DNA
per milliliter. The prehybridization solution was replaced with 10 mL
fresh solution of the same composition, and 50 ng of denatured
radiolabeled probe DNA was added. Membranes were incubated for 20 hours
at 42°C and then washed twice, for 15 minutes each, in 6x standard
saline citrate (SSC)17 and 0.1% SDS at room temperature,
followed by 30 minutes each in 2x SSC/0.1% SDS and 0.2x SSC/0.1%
SDS at 58°C. Blots were covered with plastic wrap and
autoradiographed. After the initial screening, all membranes were
stripped and reprobed with the 2.2-kb Bsu36 I rat heart AE3
cDNA fragment described previously. Prehybridization, hybridization,
and washing conditions were the same as described above.
Analysis of AE3 mRNA Expression During Murine Development
Total RNA was prepared according to the guanidinium
isothiocyanate procedure from whole heart, brain, lung, liver, skeletal
muscle, and kidney obtained from fetal (15 postcoital days), neonatal
(2 days), juvenile (3 weeks), and adult (8 weeks) mice (strain FVB/N).
Tissues were collected from four litters of fetal mice, three litters
of neonatal mice, 10 juvenile mice, and three adult mice. RNA (10 µg
per lane) was denatured by the glyoxaldimethyl sulfoxide (DMSO)
method,18 fractionated in neutral agarose gels, and
transferred to charged nylon membranes (Magna NT, MSI). Membranes were
prehybridized, hybridized, and washed as described for the
multiple-tissue Northern blots. The probe used was the 2.2-kb
Bsu36 I rat heart AE3 cDNA fragment described previously.
Signals were detected by autoradiography and then quantified by using a
series 400 PhosphorImager and IMAGEQUANT
software (Molecular Dynamics). After the initial hybridization, blots
were stripped and rescreened with the murine exon C1 probe and then
with the 32P-labeled oligonucleotide
5'-GACAAGCATATGCTACTGGC-3', which is complementary to a sequence
conserved in rat, mouse, and human 18S RNAs. For the oligonucleotide
probe, blots were prehybridized overnight at 42°C in 10 mL of a
solution containing 6x SSC/1% SDS and then incubated 18 hours at
42°C in 10 mL of a solution of the same composition containing
1x107 cpm of the end-labeled probe (total oligonucleotide
concentration, 120 pmol/mL). Membranes were washed once at room
temperature for 5 minutes and twice at 50°C for 15 minutes in 3x
SSC/0.1% SDS. Signals were detected by autoradiography and quantified
by PhosphorImager analysis as described above.
Analysis of AE3 mRNA Distribution in Murine Heart
Total RNA, prepared from atria and ventricles of 20 adult FVB/N
mice as described for reverse transcriptionPCR analysis above,
was denatured with glyoxal-DMSO, fractionated in neutral agarose gels,
and transferred to charged nylon membranes (Nytran+, Schleicher &
Schuell). Each lane contained 5, 10, or 20 µg of RNA. The blots were
first screened with the murine exon C1 probe described above, then
stripped, and reprobed with the 2.2-kb Bsu36 I rat heart AE3
cDNA fragment. Signals were detected by autoradiography and quantified
by PhosphorImager analysis.
| Results |
|---|
|
|
|---|
Analysis of the mouse and human AE3 genes demonstrated that both
contain sequences within the sixth intron that correspond to the rat
cardiac-specific first exon, C1. As illustrated in Fig 1
, the conserved region includes the rat cardiac
transcription initiation site, presumptive translation initiation
codon, and NH2-terminal coding sequence. The lengths of the
mouse and human cardiac-specific exons are greater than that of the rat
because of the presence of insertions in the 5' untranslated region.
The rat and mouse exon C1 nucleotide sequences are 83% identical, and
sequence identity between the rat and human exons is 66% (Fig 2
). Several features of exon C1 are conserved in all
three species. The first 36 nucleotides of the rat exon, including the
transcription initiation site, are completely retained in the human
sequence, and the corresponding portion of the murine exon contains
only two nucleotide substitutions. The putative translation start codon
is located in the same position in each species and is in an acceptable
context for initiation of protein synthesis.19 The open
reading frames of all three sequences are the same length, with each
containing 72 codons plus the first nucleotide of codon 73. The splice
donor sequence adjoining the 3' end of exon C1 is also conserved.
|
|
Nucleotide sequences immediately upstream and downstream from the rat cardiac transcription initiation site are highly conserved in both the mouse and human AE3 genes. The region from positions -38 through +29 relative to the transcription initiation site is identical in all three species, and identity between the rat and mouse sequences extends to -50. Overall, the rat sequence from positions -239 through +36 is 97% conserved in the mouse AE3 gene and 85% conserved in the human gene. An 8-bp deletion in the human gene, relative to the rat (nucleotides -94 to -101), constitutes the largest single difference between the three sequences. The presumptive mouse and human promoter regions, like the rat sequence, lack a classic TATA box.20 Several potential cis-acting control elements are conserved in all three species. Both the rat and mouse sequences contain a core consensus binding site for the transcription factor Sp1.21 In the human AE3 gene, the central C of the element is replaced by a T, and two overlapping copies of the sequence are present. The rat 5'-flanking region also contains copies of the CACCC,22 E-box,23 and MCAT24 consensus sequences that are conserved in the mouse and human AE3 genes.
Amino acid sequences predicted from exons C1 and 7 of the rat AE3 gene
are compared with the corresponding mouse and human sequences in Fig 3
. The murine and rat exon C1 sequences are 92%
identical. The rat and human C1 sequences are only 63% identical,
which is considerably lower than the 98% identity between the amino
acid sequences predicted from exon 7 or the identity of 96% observed
in a survey of 194 codons from human exons 7, 8, 9, 11, 13, and
14.10 Although there are significant differences between
the human and rat C1 amino acid sequences, the majority of proline and
negatively charged residues, which are relatively abundant, are
conserved in the human sequence. Also, a potential casein kinase II
phosphorylation site at Ser 3 is present in all three species, as
are possible protein kinase A and protein kinase C phosphorylation
sites encoded by exon 7.
|
AE3 mRNA Expression Patterns in Mouse and Human Tissues
Results of the genomic cloning studies showed that a counterpart
of the rat cardiac-specific exon C1 is present in the mouse and
human AE3 genes. To determine whether mRNAs containing the exon
C1exon 7 splice junction are expressed in mouse and human heart, we
performed PCR analyses of heart cDNA using species-specific primers
corresponding to the translation initiation region in exon C1 and the
3' end of exon 7. The expected 367-bp product was obtained from both
the mouse and human cDNAs (data not shown). Sequence analysis
showed that both PCR products contained the anticipated splice
junction and that the cDNA and genomic sequences were identical.
Thus, the structure and expression pattern of the rat cardiac-specific
AE3 mRNA appear to be conserved in both mice and humans.
Northern blots of poly(A)+ RNAs from mouse and human
tissues were screened with murine and human exon C1 probes to determine
the distribution of transcripts containing the alternative exon. As
shown in Fig 4
(upper panels), a 3.6-kb mRNA was
present at high levels in adult mouse heart and at low levels in
lung. A relatively abundant 3.6-kb mRNA was also detected in both adult
and fetal human hearts (Fig 5
, upper panels). An mRNA of
4.4 kb, which hybridized with the C1 probe at moderate stringency,
was detected at low levels in human fetal heart and in adult heart
after prolonged autoradiography (114 hours).
|
|
The blots were stripped and rescreened with a rat AE3 cDNA fragment
encoding COOH-terminal sequences common to both of the known AE3
variants. This probe hybridized to the 3.6-kb mRNA recognized by the
exon C1 probes and to a 4.4-kb AE3 mRNA that was first identified in
rat and mouse brain and in rat stomach.8 9 Relatively high
levels of the 4.4-kb transcript were found in adult mouse brain (Fig 4
,
lower panels) and in adult and fetal human hearts and brains (Fig 5
,
lower panels). Low levels of the 4.4-kb mRNA were present in mouse
lung, and traces were detected in skeletal muscle, kidney, and testis
(Fig 4
). An mRNA of
5.2 kb was detected at moderate levels in human
fetal liver, but not in adult liver, and at trace levels in mouse lung,
skeletal muscle, kidney, and testis.
AE3 Expression During Murine Development
To determine whether the expression of either AE3 transcript is
developmentally regulated, we performed Northern blot analyses of total
RNAs from mouse heart, brain, lung, liver, skeletal muscle, and kidney
prepared at the late fetal (15 postcoital days), neonatal (2 days),
juvenile (3 weeks), and adult (8 weeks) stages. The murine exon C1
sequence and the rat 3'-terminal AE3 cDNA fragment, which detects both
AE3 transcripts, were used as probes in these experiments. As shown in
Fig 6
, steady state levels of the cardiac-specific AE3
mRNA in heart increase significantly between the late fetal and adult
stages. In contrast, the 4.4-kb AE3 mRNA is only weakly expressed in
heart during the fetal through juvenile stages, and levels of the
transcript appear to decrease substantially in the adult. A trace
amount of the 3.6-kb mRNA seemed to be present in juvenile and
adult lungs (140-hour exposure), consistent with the results shown in
Fig 4
, and low levels of the 4.4-kb mRNA were present throughout
development. The 3.6-kb AE3 mRNA was not detected in liver, skeletal
muscle, or kidney at any of the time points examined, but after long
autoradiographic exposures, we observed trace levels of the 4.4-kb
transcript in skeletal muscle and kidney at each developmental stage
(data not shown).
|
The data for expression of the 3.6- and 4.4-kb AE3 mRNAs in heart and
brain are presented quantitatively in Fig 7
. Steady
state levels of the 3.6-kb transcript in heart increase
17-fold,
relative to 18S RNA, between the late fetal and adult stages of
development, with the greatest change occurring after birth. Levels of
the 3.6- and 4.4-kb AE3 mRNAs in heart are similar at 15 postcoital
days. By adulthood, however, the steady state level of the 4.4-kb
transcript drops
35-fold, with the bulk of the decrease occurring
between 3 and 8 weeks after birth. In brain, levels of the 4.4-kb AE3
mRNA increase 4- to 5-fold between the late fetal and adult stages. The
greatest change occurs at or near the time of birth, with progressively
smaller increases observed between the neonatal and juvenile and the
juvenile and adult stages.
|
AE3 mRNA Expression in the Atria and Ventricles of Mouse Heart
Although both the 3.6-kb cardiac-specific mRNA and the 4.4-kb AE3
transcript are expressed in rat, mouse, and human heart, there are no
published data regarding the distribution of the two mRNAs between
atrial and ventricular tissue. To address this question, we isolated
total RNAs from mouse atria and ventricles and analyzed these by
Northern blot hybridization using exon C1 and 3'-terminal AE3 probes.
The 3.6-kb cardiac-specific mRNA, as shown in Fig 8
, was
present in both RNA preparations, whereas the 4.4-kb AE3 transcript
was detected only in the atria. Even after prolonged autoradiography,
there was no clear evidence of the longer mRNA in ventricle. Because
signal from the 3.6-kb transcript might have obscured a weak band, we
cannot rule out the possibility that trace levels of the 4.4-kb mRNA
were present. It seems clear, however, that this transcript is
expressed predominantly, if not exclusively, in atrium.
|
| Discussion |
|---|
|
|
|---|
Sequence similarity between the NH2 termini of the human and rat cardiac AE3 variants is much less than that observed between rat and mouse and may reflect differences in structural and functional demands on the NH2 terminus in rodent and human hearts. Of possible significance in this regard are potential protein kinase C phosphorylation sites (SPR at residue 34 and SIR at residue 59) that are present in human cardiac AE3, as noted by Yannoukakos et al,11 but absent in the rodent exchangers. On the other hand, certain features of the cardiac-specific NH2 terminus are conserved between the rodent and human proteins. All three NH2 termini include a high proportion of prolines and negatively charged residues, a characteristic also found in AE27 25 and in the brain form of AE3.7 9 All of these amino acids are conserved between the mouse and rat sequences, and most are retained in the human protein. A potential casein kinase II phosphorylation site located at Ser 3 is present in all three sequences, as are consensus phosphorylation sites for protein kinases A and C, encoded by exon 7. There are no data pertaining to the phosphorylation state of the cardiac or brain AE3 proteins in vivo, but the NH2 terminus of band 3 (AE1) is phosphorylated by a membrane-associated tyrosine kinase,26 and it is possible that other AE family members may also be targets for phosphorylation.
It is clear from the respective mRNA tissue distributions and
developmental expression patterns that the two AE3 variants are subject
to different mechanisms of genetic regulation. Since the 3.6- and
4.4-kb mRNAs are transcribed from separate promoters, a portion of this
regulation must occur at the transcriptional level. The conservation of
sequences extending from -239 through +29 relative to the rat
transcription initiation site indicates that this region is likely to
contain control elements that regulate transcription of the cardiac AE3
mRNA. Several potential transcription factor binding sites are included
among the conserved sequences. The rat and mouse AE3 genes contain a
consensus Sp1 motif located
65 bp upstream from the transcription
initiation site. In the human sequence, the central C of the element is
replaced by a T, and two overlapping copies are present. Although
the ability of the human sequence to bind Sp1 is unknown, a statistical
analysis of >500 unrelated RNA polymerase II promoters suggests
that the C to T substitution is permitted at this
position.27 Single copies of the CACCC, E-box, and MCAT
consensus sequences are conserved in all three genes. The CACCC element
has been identified as a component of the ß-globin22 and
other promoters, but a role in directing cardiac-specific transcription
has not been described. Both the E-box and MCAT motifs, on the other
hand, are involved in regulating transcription of a number of genes
encoding skeletal and cardiac muscle proteins.28 Their
presence in the cardiac-specific promoter region of the AE3 gene and
conservation in the rodent and human sequences are therefore of
particular interest.
The cardiac promoter region of the rat AE3 gene and the corresponding
portions of the mouse and human genes do not include a consensus TATA
box. Nevertheless, transcription of the rat cardiac mRNA precursor
begins largely at a single site,8 suggesting that some
other sequence motif must be involved in correctly positioning RNA
polymerase II. One possibility is that sequences surrounding the
transcription start site contain an "initiator"
element,29 a hypothesis strengthened by the complete
conservation of this region between the rat, mouse, and human AE3
genes. Nucleotide sequences surrounding the AE3 cardiac transcription
initiation site, however, are a relatively poor match to the existing
mammalian consensus initiator (Py Py A+1 N T/A Py
Py).30 A better candidate sequence is located downstream,
at positions +18 to +24, but this lies well outside the region (roughly
-5 to +5) in which initiator elements are known to be functional when
moved relative to the transcription start point.30 It has
been noted that activity of several weak nonconsensus initiator
sequences is dependent on the presence of an A-Trich motif
25 bp
upstream.30 The cardiac AE3 promoter region contains the
sequence TCAATA at this point (Fig 2
) and could possibly include an
initiator of this type.
The specificity of human and mouse AE3 gene expression in adult tissues largely parallels that of the rat gene, although there are some significant differences. As in the rat, the murine and human 3.6-kb transcripts containing exon C1 are confined almost exclusively to the heart, suggesting that the alternative NH2 terminus of the corresponding proteins serves a cardiac-specific function. Trace amounts of the cardiac AE3 mRNA were detected in murine lung, although not in human or rat lung, and may reflect expression in atrial-like myocytes contained in the myocardium of pulmonary and caval veins.31 The low-level expression of cardiac AE3 mRNA that we observed previously in rat skeletal muscle8 was not seen in mouse or human skeletal muscle in the present study. Because the rat muscle preparation in which the cardiac AE3 mRNA was detected contained a mixture of muscle types,8 it is possible that the cardiac AE3 mRNA is restricted to slow-twitch fibers, which share a number of contractile, metabolic, and ion-transporting protein isoforms with cardiac muscle.32
In addition to the 3.6- and 4.4-kb mRNAs, the 3' AE3 probe hybridized
with a moderately abundant 5.2-kb transcript in human fetal liver (Fig 5
) and with an mRNA of the same size expressed at trace levels in mouse
lung, skeletal muscle, kidney, and testis. The genetic basis for this
transcript is unknown, but one possibility is that it arises by
alternative cleavage and polyadenylation at a point located
0.8 kb
downstream from the known polyadenylation site. This site is unusual in
that it does not contain a consensus AATAAA motif and exhibits some
variability in the position of poly A addition. If an alternative
polyadenylation site does exist, it might also explain the presence of
the low-abundance 4.4-kb mRNA detected with an exon C1 probe in human
heart, since this size is 0.8 kb larger than the 3.6-kb cardiac AE3
mRNA.
The 4.4-kb mRNA encoding the larger variant of AE3 is expressed at relatively high levels in brain of all three species, but its expression in heart seems to vary. In the adult rat,8 the transcript is present at similar levels in heart and brain, and the same result was obtained with adult and fetal human hearts in the present study. The 4.4-kb mRNA was clearly detected in intact murine heart during the fetal through juvenile stages of development. In the adult mouse, however, the transcript could only be detected in RNA isolated from atrium and not in RNA from ventricle or whole heart (which would consist predominantly of ventricle), a finding that is consistent with data reported previously by Kopito et al.9 The restriction of the larger AE3 mRNA to atrium and the decrease in its levels during development suggest that at least in the mouse the function of the corresponding protein is distinct from that of the cardiac AE3 variant.
In a recent study, Yannoukakos et al11 observed both the cardiac and brain AE3 mRNAs in human left ventricle. Those results, and possibly our own experiments showing significant levels of the 4.4-kb mRNA in human heart, would appear to differentiate the murine and human systems. However, there are reasons to be cautious in interpreting these data. First, although the commercially obtained Northern blot used in the present study contained RNA prepared from undiseased human heart, there is no information available about whether the tissue contained both atrium and ventricle or ventricle only. In the study by Yannoukakos et al, the RNA used for Northern hybridization analysis was prepared from postmortem left ventricle in congestive failure. The disease state and any pharmacological therapy that preceded death may have had an influence on AE3 gene expression. Additional studies of atrial and ventricular tissues obtained from normal as well as diseased human hearts will be needed to resolve these questions.
The high level of cardiac-specific AE3 mRNA expression observed in both the atrium and ventricle of mouse heart is consistent with the possibility that cardiac AE3 plays a significant role in regulating pH and/or chloride concentration in most cardiac myocytes. The rise in cardiac AE3 mRNA levels that occurs during development, particularly after birth, indicates that the requirement for the exchanger increases as growth progresses. This may reflect heightened demands on systems regulating pH and ion homeostasis as the workload of the heart increases. Such questions concerning the physiological role of the AE3 Cl-/HCO3- exchanger have been difficult to address, since there are no known inhibitors that will clearly differentiate the members of the AE family. With the availability of the mouse AE3 gene, however, it should be possible, by the use of gene targeting and murine embryonic stem cell technologies, to produce animals in which the cardiac AE3 protein is eliminated or modified.33 34
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 22, 1994; accepted December 14, 1994.
| References |
|---|
|
|
|---|
2.
Polimeni PI, Page E. Chloride distribution and exchange in
rat ventricle. Am J Physiol. 1980;238:C169-C176.
3. Heinemeyer D, Bay W. Intracellular pH in quiescent and stimulated ventricular myocardium: effect of extracellular chloride concentration. Pflugers Arch. 1987;409:142-144. [Medline] [Order article via Infotrieve]
4.
Vaughan-Jones RD. An investigation of chloride-bicarbonate
exchange in the sheep cardiac Purkinje fibre. J Physiol
(Lond). 1986;379:377-406.
5. Vaughan-Jones RD. Chloride activity and its control in skeletal and cardiac muscle. Phil Trans R Soc Lond. 1982;299:537-548. [Medline] [Order article via Infotrieve]
6.
Hume JR, Harvey RD. Chloride conductance pathways in heart.
Am J Physiol. 1991;261:C399-C412.
7.
Kudrycki KE, Newman PR, Shull GE. cDNA cloning and tissue
distribution of mRNAs for two proteins that are related to the band 3
Cl-/HCO3-
exchanger.
J Biol Chem. 1990;265:462-471.
8.
Linn SC, Kudrycki KE, Shull GE. The predicted translation
product of a cardiac AE3 mRNA contains an N terminus distinct from that
of the brain AE3
Cl-/HCO3-
exchanger.
J Biol Chem. 1992;267:7927-7935.
9. Kopito RR, Lee BS, Simmons DM, Lindsey AE, Morgans CW, Schneider K. Regulation of intracellular pH by a neuronal homolog of the erythrocyte anion exchanger. Cell. 1989;59:927-937. [Medline] [Order article via Infotrieve]
10. Su Y-R, Klanke CA, Houseal TW, Linn SC, Burk SE, Varvil TS, Otterud BE, Shull GE, Leppert MF, Menon AG. Molecular cloning and physical and genetic mapping of the human anion exchanger isoform 3 (SLC2C) gene to chromosome 2q36. Genomics. 1994;22:605-609. [Medline] [Order article via Infotrieve]
11.
Yannoukakos D, Stuart-Tilley A, Fernandez HA, Fey P, Duyk G,
Alper SL. Molecular cloning, expression, and chromosomal localization
of two isoforms of the AE3 anion exchanger from human heart.
Circ Res. 1994;75:603-614.
12. Wernke GR, Thompson RL. DNANALYZE: a comprehensive nucleotide and amino acid sequence analysis system emphasizing similarity comparisons Biophys J. 1989;55:390a. Abstract.
13. Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D, Annunziata N, Doetschman T. Targeted disruption of the mouse transforming growth factor-ß1 gene results in multifocal inflammatory disease. Nature. 1992;359:693-699. [Medline] [Order article via Infotrieve]
14. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol. 1975;98:503-517. [Medline] [Order article via Infotrieve]
15. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1989;1:4.2.4-4.2.5.
16. Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989;2:14.20.
17. Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989;3:B.13.
18. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc; 1989;1:4.9.8-4.9.9.
19.
Kozak M. Structural features in eukaryotic mRNAs that modulate
the initiation of translation. J Biol Chem. 1991;266:19867-19870.
20. Breathnach R, Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem. 1981;50:349-383. [Medline] [Order article via Infotrieve]
21. Kadonaga JT, Jones KA, Tjian R. Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem Sci. 1986;11:20-23.
22. Dierks P, van Ooyen A, Cochran MD, Dobkin C, Reiser J, Weissmann C. Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit ß-globin gene in mouse 3T6 cells. Cell. 1983;32:695-706. [Medline] [Order article via Infotrieve]
23.
Blackwell TK, Weintraub H. Differences and similarities in
DNA-binding preferences of MyoD and E2A protein complexes revealed by
binding site selection. Science. 1990;250:1104-1110.
24.
Mar JH, Ordahl CP. A conserved CATTCCT motif is required for
skeletal muscle-specific activity of the cardiac troponin T gene
promoter. Proc Natl Acad Sci U S A. 1988;85:6404-6408.
25.
Alper SL, Kopito RR, Libresco SM, Lodish HF. Cloning and
characterization of a murine band 3-related cDNA from kidney and from a
lymphoid cell line. J Biol Chem. 1988;263:17092-17099.
26. Tanner MJA. Molecular and cellular biology of the erythrocyte anion exchanger (AE1). Semin Hematol. 1993;30:34-57. [Medline] [Order article via Infotrieve]
27. Bucher P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J Mol Biol. 1990;212:563-578. [Medline] [Order article via Infotrieve]
28. Van Bilsen M, Chien KR. Growth and hypertrophy of the heart: towards an understanding of cardiac-specific and inducible gene expression. Cardiovasc Res. 1993;27:1140-1149. [Medline] [Order article via Infotrieve]
29. Smale ST, Baltimore D. The initiator as a transcriptional control element. Cell. 1989;57:103-113. [Medline] [Order article via Infotrieve]
30.
Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale ST. DNA
sequence requirements for transcriptional initiator activity in
mammalian cells. Mol Cell Biol. 1994;14:116-127.
31. Kramer AW, Marks LS. The occurrence of cardiac muscle in the pulmonary veins of rodents. J Morphol. 1965;117:135-150.[Medline] [Order article via Infotrieve]
32.
Olson EN. Regulation of muscle transcription by the MyoD
family: the heart of the matter. Circ Res. 1993;72:1-6.
33. Mansour SL. Gene targeting in murine embryonic stem cells: introduction of specific alterations into the mammalian genome. Genet Anal Tech Appl. 1990;7:219-227. [Medline] [Order article via Infotrieve]
34.
Askew GR, Doetschman T, Lingrel JB. Site-directed point
mutations in embryonic stem cells: a gene-targeting
tag-and-exchange strategy. Mol Cell Biol. 1993;13:4115-4124.
This article has been cited by other articles:
![]() |
V. Prasad, I. Bodi, J. W. Meyer, Y. Wang, M. Ashraf, S. J. Engle, T. Doetschman, K. Sisco, M. L. Nieman, M. L. Miller, et al. Impaired Cardiac Contractility in Mice Lacking Both the AE3 Formula Exchanger and the NKCC1 Na+-K+-2Cl- Cotransporter: EFFECTS ON Ca2+ HANDLING AND PROTEIN PHOSPHATASES J. Biol. Chem., November 14, 2008; 283(46): 31303 - 31314. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. V. Alvarez, D. M. Kieller, A. L. Quon, M. Robertson, and J. R. Casey Cardiac hypertrophy in anion exchanger 1-null mutant mice with severe hemolytic anemia Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1301 - H1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. V Alvarez, D. M Kieller, A. L Quon, D. Markovich, and J. R Casey Slc26a6: a cardiac chloride-hydroxyl exchanger and predominant chloride-bicarbonate exchanger of the mouse heart J. Physiol., December 15, 2004; 561(3): 721 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Cingolani, G. E. Chiappe, I. L. Ennis, P. G. Morgan, B. V. Alvarez, J. R. Casey, R. A. Dulce, N. G. Perez, and M. C. Camilion de Hurtado Influence of Na+-Independent Cl--HCO3- Exchange on the Slow Force Response to Myocardial Stretch Circ. Res., November 28, 2003; 93(11): 1082 - 1088. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sterling, B. V. Alvarez, and J. R. Casey The Extracellular Component of a Transport Metabolon. EXTRACELLULAR LOOP 4 OF THE HUMAN AE1 Cl-/HCO3- EXCHANGER BINDS CARBONIC ANHYDRASE IV J. Biol. Chem., July 5, 2002; 277(28): 25239 - 25246. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chiappe de Cingolani, P. Morgan, C. Mundina-Weilenmann, J. Casey, J. Fujinaga, M. Camilion de Hurtado, and H. Cingolani Hyperactivity and altered mRNA isoform expression of the Cl-/HCO3- anion-exchanger in the hypertrophied myocardium Cardiovasc Res, July 1, 2001; 51(1): 71 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Papageorgiou, B. E. Shmukler, A. K. Stuart-Tilley, L. Jiang, and S. L. Alper AE anion exchangers in atrial tumor cells Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H937 - H945. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Hume, D. Duan, M. L. Collier, J. Yamazaki, and B. Horowitz Anion Transport in Heart Physiol Rev, January 1, 2000; 80(1): 31 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. L. Ennis, B. V. Alvarez, M. C. C. de Hurtado, and H. E. Cingolani Enalapril Induces Regression of Cardiac Hypertrophy and Normalization of pHi Regulatory Mechanisms Hypertension, April 1, 1998; 31(4): 961 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, P. J. Schultheis, and G. E. Shull Three N-terminal Variants of the AE2 Cl[IMAGE]/HCO(3)[IMAGE] Exchanger Are Encoded by mRNAs Transcribed from Alternative Promoters J. Biol. Chem., March 29, 1996; 271(13): 7835 - 7843. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |