© 1995 American Heart Association, Inc.
Articles |
Nitric Oxide Synthesis by Cultured Endothelial Cells Is Modulated by Flow Conditions
From the Mario Negri Institute for Pharmacological Research (M.N., M.M., R.D., S.A., M.F., M.T., S.O., G.R., A.R.) and the Division of Nephrology (G.R.), Ospedali Riuniti di Bergamo (Italy).
Correspondence to Marina Noris, Mario Negri Institute for Pharmacological Research, Via Gavazzeni 11, 24125 Bergamo, Italy.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract In the present study, we examined the hypothesis that dynamic characteristics of flow modulate the production of vasoactive mediators, namely nitric oxide (NO) and endothelin-1 (ET-1), by human umbilical vein endothelial cells (HUVECs). Cells were exposed for 6 hours in a cone-and-plate apparatus to different types of flow: steady laminar, with shear stresses of 2, 8, and 12 dyne/cm2; pulsatile laminar, with shear stress from 8.2 to 16.6 dyne/cm2 and a frequency of 2 Hz; periodic laminar, with square wave cycles of 15 minutes and shear stress from 2 to 8 dyne/cm2; and turbulent, with shear stress of 8 dyne/cm2 on average. A second culture dish was kept in a normal incubator as a static control for each experiment. Laminar flow induced synthesis of NO by HUVECs that was dependent on shear-stress magnitude. Laminar shear stress at 8 dyne/cm2 also upregulated the level of NO synthase mRNA. As observed with steady laminar flow, pulsatile flow also induced an increase in NO release by endothelial cells. When HUVECs were subjected to step-change increases of laminar shear, a further increase of NO synthesis was observed, compared with steady laminar shear of the same magnitude. Turbulent flow did not upregulate NO synthase mRNA or increase NO release. Both laminar and turbulent shear stress reduced, although not significantly, ET-1 mRNA and ET-1 production compared with the static condition. These results indicate that local blood flow conditions modulate the production of vasoactive substances by endothelial cells. This may affect vascular cell functions such as nonthrombogenicity, regulation of blood flow, and vascular tone.
Key Words: atherosclerosis • endothelium-derived relaxing factor • endothelin • gene expression • shear stress
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The structure and the synthetic and secretory functions1 2 3 4 of vascular endothelial cells are influenced by wall shear stress, the tractive force acting on the cell surface induced by blood flow. Recent studies suggested that shear stress modulates the levels of two potent endothelium-derived vasoactive mediators: the vasodilator nitric oxide (NO)5 6 and the vasoconstrictor endothelin-1 (ET-1).7 Thus, an increase in the rate of flow through a segment of rat aorta8 9 or through a column of endothelial cells grown on the surface of microcarrier beads10 caused additional release of NO. On the other hand, exposure of endothelial cell cultures to controlled levels of laminar shear stress in a cone-and-plate apparatus resulted in downregulation of ET-1 mRNA levels and ET-1 peptide release.11 On the basis of this experimental evidence, it has been suggested that in physiological conditions fluid shear stresses regulate the release of endothelial cell–derived vasoactive mediators to maintain vascular vessel tone.
Experimental studies have documented that chronic alterations of
physiological blood flow cause the arterial diameter to change so as to
recover a physiological state of wall shear stress (
15
dyne/cm2).12 It is widely recognized that
endothelial cells are the "biosensors" of fluid dynamic shear
forces that reduce arterial diameter when blood flow rate decreases and
enlarge the diameter when the flow rate increases.12 The
constant finding that atherosclerotic lesions occur mainly at specific
sites around arterial branchings and bifurcations13 14 15 16
indicates that local flow patterns are also involved in atherogenesis.
With the aim of clarifying these processes, the localization of intimal
thickening in human carotid arteries and the related shear-stress
variables have been studied in detail.14 17 The results of
these investigations indicate that regions exposed to low and unsteady
shear stress appear to be more susceptible to the development of
structural changes than areas of the arterial wall exposed to higher
and more constant shear stress. It appears that focal response to wall
shear stress leads to focally distributed areas of intimal thickening
and subsequent plaque formation. It has been proposed that phenomena
responsible for the remodeling of arteries in response to changes in
blood flow rate are implicated in the development of early
atherosclerotic plaques.12 Recent studies have focused on
the possible role of vascular endothelium in the induction of these
structural changes, particularly on how different hemodynamic
conditions affect the regulation of endothelial cell function. Thus,
exposure to laminar steady flow results in endothelial cell elongation
and alignment with the flow direction, whereas under turbulent flow
they retain their cobblestone shape.11 18 19 Davies et
al19 reported that turbulent flow, but not laminar flow,
induced DNA synthesis and cell proliferation in a confluent endothelial
monolayer.
Since different flow patterns have different effects on endothelial morphology and proliferation, the endothelial synthesis of vasoactive mediators might also be influenced by the nature of the mechanical stimuli sensed by the cells. In this context, the only available data are from Malek and Izumo,11 who have demonstrated that laminar and turbulent shear stress downregulate ET-1 mRNA equally in endothelial cells. Detailed information on the effect of different shear stresses on the potent endothelium-derived vasodilator NO is lacking. Using controlled flow conditions, we investigated the effect of shear-stress levels and flow conditions (laminar versus turbulent flow and steady versus pulsatile or periodic flow) on NO synthase gene expression and NO formation in endothelial cells. We also evaluated endothelial gene expression and the release of the "proatherogenic" mediator ET-1 to compare the effects of physical forces on the balance of these two molecules, which have opposite actions on vascular tone and cell proliferation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Experimental Design
The effect of steady laminar shear stress on NO synthesis by endothelial cells was studied by exposing confluent monolayers of human umbilical vein endothelial cells (HUVECs) to laminar flow (8 dyne/cm2) in a cone-and-plate apparatus (Fig 1
, top) for 6 hours.
[3H]L-Arginine (1 µCi/mL, New England
Nuclear; 56.4 Ci/mmol) was added to the incubation medium before the
start of the experiments. Cell supernatant was collected at 1 and 6
hours, and [3H]L-citrulline was assayed as
a marker of NO synthesis. In some experiments HUVECs were exposed to
laminar flow for 6 hours in the presence of 300 µmol/L
N
-nitro-L-arginine (L-NNA,
Sigma Chemical Co), a specific inhibitor of NO synthesis.
|
To study the effect of steady laminar shear stress on NO synthase gene expression, confluent endothelial cell monolayers were exposed to laminar flow (8 dyne/cm2) for 6 hours, and total cellular RNA was then obtained for Northern analysis. To evaluate the effect of shear magnitude on NO synthesis by endothelial cells, cells were exposed for 6 hours to steady shear stresses of 2, 8, or 12 dyne/cm2. Cell supernatant was collected at 6 hours to measure [3H]L-citrulline. To study the effect of periodic changes in shear stress on NO synthesis, HUVECs were exposed to step changes in shear stress in square wave cycles of long duration (15 minutes) between a low (2 dyne/cm2) and a higher (8 dyne/cm2) amplitude. [3H]L-Citrulline in the supernatant was assayed after 6 hours of exposure. To study the effect of pulsatile flow, HUVECs were exposed to oscillating shear stress from 8.2 to 16.6 dyne/cm2 (average, 12.4 dyne/cm2) with a frequency of 2 Hz.
The effect of disturbed flow on NO synthesis was studied by measuring the conversion of [3H]L-arginine to [3H]L-citrulline in cultured endothelial cells exposed to turbulent flow (average shear stress, 8 dyne/cm2) for 6 hours. In additional experiments, total RNA was obtained from HUVECs after 6 hours of exposure to turbulent shear stress to assess the effects of disturbed flow on endothelial cell NO synthase gene expression.
ET-1 levels were also measured in aliquots of cell supernatant from
each experiment to evaluate the effects of different types of flow on
the ET-1 synthetic pathway. RNA from HUVECs exposed to laminar or
turbulent shear stress was also analyzed for ET-1 gene expression.
During each experiment, a culture plate of confluent HUVECs was kept in
a normal incubator as a static control. A schematic
representation of the four different flow conditions is shown
in Fig 1
(bottom).
Cell Culture and Shear Exposure Apparatus
HUVECs were obtained from umbilical veins according to the
method of Jaffé et al.20 Cells were grown in medium
199 supplemented with 10% newborn calf serum, 10% human serum, and
antibiotics and were used at the third or fourth passage. HUVEC purity
was assessed by indirect immunofluorescence microscopy using rabbit
anti–human factor VIII antigen. For shear-stress experiments, HUVECs
were plated on 145-cm2 plastic dishes and were used after
reaching confluence. Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal calf serum was used during the
experiments. All culture reagents were purchased from GIBCO-Europe.
Confluent monolayers of HUVECs were exposed to fluid flow (laminar,
turbulent, periodic, or pulsatile) in a cone-and-plate apparatus as
previously described.19 21 Briefly, this consists of a
cone of shallow angle (
) rotating on top of a tissue culture plate.
The motion of the culture medium between the plate and the cone induces
fluid shear stress of controlled magnitude, depending on the speed of
rotation of the cone. The apparatus was designed for use with
145-cm2 cell culture dishes covered by a confluent
monolayer of HUVECs as a plate and for maintaining a constant
temperature (37°C), humidified air with 5% CO2,
and a constant rotational speed of the cone. Steady laminar flow was
generated by using a cone angle of 0.5°.22 23
Shear-stress levels over the cell surface were extrapolated from
previous measurements and theory and were estimated to be accurate to
within 10%.22 23 24 To achieve oscillating shear, a modified
cone varying sinusoidally in angle and rotating at 2 revolutions per
second provided sinusoidal variation of shear-stress magnitude in time
ranging from 8.2 to 16.6 dyne/cm2 (average, 12.4
dyne/cm2) at a frequency of 2 Hz, as previously
described.22 25 Turbulent flow was induced by increasing
the flow velocity and using a cone angle of 5°. At variance with
laminar flow, in these conditions shear stress is not constant with
radial position. We used cone rotational speed that induces a mean
turbulent shear of 8 dyne/cm2, with values ranging
from 1.2 to 11.4 dyne/cm2 going from the cone apex to the
outer part of the plate.19
[3H]L-Citrulline Formation From
[3H]L-Arginine and ET-1 Release
One milliliter of cell supernatant was treated with 1 vol of
15% trichloroacetic acid (TCA) and then centrifuged at
10 000g to precipitate proteins. Supernatant was extracted
five times with 1 vol of water-saturated ether, vacuum-lyophilized,
resuspended in 2 mL HEPES (Merck), pH 5.5, and applied to 2 mL wet-bed
volumes of Dowex AG 50 WX-8 (100 to 200 mesh, Bio-Rad) (Li+
form), followed by 2 mL of water.
[3H]L-Citrulline was quantified by liquid
scintillation counting in the 4-mL column effluent. Results were
expressed as nanomoles of [3H]L-citrulline
by correcting data in counts per minute for the specific activity of
[3H]L-arginine, calculated on the basis of
the endogenous L-arginine content of the medium. Recovery
of [14C]L-citrulline (New England Nuclear,
53.7 mCi/mmol) after cation exchange chromatography, determined by the
addition of [14C]L-citrulline to samples
before TCA treatment, was over 60%. Thin-layer chromatography was used
to identify the product of cation exchange chromatography, as
previously described.26
To evaluate ET-1 release, aliquots of cell supernatant were extracted as previously described.27 ET-1 in extracted samples was quantified by a specific radioimmunoassay.28
Polymerase Chain Reaction Cloning of Human Endothelial Cell NO
Synthase cDNA
Two oligonucleotides were synthesized on the basis of the
published sequence of human endothelial cell NO synthase (EC NOS)
DNA29 30 : the sense orientation primer (oligo A: 5'-
ACAGAATTCGGATCCGGTCGCTTCGACGTGCT, beginning at position +870 of the
coding strand) and the antisense orientation primer (oligo B:
5'-ACAGAATTCAAGCTTTCCCCATTCCCAAATGTGCT-3', complementary to the human
EC NOS DNA sequence from +1734 to +1753). Restriction sites
BamHI and HindIII were inserted in oligo A and B,
respectively. One microgram of total human endothelial cell RNA was
reverse-transcribed into cDNA by using oligo B as a primer and
polymerase chain reaction (PCR)–amplified by using oligo A and B.
After BamHI/HindIII digestion of the 914-bp PCR
product, the resulting 883-bp EC NOS cDNA fragment was inserted into
pBluescript IISK vector. The authenticity of the cDNA fragment obtained
was verified by restriction digestion and DNA sequencing.
RNA Preparation and Analysis
Total cellular RNA was isolated from HUVECs by the guanidium
isothiocyanate/cesium chloride procedure.31 Samples (10
µg per lane) were loaded onto 1.2% agarose gel with 6% formaldehyde
and transferred to Gene Screen Plus (New England Nuclear) by capillary
blotting in 10x standard saline citrate (SSC: 1.5 mol/L NaCl and 0.15
mol/L sodium citrate, pH 7.0). Gels were stained with ethidium bromide
to visualize 28S and 18S ribosomal RNA bands. These bands were used to
confirm that approximately equivalent amounts of RNA were loaded in
each gel lane and that there was no obvious degradation of RNA. The
BamHI-HindIII cDNA fragment of human EC NOS was
labeled with [32P]dCTP by the random-primed
method.32
Membranes were hybridized for 20 hours at 60°C with 1.5x106 cpm per labeled probe in a solution containing 1 mol/L NaCl, 1% sodium dodecyl sulfate (SDS), 10% dextran sulfate, and 100 µg/mL salmon sperm DNA. Filters were then washed at 60°C in 2x SSC containing 1% SDS for 1 hour and exposed to X-ray film for autoradiography. The same membranes were subsequently probed with human preproendothelin-1 cDNA fragment.33 Finally, they were hybridized with a rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA,34 taken as an internal standard for equal loading of the samples on the membrane.
After optimal exposure, the autoradiographs of each experiment were analyzed by densitometry to quantify the relative amounts of radioactively labeled probe bound for each transcript. The hybridization signals of EC NOS and ET-1 were normalized for each sample with respect to the density of the corresponding GAPDH signals.
Statistical Analysis
Results are expressed as mean±SEM. Data were analyzed by
one-way ANOVA followed by the Tukey-Ciccheti test for multiple
comparisons. Statistical level of significance was defined as
P<.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Laminar Shear Stress Stimulates NO Synthesis and Upregulates NO Synthase Gene Expression
Stationary confluent HUVEC cultures released 0.025±0.005 nmol/105 cells NO (n=4) during 1 hour of incubation, as assessed by the conversion of [3H]L-arginine to [3H]L-citrulline (Fig 2
).
Cumulative production of NO rose to 0.07±0.03 nmol/105
cells (n=4) after 6 hours of incubation (Fig 2). A 1-hour exposure of
HUVECs to laminar steady shear stress of 8 dyne/cm2 caused
a slight but not significant increase of NO release compared with
static cultures (0.04±0.01 nmol/105 cells [n=4], Fig 2).
By contrast, a 6-hour exposure to shear stress greatly increased the
cumulative release of NO (0.59±0.08 nmol/105 cells
[n=4], P<.01 versus static, Fig 2). Treatment with L-NNA,
a specific inhibitor of NO synthesis, completely abolished the
stimulatory effect of shear stress on NO release (0.003±0.001
nmol/105 cells [n=3], Fig 2).
|
To establish whether shear-stress–mediated stimulation of NO synthesis
in endothelial cells was due to increased NO synthase gene expression,
we analyzed RNA from HUVECs cultured either in static conditions or
under laminar shear stress. Northern hybridization analysis with a
human constitutive NO synthase (EC NOS) cDNA probe indicated the
presence of a 4.8-kb EC NOS mRNA in cells maintained under static
conditions. Exposure to shear stress of 8 dyne/cm2 caused
100% increase over static controls (Fig 3). This
indicates that EC NOS mRNA is upregulated at physiological laminar
shear stress levels.
|
Fluid Shear-Stress Magnitude Modulates NO Synthesis
As shown in Fig 4, the level of shear stress
influenced the degree of stimulation of NO release by endothelial cell
monolayers. After 6 hours of exposure to a shear stress of 2
dyne/cm2, there was a small, not statistically
significant, increase of NO synthesis compared with static controls.
Release was stimulated more by exposure to shear stress of 8 and 12
dyne/cm2 (static, 0.11±0.02 nmol/105 cells
[n=10]; at 2 dyne/cm2, 0.38±0.24
nmol/105 cells [n=3]; at 8 dyne/cm2,
0.59±0.08 nmol/105 cells [n=4, P<.01 versus
static]; and at 12 dyne/cm2, 1.42±0.20
nmol/105 cells [n=3, P<.01 versus static];
Fig 4).
|
Time Variations of Laminar Shear Stress Stimulate NO Synthesis
To verify the effects of periodic changes in shear stress on NO
synthesis, confluent endothelial cells were subjected to step changes
in the amplitude of shear stress from 2 to 8 dyne/cm2 every
15 minutes for 6 hours. This resulted in a massive increase of NO
release compared with static controls (static, 0.06±0.02
nmol/105 cells [n=4]; periodic shear, 1.58±0.61
nmol/105 cells [n=4]; P<.01; Fig 5A). To compare the effects of steady laminar and of
periodic shear stress on NO release by HUVECs, data from single
experiments were expressed as the percent increase over corresponding
static controls. As shown in Fig 6, low-frequency cyclic
fluctuations in shear stress caused a further significant increase of
NO synthesis compared with steady shear stress of the same magnitude
(P<.05). This suggests that periodic changes of flow
conditions, beside shear-stress levels, are enough "per se" to
influence NO production by endothelial cells.
|
|
To verify the effects of oscillating shear stress on NO synthesis,
HUVECs were exposed to oscillating shear stress (from 8.2 to 16.6
dyne/cm2; mean, 12.4 dyne/cm2; frequency, 2 Hz)
for 6 hours. This condition resulted in a significant increase in NO
release compared with static controls (static, 0.06±0.02
nmol/105 cells [n=4]; oscillating shear, 0.51±0.07
nmol/105 cells [n=4]; P<.01 versus static;
Fig 5B).
Turbulent Shear Stress Does Not Affect NO Synthesis and NO Synthase
Gene Expression
To assess the effect of nonuniform fluid shear stresses on
NO release by vascular endothelium compared with the effect of laminar
shear stress, confluent HUVEC monolayers were exposed to turbulent
shear stress at an average magnitude of 8 dyne/cm2 for 6
hours. Shear stress in the turbulent flow condition did not stimulate
NO release by HUVECs (static, 0.23±0.09 nmol/105 cells
[n=6]; turbulent shear, 0.31±0.09 nmol/105 cells
[n=6]; Fig 7). In these series of experiments, control
unsheared cells released more NO than did the control cells in laminar
flow experiments (0.23±0.09 versus 0.07±0.03 nmol/105
cells). This might be a consequence of the different incubation volume
(turbulent flow and static control, 80 mL; laminar flow and static
control, 22 mL) and the related different amounts of
[3H]L-arginine (turbulent, 80 µCi;
laminar, 22 µCi; specific activity, 2.5 µCi/µmol for both laminar
and turbulent experiments). Besides not increasing NO release by
HUVECs, turbulent flow also did not induce any upregulation of EC NOS
mRNA (Fig 3). These results exclude the possibility that shear-induced
NO upregulation is simply the result of culture media disturbance and
indicate that EC NOS mRNA expression and NO production by HUVECs are
sensitive to the magnitude and type of flow on the cell surface.
|
Both Laminar and Turbulent Shear Stress Partially Reduce ET-1
Production and Downregulate ET-1 Gene Expression
Since fluid shear stress is a major physiological regulator of the
expression of the ET-1 gene, we also evaluated the effect of laminar or
disturbed flow on ET-1 production and ET-1 mRNA in HUVECs. A decrease
in ET-1 production, although not significant, was observed when HUVECs
were subjected to laminar (steady or oscillating) and turbulent shear
stress. Results, expressed as percent decrement over corresponding
static controls, were as follows: steady laminar shear, 24.0±7.7% at
2 dyne/cm2 (n=3), 28.0±9.7% at 8 dyne/cm2
(n=4), and 5.0±3.5% at 12 dyne/cm2 (n=3); oscillating
shear, 35.1±13.2% (n=4); and turbulent shear, 24.0±9.8% (n=6). By
contrast, periodic shear stress caused a marginal increase of ET-1
release by endothelial cells: 28.0±10.0% (n=3). As shown in Fig 8, exposure to laminar shear stress of 8
dyne/cm2 caused a 51% decrease of ET-1 mRNA. Shear stress
in the turbulent regimen caused a 42% downregulation of ET-1 mRNA,
comparable to that resulting from exposure to laminar shear stress of
the same magnitude (Fig 8).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present study shows that the magnitude and dynamic nature of fluid shear stress have a major influence on endothelial cell NO synthesis. Laminar shear stress dose-dependently upregulates NO synthesis by cultured endothelial cells, whereas turbulent shear stress has no effects on the NO-synthetic pathway. A different pattern was observed for ET-1, which was downregulated to much the same extent by laminar and turbulent shear stress.
Release of NO in cell supernatant required at least a 6-hour exposure of the cells to laminar shear stress. The fact that NO synthase mRNA is upregulated in endothelial cells after this interval could be taken as evidence that shear forces modulate the NO synthase gene. Recent data29 showing that the endothelial cell NO synthase 5' flanking region contains a cis-acting regulatory sequence identical to the previously recognized shear-stress responsive element (SSRE)35 suggest that the upregulation of NO synthase mRNA may derive from a direct effect of shear stress on NO synthase gene transcription. Other endothelial cell genes are upregulated by shear stress, including platelet-derived growth factor-B chain,3 tissue-type plasminogen activator,36 and intercellular adhesion molecule-1,37 all of which contain the same sequence.35
The precise mechanisms by which shear stress upregulates NO synthase have to be further explored. "In vivo" studies have found that flow reorganizes endothelial cell cytoskeletal proteins by rearranging the actin microfilament network into stress fibers, which mainly align parallel to the flow direction.38 It has been proposed that endothelial stress fibers may apply tension to resist the shear forces acting on the cells, thus allowing the cells to maintain their flattened phenotype and to remain firmly attached to the substratum.1 The cytoskeleton may also serve as a second signal apparatus for transducing the biomechanical stimulus sensed by endothelial cell surface to the nucleus, which would favor transcriptional activation of NO synthase mRNA.35
A recent study with HUVECs exposed to fluid flow in a parallel plate chamber39 suggested a bimodal pathway of NO release by endothelial cells exposed to flow: a rapid shear level–independent and partially calcium-dependent step, which however is transient, followed by a shear-dependent production, which is sustained with time. Quite possibly, a rapid rise in shear stress, by elevating intracellular Ca2+, activates preformed NO-forming enzyme in vascular endothelial cells.
In our experimental conditions, the possibility of transient activation of the enzyme is consistent with the numerical increase of NO induced by a 1-hour exposure to laminar shear stress. Such transient activation is then followed by a lasting increase of NO synthesis, actually paralleled by the upregulation of NO synthase mRNA. In addition, our experiments using step changes in shear stress have indicated that rapid changes in flow conditions enhance NO release more than does steady laminar flow alone of comparable magnitude. This may have practical implications for vessel hemodynamics in vivo, since in some regions of the circulation components of slow periodicity may be induced by the combination of two main factors, the geometric arrangement of blood vessels and poorly defined fluctuations of blood pressure.22 These events are superimposed on the higher frequency pulse wave due to systolic and diastolic cycles, which "per se" stimulates NO release as documented by our experiments with pulsatile flow. Moreover, during a 24-hour period, major changes of blood flow and pulse rate occur with frequencies varying from 1 hour to several minutes.40 Upregulation of endothelial cell NO synthesis may therefore serve to adapt local vascular tone to the modifications of shear stress characteristics after the changes in blood pressure and flow normally occurring throughout the day.
In some regions of the arterial tree, under conditions of increased flow velocity, unsteady flow patterns may develop with shear stress fluctuating in amplitude and direction.19 41 In our experimental conditions, disturbance of flow toward turbulence was induced by increasing the cone angle in the flow apparatus. This allowed the development of secondary flow and unsteady shear stress along the cell culture plate. As shown by the theoretical analysis of Sdougos et al,42 in these conditions the flow pattern is not uniform with radial position, but the flow from laminar becomes turbulent from the cone apex to the edge. We did in fact find that the transition from laminar to turbulent flow, unlike steady laminar flow of comparable magnitude, did not upregulate NO synthase mRNA and did not increase NO formation and release. This would indicate that small-scale high-frequency fluctuations in amplitude and rapid changes in direction of turbulent shear stress do not activate SSRE of the NO synthase promoter.
In contrast with the NO pathway, laminar shear stress partially reduced ET-1 mRNA and release compared with the static conditions. Since NO downregulates ET-1 gene transcription in endothelial cells,43 the effect of shear stress on ET-1 might be mediated by the release of NO. However, our findings that turbulent shear stress, which does not stimulate NO synthesis, lowered endothelial ET-1 to the same degree as laminar shear stress, make this unlikely.
The patterns of response of endothelial cells to different types of fluid shear suggest that under physiological conditions of steady laminar flow, NO is continuously released while ET-1 secretion is partially depressed. By contrast, in regions where shear stress decreases toward null values, NO release is impaired, and ET-1 secretion is enhanced. This would cause local vasoconstriction and vascular remodeling of arteries as observed in response to a reduction in blood flow rate.12 44 45 On the other hand, if flow has rapid oscillations in magnitude and direction, endothelial cell synthesis and release of NO may be reduced, thus contributing to vasoconstriction and cell proliferation. It is tempting to speculate that the reduction of NO in response to unsteady fluid shear stress is implicated in the pathogenesis of the atherosclerotic lesion. This may explain why such lesions prevail in regions where flow conditions are unsteady.14 17
Because of its potent biological properties, endothelium-derived NO has been proposed as a potential modulator of the key events in atherogenesis.46 Besides its vasodilatory and antiproliferative effects on vascular smooth muscle cells,47 NO also inhibits platelet adhesion and aggregation48 and inhibits the leukocyte–endothelial cell interaction.49 Inhibitors of NO synthesis administered to normal cats largely enhance leukocyte adhesion to venular endothelium and promote extravascular leukocyte migration.49 However, the most convincing evidence that NO is protective against atherosclerosis is probably provided by Cooke et al,50 who showed that the precursor of NO, L-arginine, given with the diet, almost completely prevented atherosclerotic lesions in hypercholesterolemic rabbits. Together with the above evidence, our findings suggest that constant release of NO from vascular endothelium under laminar shear stress has some physiological role in maintaining the nonthrombogenicity of the vascular wall as well as in the control of vascular cell proliferation. In regions where fluid shear stress decreases or in regions where flow is disturbed and turbulence develops, local NO production by the endothelium may be reduced or abolished, thus favoring the start of a process that eventually results in atheroma.
In conclusion, our findings indicate that production of vasoactive substances by vascular endothelial cells is related to the fluid shear stress condition experienced by the cells. The physiological condition of laminar flow induces constant release of NO and partially decreases ET-1 production, whereas when shear stress is not laminar, the balance between the production of these compounds may be greatly affected.
|
Acknowledgments |
|---|
The authors are grateful to Dr Enrico Garattini for assistance in cloning NO synthase cDNA. We also thank Dr Carla Zoja for valuable help in planning experiments and discussing results. Dr Isabella Bruzzi performed ET-1 radioimmunoassay measurements.
Received June 20, 1994; accepted December 21, 1994.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Franke RP, Grafe M, Schnittler H, Seiffge D, Mittermayer C. Induction of human vascular endothelial stress fibres by fluid shear stress. Nature. 1984;307:648-649. [Medline] [Order article via Infotrieve]
2.
Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on
prostacyclin production by cultured endothelial cells.
Science. 1985;227:1477-1479.
3.
Hsieh HJ, Li NQ, Frangos JA. Shear stress increases
endothelial platelet-derived growth factor mRNA levels. Am J
Physiol. 1991;260:H642-H646.
4.
Diamond SL, Eskin SG, McIntire LV. Fluid flow stimulates
tissue plasminogen activator secretion by cultured human endothelial
cells. Science. 1989;243:1483-1485.
5. Marletta MA. Nitric oxide: biosynthesis and biological significance. Trends Biochem Sci. 1989;14:488-492. [Medline] [Order article via Infotrieve]
6. Nishida K, Harrison DG, Navas JP, Fisher AA, Dockery SP, Uematsu M, Nerem RM, Alexander RW, Murphy TJ. Molecular cloning and characterization of the constitutive bovine aortic endothelial cell nitric oxide synthase. J Clin Invest. 1992;90:2092-2096.
7. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazako Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415. [Medline] [Order article via Infotrieve]
8.
Rubanyi GM, Romero JC, Vanhoutte PM. Flow-induced release of
endothelium relaxing factor. Am J Physiol. 1986;250:H1145-H1149.
9.
Hutcheson IR, Griffith TM. Release of
endothelium-derived relaxing factor is modulated both
by frequency and amplitude of pulsatile flow. Am J Physiol. 1991;261:H257-H262.
10.
Buga GM, Gold ME, Fukuto JM, Ignarro LJ. Shear stress-induced
release of nitric oxide from endothelial cells grown on beads.
Hypertension. 1991;17:187-193.
11.
Malek A, Izumo S. Physiological fluid shear stress causes
downregulation of endothelin-1 mRNA in bovine aortic endothelium.
Am J Physiol. 1992;263:C389-C396.
12. Giddens DP, Zarins CK, Glagov S. The role of fluid mechanism in the localization and detection of atherosclerosis. J Biomech Eng. 1993;115:588-594. [Medline] [Order article via Infotrieve]
13. Roach MR. The effect of bifurcations and stenoses on arterial disease. In: Wang NH, Norrman NA, eds. Cardiovascular Flow Dynamics and Measurements. Baltimore, Md: University Park Press; 1977:489-539.
14.
Zarins CK, Giddens DP, Bharadvaj BK, Sottiurai VS, Mabon RF,
Glagov S. Carotid bifurcation atherosclerosis: quantitative correlation
of plaque localization with flow velocity profiles and wall shear
stress. Circ Res. 1983;53:502-514.
15.
Lutz RJ, Cannon JN, Bischoff KB, Dedrick RL, Stiles RK, Fry
DL. Wall shear stress distribution in a model canine artery during
steady flow. Circ Res. 1977;41:391-399.
16.
Motomiya M, Karino T. Flow patterns in the human carotid
artery bifurcation. Stroke. 1984;15:50-56.
17. Ku DN, Giddens DP, Philips DJ, Strandness DE. Hemodynamics of the normal human carotid bifurcation: in vitro and in vivo studies. Ultrasound Med Biol. 1985;11:13-26. [Medline] [Order article via Infotrieve]
18. Nerem RM. Hemodynamics and the vascular endothelium. J Biomech Eng. 1993;115:510-514. [Medline] [Order article via Infotrieve]
19.
Davies PF, Remuzzi A, Gordon EJ, Dewey CF Jr, Gimbrone MA Jr.
Turbulent fluid shear stress induces vascular endothelial cell
turnover. Proc Natl Acad Sci U S A. 1986;83:2114-2117.
20. Jaffe EA, Nach RL, Becker CG, Minik CR. Culture of human endothelial cells derived from umbilical veins. J Clin Invest. 1973;52:2745-2756.
21.
Morigi M, Zoja C, Figliuzzi M, Remuzzi G, Remuzzi A.
Supernatant of endothelial cells exposed to laminar flow inhibits
mesangial cell proliferation. Am J Physiol. 1993;264:C1080-C1083.
22. Davies PF, Dewey CF Jr, Bussolari SR, Gordon EJ, Gimbrone MA Jr. Influence of hemodynamic forces on vascular endothelial function: in vitro studies of shear stress and pinocytosis in bovine aortic cells. J Clin Invest. 1984;73:1121-1129.
23. Dewey CF Jr, Bussolari SR, Gimbrone MA Jr, Davies PF. The dynamic response of vascular endothelial cells to fluid shear stress. J Biomech Eng. 1981;103:177-185. [Medline] [Order article via Infotrieve]
24. Bussolari SR, Dewey CF Jr, Gimbrone MA Jr. Apparatus for subjecting living cells to fluid shear stress. Rev Sci Instrum. 1982;53:1851-1854. [Medline] [Order article via Infotrieve]
25.
Malek AM, Jackman R, Rosenberg RD, Izumo S. Endothelial
expression of thrombomodulin is reversibly regulated by fluid shear
stress. Circ Res. 1994;74:852-860.
26.
Lamas S, Michel T, Brenner BM, Marsden PA. Nitric oxide
synthesis in endothelial cells: evidence for a pathway inducible by TNF
. Am J Physiol. 1991;261:C634-C641.
27.
Benigni A, Perico N, Gaspari F, Zoja C, Bellizzi L, Gabanelli
M, Remuzzi G. Increased renal endothelin production in rats with
reduced mass. Am J Physiol. 1991;260:F331-F339.
28. Orisio S, Benigni A, Bruzzi I, Corna D, Perico N, Zoja C, Benatti L, Remuzzi G. Renal endothelin gene expression is increased in remnant kidney and correlates with desease progression. Kidney Int. 1993;43:354-358. [Medline] [Order article via Infotrieve]
29.
Marsden PA, Heng HHQ, Scherer SW, Stewart RJ, Hall AV, Shi X,
Tsui L, Schappert KT. Structure and chromosomal localization of the
human constitutive endothelial nitric oxide synthase gene. J Biol
Chem. 1993;268:17478-17488.
30. Marsden PA, Schappert KT, Chen HS, Flowers M, Sundell CL, Wilcox JN, Lamas S, Michel T. Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett. 1992;307:287-293. [Medline] [Order article via Infotrieve]
31.
Rambaldi A, Young DC, Griffin JD. Expression of the M-CSF
(CSF-1) gene by human monocytes. Blood. 1987;69:1409-1413.
32. Feinberg AP, Volgestein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13. [Medline] [Order article via Infotrieve]
33. Zoja C, Orisio S, Perico N, Benigni A, Morigi M, Benatti L, Rambaldi A, Remuzzi G. Constitutive expression of endothelin gene in cultured human mesangial cells and its modulation by transforming growth factor-ß, thrombin, and a thromboxane A2 analogue. Lab Invest. 1991;64:16-20. [Medline] [Order article via Infotrieve]
34. Forth P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res. 1985;13: 1431-1432.
35.
Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF Jr,
Gimbrone MA Jr. Platelet-derived growth factor ß chain promoter
contains a cis-acting fluid shear-stress-responsive element. Proc
Natl Acad Sci U S A. 1993;90:4591-4595.
36. Diamond SL, Sharefkin JB, Diffenbach C, Scott KF, McIntire LV, Eskin SG. Tissue plasminogen activator messenger RNA levels increase in cultured human endothelial cells exposed to laminar shear stress. J Cell Physiol. 1990;143:364-371. [Medline] [Order article via Infotrieve]
37. Nagel T, Resnick N, Atkinson WJ, Dewey CF, Gimbrone MA Jr. Shear stress upregulates functional ICAM-1 expression in cultured vascular endothelial cells. FASEB J. 1993;7:2a. Abstract.
38.
Langille BL, Graham JJK, Kim D, Gotlieb AI. Dynamics of
shear-induced redistribution of F-actin in endothelial cells in vitro.
Arterioscler Thromb. 1991;11:1814-1820.
39.
Kuchan MJ, Frangos JA. Role of calcium and calmodulin in
flow-induced nitric oxide production in endothelial cells. Am J
Physiol. 1994;266:C628-C636.
40. Mitchell RH, Ruff SC, Murnaghan GA. Computer processing of long-term blood pressure and pulse rate variations. In: Stott FD, Raftery EB, Sleight P, Goulding L, eds. Proceedings of the 2nd International Symposium on Ambulatory Monitoring. London, England: Academic Press Inc; 1978:195-203.
41. Schalin L, Moberger G. Endothelial and vein wall response to turbulent shear stress from arteriovenous communications (AVCs). In: Liepsch D, ed. Biofluid Mechanics: Proceedings of the 3rd International Symposium. Dusseldorf, Germany: Springer-Verlag; 1994:53-65.
42. Sdougos HP, Bussolari SR, Dewey CF Jr. Secondary flow and turbulence in a cone-and-plate device. J Fluid Mech. 1984;138: 379-404.
43. Kourembanas S, McQuillan LP, Leung GK, Douglas VF. Nitric oxide regulates the expression of vasoconstrictors and growth factors by vascular endothelium under both normoxia and hypoxia. J Clin Invest. 1993;92:99-104.
44.
Languille BL, O'Donnell F. Reductions in arterial diameter
produced by chronic decreases in blood flow are
endothelium-dependent. Science. 1986;231:405-407.
45.
Kamiya T, Togawa T. Adaptive regulation of wall shear stress
to flow and change in the canine carotid artery. Am J
Physiol. 1980;239:H14-H21.
46. Simionescu M, Simionescu N. Proatherosclerotic events: pathobiochemical changes occurring in the arterial wall before monocyte migration. FASEB J. 1993;7:1359-1366. [Abstract]
47. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:1774-1777.
48.
Radomsky MW, Palmer RMJ, Moncada S. An L-arginine/nitric oxide
pathway present in human platelets regulates aggregation.
Proc Natl Acad Sci U S A. 1990;87:5193-5197.
49.
Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous
modulator of leukocyte adhesion. Proc Natl Acad Sci U S A. 1991;88:4651-4655.
50. Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham ME. Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest. 1992;90:1168-1172.
This article has been cited by other articles:
 |
|
 |
|
  N. Sud, S. Kumar, S. Wedgwood, and S. M. Black Modulation of PKC{delta} signaling alters the shear stress-mediated increases in endothelial nitric oxide synthase transcription: role of STAT3 Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L519 - L526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Ootaki, M. Yamashita, Y. Ootaki, K. Kamohara, S. Weber, R. S. Klatte, W. A. Smith, A. L. Massiello, S. N. Emancipator, L. A.R. Golding, et al. Reduced Pulsatility Induces Periarteritis in Kidney: Role of the Local Renin-Angiotensin System J. Thorac. Cardiovasc. Surg., July 1, 2008; 136(1): 150 - 158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lee, J.-C. Kim, Y. Li, M.-J. Son, and S.-H. Woo Fluid pressure modulates L-type Ca2+ channel via enhancement of Ca2+-induced Ca2+ release in rat ventricular myocytes Am J Physiol Cell Physiol, April 1, 2008; 294(4): C966 - C976. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. Laughlin, S. C. Newcomer, and S. B. Bender Importance of hemodynamic forces as signals for exercise-induced changes in endothelial cell phenotype J Appl Physiol, March 1, 2008; 104(3): 588 - 600. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. W. Groenendijk, K. Van der Heiden, B. P. Hierck, and R. E. Poelmann The Role of Shear Stress on ET-1, KLF2, and NOS-3 Expression in the Developing Cardiovascular System of Chicken Embryos in a Venous Ligation Model Physiology, December 1, 2007; 22(6): 380 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Tsai, H.-J. Hsieh, F. Liao, C.-W. Ni, Y.-J. Chao, C.-Y. Hsieh, and D. L. Wang Laminar flow attenuates interferon-induced inflammatory responses in endothelial cells Cardiovasc Res, June 1, 2007; 74(3): 497 - 505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Saloner, G. Acevedo-Bolton, M. Wintermark, and J. H. Rapp MRI of Geometric and Compositional Features of Vulnerable Carotid Plaque Stroke, February 1, 2007; 38(2): 637 - 641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yayama, H. Hiyoshi, D. Imazu, and H. Okamoto Angiotensin II Stimulates Endothelial NO Synthase Phosphorylation in Thoracic Aorta of Mice With Abdominal Aortic Banding Via Type 2 Receptor Hypertension, November 1, 2006; 48(5): 958 - 964. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yin, Z. Wang, H. Zhu, R. Zhang, H. Wang, and X. Li Experimental Study of Effect of Fontan Circuit on Pulmonary Microcirculation Asian Cardiovasc Thorac Ann, June 1, 2006; 14(3): 183 - 188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Gambillara, C. Chambaz, G. Montorzi, S. Roy, N. Stergiopulos, and P. Silacci Plaque-prone hemodynamics impair endothelial function in pig carotid arteries Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2320 - H2328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. A. Arenas, Y. Xu, and S. T. Davidge Age-associated impairment in vasorelaxation to fluid shear stress in the female vasculature is improved by TNF-{alpha} antagonism Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1259 - H1263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Vargas, J. M. Moreno, I. Rodriguez-Gomez, R. Wangensteen, A. Osuna, M. Alvarez-Guerra, and J. Garcia-Estan Vascular and renal function in experimental thyroid disorders Eur. J. Endocrinol., February 1, 2006; 154(2): 197 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Reboul, S. Tanguy, A. Gibault, M. Dauzat, and P. Obert Chronic hypoxia exposure depresses aortic endothelium-dependent vasorelaxation in both sedentary and trained rats: involvement of L-arginine J Appl Physiol, September 1, 2005; 99(3): 1029 - 1035. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Alegria, J. Herrmann, D. R. Holmes Jr, A. Lerman, and C. S. Rihal Myocardial bridging Eur. Heart J., June 2, 2005; 26(12): 1159 - 1168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hiyoshi, K. Yayama, M. Takano, and H. Okamoto Angiotensin Type 2 Receptor-Mediated Phosphorylation of eNOS in the Aortas of Mice With 2-Kidney, 1-Clip Hypertension Hypertension, May 1, 2005; 45(5): 967 - 973. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R M McAllister, I Albarracin, E M Price, T K Smith, J R Turk, and K D Wyatt Thyroid status and nitric oxide in rat arterial vessels J. Endocrinol., April 1, 2005; 185(1): 111 - 119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Woodman, E. M. Price, and M. H. Laughlin Shear stress induces eNOS mRNA expression and improves endothelium-dependent dilation in senescent soleus muscle feed arteries J Appl Physiol, March 1, 2005; 98(3): 940 - 946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sokabe, K. Yamamoto, N. Ohura, H. Nakatsuka, K. Qin, S. Obi, A. Kamiya, and J. Ando Differential regulation of urokinase-type plasminogen activator expression by fluid shear stress in human coronary artery endothelial cells Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2027 - H2034. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Goodwin, L. P. Solomonson, and D. C. Eichler Argininosuccinate Synthase Expression Is Required to Maintain Nitric Oxide Production and Cell Viability in Aortic Endothelial Cells J. Biol. Chem., April 30, 2004; 279(18): 18353 - 18360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Shimizu, S. Ito, Y. Kikuchi, M. Misaka, T. Hirayama, S. Ishimaru, and A. Yamashina Arterial conduit shear stress following bypass grafting for intermediate coronary artery stenosis: a comparative study with saphenous vein grafts Eur. J. Cardiothorac. Surg., April 1, 2004; 25(4): 578 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Loufrani, C. Dubroca, D. You, Z. Li, B. Levy, D. Paulin, and D. Henrion Absence of Dystrophin in Mice Reduces NO-Dependent Vascular Function and Vascular Density: Total Recovery After a Treatment with the Aminoglycoside Gentamicin Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 671 - 676. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, J. Zheng, I. M. Bird, and R. R. Magness Effects of Pulsatile Shear Stress on Nitric Oxide Production and Endothelial Cell Nitric Oxide Synthase Expression by Ovine Fetoplacental Artery Endothelial Cells Biol Reprod, September 1, 2003; 69(3): 1053 - 1059. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Hambrecht, V. Adams, S. Erbs, A. Linke, N. Krankel, Y. Shu, Y. Baither, S. Gielen, H. Thiele, J.F. Gummert, et al. Regular Physical Activity Improves Endothelial Function in Patients With Coronary Artery Disease by Increasing Phosphorylation of Endothelial Nitric Oxide Synthase Circulation, July 1, 2003; 107(25): 3152 - 3158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Paddenberg, B. Ishaq, A. Goldenberg, P. Faulhammer, F. Rose, N. Weissmann, R. C. Braun-Dullaeus, and W. Kummer Essential role of complex II of the respiratory chain in hypoxia-induced ROS generation in the pulmonary vasculature Am J Physiol Lung Cell Mol Physiol, May 1, 2003; 284(5): L710 - L719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Lloyd, B. M. Prior, H. T. Yang, and R. L. Terjung Angiogenic growth factor expression in rat skeletal muscle in response to exercise training Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1668 - H1678. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wedgwood, C. J. Mitchell, J. R. Fineman, and S. M. Black Developmental differences in the shear stress-induced expression of endothelial NO synthase: changing role of AP-1 Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L650 - L662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Paszkowiak and A. Dardik Arterial Wall Shear Stress: Observations from the Bench to the Bedside Vascular and Endovascular Surgery, January 1, 2003; 37(1): 47 - 57. [Abstract] [PDF]
|
|
|
|
|
|
C. R. Woodman, E. M. Price, and M. H. Laughlin Aging induces muscle-specific impairment of endothelium-dependent dilation in skeletal muscle feed arteries J Appl Physiol, November 1, 2002; 93(5): 1685 - 1690. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Irace, A. Gnasso, F. Cirillo, G. Leonardo, M. Ciamei, A. Crivaro, A. Renzulli, and M. Cotrufo Arterial Remodeling of the Common Carotid Artery After Aortic Valve Replacement in Patients With Aortic Stenosis Stroke, October 1, 2002; 33(10): 2446 - 2450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Wang Role of iNOS and eNOS in modulating proximal tubule transport and acid-base balance Am J Physiol Renal Physiol, October 1, 2002; 283(4): F658 - F662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kawano, T. Motoyama, H. Yasue, N. Hirai, H. M. Waly, K. Kugiyama, and H. Ogawa Endothelial function fluctuates with diurnal variation in the frequency of ischemic episodes in patients with variant angina J. Am. Coll. Cardiol., July 17, 2002; 40(2): 266 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Joyce, T. M. Phernetton, and R. R. Magness Effect of Uterine Blood Flow Occlusion on Shear Stress-Mediated Nitric Oxide Production and Endothelial Nitric Oxide Synthase Expression During Ovine Pregnancy Biol Reprod, July 1, 2002; 67(1): 320 - 326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. L. Boot, Jan. T. Groothuis, H. van Langen, and M. T. E. Hopman Shear stress levels in paralyzed legs of spinal cord-injured individuals with and without nerve degeneration J Appl Physiol, June 1, 2002; 92(6): 2335 - 2340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dai, O. Tsukurov, M. Chen, J. P. Gertler, and R. D. Kamm Endothelial nitric oxide production during in vitro simulation of external limb compression Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2066 - H2075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kihara, S. Biro, M. Imamura, S. Yoshifuku, K. Takasaki, Y. Ikeda, Y. Otuji, S. Minagoe, Y. Toyama, and C. Tei Repeated sauna treatment improves vascular endothelial and cardiac function in patients with chronic heart failure J. Am. Coll. Cardiol., March 6, 2002; 39(5): 754 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-E. Chen, K. Liu, W.-N. Qi, E. Joneschild, X. Tan, A. V. Seaber, J. S. Stamler, and J. R. Urbaniak Role of nitric oxide in vasodilation in upstream muscle during intermittent pneumatic compression J Appl Physiol, February 1, 2002; 92(2): 559 - 566. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. T. Yang, J. Ren, M. H. Laughlin, and R. L. Terjung Prior exercise training produces NO-dependent increases in collateral blood flow after acute arterial occlusion Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H301 - H310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Joyce, T. M. Phernetton, C. E. Shaw, M. L. Modrick, and R. R. Magness Endothelial vasodilator production by uterine and systemic arteries. IX. eNOS gradients in cycling and pregnant ewes Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H342 - H348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Gaenzer, G. Neumayr, P. Marschang, W. Sturm, R. Kirchmair, and J. R. Patsch Flow-mediated vasodilation of the femoral and brachial artery induced by exercise in healthy nonsmoking and smoking men J. Am. Coll. Cardiol., November 1, 2001; 38(5): 1313 - 1319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Song, A. B. Al-Mehdi, and A. B. Fisher An immediate endothelial cell signaling response to lung ischemia Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L993 - L1000. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Woodman, W. G. Schrage, J. W. E. Rush, C. A. Ray, E. M. Price, E. M. Hasser, and M. H. Laughlin Hindlimb unweighting decreases endothelium-dependent dilation and eNOS expression in soleus not gastrocnemius J Appl Physiol, September 1, 2001; 91(3): 1091 - 1098. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Tuttle, R. D. Nachreiner, A. S. Bhuller, K. W. Condict, B. A. Connors, B. P. Herring, M. C. Dalsing, and J. L. Unthank Shear level influences resistance artery remodeling: wall dimensions, cell density, and eNOS expression Am J Physiol Heart Circ Physiol, September 1, 2001; 281(3): H1380 - H1389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wedgwood, J. M. Bekker, and S. M. Black Shear stress regulation of endothelial NOS in fetal pulmonary arterial endothelial cells involves PKC Am J Physiol Lung Cell Mol Physiol, August 1, 2001; 281(2): L490 - L498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nakano, R. Tominaga, S. Morita, M. Masuda, I. Nagano, K.-i. Imasaka, and H. Yasui Impacts of pulsatile systemic circulation on endothelium-derived nitric oxide release in anesthetized dogs Ann. Thorac. Surg., July 1, 2001; 72(1): 156 - 162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kurotobi, T. Sano, S. Kogaki, T. Matsushita, T. Miwatani, M. Takeuchi, H. Matsuda, and S. Okada Bidirectional cavopulmonary shunt with right ventricular outflow patency: The impact of pulsatility on pulmonary endothelial function J. Thorac. Cardiovasc. Surg., June 1, 2001; 121(6): 1161 - 1168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. R. Johnson, J. W. E. Rush, J. R. Turk, E. M. Price, and M. H. Laughlin Short-term exercise training increases ACh-induced relaxation and eNOS protein in porcine pulmonary arteries J Appl Physiol, March 1, 2001; 90(3): 1102 - 1110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Govers and T. J. Rabelink Cellular regulation of endothelial nitric oxide synthase Am J Physiol Renal Physiol, February 1, 2001; 280(2): F193 - F206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gielen, G. Schuler, and R. Hambrecht Exercise Training in Coronary Artery Disease and Coronary Vasomotion Circulation, January 2, 2001; 103 (1): e1 - e6. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Gosgnach, D. Messika-Zeitoun, W. Gonzalez, M. Philipe, and J.-B. Michel Shear stress induces iNOS expression in cultured smooth muscle cells: role of oxidative stress Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1880 - C1888. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Urbich, D. H. Walter, A. M. Zeiher, and S. Dimmeler Laminar Shear Stress Upregulates Integrin Expression : Role in Endothelial Cell Adhesion and Apoptosis Circ. Res., October 13, 2000; 87(8): 683 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Jen, S.-J. Jhiang, and H.-I. Chen Cellular Responses to Mechanical Stress: Invited Review: Effects of flow on vascular endothelial intracellular calcium signaling of rat aortas ex vivo J Appl Physiol, October 1, 2000; 89(4): 1657 - 1662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. T. Yang, M. H. Laughlin, and R. L. Terjung Prior exercise training increases collateral-dependent blood flow in rats after acute femoral artery occlusion Am J Physiol Heart Circ Physiol, October 1, 2000; 279(4): H1890 - H1897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-m. Gan, L. Selin-Sjogren, R. Doroudi, and S. Jern Temporal regulation of endothelial ET-1 and eNOS expression in intact human conduit vessels exposed to different intraluminal pressure levels at physiological shear stress Cardiovasc Res, October 1, 2000; 48(1): 168 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Lin, P.-P. Hsu, B. P. Chen, S. Yuan, S. Usami, J. Y.-J. Shyy, Y.-S. Li, and S. Chien Molecular mechanism of endothelial growth arrest by laminar shear stress PNAS, July 30, 2000; (2000) 170282597. [Abstract] [Full Text]
|
|
|
|
|
|
M. J VanWijk, K. Kublickiene, K. Boer, and E. VanBavel Vascular function in preeclampsia Cardiovasc Res, July 1, 2000; 47(1): 38 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. S. Wittstein, W. Qiu, R. C. Ziegelstein, Q. Hu, and D. A. Kass Opposite Effects of Pressurized Steady Versus Pulsatile Perfusion on Vascular Endothelial Cell Cytosolic pH : Role of Tyrosine Kinase and Mitogen-Activated Protein Kinase Signaling Circ. Res., June 23, 2000; 86(12): 1230 - 1236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Morawietz, R. Talanow, M. Szibor, U. Rueckschloss, A. Schubert, B. Bartling, D. Darmer, and J. Holtz Regulation of the endothelin system by shear stress in human endothelial cells J. Physiol., June 15, 2000; 525(3): 761 - 770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. R. Johnson and M. H. Laughlin Chronic exercise training does not alter pulmonary vasorelaxation in normal pigs J Appl Physiol, June 1, 2000; 88(6): 2008 - 2014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gnasso, C. Motti, C. Irace, C. Carallo, L. Liberatoscioli, S. Bernardini, R. Massoud, P. L. Mattioli, G. Federici, and C. Cortese Genetic Variation in Human Stromelysin Gene Promoter and Common Carotid Geometry in Healthy Male Subjects Arterioscler Thromb Vasc Biol, June 1, 2000; 20(6): 1600 - 1605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Matsuo Basal nitric oxide production is enhanced by hydraulic pressure in cultured human trabecular cells Br J Ophthalmol, June 1, 2000; 84(6): 631 - 635. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. CATTARUZZA, C. DIMIGEN, H. EHRENREICH, and M. HECKER Stretch-induced endothelin B receptor-mediated apoptosis in vascular smooth muscle cells FASEB J, May 1, 2000; 14(7): 991 - 998. [Abstract] [Full Text]
|
|
|
|
|
|
X. Bao, C. B. Clark, and J. A. Frangos Temporal gradient in shear-induced signaling pathway: involvement of MAP kinase, c-fos, and connexin43 Am J Physiol Heart Circ Physiol, May 1, 2000; 278(5): H1598 - H1605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nakano, R. Tominaga, I. Nagano, H. Okabe, and H. Yasui Pulsatile flow enhances endothelium-derived nitric oxide release in the peripheral vasculature Am J Physiol Heart Circ Physiol, April 1, 2000; 278(4): H1098 - H1104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Hambrecht, L. Hilbrich, S. Erbs, S. Gielen, E. Fiehn, N. Schoene, and G. Schuler Correction of endothelial dysfunction in chronic heart failure: additional effects of exercise training and oral L-arginine supplementation J. Am. Coll. Cardiol., March 1, 2000; 35(3): 706 - 713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Pagliaro, N. Paolocci, T. Isoda, W. F Saavedra, G. Sunagawa, and D. A Kass Reversal of glibenclamide-induced coronary vasoconstriction by enhanced perfusion pulsatility: possible role for nitric oxide Cardiovasc Res, March 1, 2000; 45(4): 1001 - 1009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Tworetzky, P. Moore, J. M. Bekker, J. Bristow, S. M. Black, and J. R. Fineman Pulmonary blood flow alters nitric oxide production in patients undergoing device closure of atrial septal defects J. Am. Coll. Cardiol., February 1, 2000; 35(2): 463 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yada, O. Hiramatsu, H. Tachibana, E. Toyota, and F. Kajiya Role of NO and K+ATP channels in adenosine-induced vasodilation on in vivo canine subendocardial arterioles Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H1931 - H1939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. D. Vaziri, Y. Ding, and Z. Ni Nitric Oxide Synthase Expression in the Course of Lead-Induced Hypertension Hypertension, October 1, 1999; 34(4): 558 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Klassen, J. H. Traverse, and R. J. Bache Nitroglycerin dilates coronary collateral vessels during exercise after blockade of endogenous NO production Am J Physiol Heart Circ Physiol, September 1, 1999; 277(3): H918 - H923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Brochu, S. Lacasse-M., C. Moreau, M. Lebel, I. Kingma, J. H. Grose, and R. Lariviere Endothelin ETA receptor blockade prevents the progression of renal failure and hypertension in uraemic rats Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1881 - 1888. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ichihara, H. Suzuki, Y. Miyashita, M. Naitoh, M. Hayashi, and T. Saruta Transmural pressure inhibits prorenin processing in juxtaglomerular cell Am J Physiol Regulatory Integrative Comp Physiol, July 1, 1999; 277(1): R220 - R228. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Gloe, S. Riedmayr, H.-Y. Sohn, and U. Pohl The 67-kDa Laminin-binding Protein Is Involved in Shear Stress-dependent Endothelial Nitric-oxide Synthase Expression J. Biol. Chem., June 4, 1999; 274(23): 15996 - 16002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Toyota, M. Goto, H. Nakamoto, J. Ebata, H. Tachibana, O. Hiramatsu, Y. Ogasawara, and F. Kajiya Endothelium-derived nitric oxide enhances the effect of intraaortic balloon pumping on diastolic coronary flow Ann. Thorac. Surg., May 1, 1999; 67(5): 1254 - 1261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dimmeler, C. Hermann, J. Galle, and A. M. Zeiher Upregulation of Superoxide Dismutase and Nitric Oxide Synthase Mediates the Apoptosis-Suppressive Effects of Shear Stress on Endothelial Cells Arterioscler Thromb Vasc Biol, March 1, 1999; 19(3): 656 - 664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Woodman, J. M. Muller, J. W. E. Rush, M. H. Laughlin, and E. M. Price Flow regulation of ecNOS and Cu/Zn SOD mRNA expression in porcine coronary arterioles Am J Physiol Heart Circ Physiol, March 1, 1999; 276(3): H1058 - H1063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Q. Wang and N. D. Vaziri Erythropoietin Depresses Nitric Oxide Synthase Expression by Human Endothelial Cells Hypertension, March 1, 1999; 33(3): 894 - 899. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Patel, I. V. Kaplan, R. N. Patni, D. Levy, J. A. Strom, J. Shirani, and T. H. LeJemtel Sustained Improvement in Flow-Mediated Vasodilation After Short-Term Administration of Dobutamine in Patients With Severe Congestive Heart Failure Circulation, January 12, 1999; 99(1): 60 - 64. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Hambrecht, E. Fiehn, C. Weigl, S. Gielen, C. Hamann, R. Kaiser, J. Yu, V. Adams, J. Niebauer, and G. Schuler Regular Physical Exercise Corrects Endothelial Dysfunction and Improves Exercise Capacity in Patients With Chronic Heart Failure Circulation, December 15, 1998; 98(24): 2709 - 2715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Okahara, B. Sun, and J.-i. Kambayashi Upregulation of Prostacyclin Synthesis–Related Gene Expression by Shear Stress in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, December 1, 1998; 18(12): 1922 - 1926. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Black, J. R. Fineman, R. H. Steinhorn, J. Bristow, and S. J. Soifer Increased endothelial NOS in lambs with increased pulmonary blood flow and pulmonary hypertension Am J Physiol Heart Circ Physiol, November 1, 1998; 275(5): H1643 - H1651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minamino, M. Kitakaze, S. Sanada, H. Asanuama, T. Kurotobi, Y. Koretsune, M. Fukunami, T. Kuzuya, N. Hoki, and M. Hori Increased Expression of P-Selectin on Platelets Is a Risk Factor for Silent Cerebral Infarction in Patients With Atrial Fibrillation : Role of Nitric Oxide Circulation, October 27, 1998; 98(17): 1721 - 1727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ding and N. D. Vaziri Calcium Channel Blockade Enhances Nitric Oxide Synthase Expression by Cultured Endothelial Cells Hypertension, October 1, 1998; 32(4): 718 - 723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Ni, X. Q. Wang, and N. D. Vaziri Nitric Oxide Metabolism in Erythropoietin-Induced Hypertension : Effect of Calcium Channel Blockade Hypertension, October 1, 1998; 32(4): 724 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dimmeler, B. Assmus, C. Hermann, J. Haendeler, and A. M. Zeiher Fluid Shear Stress Stimulates Phosphorylation of Akt in Human Endothelial Cells : Involvement in Suppression of Apoptosis Circ. Res., August 10, 1998; 83(3): 334 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Zanchi, N. Stergiopulos, H. R. Brunner, and D. Hayoz Differences in the Mechanical Properties of the Rat Carotid Artery In Vivo, In Situ, and In Vitro Hypertension, July 1, 1998; 32(1): 180 - 185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Thorin-Trescases, J. A. Bevan, and W. J. Pearce High Levels of Myogenic Tone Antagonize the Dilator Response to Flow of Small Rabbit Cerebral Arteries • Editorial Comment Stroke, June 1, 1998; 29(6): 1194 - 1201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. D. Vaziri, Z. Ni, X. Q. Wang, F. Oveisi, and X. J. Zhou Downregulation of nitric oxide synthase in chronic renal insufficiency: role of excess PTH Am J Physiol Renal Physiol, April 1, 1998; 274(4): F642 - F649. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Watanabe, R. Takahashi, X.-x. Zhang, Y. Goto, H. Hayashi, J. Ando, M. Isshiki, M. Seto, H. Hidaka, I. Niki, et al. An essential role of myosin light-chain kinase in the regulation of agonist- and fluid flow-stimulated Ca2+ influx in endothelial cells FASEB J, March 1, 1998; 12(3): 341 - 348. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. Wada, Y. Kamisaki, T. Ohkura, G. Kanda, K. Nakamoto, Y. Kishimoto, K. Ashida, and T. Itoh Direct measurement of nitric oxide release in gastric mucosa during ischemia-reperfusion in rats Am J Physiol Gastrointest Liver Physiol, March 1, 1998; 274(3): G465 - G471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Andries, D. L. Brutsaert, and S. U. Sys Nonuniformity of Endothelial Constitutive Nitric Oxide Synthase Distribution in Cardiac Endothelium Circ. Res., February 9, 1998; 82(2): 195 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Papadaki, R. G. Tilton, S. G. Eskin, and L. V. McIntire Nitric oxide production by cultured human aortic smooth muscle cells: stimulation by fluid flow Am J Physiol Heart Circ Physiol, February 1, 1998; 274(2): H616 - H626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dimmeler, V. Rippmann, U. Weiland, J. Haendeler, and A. M. Zeiher Angiotensin II Induces Apoptosis of Human Endothelial Cells : Protective Effect of Nitric Oxide Circ. Res., December 19, 1997; 81(6): 970 - 976. [Abstract] [Full Text]
|
|
|
|
|
|
C. Hermann, A. M. Zeiher, and S. Dimmeler Shear Stress Inhibits H2O2-Induced Apoptosis of Human Endothelial Cells by Modulation of the Glutathione Redox Cycle and Nitric Oxide Synthase Arterioscler Thromb Vasc Biol, December 1, 1997; 17(12): 3588 - 3592. [Abstract] [Full Text]
|
|
|
|
|
|
M. van Bilsen Signal transduction revisited: recent developments in angiotensin II signaling in the cardiovascular system Cardiovasc Res, December 1, 1997; 36(3): 310 - 322. [Full Text] [PDF]
|
|
|
|
|
|
Z.-G. Zhu, H.-H. Li, and B.-R. Zhang Expression of Endothelin-1 and Constitutional Nitric Oxide Synthase Messenger RNA in Saphenous Vein Endothelial Cells Exposed to Arterial Flow Shear Stress Ann. Thorac. Surg., November 1, 1997; 64(5): 1333 - 1338. [Abstract] [Full Text]
|
|
|
|
|
|
T. Minamino, M. Kitakaze, H. Sato, H. Asanuma, H. Funaya, Y. Koretsune, and M. Hori Plasma Levels of Nitrite/Nitrate and Platelet cGMP Levels Are Decreased in Patients With Atrial Fibrillation Arterioscler Thromb Vasc Biol, November 1, 1997; 17(11): 3191 - 3195. [Abstract] [Full Text]
|
|
|
|
|
|
J. Wang, G.-H. Yi, M. Knecht, B.-l. Cai, S. Poposkis, M. Packer, and D. Burkhoff Physical Training Alters the Pathogenesis of Pacing-Induced Heart Failure Through Endothelium-Mediated Mechanisms in Awake Dogs Circulation, October 21, 1997; 96(8): 2683 - 2692. [Abstract] [Full Text]
|
|
|
|
 |
|
 R. A. Ahokas, S. A. Friedman, and B. M. Sibai Effect of Indomethacin and N{omega}-Nitro-L-Arginine Methyl Ester on the Pressure/Flow Relation in Isolated Perfused Hindlimbs From Pregnant and Nonpregnant Rats Reproductive Sciences, September 1, 1997; 4(5): 229 - 235. [Abstract] [PDF]
|
|
|
|
 |
|
 M. Galbusera, C. Zoja, R. Donadelli, S. Paris, M. Morigi, A. Benigni, M. Figliuzzi, G. Remuzzi, and A. Remuzzi Fluid Shear Stress Modulates von Willebrand Factor Release From Human Vascular Endothelium Blood, August 15, 1997; 90(4): 1558 - 1564. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Chammas, David. A. Rickaby, M. Guarin, J. H. Linehan, C. C. Hanger, and C. A. Dawson Flow-induced vasodilation in the ferret lung J Appl Physiol, August 1, 1997; 83(2): 495 - 502. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||