This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Noris, M. Articles by Remuzzi, A. Search for Related Content PubMed PubMed Citation Articles by Noris, M. Articles by Remuzzi, A. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB NITRIC OXIDE

(Circulation Research. 1995;76:536-543.)
© 1995 American Heart Association, Inc.

Articles

Nitric Oxide Synthesis by Cultured Endothelial Cells Is Modulated by Flow Conditions

Marina Noris, Marina Morigi, Roberta Donadelli, Sistiana Aiello, Marco Foppolo, Marta Todeschini, Silvia Orisio, Giuseppe Remuzzi, Andrea Remuzzi

From the Mario Negri Institute for Pharmacological Research (M.N., M.M., R.D., S.A., M.F., M.T., S.O., G.R., A.R.) and the Division of Nephrology (G.R.), Ospedali Riuniti di Bergamo (Italy).

Correspondence to Marina Noris, Mario Negri Institute for Pharmacological Research, Via Gavazzeni 11, 24125 Bergamo, Italy.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract In the present study, we examined the hypothesis that dynamic characteristics of flow modulate the production of vasoactive mediators, namely nitric oxide (NO) and endothelin-1 (ET-1), by human umbilical vein endothelial cells (HUVECs). Cells were exposed for 6 hours in a cone-and-plate apparatus to different types of flow: steady laminar, with shear stresses of 2, 8, and 12 dyne/cm²; pulsatile laminar, with shear stress from 8.2 to 16.6 dyne/cm² and a frequency of 2 Hz; periodic laminar, with square wave cycles of 15 minutes and shear stress from 2 to 8 dyne/cm²; and turbulent, with shear stress of 8 dyne/cm² on average. A second culture dish was kept in a normal incubator as a static control for each experiment. Laminar flow induced synthesis of NO by HUVECs that was dependent on shear-stress magnitude. Laminar shear stress at 8 dyne/cm² also upregulated the level of NO synthase mRNA. As observed with steady laminar flow, pulsatile flow also induced an increase in NO release by endothelial cells. When HUVECs were subjected to step-change increases of laminar shear, a further increase of NO synthesis was observed, compared with steady laminar shear of the same magnitude. Turbulent flow did not upregulate NO synthase mRNA or increase NO release. Both laminar and turbulent shear stress reduced, although not significantly, ET-1 mRNA and ET-1 production compared with the static condition. These results indicate that local blood flow conditions modulate the production of vasoactive substances by endothelial cells. This may affect vascular cell functions such as nonthrombogenicity, regulation of blood flow, and vascular tone.

Key Words: atherosclerosis • endothelium-derived relaxing factor • endothelin • gene expression • shear stress

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The structure and the synthetic and secretory functions^{1 2 3 4} of vascular endothelial cells are influenced by wall shear stress, the tractive force acting on the cell surface induced by blood flow. Recent studies suggested that shear stress modulates the levels of two potent endothelium-derived vasoactive mediators: the vasodilator nitric oxide (NO)^{5 6} and the vasoconstrictor endothelin-1 (ET-1).⁷ Thus, an increase in the rate of flow through a segment of rat aorta^{8 9} or through a column of endothelial cells grown on the surface of microcarrier beads¹⁰ caused additional release of NO. On the other hand, exposure of endothelial cell cultures to controlled levels of laminar shear stress in a cone-and-plate apparatus resulted in downregulation of ET-1 mRNA levels and ET-1 peptide release.¹¹ On the basis of this experimental evidence, it has been suggested that in physiological conditions fluid shear stresses regulate the release of endothelial cell–derived vasoactive mediators to maintain vascular vessel tone.

Experimental studies have documented that chronic alterations of physiological blood flow cause the arterial diameter to change so as to recover a physiological state of wall shear stress (15 dyne/cm²).¹² It is widely recognized that endothelial cells are the "biosensors" of fluid dynamic shear forces that reduce arterial diameter when blood flow rate decreases and enlarge the diameter when the flow rate increases.¹² The constant finding that atherosclerotic lesions occur mainly at specific sites around arterial branchings and bifurcations^{13 14 15 16} indicates that local flow patterns are also involved in atherogenesis. With the aim of clarifying these processes, the localization of intimal thickening in human carotid arteries and the related shear-stress variables have been studied in detail.^{14 17} The results of these investigations indicate that regions exposed to low and unsteady shear stress appear to be more susceptible to the development of structural changes than areas of the arterial wall exposed to higher and more constant shear stress. It appears that focal response to wall shear stress leads to focally distributed areas of intimal thickening and subsequent plaque formation. It has been proposed that phenomena responsible for the remodeling of arteries in response to changes in blood flow rate are implicated in the development of early atherosclerotic plaques.¹² Recent studies have focused on the possible role of vascular endothelium in the induction of these structural changes, particularly on how different hemodynamic conditions affect the regulation of endothelial cell function. Thus, exposure to laminar steady flow results in endothelial cell elongation and alignment with the flow direction, whereas under turbulent flow they retain their cobblestone shape.^{11 18 19} Davies et al¹⁹ reported that turbulent flow, but not laminar flow, induced DNA synthesis and cell proliferation in a confluent endothelial monolayer.

Since different flow patterns have different effects on endothelial morphology and proliferation, the endothelial synthesis of vasoactive mediators might also be influenced by the nature of the mechanical stimuli sensed by the cells. In this context, the only available data are from Malek and Izumo,¹¹ who have demonstrated that laminar and turbulent shear stress downregulate ET-1 mRNA equally in endothelial cells. Detailed information on the effect of different shear stresses on the potent endothelium-derived vasodilator NO is lacking. Using controlled flow conditions, we investigated the effect of shear-stress levels and flow conditions (laminar versus turbulent flow and steady versus pulsatile or periodic flow) on NO synthase gene expression and NO formation in endothelial cells. We also evaluated endothelial gene expression and the release of the "proatherogenic" mediator ET-1 to compare the effects of physical forces on the balance of these two molecules, which have opposite actions on vascular tone and cell proliferation.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Experimental Design
The effect of steady laminar shear stress on NO synthesis by endothelial cells was studied by exposing confluent monolayers of human umbilical vein endothelial cells (HUVECs) to laminar flow (8 dyne/cm²) in a cone-and-plate apparatus (Fig 1, top) for 6 hours. [³H]L-Arginine (1 µCi/mL, New England Nuclear; 56.4 Ci/mmol) was added to the incubation medium before the start of the experiments. Cell supernatant was collected at 1 and 6 hours, and [³H]L-citrulline was assayed as a marker of NO synthesis. In some experiments HUVECs were exposed to laminar flow for 6 hours in the presence of 300 µmol/L N-nitro-L-arginine (L-NNA, Sigma Chemical Co), a specific inhibitor of NO synthesis.

View larger version (28K): [in this window] [in a new window]   Figure 1. Representation of shear exposure experiments. Top, Schematic figure of the cone-and-plate apparatus used to apply fluid shear stress to endothelial cells plated in tissue culture dishes. A cone of shallow angle (), rotating at angular velocity (), applies fluid shear stress of controlled magnitude to an endothelial cell monolayer grown on a plate. Bottom, Representation of the four regimens of fluid shear stress to which endothelial cells were exposed: (1) steady laminar shear, (2) periodic shear, (3) oscillating shear, and (4) turbulent shear (the profile for turbulent shear is shown simply for illustration and is not an exact representation of shear stress magnitude).

To study the effect of steady laminar shear stress on NO synthase gene expression, confluent endothelial cell monolayers were exposed to laminar flow (8 dyne/cm²) for 6 hours, and total cellular RNA was then obtained for Northern analysis. To evaluate the effect of shear magnitude on NO synthesis by endothelial cells, cells were exposed for 6 hours to steady shear stresses of 2, 8, or 12 dyne/cm². Cell supernatant was collected at 6 hours to measure [³H]L-citrulline. To study the effect of periodic changes in shear stress on NO synthesis, HUVECs were exposed to step changes in shear stress in square wave cycles of long duration (15 minutes) between a low (2 dyne/cm²) and a higher (8 dyne/cm²) amplitude. [³H]L-Citrulline in the supernatant was assayed after 6 hours of exposure. To study the effect of pulsatile flow, HUVECs were exposed to oscillating shear stress from 8.2 to 16.6 dyne/cm² (average, 12.4 dyne/cm²) with a frequency of 2 Hz.

The effect of disturbed flow on NO synthesis was studied by measuring the conversion of [³H]L-arginine to [³H]L-citrulline in cultured endothelial cells exposed to turbulent flow (average shear stress, 8 dyne/cm²) for 6 hours. In additional experiments, total RNA was obtained from HUVECs after 6 hours of exposure to turbulent shear stress to assess the effects of disturbed flow on endothelial cell NO synthase gene expression.

ET-1 levels were also measured in aliquots of cell supernatant from each experiment to evaluate the effects of different types of flow on the ET-1 synthetic pathway. RNA from HUVECs exposed to laminar or turbulent shear stress was also analyzed for ET-1 gene expression. During each experiment, a culture plate of confluent HUVECs was kept in a normal incubator as a static control. A schematic representation of the four different flow conditions is shown in Fig 1 (bottom).

Cell Culture and Shear Exposure Apparatus
HUVECs were obtained from umbilical veins according to the method of Jaffé et al.²⁰ Cells were grown in medium 199 supplemented with 10% newborn calf serum, 10% human serum, and antibiotics and were used at the third or fourth passage. HUVEC purity was assessed by indirect immunofluorescence microscopy using rabbit anti–human factor VIII antigen. For shear-stress experiments, HUVECs were plated on 145-cm² plastic dishes and were used after reaching confluence. Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum was used during the experiments. All culture reagents were purchased from GIBCO-Europe.

Confluent monolayers of HUVECs were exposed to fluid flow (laminar, turbulent, periodic, or pulsatile) in a cone-and-plate apparatus as previously described.^{19 21} Briefly, this consists of a cone of shallow angle () rotating on top of a tissue culture plate. The motion of the culture medium between the plate and the cone induces fluid shear stress of controlled magnitude, depending on the speed of rotation of the cone. The apparatus was designed for use with 145-cm² cell culture dishes covered by a confluent monolayer of HUVECs as a plate and for maintaining a constant temperature (37°C), humidified air with 5% CO₂, and a constant rotational speed of the cone. Steady laminar flow was generated by using a cone angle of 0.5°.^{22 23} Shear-stress levels over the cell surface were extrapolated from previous measurements and theory and were estimated to be accurate to within 10%.^{22 23 24} To achieve oscillating shear, a modified cone varying sinusoidally in angle and rotating at 2 revolutions per second provided sinusoidal variation of shear-stress magnitude in time ranging from 8.2 to 16.6 dyne/cm² (average, 12.4 dyne/cm²) at a frequency of 2 Hz, as previously described.^{22 25} Turbulent flow was induced by increasing the flow velocity and using a cone angle of 5°. At variance with laminar flow, in these conditions shear stress is not constant with radial position. We used cone rotational speed that induces a mean turbulent shear of 8 dyne/cm², with values ranging from 1.2 to 11.4 dyne/cm² going from the cone apex to the outer part of the plate.¹⁹

[³H]L-Citrulline Formation From [³H]L-Arginine and ET-1 Release
One milliliter of cell supernatant was treated with 1 vol of 15% trichloroacetic acid (TCA) and then centrifuged at 10 000g to precipitate proteins. Supernatant was extracted five times with 1 vol of water-saturated ether, vacuum-lyophilized, resuspended in 2 mL HEPES (Merck), pH 5.5, and applied to 2 mL wet-bed volumes of Dowex AG 50 WX-8 (100 to 200 mesh, Bio-Rad) (Li⁺ form), followed by 2 mL of water. [³H]L-Citrulline was quantified by liquid scintillation counting in the 4-mL column effluent. Results were expressed as nanomoles of [³H]L-citrulline by correcting data in counts per minute for the specific activity of [³H]L-arginine, calculated on the basis of the endogenous L-arginine content of the medium. Recovery of [¹⁴C]L-citrulline (New England Nuclear, 53.7 mCi/mmol) after cation exchange chromatography, determined by the addition of [¹⁴C]L-citrulline to samples before TCA treatment, was over 60%. Thin-layer chromatography was used to identify the product of cation exchange chromatography, as previously described.²⁶

To evaluate ET-1 release, aliquots of cell supernatant were extracted as previously described.²⁷ ET-1 in extracted samples was quantified by a specific radioimmunoassay.²⁸

Polymerase Chain Reaction Cloning of Human Endothelial Cell NO Synthase cDNA
Two oligonucleotides were synthesized on the basis of the published sequence of human endothelial cell NO synthase (EC NOS) DNA^{29 30} : the sense orientation primer (oligo A: 5'- ACAGAATTCGGATCCGGTCGCTTCGACGTGCT, beginning at position +870 of the coding strand) and the antisense orientation primer (oligo B: 5'-ACAGAATTCAAGCTTTCCCCATTCCCAAATGTGCT-3', complementary to the human EC NOS DNA sequence from +1734 to +1753). Restriction sites BamHI and HindIII were inserted in oligo A and B, respectively. One microgram of total human endothelial cell RNA was reverse-transcribed into cDNA by using oligo B as a primer and polymerase chain reaction (PCR)–amplified by using oligo A and B. After BamHI/HindIII digestion of the 914-bp PCR product, the resulting 883-bp EC NOS cDNA fragment was inserted into pBluescript IISK vector. The authenticity of the cDNA fragment obtained was verified by restriction digestion and DNA sequencing.

RNA Preparation and Analysis
Total cellular RNA was isolated from HUVECs by the guanidium isothiocyanate/cesium chloride procedure.³¹ Samples (10 µg per lane) were loaded onto 1.2% agarose gel with 6% formaldehyde and transferred to Gene Screen Plus (New England Nuclear) by capillary blotting in 10x standard saline citrate (SSC: 1.5 mol/L NaCl and 0.15 mol/L sodium citrate, pH 7.0). Gels were stained with ethidium bromide to visualize 28S and 18S ribosomal RNA bands. These bands were used to confirm that approximately equivalent amounts of RNA were loaded in each gel lane and that there was no obvious degradation of RNA. The BamHI-HindIII cDNA fragment of human EC NOS was labeled with [³²P]dCTP by the random-primed method.³²

Membranes were hybridized for 20 hours at 60°C with 1.5x10⁶ cpm per labeled probe in a solution containing 1 mol/L NaCl, 1% sodium dodecyl sulfate (SDS), 10% dextran sulfate, and 100 µg/mL salmon sperm DNA. Filters were then washed at 60°C in 2x SSC containing 1% SDS for 1 hour and exposed to X-ray film for autoradiography. The same membranes were subsequently probed with human preproendothelin-1 cDNA fragment.³³ Finally, they were hybridized with a rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA,³⁴ taken as an internal standard for equal loading of the samples on the membrane.

After optimal exposure, the autoradiographs of each experiment were analyzed by densitometry to quantify the relative amounts of radioactively labeled probe bound for each transcript. The hybridization signals of EC NOS and ET-1 were normalized for each sample with respect to the density of the corresponding GAPDH signals.

Statistical Analysis
Results are expressed as mean±SEM. Data were analyzed by one-way ANOVA followed by the Tukey-Ciccheti test for multiple comparisons. Statistical level of significance was defined as P<.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Laminar Shear Stress Stimulates NO Synthesis and Upregulates NO Synthase Gene Expression
Stationary confluent HUVEC cultures released 0.025±0.005 nmol/10⁵ cells NO (n=4) during 1 hour of incubation, as assessed by the conversion of [³H]L-arginine to [³H]L-citrulline (Fig 2). Cumulative production of NO rose to 0.07±0.03 nmol/10⁵ cells (n=4) after 6 hours of incubation (Fig 2). A 1-hour exposure of HUVECs to laminar steady shear stress of 8 dyne/cm² caused a slight but not significant increase of NO release compared with static cultures (0.04±0.01 nmol/10⁵ cells [n=4], Fig 2). By contrast, a 6-hour exposure to shear stress greatly increased the cumulative release of NO (0.59±0.08 nmol/10⁵ cells [n=4], P<.01 versus static, Fig 2). Treatment with L-NNA, a specific inhibitor of NO synthesis, completely abolished the stimulatory effect of shear stress on NO release (0.003±0.001 nmol/10⁵ cells [n=3], Fig 2).

View larger version (27K): [in this window] [in a new window]   Figure 2. Bar graph showing the effect of laminar shear stress on nitric oxide (NO) release by human umbilical vein endothelial cells (HUVECs). Confluent HUVEC cultures were incubated under static conditions (n=4), laminar flow (8 dyne/cm2 [n=4]), or laminar flow in the presence of a specific inhibitor of NO synthase, N-nitro-L-arginine (L-NNA, 300 µmol/L) (n=3). [3H]L-Arginine (1 µCi/mL) was added to incubation medium before the start of each experiment. Cell supernatant was collected at 1 and 6 hours, and [3H]L-citrulline formation was measured as a marker of NO synthesis. Data are mean±SEM. *P<.01 vs static.

To establish whether shear-stress–mediated stimulation of NO synthesis in endothelial cells was due to increased NO synthase gene expression, we analyzed RNA from HUVECs cultured either in static conditions or under laminar shear stress. Northern hybridization analysis with a human constitutive NO synthase (EC NOS) cDNA probe indicated the presence of a 4.8-kb EC NOS mRNA in cells maintained under static conditions. Exposure to shear stress of 8 dyne/cm² caused 100% increase over static controls (Fig 3). This indicates that EC NOS mRNA is upregulated at physiological laminar shear stress levels.

View larger version (54K): [in this window] [in a new window]   Figure 3. Northern blot analysis of RNA obtained from human umbilical vein endothelial cells exposed to steady laminar fluid shear stress (magnitude, 8 dyne/cm2) or turbulent shear stress (average, 8 dyne/cm2) for 6 hours. After electrophoresis on agarose/formaldehyde gels, RNA was transferred to nylon membranes and hybridized sequentially with -32P–labeled endothelial cell nitric oxide synthase (EC-NOS, top) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, bottom) cDNA probes. The optical density of the autoradiography signals was quantified and calculated as the ratio of EC-NOS to GAPDH mRNA. The mRNA levels of laminar and turbulent flows were calculated by assuming the optical density of static controls (unsheared cells) as unit.

Fluid Shear-Stress Magnitude Modulates NO Synthesis
As shown in Fig 4, the level of shear stress influenced the degree of stimulation of NO release by endothelial cell monolayers. After 6 hours of exposure to a shear stress of 2 dyne/cm², there was a small, not statistically significant, increase of NO synthesis compared with static controls. Release was stimulated more by exposure to shear stress of 8 and 12 dyne/cm² (static, 0.11±0.02 nmol/10⁵ cells [n=10]; at 2 dyne/cm², 0.38±0.24 nmol/10⁵ cells [n=3]; at 8 dyne/cm², 0.59±0.08 nmol/10⁵ cells [n=4, P<.01 versus static]; and at 12 dyne/cm², 1.42±0.20 nmol/10⁵ cells [n=3, P<.01 versus static]; Fig 4).

View larger version (34K): [in this window] [in a new window]   Figure 4. Bar graph showing the dose-response relation between laminar shear stress and release of nitric oxide by cultured human umbilical vein endothelial cells. Confluent endothelial cell monolayers were incubated under laminar shear stress of 2, 8, or 12 dyne/cm2 or in static conditions in the presence of [3H]L-arginine (1 µCi/mL). Cell supernatant was collected at 6 hours to measure [3H]L-citrulline formation. Data are mean±SEM. *P<.01 vs 0 dyne/cm2 (static control).

Time Variations of Laminar Shear Stress Stimulate NO Synthesis
To verify the effects of periodic changes in shear stress on NO synthesis, confluent endothelial cells were subjected to step changes in the amplitude of shear stress from 2 to 8 dyne/cm² every 15 minutes for 6 hours. This resulted in a massive increase of NO release compared with static controls (static, 0.06±0.02 nmol/10⁵ cells [n=4]; periodic shear, 1.58±0.61 nmol/10⁵ cells [n=4]; P<.01; Fig 5A). To compare the effects of steady laminar and of periodic shear stress on NO release by HUVECs, data from single experiments were expressed as the percent increase over corresponding static controls. As shown in Fig 6, low-frequency cyclic fluctuations in shear stress caused a further significant increase of NO synthesis compared with steady shear stress of the same magnitude (P<.05). This suggests that periodic changes of flow conditions, beside shear-stress levels, are enough "per se" to influence NO production by endothelial cells.

View larger version (22K): [in this window] [in a new window]   Figure 5. Bar graphs showing the effects of time variations in shear stress on nitric oxide (NO) release by human umbilical vein endothelial cells (HUVECs). A, Cultured HUVECs were exposed to square-wave periodic shear stress (from 2 to 8 dyne/cm2 every 15 minutes [n=4]) in the presence of [3H]L-arginine (1 µCi/mL). After 6 hours, the release of [3H]L-citrulline in the supernatant was evaluated as a marker of NO synthesis. *P<.01 vs static (n=4). B, Confluent HUVEC monolayers were incubated for 6 hours under oscillating shear stress (sinusoidal variations with average shear stress of 12.4 dyne/cm2 [n=4]) or in static conditions (n=4) in the presence of [3H]L-arginine (1 µCi/mL). The formation of [3H]L-citrulline was measured after 6 hours. *P<.01 vs static. Data are mean±SEM.

View larger version (27K): [in this window] [in a new window]   Figure 6. Bar graph comparing the effect of different flow conditions (steady laminar flow, 8 dyne/cm2 [n=4]; periodic laminar flow, from 2 to 8 dyne/cm2 every 15 minutes [n=4]; and turbulent flow, from 1.2 to 11.7 [average, 8] dyne/cm2 [n=6]) on nitric oxide synthesis by cultured human umbilical vein endothelial cells versus static conditions. Cells were incubated for 6 hours in either static or flow conditions. Data are expressed as the percent increase over the static controls (mean±SEM). Stippled horizontal bar indicates the range of static controls. *P<.01 vs static; °P<.05 vs steady laminar and turbulent flows.

To verify the effects of oscillating shear stress on NO synthesis, HUVECs were exposed to oscillating shear stress (from 8.2 to 16.6 dyne/cm²; mean, 12.4 dyne/cm²; frequency, 2 Hz) for 6 hours. This condition resulted in a significant increase in NO release compared with static controls (static, 0.06±0.02 nmol/10⁵ cells [n=4]; oscillating shear, 0.51±0.07 nmol/10⁵ cells [n=4]; P<.01 versus static; Fig 5B).

Turbulent Shear Stress Does Not Affect NO Synthesis and NO Synthase Gene Expression
To assess the effect of nonuniform fluid shear stresses on NO release by vascular endothelium compared with the effect of laminar shear stress, confluent HUVEC monolayers were exposed to turbulent shear stress at an average magnitude of 8 dyne/cm² for 6 hours. Shear stress in the turbulent flow condition did not stimulate NO release by HUVECs (static, 0.23±0.09 nmol/10⁵ cells [n=6]; turbulent shear, 0.31±0.09 nmol/10⁵ cells [n=6]; Fig 7). In these series of experiments, control unsheared cells released more NO than did the control cells in laminar flow experiments (0.23±0.09 versus 0.07±0.03 nmol/10⁵ cells). This might be a consequence of the different incubation volume (turbulent flow and static control, 80 mL; laminar flow and static control, 22 mL) and the related different amounts of [³H]L-arginine (turbulent, 80 µCi; laminar, 22 µCi; specific activity, 2.5 µCi/µmol for both laminar and turbulent experiments). Besides not increasing NO release by HUVECs, turbulent flow also did not induce any upregulation of EC NOS mRNA (Fig 3). These results exclude the possibility that shear-induced NO upregulation is simply the result of culture media disturbance and indicate that EC NOS mRNA expression and NO production by HUVECs are sensitive to the magnitude and type of flow on the cell surface.

View larger version (12K): [in this window] [in a new window]   Figure 7. Bar graph showing the effect of turbulent shear stress on nitric oxide release by human umbilical vein endothelial cells (HUVECs). Confluent HUVEC monolayers were incubated for 6 hours under turbulent flow (average, 8 dyne/cm2 [n=6]) or in static conditions (n=6) in the presence of [3H]L-arginine (1 µCi/mL). The formation of [3H]L-citrulline was measured after 6 hours. Data are mean±SEM.

Both Laminar and Turbulent Shear Stress Partially Reduce ET-1 Production and Downregulate ET-1 Gene Expression
Since fluid shear stress is a major physiological regulator of the expression of the ET-1 gene, we also evaluated the effect of laminar or disturbed flow on ET-1 production and ET-1 mRNA in HUVECs. A decrease in ET-1 production, although not significant, was observed when HUVECs were subjected to laminar (steady or oscillating) and turbulent shear stress. Results, expressed as percent decrement over corresponding static controls, were as follows: steady laminar shear, 24.0±7.7% at 2 dyne/cm² (n=3), 28.0±9.7% at 8 dyne/cm² (n=4), and 5.0±3.5% at 12 dyne/cm² (n=3); oscillating shear, 35.1±13.2% (n=4); and turbulent shear, 24.0±9.8% (n=6). By contrast, periodic shear stress caused a marginal increase of ET-1 release by endothelial cells: 28.0±10.0% (n=3). As shown in Fig 8, exposure to laminar shear stress of 8 dyne/cm² caused a 51% decrease of ET-1 mRNA. Shear stress in the turbulent regimen caused a 42% downregulation of ET-1 mRNA, comparable to that resulting from exposure to laminar shear stress of the same magnitude (Fig 8).

View larger version (43K): [in this window] [in a new window]   Figure 8. Endothelin-1 gene expression in human umbilical vein endothelial cells exposed to steady laminar fluid shear stress (magnitude, 8 dyne/cm2) or turbulent shear stress (average, 8 dyne/cm2) for 6 hours. RNA was subjected to electrophoresis and blotted as described in "Materials and Methods" and then hybridized with human preproendothelin-1 cDNA (top) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, bottom). The ratio of endothelin-1 to GAPDH was calculated as previously described in Fig 3.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The present study shows that the magnitude and dynamic nature of fluid shear stress have a major influence on endothelial cell NO synthesis. Laminar shear stress dose-dependently upregulates NO synthesis by cultured endothelial cells, whereas turbulent shear stress has no effects on the NO-synthetic pathway. A different pattern was observed for ET-1, which was downregulated to much the same extent by laminar and turbulent shear stress.

Release of NO in cell supernatant required at least a 6-hour exposure of the cells to laminar shear stress. The fact that NO synthase mRNA is upregulated in endothelial cells after this interval could be taken as evidence that shear forces modulate the NO synthase gene. Recent data²⁹ showing that the endothelial cell NO synthase 5' flanking region contains a cis-acting regulatory sequence identical to the previously recognized shear-stress responsive element (SSRE)³⁵ suggest that the upregulation of NO synthase mRNA may derive from a direct effect of shear stress on NO synthase gene transcription. Other endothelial cell genes are upregulated by shear stress, including platelet-derived growth factor-B chain,³ tissue-type plasminogen activator,³⁶ and intercellular adhesion molecule-1,³⁷ all of which contain the same sequence.³⁵

The precise mechanisms by which shear stress upregulates NO synthase have to be further explored. "In vivo" studies have found that flow reorganizes endothelial cell cytoskeletal proteins by rearranging the actin microfilament network into stress fibers, which mainly align parallel to the flow direction.³⁸ It has been proposed that endothelial stress fibers may apply tension to resist the shear forces acting on the cells, thus allowing the cells to maintain their flattened phenotype and to remain firmly attached to the substratum.¹ The cytoskeleton may also serve as a second signal apparatus for transducing the biomechanical stimulus sensed by endothelial cell surface to the nucleus, which would favor transcriptional activation of NO synthase mRNA.³⁵

A recent study with HUVECs exposed to fluid flow in a parallel plate chamber³⁹ suggested a bimodal pathway of NO release by endothelial cells exposed to flow: a rapid shear level–independent and partially calcium-dependent step, which however is transient, followed by a shear-dependent production, which is sustained with time. Quite possibly, a rapid rise in shear stress, by elevating intracellular Ca²⁺, activates preformed NO-forming enzyme in vascular endothelial cells.

In our experimental conditions, the possibility of transient activation of the enzyme is consistent with the numerical increase of NO induced by a 1-hour exposure to laminar shear stress. Such transient activation is then followed by a lasting increase of NO synthesis, actually paralleled by the upregulation of NO synthase mRNA. In addition, our experiments using step changes in shear stress have indicated that rapid changes in flow conditions enhance NO release more than does steady laminar flow alone of comparable magnitude. This may have practical implications for vessel hemodynamics in vivo, since in some regions of the circulation components of slow periodicity may be induced by the combination of two main factors, the geometric arrangement of blood vessels and poorly defined fluctuations of blood pressure.²² These events are superimposed on the higher frequency pulse wave due to systolic and diastolic cycles, which "per se" stimulates NO release as documented by our experiments with pulsatile flow. Moreover, during a 24-hour period, major changes of blood flow and pulse rate occur with frequencies varying from 1 hour to several minutes.⁴⁰ Upregulation of endothelial cell NO synthesis may therefore serve to adapt local vascular tone to the modifications of shear stress characteristics after the changes in blood pressure and flow normally occurring throughout the day.

In some regions of the arterial tree, under conditions of increased flow velocity, unsteady flow patterns may develop with shear stress fluctuating in amplitude and direction.^{19 41} In our experimental conditions, disturbance of flow toward turbulence was induced by increasing the cone angle in the flow apparatus. This allowed the development of secondary flow and unsteady shear stress along the cell culture plate. As shown by the theoretical analysis of Sdougos et al,⁴² in these conditions the flow pattern is not uniform with radial position, but the flow from laminar becomes turbulent from the cone apex to the edge. We did in fact find that the transition from laminar to turbulent flow, unlike steady laminar flow of comparable magnitude, did not upregulate NO synthase mRNA and did not increase NO formation and release. This would indicate that small-scale high-frequency fluctuations in amplitude and rapid changes in direction of turbulent shear stress do not activate SSRE of the NO synthase promoter.

In contrast with the NO pathway, laminar shear stress partially reduced ET-1 mRNA and release compared with the static conditions. Since NO downregulates ET-1 gene transcription in endothelial cells,⁴³ the effect of shear stress on ET-1 might be mediated by the release of NO. However, our findings that turbulent shear stress, which does not stimulate NO synthesis, lowered endothelial ET-1 to the same degree as laminar shear stress, make this unlikely.

The patterns of response of endothelial cells to different types of fluid shear suggest that under physiological conditions of steady laminar flow, NO is continuously released while ET-1 secretion is partially depressed. By contrast, in regions where shear stress decreases toward null values, NO release is impaired, and ET-1 secretion is enhanced. This would cause local vasoconstriction and vascular remodeling of arteries as observed in response to a reduction in blood flow rate.^{12 44 45} On the other hand, if flow has rapid oscillations in magnitude and direction, endothelial cell synthesis and release of NO may be reduced, thus contributing to vasoconstriction and cell proliferation. It is tempting to speculate that the reduction of NO in response to unsteady fluid shear stress is implicated in the pathogenesis of the atherosclerotic lesion. This may explain why such lesions prevail in regions where flow conditions are unsteady.^{14 17}

Because of its potent biological properties, endothelium-derived NO has been proposed as a potential modulator of the key events in atherogenesis.⁴⁶ Besides its vasodilatory and antiproliferative effects on vascular smooth muscle cells,⁴⁷ NO also inhibits platelet adhesion and aggregation⁴⁸ and inhibits the leukocyte–endothelial cell interaction.⁴⁹ Inhibitors of NO synthesis administered to normal cats largely enhance leukocyte adhesion to venular endothelium and promote extravascular leukocyte migration.⁴⁹ However, the most convincing evidence that NO is protective against atherosclerosis is probably provided by Cooke et al,⁵⁰ who showed that the precursor of NO, L-arginine, given with the diet, almost completely prevented atherosclerotic lesions in hypercholesterolemic rabbits. Together with the above evidence, our findings suggest that constant release of NO from vascular endothelium under laminar shear stress has some physiological role in maintaining the nonthrombogenicity of the vascular wall as well as in the control of vascular cell proliferation. In regions where fluid shear stress decreases or in regions where flow is disturbed and turbulence develops, local NO production by the endothelium may be reduced or abolished, thus favoring the start of a process that eventually results in atheroma.

In conclusion, our findings indicate that production of vasoactive substances by vascular endothelial cells is related to the fluid shear stress condition experienced by the cells. The physiological condition of laminar flow induces constant release of NO and partially decreases ET-1 production, whereas when shear stress is not laminar, the balance between the production of these compounds may be greatly affected.

	Acknowledgments

 
The authors are grateful to Dr Enrico Garattini for assistance in cloning NO synthase cDNA. We also thank Dr Carla Zoja for valuable help in planning experiments and discussing results. Dr Isabella Bruzzi performed ET-1 radioimmunoassay measurements.

Received June 20, 1994; accepted December 21, 1994.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Franke RP, Grafe M, Schnittler H, Seiffge D, Mittermayer C. Induction of human vascular endothelial stress fibres by fluid shear stress. Nature. 1984;307:648-649. [Medline] [Order article via Infotrieve]
2. Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on prostacyclin production by cultured endothelial cells. Science. 1985;227:1477-1479. [Abstract/Free Full Text]
3. Hsieh HJ, Li NQ, Frangos JA. Shear stress increases endothelial platelet-derived growth factor mRNA levels. Am J Physiol. 1991;260:H642-H646. [Abstract/Free Full Text]
4. Diamond SL, Eskin SG, McIntire LV. Fluid flow stimulates tissue plasminogen activator secretion by cultured human endothelial cells. Science. 1989;243:1483-1485. [Abstract/Free Full Text]
5. Marletta MA. Nitric oxide: biosynthesis and biological significance. Trends Biochem Sci. 1989;14:488-492. [Medline] [Order article via Infotrieve]
6. Nishida K, Harrison DG, Navas JP, Fisher AA, Dockery SP, Uematsu M, Nerem RM, Alexander RW, Murphy TJ. Molecular cloning and characterization of the constitutive bovine aortic endothelial cell nitric oxide synthase. J Clin Invest. 1992;90:2092-2096.
7. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazako Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415. [Medline] [Order article via Infotrieve]
8. Rubanyi GM, Romero JC, Vanhoutte PM. Flow-induced release of endothelium relaxing factor. Am J Physiol. 1986;250:H1145-H1149. [Abstract/Free Full Text]
9. Hutcheson IR, Griffith TM. Release of endothelium-derived relaxing factor is modulated both by frequency and amplitude of pulsatile flow. Am J Physiol. 1991;261:H257-H262. [Abstract/Free Full Text]
10. Buga GM, Gold ME, Fukuto JM, Ignarro LJ. Shear stress-induced release of nitric oxide from endothelial cells grown on beads. Hypertension. 1991;17:187-193. [Abstract/Free Full Text]
11. Malek A, Izumo S. Physiological fluid shear stress causes downregulation of endothelin-1 mRNA in bovine aortic endothelium. Am J Physiol. 1992;263:C389-C396. [Abstract/Free Full Text]
12. Giddens DP, Zarins CK, Glagov S. The role of fluid mechanism in the localization and detection of atherosclerosis. J Biomech Eng. 1993;115:588-594. [Medline] [Order article via Infotrieve]
13. Roach MR. The effect of bifurcations and stenoses on arterial disease. In: Wang NH, Norrman NA, eds. Cardiovascular Flow Dynamics and Measurements. Baltimore, Md: University Park Press; 1977:489-539.
14. Zarins CK, Giddens DP, Bharadvaj BK, Sottiurai VS, Mabon RF, Glagov S. Carotid bifurcation atherosclerosis: quantitative correlation of plaque localization with flow velocity profiles and wall shear stress. Circ Res. 1983;53:502-514. [Abstract/Free Full Text]
15. Lutz RJ, Cannon JN, Bischoff KB, Dedrick RL, Stiles RK, Fry DL. Wall shear stress distribution in a model canine artery during steady flow. Circ Res. 1977;41:391-399. [Abstract/Free Full Text]
16. Motomiya M, Karino T. Flow patterns in the human carotid artery bifurcation. Stroke. 1984;15:50-56. [Abstract/Free Full Text]
17. Ku DN, Giddens DP, Philips DJ, Strandness DE. Hemodynamics of the normal human carotid bifurcation: in vitro and in vivo studies. Ultrasound Med Biol. 1985;11:13-26. [Medline] [Order article via Infotrieve]
18. Nerem RM. Hemodynamics and the vascular endothelium. J Biomech Eng. 1993;115:510-514. [Medline] [Order article via Infotrieve]
19. Davies PF, Remuzzi A, Gordon EJ, Dewey CF Jr, Gimbrone MA Jr. Turbulent fluid shear stress induces vascular endothelial cell turnover. Proc Natl Acad Sci U S A. 1986;83:2114-2117.[Abstract/Free Full Text]
20. Jaffe EA, Nach RL, Becker CG, Minik CR. Culture of human endothelial cells derived from umbilical veins. J Clin Invest. 1973;52:2745-2756.
21. Morigi M, Zoja C, Figliuzzi M, Remuzzi G, Remuzzi A. Supernatant of endothelial cells exposed to laminar flow inhibits mesangial cell proliferation. Am J Physiol. 1993;264:C1080-C1083. [Abstract/Free Full Text]
22. Davies PF, Dewey CF Jr, Bussolari SR, Gordon EJ, Gimbrone MA Jr. Influence of hemodynamic forces on vascular endothelial function: in vitro studies of shear stress and pinocytosis in bovine aortic cells. J Clin Invest. 1984;73:1121-1129.
23. Dewey CF Jr, Bussolari SR, Gimbrone MA Jr, Davies PF. The dynamic response of vascular endothelial cells to fluid shear stress. J Biomech Eng. 1981;103:177-185. [Medline] [Order article via Infotrieve]
24. Bussolari SR, Dewey CF Jr, Gimbrone MA Jr. Apparatus for subjecting living cells to fluid shear stress. Rev Sci Instrum. 1982;53:1851-1854. [Medline] [Order article via Infotrieve]
25. Malek AM, Jackman R, Rosenberg RD, Izumo S. Endothelial expression of thrombomodulin is reversibly regulated by fluid shear stress. Circ Res. 1994;74:852-860. [Abstract/Free Full Text]
26. Lamas S, Michel T, Brenner BM, Marsden PA. Nitric oxide synthesis in endothelial cells: evidence for a pathway inducible by TNF . Am J Physiol. 1991;261:C634-C641. [Abstract/Free Full Text]
27. Benigni A, Perico N, Gaspari F, Zoja C, Bellizzi L, Gabanelli M, Remuzzi G. Increased renal endothelin production in rats with reduced mass. Am J Physiol. 1991;260:F331-F339. [Abstract/Free Full Text]
28. Orisio S, Benigni A, Bruzzi I, Corna D, Perico N, Zoja C, Benatti L, Remuzzi G. Renal endothelin gene expression is increased in remnant kidney and correlates with desease progression. Kidney Int. 1993;43:354-358. [Medline] [Order article via Infotrieve]
29. Marsden PA, Heng HHQ, Scherer SW, Stewart RJ, Hall AV, Shi X, Tsui L, Schappert KT. Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene. J Biol Chem. 1993;268:17478-17488. [Abstract/Free Full Text]
30. Marsden PA, Schappert KT, Chen HS, Flowers M, Sundell CL, Wilcox JN, Lamas S, Michel T. Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett. 1992;307:287-293. [Medline] [Order article via Infotrieve]
31. Rambaldi A, Young DC, Griffin JD. Expression of the M-CSF (CSF-1) gene by human monocytes. Blood. 1987;69:1409-1413. [Abstract/Free Full Text]
32. Feinberg AP, Volgestein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13. [Medline] [Order article via Infotrieve]
33. Zoja C, Orisio S, Perico N, Benigni A, Morigi M, Benatti L, Rambaldi A, Remuzzi G. Constitutive expression of endothelin gene in cultured human mesangial cells and its modulation by transforming growth factor-ß, thrombin, and a thromboxane A2 analogue. Lab Invest. 1991;64:16-20. [Medline] [Order article via Infotrieve]
34. Forth P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res. 1985;13: 1431-1432.
35. Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF Jr, Gimbrone MA Jr. Platelet-derived growth factor ß chain promoter contains a cis-acting fluid shear-stress-responsive element. Proc Natl Acad Sci U S A. 1993;90:4591-4595. [Abstract/Free Full Text]
36. Diamond SL, Sharefkin JB, Diffenbach C, Scott KF, McIntire LV, Eskin SG. Tissue plasminogen activator messenger RNA levels increase in cultured human endothelial cells exposed to laminar shear stress. J Cell Physiol. 1990;143:364-371. [Medline] [Order article via Infotrieve]
37. Nagel T, Resnick N, Atkinson WJ, Dewey CF, Gimbrone MA Jr. Shear stress upregulates functional ICAM-1 expression in cultured vascular endothelial cells. FASEB J. 1993;7:2a. Abstract.
38. Langille BL, Graham JJK, Kim D, Gotlieb AI. Dynamics of shear-induced redistribution of F-actin in endothelial cells in vitro. Arterioscler Thromb. 1991;11:1814-1820. [Abstract/Free Full Text]
39. Kuchan MJ, Frangos JA. Role of calcium and calmodulin in flow-induced nitric oxide production in endothelial cells. Am J Physiol. 1994;266:C628-C636. [Abstract/Free Full Text]
40. Mitchell RH, Ruff SC, Murnaghan GA. Computer processing of long-term blood pressure and pulse rate variations. In: Stott FD, Raftery EB, Sleight P, Goulding L, eds. Proceedings of the 2nd International Symposium on Ambulatory Monitoring. London, England: Academic Press Inc; 1978:195-203.
41. Schalin L, Moberger G. Endothelial and vein wall response to turbulent shear stress from arteriovenous communications (AVCs). In: Liepsch D, ed. Biofluid Mechanics: Proceedings of the 3rd International Symposium. Dusseldorf, Germany: Springer-Verlag; 1994:53-65.
42. Sdougos HP, Bussolari SR, Dewey CF Jr. Secondary flow and turbulence in a cone-and-plate device. J Fluid Mech. 1984;138: 379-404.
43. Kourembanas S, McQuillan LP, Leung GK, Douglas VF. Nitric oxide regulates the expression of vasoconstrictors and growth factors by vascular endothelium under both normoxia and hypoxia. J Clin Invest. 1993;92:99-104.
44. Languille BL, O'Donnell F. Reductions in arterial diameter produced by chronic decreases in blood flow are endothelium-dependent. Science. 1986;231:405-407. [Abstract/Free Full Text]
45. Kamiya T, Togawa T. Adaptive regulation of wall shear stress to flow and change in the canine carotid artery. Am J Physiol. 1980;239:H14-H21. [Abstract/Free Full Text]
46. Simionescu M, Simionescu N. Proatherosclerotic events: pathobiochemical changes occurring in the arterial wall before monocyte migration. FASEB J. 1993;7:1359-1366. [Abstract]
47. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:1774-1777.
48. Radomsky MW, Palmer RMJ, Moncada S. An L-arginine/nitric oxide pathway present in human platelets regulates aggregation. Proc Natl Acad Sci U S A. 1990;87:5193-5197. [Abstract/Free Full Text]
49. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A. 1991;88:4651-4655. [Abstract/Free Full Text]
50. Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham ME. Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest. 1992;90:1168-1172.

This article has been cited by other articles:

				C. Ootaki, M. Yamashita, Y. Ootaki, K. Kamohara, S. Weber, R. S. Klatte, W. A. Smith, A. L. Massiello, S. N. Emancipator, L. A.R. Golding, et al. Reduced Pulsatility Induces Periarteritis in Kidney: Role of the Local Renin-Angiotensin System J. Thorac. Cardiovasc. Surg., July 1, 2008; 136(1): 150 - 158. [Abstract] [Full Text] [PDF]

				S. Lee, J.-C. Kim, Y. Li, M.-J. Son, and S.-H. Woo Fluid pressure modulates L-type Ca2+ channel via enhancement of Ca2+-induced Ca2+ release in rat ventricular myocytes Am J Physiol Cell Physiol, April 1, 2008; 294(4): C966 - C976. [Abstract] [Full Text] [PDF]

				M. H. Laughlin, S. C. Newcomer, and S. B. Bender Importance of hemodynamic forces as signals for exercise-induced changes in endothelial cell phenotype J Appl Physiol, March 1, 2008; 104(3): 588 - 600. [Abstract] [Full Text] [PDF]

				B. C. W. Groenendijk, K. Van der Heiden, B. P. Hierck, and R. E. Poelmann The Role of Shear Stress on ET-1, KLF2, and NOS-3 Expression in the Developing Cardiovascular System of Chicken Embryos in a Venous Ligation Model Physiology, December 1, 2007; 22(6): 380 - 389. [Abstract] [Full Text] [PDF]

				Y.-C. Tsai, H.-J. Hsieh, F. Liao, C.-W. Ni, Y.-J. Chao, C.-Y. Hsieh, and D. L. Wang Laminar flow attenuates interferon-induced inflammatory responses in endothelial cells Cardiovasc Res, June 1, 2007; 74(3): 497 - 505. [Abstract] [Full Text] [PDF]

				D. Saloner, G. Acevedo-Bolton, M. Wintermark, and J. H. Rapp MRI of Geometric and Compositional Features of Vulnerable Carotid Plaque Stroke, February 1, 2007; 38(2): 637 - 641. [Abstract] [Full Text] [PDF]

				K. Yayama, H. Hiyoshi, D. Imazu, and H. Okamoto Angiotensin II Stimulates Endothelial NO Synthase Phosphorylation in Thoracic Aorta of Mice With Abdominal Aortic Banding Via Type 2 Receptor Hypertension, November 1, 2006; 48(5): 958 - 964. [Abstract] [Full Text] [PDF]

				Z. Yin, Z. Wang, H. Zhu, R. Zhang, H. Wang, and X. Li Experimental Study of Effect of Fontan Circuit on Pulmonary Microcirculation Asian Cardiovasc Thorac Ann, June 1, 2006; 14(3): 183 - 188. [Abstract] [Full Text] [PDF]

				V. Gambillara, C. Chambaz, G. Montorzi, S. Roy, N. Stergiopulos, and P. Silacci Plaque-prone hemodynamics impair endothelial function in pig carotid arteries Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2320 - H2328. [Abstract] [Full Text] [PDF]

				I. A. Arenas, Y. Xu, and S. T. Davidge Age-associated impairment in vasorelaxation to fluid shear stress in the female vasculature is improved by TNF-{alpha} antagonism Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1259 - H1263. [Abstract] [Full Text] [PDF]

				F. Vargas, J. M. Moreno, I. Rodriguez-Gomez, R. Wangensteen, A. Osuna, M. Alvarez-Guerra, and J. Garcia-Estan Vascular and renal function in experimental thyroid disorders Eur. J. Endocrinol., February 1, 2006; 154(2): 197 - 212. [Abstract] [Full Text] [PDF]

				C. Reboul, S. Tanguy, A. Gibault, M. Dauzat, and P. Obert Chronic hypoxia exposure depresses aortic endothelium-dependent vasorelaxation in both sedentary and trained rats: involvement of L-arginine J Appl Physiol, September 1, 2005; 99(3): 1029 - 1035. [Abstract] [Full Text] [PDF]