Articles |
From the Mario Negri Institute for Pharmacological Research (M.N., M.M., R.D., S.A., M.F., M.T., S.O., G.R., A.R.) and the Division of Nephrology (G.R.), Ospedali Riuniti di Bergamo (Italy).
Correspondence to Marina Noris, Mario Negri Institute for Pharmacological Research, Via Gavazzeni 11, 24125 Bergamo, Italy.
| Abstract |
|---|
|
|
|---|
Key Words: atherosclerosis endothelium-derived relaxing factor endothelin gene expression shear stress
| Introduction |
|---|
|
|
|---|
Experimental studies have documented that chronic alterations of
physiological blood flow cause the arterial diameter to change so as to
recover a physiological state of wall shear stress (
15
dyne/cm2).12 It is widely recognized that
endothelial cells are the "biosensors" of fluid dynamic shear
forces that reduce arterial diameter when blood flow rate decreases and
enlarge the diameter when the flow rate increases.12 The
constant finding that atherosclerotic lesions occur mainly at specific
sites around arterial branchings and bifurcations13 14 15 16
indicates that local flow patterns are also involved in atherogenesis.
With the aim of clarifying these processes, the localization of intimal
thickening in human carotid arteries and the related shear-stress
variables have been studied in detail.14 17 The results of
these investigations indicate that regions exposed to low and unsteady
shear stress appear to be more susceptible to the development of
structural changes than areas of the arterial wall exposed to higher
and more constant shear stress. It appears that focal response to wall
shear stress leads to focally distributed areas of intimal thickening
and subsequent plaque formation. It has been proposed that phenomena
responsible for the remodeling of arteries in response to changes in
blood flow rate are implicated in the development of early
atherosclerotic plaques.12 Recent studies have focused on
the possible role of vascular endothelium in the induction of these
structural changes, particularly on how different hemodynamic
conditions affect the regulation of endothelial cell function. Thus,
exposure to laminar steady flow results in endothelial cell elongation
and alignment with the flow direction, whereas under turbulent flow
they retain their cobblestone shape.11 18 19 Davies et
al19 reported that turbulent flow, but not laminar flow,
induced DNA synthesis and cell proliferation in a confluent endothelial
monolayer.
Since different flow patterns have different effects on endothelial morphology and proliferation, the endothelial synthesis of vasoactive mediators might also be influenced by the nature of the mechanical stimuli sensed by the cells. In this context, the only available data are from Malek and Izumo,11 who have demonstrated that laminar and turbulent shear stress downregulate ET-1 mRNA equally in endothelial cells. Detailed information on the effect of different shear stresses on the potent endothelium-derived vasodilator NO is lacking. Using controlled flow conditions, we investigated the effect of shear-stress levels and flow conditions (laminar versus turbulent flow and steady versus pulsatile or periodic flow) on NO synthase gene expression and NO formation in endothelial cells. We also evaluated endothelial gene expression and the release of the "proatherogenic" mediator ET-1 to compare the effects of physical forces on the balance of these two molecules, which have opposite actions on vascular tone and cell proliferation.
| Materials and Methods |
|---|
|
|
|---|
1 µCi/mL, New England
Nuclear; 56.4 Ci/mmol) was added to the incubation medium before the
start of the experiments. Cell supernatant was collected at 1 and 6
hours, and [3H]L-citrulline was assayed as
a marker of NO synthesis. In some experiments HUVECs were exposed to
laminar flow for 6 hours in the presence of 300 µmol/L
N
-nitro-L-arginine (L-NNA,
Sigma Chemical Co), a specific inhibitor of NO synthesis.
|
To study the effect of steady laminar shear stress on NO synthase gene expression, confluent endothelial cell monolayers were exposed to laminar flow (8 dyne/cm2) for 6 hours, and total cellular RNA was then obtained for Northern analysis. To evaluate the effect of shear magnitude on NO synthesis by endothelial cells, cells were exposed for 6 hours to steady shear stresses of 2, 8, or 12 dyne/cm2. Cell supernatant was collected at 6 hours to measure [3H]L-citrulline. To study the effect of periodic changes in shear stress on NO synthesis, HUVECs were exposed to step changes in shear stress in square wave cycles of long duration (15 minutes) between a low (2 dyne/cm2) and a higher (8 dyne/cm2) amplitude. [3H]L-Citrulline in the supernatant was assayed after 6 hours of exposure. To study the effect of pulsatile flow, HUVECs were exposed to oscillating shear stress from 8.2 to 16.6 dyne/cm2 (average, 12.4 dyne/cm2) with a frequency of 2 Hz.
The effect of disturbed flow on NO synthesis was studied by measuring the conversion of [3H]L-arginine to [3H]L-citrulline in cultured endothelial cells exposed to turbulent flow (average shear stress, 8 dyne/cm2) for 6 hours. In additional experiments, total RNA was obtained from HUVECs after 6 hours of exposure to turbulent shear stress to assess the effects of disturbed flow on endothelial cell NO synthase gene expression.
ET-1 levels were also measured in aliquots of cell supernatant from
each experiment to evaluate the effects of different types of flow on
the ET-1 synthetic pathway. RNA from HUVECs exposed to laminar or
turbulent shear stress was also analyzed for ET-1 gene expression.
During each experiment, a culture plate of confluent HUVECs was kept in
a normal incubator as a static control. A schematic
representation of the four different flow conditions is shown
in Fig 1
(bottom).
Cell Culture and Shear Exposure Apparatus
HUVECs were obtained from umbilical veins according to the
method of Jaffé et al.20 Cells were grown in medium
199 supplemented with 10% newborn calf serum, 10% human serum, and
antibiotics and were used at the third or fourth passage. HUVEC purity
was assessed by indirect immunofluorescence microscopy using rabbit
antihuman factor VIII antigen. For shear-stress experiments, HUVECs
were plated on 145-cm2 plastic dishes and were used after
reaching confluence. Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal calf serum was used during the
experiments. All culture reagents were purchased from GIBCO-Europe.
Confluent monolayers of HUVECs were exposed to fluid flow (laminar,
turbulent, periodic, or pulsatile) in a cone-and-plate apparatus as
previously described.19 21 Briefly, this consists of a
cone of shallow angle (
) rotating on top of a tissue culture plate.
The motion of the culture medium between the plate and the cone induces
fluid shear stress of controlled magnitude, depending on the speed of
rotation of the cone. The apparatus was designed for use with
145-cm2 cell culture dishes covered by a confluent
monolayer of HUVECs as a plate and for maintaining a constant
temperature (37°C), humidified air with 5% CO2,
and a constant rotational speed of the cone. Steady laminar flow was
generated by using a cone angle of 0.5°.22 23
Shear-stress levels over the cell surface were extrapolated from
previous measurements and theory and were estimated to be accurate to
within 10%.22 23 24 To achieve oscillating shear, a modified
cone varying sinusoidally in angle and rotating at 2 revolutions per
second provided sinusoidal variation of shear-stress magnitude in time
ranging from 8.2 to 16.6 dyne/cm2 (average, 12.4
dyne/cm2) at a frequency of 2 Hz, as previously
described.22 25 Turbulent flow was induced by increasing
the flow velocity and using a cone angle of 5°. At variance with
laminar flow, in these conditions shear stress is not constant with
radial position. We used cone rotational speed that induces a mean
turbulent shear of 8 dyne/cm2, with values ranging
from 1.2 to 11.4 dyne/cm2 going from the cone apex to the
outer part of the plate.19
[3H]L-Citrulline Formation From
[3H]L-Arginine and ET-1 Release
One milliliter of cell supernatant was treated with 1 vol of
15% trichloroacetic acid (TCA) and then centrifuged at
10 000g to precipitate proteins. Supernatant was extracted
five times with 1 vol of water-saturated ether, vacuum-lyophilized,
resuspended in 2 mL HEPES (Merck), pH 5.5, and applied to 2 mL wet-bed
volumes of Dowex AG 50 WX-8 (100 to 200 mesh, Bio-Rad) (Li+
form), followed by 2 mL of water.
[3H]L-Citrulline was quantified by liquid
scintillation counting in the 4-mL column effluent. Results were
expressed as nanomoles of [3H]L-citrulline
by correcting data in counts per minute for the specific activity of
[3H]L-arginine, calculated on the basis of
the endogenous L-arginine content of the medium. Recovery
of [14C]L-citrulline (New England Nuclear,
53.7 mCi/mmol) after cation exchange chromatography, determined by the
addition of [14C]L-citrulline to samples
before TCA treatment, was over 60%. Thin-layer chromatography was used
to identify the product of cation exchange chromatography, as
previously described.26
To evaluate ET-1 release, aliquots of cell supernatant were extracted as previously described.27 ET-1 in extracted samples was quantified by a specific radioimmunoassay.28
Polymerase Chain Reaction Cloning of Human Endothelial Cell NO
Synthase cDNA
Two oligonucleotides were synthesized on the basis of the
published sequence of human endothelial cell NO synthase (EC NOS)
DNA29 30 : the sense orientation primer (oligo A: 5'-
ACAGAATTCGGATCCGGTCGCTTCGACGTGCT, beginning at position +870 of the
coding strand) and the antisense orientation primer (oligo B:
5'-ACAGAATTCAAGCTTTCCCCATTCCCAAATGTGCT-3', complementary to the human
EC NOS DNA sequence from +1734 to +1753). Restriction sites
BamHI and HindIII were inserted in oligo A and B,
respectively. One microgram of total human endothelial cell RNA was
reverse-transcribed into cDNA by using oligo B as a primer and
polymerase chain reaction (PCR)amplified by using oligo A and B.
After BamHI/HindIII digestion of the 914-bp PCR
product, the resulting 883-bp EC NOS cDNA fragment was inserted into
pBluescript IISK vector. The authenticity of the cDNA fragment obtained
was verified by restriction digestion and DNA sequencing.
RNA Preparation and Analysis
Total cellular RNA was isolated from HUVECs by the guanidium
isothiocyanate/cesium chloride procedure.31 Samples (10
µg per lane) were loaded onto 1.2% agarose gel with 6% formaldehyde
and transferred to Gene Screen Plus (New England Nuclear) by capillary
blotting in 10x standard saline citrate (SSC: 1.5 mol/L NaCl and 0.15
mol/L sodium citrate, pH 7.0). Gels were stained with ethidium bromide
to visualize 28S and 18S ribosomal RNA bands. These bands were used to
confirm that approximately equivalent amounts of RNA were loaded in
each gel lane and that there was no obvious degradation of RNA. The
BamHI-HindIII cDNA fragment of human EC NOS was
labeled with [
32P]dCTP by the random-primed
method.32
Membranes were hybridized for 20 hours at 60°C with 1.5x106 cpm per labeled probe in a solution containing 1 mol/L NaCl, 1% sodium dodecyl sulfate (SDS), 10% dextran sulfate, and 100 µg/mL salmon sperm DNA. Filters were then washed at 60°C in 2x SSC containing 1% SDS for 1 hour and exposed to X-ray film for autoradiography. The same membranes were subsequently probed with human preproendothelin-1 cDNA fragment.33 Finally, they were hybridized with a rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA,34 taken as an internal standard for equal loading of the samples on the membrane.
After optimal exposure, the autoradiographs of each experiment were analyzed by densitometry to quantify the relative amounts of radioactively labeled probe bound for each transcript. The hybridization signals of EC NOS and ET-1 were normalized for each sample with respect to the density of the corresponding GAPDH signals.
Statistical Analysis
Results are expressed as mean±SEM. Data were analyzed by
one-way ANOVA followed by the Tukey-Ciccheti test for multiple
comparisons. Statistical level of significance was defined as
P<.05.
| Results |
|---|
|
|
|---|
|
To establish whether shear-stressmediated stimulation of NO synthesis
in endothelial cells was due to increased NO synthase gene expression,
we analyzed RNA from HUVECs cultured either in static conditions or
under laminar shear stress. Northern hybridization analysis with a
human constitutive NO synthase (EC NOS) cDNA probe indicated the
presence of a 4.8-kb EC NOS mRNA in cells maintained under static
conditions. Exposure to shear stress of 8 dyne/cm2 caused
100% increase over static controls (Fig 3
). This
indicates that EC NOS mRNA is upregulated at physiological laminar
shear stress levels.
|
Fluid Shear-Stress Magnitude Modulates NO Synthesis
As shown in Fig 4
, the level of shear stress
influenced the degree of stimulation of NO release by endothelial cell
monolayers. After 6 hours of exposure to a shear stress of 2
dyne/cm2, there was a small, not statistically
significant, increase of NO synthesis compared with static controls.
Release was stimulated more by exposure to shear stress of 8 and 12
dyne/cm2 (static, 0.11±0.02 nmol/105 cells
[n=10]; at 2 dyne/cm2, 0.38±0.24
nmol/105 cells [n=3]; at 8 dyne/cm2,
0.59±0.08 nmol/105 cells [n=4, P<.01 versus
static]; and at 12 dyne/cm2, 1.42±0.20
nmol/105 cells [n=3, P<.01 versus static];
Fig 4
).
|
Time Variations of Laminar Shear Stress Stimulate NO Synthesis
To verify the effects of periodic changes in shear stress on NO
synthesis, confluent endothelial cells were subjected to step changes
in the amplitude of shear stress from 2 to 8 dyne/cm2 every
15 minutes for 6 hours. This resulted in a massive increase of NO
release compared with static controls (static, 0.06±0.02
nmol/105 cells [n=4]; periodic shear, 1.58±0.61
nmol/105 cells [n=4]; P<.01; Fig 5A
). To compare the effects of steady laminar and of
periodic shear stress on NO release by HUVECs, data from single
experiments were expressed as the percent increase over corresponding
static controls. As shown in Fig 6
, low-frequency cyclic
fluctuations in shear stress caused a further significant increase of
NO synthesis compared with steady shear stress of the same magnitude
(P<.05). This suggests that periodic changes of flow
conditions, beside shear-stress levels, are enough "per se" to
influence NO production by endothelial cells.
|
|
To verify the effects of oscillating shear stress on NO synthesis,
HUVECs were exposed to oscillating shear stress (from 8.2 to 16.6
dyne/cm2; mean, 12.4 dyne/cm2; frequency, 2 Hz)
for 6 hours. This condition resulted in a significant increase in NO
release compared with static controls (static, 0.06±0.02
nmol/105 cells [n=4]; oscillating shear, 0.51±0.07
nmol/105 cells [n=4]; P<.01 versus static;
Fig 5B
).
Turbulent Shear Stress Does Not Affect NO Synthesis and NO Synthase
Gene Expression
To assess the effect of nonuniform fluid shear stresses on
NO release by vascular endothelium compared with the effect of laminar
shear stress, confluent HUVEC monolayers were exposed to turbulent
shear stress at an average magnitude of 8 dyne/cm2 for 6
hours. Shear stress in the turbulent flow condition did not stimulate
NO release by HUVECs (static, 0.23±0.09 nmol/105 cells
[n=6]; turbulent shear, 0.31±0.09 nmol/105 cells
[n=6]; Fig 7
). In these series of experiments, control
unsheared cells released more NO than did the control cells in laminar
flow experiments (0.23±0.09 versus 0.07±0.03 nmol/105
cells). This might be a consequence of the different incubation volume
(turbulent flow and static control, 80 mL; laminar flow and static
control, 22 mL) and the related different amounts of
[3H]L-arginine (turbulent, 80 µCi;
laminar, 22 µCi; specific activity, 2.5 µCi/µmol for both laminar
and turbulent experiments). Besides not increasing NO release by
HUVECs, turbulent flow also did not induce any upregulation of EC NOS
mRNA (Fig 3
). These results exclude the possibility that shear-induced
NO upregulation is simply the result of culture media disturbance and
indicate that EC NOS mRNA expression and NO production by HUVECs are
sensitive to the magnitude and type of flow on the cell surface.
|
Both Laminar and Turbulent Shear Stress Partially Reduce ET-1
Production and Downregulate ET-1 Gene Expression
Since fluid shear stress is a major physiological regulator of the
expression of the ET-1 gene, we also evaluated the effect of laminar or
disturbed flow on ET-1 production and ET-1 mRNA in HUVECs. A decrease
in ET-1 production, although not significant, was observed when HUVECs
were subjected to laminar (steady or oscillating) and turbulent shear
stress. Results, expressed as percent decrement over corresponding
static controls, were as follows: steady laminar shear, 24.0±7.7% at
2 dyne/cm2 (n=3), 28.0±9.7% at 8 dyne/cm2
(n=4), and 5.0±3.5% at 12 dyne/cm2 (n=3); oscillating
shear, 35.1±13.2% (n=4); and turbulent shear, 24.0±9.8% (n=6). By
contrast, periodic shear stress caused a marginal increase of ET-1
release by endothelial cells: 28.0±10.0% (n=3). As shown in Fig 8
, exposure to laminar shear stress of 8
dyne/cm2 caused a 51% decrease of ET-1 mRNA. Shear stress
in the turbulent regimen caused a 42% downregulation of ET-1 mRNA,
comparable to that resulting from exposure to laminar shear stress of
the same magnitude (Fig 8
).
|
| Discussion |
|---|
|
|
|---|
Release of NO in cell supernatant required at least a 6-hour exposure of the cells to laminar shear stress. The fact that NO synthase mRNA is upregulated in endothelial cells after this interval could be taken as evidence that shear forces modulate the NO synthase gene. Recent data29 showing that the endothelial cell NO synthase 5' flanking region contains a cis-acting regulatory sequence identical to the previously recognized shear-stress responsive element (SSRE)35 suggest that the upregulation of NO synthase mRNA may derive from a direct effect of shear stress on NO synthase gene transcription. Other endothelial cell genes are upregulated by shear stress, including platelet-derived growth factor-B chain,3 tissue-type plasminogen activator,36 and intercellular adhesion molecule-1,37 all of which contain the same sequence.35
The precise mechanisms by which shear stress upregulates NO synthase have to be further explored. "In vivo" studies have found that flow reorganizes endothelial cell cytoskeletal proteins by rearranging the actin microfilament network into stress fibers, which mainly align parallel to the flow direction.38 It has been proposed that endothelial stress fibers may apply tension to resist the shear forces acting on the cells, thus allowing the cells to maintain their flattened phenotype and to remain firmly attached to the substratum.1 The cytoskeleton may also serve as a second signal apparatus for transducing the biomechanical stimulus sensed by endothelial cell surface to the nucleus, which would favor transcriptional activation of NO synthase mRNA.35
A recent study with HUVECs exposed to fluid flow in a parallel plate chamber39 suggested a bimodal pathway of NO release by endothelial cells exposed to flow: a rapid shear levelindependent and partially calcium-dependent step, which however is transient, followed by a shear-dependent production, which is sustained with time. Quite possibly, a rapid rise in shear stress, by elevating intracellular Ca2+, activates preformed NO-forming enzyme in vascular endothelial cells.
In our experimental conditions, the possibility of transient activation of the enzyme is consistent with the numerical increase of NO induced by a 1-hour exposure to laminar shear stress. Such transient activation is then followed by a lasting increase of NO synthesis, actually paralleled by the upregulation of NO synthase mRNA. In addition, our experiments using step changes in shear stress have indicated that rapid changes in flow conditions enhance NO release more than does steady laminar flow alone of comparable magnitude. This may have practical implications for vessel hemodynamics in vivo, since in some regions of the circulation components of slow periodicity may be induced by the combination of two main factors, the geometric arrangement of blood vessels and poorly defined fluctuations of blood pressure.22 These events are superimposed on the higher frequency pulse wave due to systolic and diastolic cycles, which "per se" stimulates NO release as documented by our experiments with pulsatile flow. Moreover, during a 24-hour period, major changes of blood flow and pulse rate occur with frequencies varying from 1 hour to several minutes.40 Upregulation of endothelial cell NO synthesis may therefore serve to adapt local vascular tone to the modifications of shear stress characteristics after the changes in blood pressure and flow normally occurring throughout the day.
In some regions of the arterial tree, under conditions of increased flow velocity, unsteady flow patterns may develop with shear stress fluctuating in amplitude and direction.19 41 In our experimental conditions, disturbance of flow toward turbulence was induced by increasing the cone angle in the flow apparatus. This allowed the development of secondary flow and unsteady shear stress along the cell culture plate. As shown by the theoretical analysis of Sdougos et al,42 in these conditions the flow pattern is not uniform with radial position, but the flow from laminar becomes turbulent from the cone apex to the edge. We did in fact find that the transition from laminar to turbulent flow, unlike steady laminar flow of comparable magnitude, did not upregulate NO synthase mRNA and did not increase NO formation and release. This would indicate that small-scale high-frequency fluctuations in amplitude and rapid changes in direction of turbulent shear stress do not activate SSRE of the NO synthase promoter.
In contrast with the NO pathway, laminar shear stress partially reduced ET-1 mRNA and release compared with the static conditions. Since NO downregulates ET-1 gene transcription in endothelial cells,43 the effect of shear stress on ET-1 might be mediated by the release of NO. However, our findings that turbulent shear stress, which does not stimulate NO synthesis, lowered endothelial ET-1 to the same degree as laminar shear stress, make this unlikely.
The patterns of response of endothelial cells to different types of fluid shear suggest that under physiological conditions of steady laminar flow, NO is continuously released while ET-1 secretion is partially depressed. By contrast, in regions where shear stress decreases toward null values, NO release is impaired, and ET-1 secretion is enhanced. This would cause local vasoconstriction and vascular remodeling of arteries as observed in response to a reduction in blood flow rate.12 44 45 On the other hand, if flow has rapid oscillations in magnitude and direction, endothelial cell synthesis and release of NO may be reduced, thus contributing to vasoconstriction and cell proliferation. It is tempting to speculate that the reduction of NO in response to unsteady fluid shear stress is implicated in the pathogenesis of the atherosclerotic lesion. This may explain why such lesions prevail in regions where flow conditions are unsteady.14 17
Because of its potent biological properties, endothelium-derived NO has been proposed as a potential modulator of the key events in atherogenesis.46 Besides its vasodilatory and antiproliferative effects on vascular smooth muscle cells,47 NO also inhibits platelet adhesion and aggregation48 and inhibits the leukocyteendothelial cell interaction.49 Inhibitors of NO synthesis administered to normal cats largely enhance leukocyte adhesion to venular endothelium and promote extravascular leukocyte migration.49 However, the most convincing evidence that NO is protective against atherosclerosis is probably provided by Cooke et al,50 who showed that the precursor of NO, L-arginine, given with the diet, almost completely prevented atherosclerotic lesions in hypercholesterolemic rabbits. Together with the above evidence, our findings suggest that constant release of NO from vascular endothelium under laminar shear stress has some physiological role in maintaining the nonthrombogenicity of the vascular wall as well as in the control of vascular cell proliferation. In regions where fluid shear stress decreases or in regions where flow is disturbed and turbulence develops, local NO production by the endothelium may be reduced or abolished, thus favoring the start of a process that eventually results in atheroma.
In conclusion, our findings indicate that production of vasoactive substances by vascular endothelial cells is related to the fluid shear stress condition experienced by the cells. The physiological condition of laminar flow induces constant release of NO and partially decreases ET-1 production, whereas when shear stress is not laminar, the balance between the production of these compounds may be greatly affected.
| Acknowledgments |
|---|
Received June 20, 1994; accepted December 21, 1994.
| References |
|---|
|
|
|---|
. Am J Physiol. 1991;261:C634-C641. This article has been cited by other articles:
![]() |
C. Ootaki, M. Yamashita, Y. Ootaki, K. Kamohara, S. Weber, R. S. Klatte, W. A. Smith, A. L. Massiello, S. N. Emancipator, L. A.R. Golding, et al. Reduced Pulsatility Induces Periarteritis in Kidney: Role of the Local Renin-Angiotensin System J. Thorac. Cardiovasc. Surg., July 1, 2008; 136(1): 150 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, J.-C. Kim, Y. Li, M.-J. Son, and S.-H. Woo Fluid pressure modulates L-type Ca2+ channel via enhancement of Ca2+-induced Ca2+ release in rat ventricular myocytes Am J Physiol Cell Physiol, April 1, 2008; 294(4): C966 - C976. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Laughlin, S. C. Newcomer, and S. B. Bender Importance of hemodynamic forces as signals for exercise-induced changes in endothelial cell phenotype J Appl Physiol, March 1, 2008; 104(3): 588 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. W. Groenendijk, K. Van der Heiden, B. P. Hierck, and R. E. Poelmann The Role of Shear Stress on ET-1, KLF2, and NOS-3 Expression in the Developing Cardiovascular System of Chicken Embryos in a Venous Ligation Model Physiology, December 1, 2007; 22(6): 380 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Tsai, H.-J. Hsieh, F. Liao, C.-W. Ni, Y.-J. Chao, C.-Y. Hsieh, and D. L. Wang Laminar flow attenuates interferon-induced inflammatory responses in endothelial cells Cardiovasc Res, June 1, 2007; 74(3): 497 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Saloner, G. Acevedo-Bolton, M. Wintermark, and J. H. Rapp MRI of Geometric and Compositional Features of Vulnerable Carotid Plaque Stroke, February 1, 2007; 38(2): 637 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yayama, H. Hiyoshi, D. Imazu, and H. Okamoto Angiotensin II Stimulates Endothelial NO Synthase Phosphorylation in Thoracic Aorta of Mice With Abdominal Aortic Banding Via Type 2 Receptor Hypertension, November 1, 2006; 48(5): 958 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yin, Z. Wang, H. Zhu, R. Zhang, H. Wang, and X. Li Experimental Study of Effect of Fontan Circuit on Pulmonary Microcirculation Asian Cardiovasc Thorac Ann, June 1, 2006; 14(3): 183 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gambillara, C. Chambaz, G. Montorzi, S. Roy, N. Stergiopulos, and P. Silacci Plaque-prone hemodynamics impair endothelial function in pig carotid arteries Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2320 - H2328. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Arenas, Y. Xu, and S. T. Davidge Age-associated impairment in vasorelaxation to fluid shear stress in the female vasculature is improved by TNF-{alpha} antagonism Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1259 - H1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Vargas, J. M. Moreno, I. Rodriguez-Gomez, R. Wangensteen, A. Osuna, M. Alvarez-Guerra, and J. Garcia-Estan Vascular and renal function in experimental thyroid disorders Eur. J. Endocrinol., February 1, 2006; 154(2): 197 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Reboul, S. Tanguy, A. Gibault, M. Dauzat, and P. Obert Chronic hypoxia exposure depresses aortic endothelium-dependent vasorelaxation in both sedentary and trained rats: involvement of L-arginine J Appl Physiol, September 1, 2005; 99(3): 1029 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |