This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wible, B. A. Articles by Brown, A. M. Search for Related Content PubMed PubMed Citation Articles by Wible, B. A. Articles by Brown, A. M.

(Circulation Research. 1995;76:343-350.)
© 1995 American Heart Association, Inc.

Articles

Cloning and Functional Expression of an Inwardly Rectifying K⁺ Channel From Human Atrium

Barbara A. Wible, Mariella De Biasi, Kumud Majumder, Maurizio Taglialatela, Arthur M. Brown

From the Department of Molecular Physiology and Biophysics (B.A.W., M. De B., K.M.), Baylor College of Medicine, Houston, Tex; the Department of Pharmacology "E. Meneghetti" (M. De B.), University of Padua (Italy); the Department of Human Communication Science–Section of Pharmacology (M.T.), Second School of Medicine, University of Naples (Italy); and Rammelkamp Center (A.M.B.), Metro Health System, and Department of Physiology, Case Western Reserve University, Cleveland, Ohio.

Correspondence to Dr Barbara A. Wible, Department of Molecular Physiology and Biophysics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract The cardiac inward rectifier current (I_K1) contributes to the shape and duration of the cardiac action potential and helps to set the resting membrane potential. Although several inwardly rectifying K⁺ channels (IRKs) from different tissues have been cloned recently, the nature and number of K⁺ channels contributing to the cardiac I_K1 are presently unknown. To address this issue in human heart, we have used the reverse-transcriptase–polymerase chain reaction (PCR) technique with human atrial total RNA as a template to identify two sequences expressed in heart that are homologous to previously cloned IRKs. One of the PCR products we obtained was virtually identical to IRK1 (cloned from a mouse macrophage cell line); the other, which we named hIRK, exhibited <70% identity to IRK1. A full-length clone encoding hIRK was isolated from a human atrial cDNA library and functionally expressed in Xenopus oocytes. This channel, like IRK1, exhibited strong inward rectification and was blocked by divalent cations. However, hIRK differed from IRK1 at the single-channel level: hIRK had a single-channel conductance of 36 pS compared with 21 pS for IRK1. We have identified single channels of 41, 35, 21, and 9 pS in recordings from dispersed human atrial myocytes. However, none of these atrial inward rectifiers exhibited single-channel properties exactly like those of cloned hIRK expressed in oocytes. Our findings suggest that the cardiac I_K1 in human atrial myocytes is composed of multiple inwardly rectifying channels distinguishable on the basis of single-channel conductance, each of which may be the product of a different gene.

Key Words: human cardiac myocytes • human atrium • K⁺ channels • inward rectifiers

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The human cardiac action potential is a composite of the currents generated by a variety of ion channels and electrogenic transporters. Voltage- dependent K⁺ currents are especially important in determining the duration of the action potential.¹ Among these K⁺ currents in the heart is an inwardly rectifying current (I_K1), which exhibits very little outward current on depolarization.² I_K1 helps to maintain the resting membrane potential near the equilibrium potential for K⁺ (E_K). In addition, the small amount of outward current elicited on depolarization is thought to be important in the final stages of repolarization.^{3 4 5 6 7}

An understanding of the molecular basis of the human cardiac K⁺ currents is still in its infancy. For inwardly rectifying K⁺ channels (IRKs), the recent cloning of an IRK gene from mouse macrophage,⁸ IRK1, provides a tool with which to probe the composition of IRKs in human heart. Although I_K1 has been assumed to be composed of a single type of IRK, evidence has begun to appear suggesting that I_K1 may actually be the composite of a number of different IRKs.^{9 10 11 12} Recent cloning studies have supported this suggested diversity in IRKs. IRK1 is a member of a new superfamily of K⁺ channels distinct from the voltage-gated K⁺ channels. This ever-growing family also includes ROMK1, an ATP-regulated IRK from rat kidney,¹³ GIRK1¹⁴ or KGA,¹⁵ a G protein–gated K⁺ channel from rat atrium, and rcKATP,¹⁶ an ATP-sensitive channel from rat heart. In addition, the sequences for several inward rectifiers exhibiting 60% to 70% homology to IRK1 have recently been published. These inward rectifiers fall into two groups based on proposed amino acid sequences: (1) HIR,¹⁷ HRK1,¹⁸ and hIRK2,¹⁹ which are virtually identical cDNAs independently cloned from human brain, and their mouse brain homologue, MB-IRK3,²⁰ and (2) RB-IRK2,²¹ cloned from rat brain.

IRKs consist of only two putative membrane-spanning domains, M1 and M2, in contrast to the six transmembrane segments proposed for voltage-gated K⁺ channels.²² Domains M1 and M2 are suggested to be analogous to domains S5 and S6 of the voltage-gated channels. The greatest degree of homology between the two families occurs in the putative pore region, H5, which links M1 and M2 or S5 and S6.

The availability of IRK1 led us to develop a strategy for cloning human heart IRKs on the basis of homology with the mouse clone. We identified two IRK1-like sequences expressed in human heart by reverse-transcriptase (RT)–polymerase chain reaction (PCR) by using degenerate oligonucleotides encoding portions of domains M1 and M2. The deduced amino acid sequence of one of the PCR products was virtually identical to IRK1, whereas the other exhibited <70% identity. Since the less homologous sequence might have represented a novel cardiac-specific IRK, we screened a human atrial cDNA library to isolate a full-length cDNA clone containing this sequence. This clone, hIRK, has been heterologously expressed in Xenopus oocytes and generates whole-cell currents characteristic of classic IRKs. At the single-channel level, however, the current is clearly distinct from IRK1. Furthermore, endogenous IRKs with some conductance properties similar to those found in hIRKs have been identified in single human atrial myocytes. We propose that I_K1 is composed of several IRKs, including hIRK, the first inward rectifier to be cloned from human heart. While this work was being completed, a cDNA (RB-IRK2, 98% identical to hIRK at the amino acid level) was cloned from rat brain.²¹

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Identification of IRK Sequences Expressed in Human Atrium
Specimens of right atrial appendages were obtained from the hearts of patients undergoing coronary bypass surgery. The samples were frozen in liquid nitrogen and stored at -80°C until needed. Total RNA was extracted from pooled tissue (0.5 to 1.0 g) by using RNA-Stat 60 (Tel-Test Inc) according to the manufacturer's protocol. This RNA served as the template in RT-PCR (GeneAmp RNA PCR kit, Perkin-Elmer), with degenerate oligonucleotides encoding portions of the M1 and M2 regions of mouse IRK1 used as primers. Specifically, the oligonucleotides used in the PCR were as follows: (1) M1 sense oligonucleotide, 5' TG(TC)CT(CG)GCCTTCG(CG)CT(CG)(AT)(GC)CTGGC, and (2) M2 antisense oligonucleotide, 5' CC(CG)ACGAT(GC)(TA)CTGGAA(GC)AC(GC)ACC. The base pairs in parentheses denote degenerate bases at that position. Thirty-five cycles of the following PCR program were performed with 10 pmol of each primer: 94°C, 30 seconds; 55°C, 30 seconds; and 72°C, 30 seconds. A 10-minute incubation at 72°C terminated the PCR. The resulting PCR products (250 bp) were subcloned into the pCRII vector (Invitrogen) and sequenced in both directions with the Sequenase kit (USB).

Construction and Screening of a Human Atrial cDNA Library
Poly (A)⁺ RNA was isolated from human atrial total RNA with the oligo dT-cellulose–based mRNA isolation kit (Stratagene). A mixture of oligo (dT)_12-18 primers and random hexamers [pd(N)₆] was used to prime first-strand cDNA synthesis from 6.7 µg poly (A)⁺ RNA with the TimeSaver cDNA synthesis kit (Pharmacia). Construction of the cDNA library was performed by use of the cDNA synthesis kit from Stratagene. Size fractionation of the cDNA was achieved with Sephacryl S-400 spin columns. Double-stranded cDNA (120 ng, >700 bp) was ligated to 1 µg EcoRI-calf intestinal alkaline phosphatase–treated -ZAPII vector (Stratagene). The ligation product was packaged in Gigapack II gold packaging mix (Stratagene) and resulted in a total of 4x10⁵ independent recombinant clones.

A total of 6.5x10⁴ recombinant phages from the unamplified library were screened for inward rectifier sequences by using a PCR-based library screening protocol.²³ The library was split into 64 pools of 1000 clones each and plated in 64 wells of a 96-well microtiter plate. After amplification (5 hours at 37°C), aliquots of the amplified phage were pooled in 16 tubes, representing each of the eight rows and eight columns in the grid pattern. Aliquots (1 µL) served as templates for PCR amplification using the degenerate oligonucleotides (15 pmol each) described above encoding portions of the M1 and M2 regions of mouse IRK1. Human genomic DNA (100 ng) (Clontech) was used as the positive control template for PCR and subsequent hybridization reactions. PCR was performed as described above. Aliquots of each PCR product were electrophoresed on 2% agarose/TAE gels. After ethidium bromide staining, the gels were dried and used for hybridization to an internal oligonucleotide after a modification of the protocol of Tsao et al.²⁴ DNA on the dried gel was denatured by soaking the gel in 0.5 mol/L NaOH/0.15 mol/L NaCl for 20 minutes at room temperature. Renaturation was performed for 20 minutes in 0.5 mol/L Tris-Cl (pH 8.0)/0.15 mol/L NaCl. After the gel was briefly rinsed with water, it was prehybridized for 2 hours at 53°C to 55°C in Rapid hybridization buffer (Amersham). Hybridization was carried out in the same buffer for 16 to 18 hours by using an internal oligonucleotide (5' CCCTGTGTGATCGAGGTGCACGGCTTCATG) encoding a portion of the M1 to H5 linker sequence specific to PCR 2, one of the products obtained by RT-PCR of human atrial total RNA. The oligonucleotide was end-labeled with ³²P by use of T4 polynucleotide kinase. After hybridization, the gels were washed twice for 15 minutes each with 2x standard saline citrate (SSC)/0.1% sodium dodecyl sulfate (SDS) at room temperature, followed by two washes for 30 minutes each with 0.1x SSC/0.1% SDS at the hybridization temperature. Autoradiograms of the gels were prepared by using Kodak XAR-5 film and an overnight exposure with an intensifying screen. Comparison of the band patterns on the ethidium bromide–stained gels and autoradiograms allowed the selection of one pool of phage for further screening. This positive pool of phage was subdivided and subjected to a second round of screening with this PCR-based protocol. A single positive pool was isolated from the second round. After two rounds of conventional phage screening by hybridization of the labeled oligonucleotide to plaque lifts on Hybond N membranes (Amersham), a single positive phage population was isolated. Excision of the pBluescript SK(-) plasmid from -ZAPII was performed according to Stratagene's protocol. This clone, called hIRK, contained a 1.8-kb cDNA. Complete sequencing of the clone was performed in both directions.

Northern Blot Analysis
Human atrial poly (A)⁺ RNA was isolated from right atrial appendage samples as described above. Human ventricular muscle obtained from hypertrophic hearts removed during heart transplant was the source of ventricular poly (A)⁺ RNA. Eight micrograms of each RNA was fractionated on a 1% agarose/formaldehyde gel. An aliquot of the 0.24- to 9.5-kb RNA ladder (BRL) served as the molecular size marker. The RNAs were blotted to Nytran membrane (Schleicher & Schuell) by capillary transfer. hIRK cDNA was removed from pBluescript SK(-) with EcoRI/HindIII, gel-purified, and random prime–labeled with ³²P by using the Multiprime DNA labeling system (Amersham). Hybridization was performed at 45°C overnight in Rapid hybridization buffer (Amersham) at a probe concentration of 10⁶ cpm/mL. The blot was washed twice for 10 minutes each in 2x SSC/0.1% SDS at room temperature, followed by two washes for 20 minutes each in 1x SSC/0.1% SDS at 65°C. Autoradiography was for 30 hours with Kodak BioMax MR film and an intensifying screen.

Functional Expression of hIRK and IRK1 in Xenopus Oocytes
To boost the expression of hIRK in oocytes, the hIRK cDNA was subcloned into an expression vector that contained a poly (A)⁺ tail. The expression vector, pCRII (Invitrogen) was modified to contain a portion of the 3' untranslated region, including the poly (A)⁺ tail, of the rat DRK1 gene. The modified vector is referred to as A⁺-pCR II. The coding region of hIRK was amplified by PCR to facilitate cloning into the Apa I–EcoRI sites of A⁺-pCR II. The hIRK PCR product was sequenced completely and was identical to the original clone.

cRNAs for injection into Xenopus oocytes were prepared by the use of the mMESSAGE mMACHINE kit (Ambion) with T7 RNA polymerase after linearization of the hIRK plasmid with BamHI and the IRK1 plasmid with Not I. Oocytes were injected with cRNA at concentrations of 1 to 100 ng/µL. Macroscopic currents were recorded in oocytes voltage-clamped with two intracellular microelectrodes as described previously.²⁵ External bathing solution consisted of (mmol/L) KOH 100, N-methyl-D-glucamine (NMDG) 22.5, MES 122.5, MgCl₂-6H₂O 2.0, and HEPES 10, pH 7.4. In the experiments performed in low K⁺ concentrations (2.5 mmol/L), KOH was substituted with equimolar concentrations of NMDG. No linear leakage or capacity current correction was performed. Single-channel currents were recorded from cell-attached membrane patches. Patch pipettes were filled with a solution consisting of (mmol/L) KCl 100, CaCl₂ 2.0, and HEPES 10, pH 7.4. Depolarizing bath solution consisted of (mmol/L) KCl 100, EGTA 10, and HEPES 10, pH 7.3. Recordings were digitized at 2 to 5 kHz and filtered at 1 kHz.

Electrophysiology of Dispersed Human Atrial Myocytes
Human myocytes were obtained from specimens of right atrial appendage obtained from patients undergoing cardiopulmonary bypass. The isolation procedure was similar to that described in Wang et al,²⁶ which was based on an earlier method by Escande et al.²⁷ Samples were immersed in a cardioplegic solution consisting of (mmol/L) KH₂PO₄ 50, MgSO₄ 8.0, NaHCO₃ 10, adenosine 5.0, taurine 5.0, glucose 140, and mannitol 100, titrated to a pH of 7.4, and bubbled with O₂ (100%) at 0°C to 4°C. Specimens were minced into 0.5- to 1-mm cubes and transferred to a 50-mL conical tube containing an ultra–low calcium wash consisting of (mmol/L) NaCl 135, KH₂PO₄ 5.0, MgSO₄ 1.0, taurine 10, glucose 10, HEPES 5.0, and EGTA 100, pH 7.4 (22°C to 24°C). The tissue was gently agitated by continuous bubbling with O₂ (100%) for 5 minutes, then incubated in 5 mL of a solution containing (mmol/L) NaCl 135, KH₂PO₄ 5.0, MgSO₄ 1.0, taurine 10, glucose 10, and HEPES 5.0, supplemented with 0.1% bovine albumin, 2.2 mg/mL collagenase type V, and 1.0 mg/mL protease type XXIV (Sigma Chemical Co), pH 7.4 (37°C), and bubbled continuously with O₂ (100%). The supernatant was removed after 40 minutes and discarded. The chunks were then incubated in a solution of the same ionic composition but supplemented with only collagenase and 100 µmol/L CaCl₂. The cell suspension was centrifuged at low speed for 2 minutes, and the resulting pellet was resuspended in a modified Kraftbrühe solution containing (mmol/L) KCl 25, KH₂PO₄ 10, taurine 25, EGTA 0.5, glucose 22, and glutamic acid 55, along with 0.1% human albumin, pH 7.3 (22°C to 24°C). In general, the isolation procedure produced an initial yield of 40% to 60% spindle-shaped calcium-tolerant cells. Myocytes were used within 8 to 10 hours after isolation. Only quiescent rod-shaped myocytes showing clear cross striations were used for recording. Single-channel currents were recorded from cell-attached patches at room temperature (23°C to 25°C). Patch pipettes were filled with a solution consisting of (mmol/L) KCl 140, MgCl₂-6H₂O 2, and HEPES 10, pH 7.4. The bath solution contained (mmol/L) KCl 140, EGTA 10, and HEPES 10, pH 7.3. The current tracings were stored by using a videotape recorder (JVC HR-D360U) and a digital adaptor (PCM-1, Medical System Corp). The currents were replayed through an eight-pole Bessel filter and digitized at 5 kHz. Recordings were low-pass–filtered at 1 kHz.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of hIRK, a Human Inward Rectifier K⁺ Channel
To determine whether IRK-like sequences are expressed in human atrium, RT-PCR of total human atrial RNA was performed by using degenerate oligonucleotides encoding portions of the M1 and M2 regions of IRK1, an inward rectifier gene cloned from mouse macrophage. Two PCR products of 250 bp that spanned the putative pore (H5 region) of the cDNA were obtained (Fig 1). The predicted amino acid sequence of each of the PCR products revealed extensive homology to IRK1: one of them, PCR 1, was 94% identical to IRK1, whereas the other, PCR 2, differed substantially (only 64% identical to IRK1). These results suggest that at least two IRK-like sequences are expressed in human atrium. Because of the high degree of homology between IRK1 and PCR 1, it is likely that PCR 1 constitutes a portion of the human homologue of IRK1. The functional properties of IRK1 have been the focus of extensive analysis.^{8 28} Initially, therefore, we were more interested in obtaining a full-length cDNA clone containing the less homologous sequence, PCR 2, and analyzing the functional properties of the expressed channel.

View larger version (8K): [in this window] [in a new window]   Figure 1. Alignment of an inwardly rectifying K+ channel cloned from a mouse macrophage cell line (IRK1) with the deduced amino acid sequences of the reverse-transcriptase (RT)–polymerase chain reaction (PCR) products from human atrial total RNA. RT-PCR was performed on human atrial total RNA by using degenerate oligonucleotides encoding portions of the M1 and M2 domains of IRK1. The nucleotide sequence of the PCR products was determined, and the sequence was translated in three reading frames. In each case, the open reading frame exhibiting significant homology to IRK1 is shown here.

To isolate a full-length clone containing the PCR 2 sequence, we constructed a cDNA library from human atrial poly (A)⁺ RNA. By use of a combination of PCR-based and conventional plaque-hybridization library screening techniques, a 1.8-kb clone was obtained, which contained the entire PCR 2 sequence (Fig 2A). This clone, hIRK, encompasses a 1.3-kb open reading frame, which spans the PCR 2 sequence in the correct reading frame. The initiating methionine was chosen by homology with IRK1 (see Fig 2B), since in the 54 bases of upstream cDNA sequence in the hIRK clone, there was no in-frame stop codon. hIRK encodes a protein of 432 amino acids and exhibits significant homology with other IRKs (Fig 2B). RB-IRK2, an inward rectifier cloned from rat brain,²¹ is 98% identical to hIRK at the amino acid level and most likely represents the rat homologue of hIRK. Most of the sequence differences between these two channels reside in the carboxyl terminus. RB-IRK2 has also been proposed to be initiated at the same methionine residue as hIRK. hIRK shares 70% identity with IRK1 and 62% identity with HIR, an inward rectifier cloned from human hippocampus.¹⁷ By contrast, hIRK is only 39% identical to ROMK1, an IRK cloned from rat kidney outer medulla.¹³ GIRK1, a G protein–coupled muscarinic IRK cloned from rat atrium,¹⁴ with a total of 501 amino acids, has an additional extension of 69 amino acids in the carboxyl terminus relative to hIRK. Over the initial 432 amino acids, however, the two channels are 53% identical. Finally, hIRK shares 44% identity with the recently cloned hcK_ATP, the human cardiac ATP-sensitive K⁺ channel.¹⁶

View larger version (60K): [in this window] [in a new window]   Figure 2. Primary structure of the inward rectifier K+ channel from a human atrial cDNA library (hIRK). A, Nucleotide and deduced amino acid sequence of hIRK. The proposed transmembrane domains M1 and M2 and the putative pore H5 are indicated. There are four potential phosphorylation sites for protein kinase C (T38, S64, T353, and S357), one for protein kinase A (S430), and one for tyrosine kinase (Y243). The sequence has been submitted to GenBank (accession No. L36069). B, Peptide sequence alignments of hIRK with other cloned inward rectifying K+ channels (IRKs). The deduced primary amino sequence (single-letter code) of hIRK is compared with RB-IRK2 (cloned from rat brain), IRK1 (cloned from a mouse macrophage cell line), HIR (cloned from human hippocampus), ROMK1 (an ATP-regulated IRK from rat kidney), GIRK1 (a G protein–gated K+ channel from rat atrium), and hcKATP (the human cardiac ATP-sensitive K+ channel). Residues identical to hIRK are noted with a colon; gaps introduced to improve the alignment are marked with a hyphen. The two putative transmembrane domains M1 and M2 and the putative pore region, H5, are indicated.

Northern blot analysis (Fig 3) shows that hIRK is expressed in both human atrium and ventricle. In both tissues, two RNA bands of 6.0 and 3.1 kb hybridized to the ³²P-labeled hIRK cDNA.

View larger version (43K): [in this window] [in a new window]   Figure 3. Expression of a human inward rectifier K+ channel (hIRK) in atrium and ventricle. Northern blot analysis was performed on total RNA prepared from adult human ventricle (lane A) and atrium (lane B). RNA molecular size markers are indicated on the right side of the figure. The arrow points to the position of the sample wells. Two RNA bands of 6.0 and 3.1 kb hybridize to hIRK cDNA in both tissues.

Heterologous Expression of hIRK
When hIRK cRNA is heterologously expressed in Xenopus oocytes, the channel exhibits properties characteristic of an IRK. Fig 4A shows two microelectrode voltage-clamp recordings from oocytes injected with mRNA encoding hIRK. Channel activity was recorded in 2.5 mmol/L (left) and 100 mmol/L (right) external K⁺ by stepping from a holding potential of -40 mV to various test potentials in 10-mV steps. Large inward currents, especially pronounced in 100 mmol/L K⁺, are seen at voltages below E_K, with virtually no outward currents detectable at depolarized potentials. The current-voltage plot of the whole-cell currents recorded at test potentials between -130 mV and +20 mV shows the strong inwardly rectifying behavior of hIRK (Fig 4B).

View larger version (27K): [in this window] [in a new window]   Figure 4. Heterologous expression of an inward rectifier K+ channel from a human atrial cDNA library (hIRK) and an inwardly rectifying K+ channel cloned from a mouse macrophage cell line (IRK1) in Xenopus oocytes. A, Whole-cell currents recorded under two microelectrode voltage clamps. The bath solution contained 2.5 mmol/L K+ (left) or 100 mmol/L K+ (right). The holding potential was -40 mV. Currents obtained with 10-mV steps from -130 to +20 mV are shown. The dotted line indicates the 0-mV potential. B, Current-voltage (I-V) curves of data shown in panel A. Current amplitudes just after the capacitive transient were plotted against the test potential. C, hIRK currents recorded under control conditions and in the presence of 30 µmol/L Ba2+. K+ (100 mmol/L) was present in the bathing solution. Test potentials from -120 to +40 mV, in 20-mV steps, were delivered from a holding potential of -60 mV. No linear subtraction of the capacitance artifact and the leak currents was performed. The dotted line indicates the 0-mV potential. D, hIRK macroscopic I-V curves obtained under control conditions () and in the presence of Ba2+ concentrations ranging from 3 to 100 µmol/L (3 µmol/L [], 10 µmol/L [], 30 µmol/L [], 100 µmol/L [], and washout []). E, Single channels recorded in the cell-attached configuration from oocytes injected with cRNA encoding hIRK (left) and IRK1 (right). Recordings were obtained in isotonic K+ (100 mmol/L), and data were low-pass–filtered at 1 kHz. The open-channel noise is typically larger for IRK1. F, I-V plots of single-channel currents from IRK1 () and hIRK () recorded in 100 mmol/L K+ in the pipette and hIRK () in 140 mmol/L K+. Em indicates membrane potential.

hIRK, like other inward rectifier channels, is susceptible to the block by divalent cations like Ba²⁺.^{29 30} Fig 4C shows an example of whole-oocyte currents recorded under control conditions (left) and in the presence of 30 µmol/L Ba²⁺ (right). The block by Ba²⁺ was both voltage and time dependent, as the current-voltage curves obtained in the presence of Ba²⁺ ranging from 3 to 100 µmol/L show (Fig 4D). The K_d for external Ba²⁺ calculated at the end of a pulse to -60 mV was 19.6±10.5 µmol/L (n=3) for hIRK compared with 15.4±3 µmol/L (n=10) for IRK1. These values were not significantly different (P>.05).

At the whole-cell level, expression of hIRK in oocytes resembles IRK1 in having strong inward rectification and strong block by external divalent cations. Since the two channels differ significantly in primary amino acid sequence, we sought to distinguish hIRK and IRK1 at the single-channel level. Fig 4E (left) shows typical single-channel recordings from hIRKs expressed in oocytes at potentials from -60 to -120 mV in iso-K⁺ (100 mmol/L) conditions. The right panel illustrates currents from IRK1 single channels obtained under the same experimental conditions. Examination of the tracings revealed differences in single-channel amplitude between the two inward rectifiers. The slope conductance calculated from the single-channel current-voltage curves (Fig 4F) recorded with 100 mmol/L K⁺ in the pipette was 36.1±0.6 pS (n=10) for hIRK compared with 21.0±0.6 pS (n=4) for IRK1. To facilitate the comparison of hIRK with native atrial channels, experiments were also performed with 140 mmol/L K⁺ in the pipette. Under these conditions, the slope conductance of hIRK increased to 41.3±1.2 pS (n=8).

The mean open times of hIRK and IRK1 were also different. At 1-kHz recording bandwidth, the mean open times were 35.7±5.8 (n=8) and 140.0±40.0 (n=5) milliseconds for hIRK and IRK1, respectively.

IRKs in Human Atrial Myocytes
Given the difference in amplitude between the single-channel currents of hIRK and IRK1, we examined dispersed human atrial myocytes for single-channel currents that resembled those expressed from cloned hIRK. Inward single-channel K⁺ currents were recorded from single myocytes at room temperature over a range of test potentials in 140 mmol/L K⁺. Four types of single-channel currents with amplitude levels of -1.0, -2.2, -3.2, and -4.2 pA were detected at -100 mV (Fig 5A). When recorded over a wider range of potentials (-40 to -120 mV), the four channels had slope conductances of 8.9±2.3 (n=4), 20.9±3.9 (n=6), 34.8±2 (n=5), and 41.1±2.8 (n=3 to 7) pS. The four endogenous atrial channels also showed different gating properties. The 41-, 35-, and 9-pS channels had much shorter mean open times, at least 50-fold, than the 21-pS channel.

View larger version (22K): [in this window] [in a new window]   Figure 5. Different classes of inward rectifier channels in adult human atrial myocytes. A, Single-channel recordings from a human atrial myocyte. Single-channel currents were recorded from cell-attached patches in isotonic K+(140 mmol/L) at -100 mV and low-pass–filtered at 1 kHz. Four distinct channels of different amplitude could be distinguished in this patch. The arrows indicate the zero current level, and the dotted lines indicate the corresponding current amplitudes of -1, -2, -3, and -4 pA. B, Current (I)–voltage (Em [membrane potential]) plots of endogenous cardiac channels of 10-pS (), 21-pS (), 35-pS (), and 41-pS () single-channel conductance. Each point is the mean of four to eight patches, each corresponding to a different myocyte. The mean±SEM is visible when larger than the symbol.

Of the endogenous atrial channels, the 21-pS channel was observed most frequently. In patches recorded from 13 myocytes, this channel was present in 77% of the patches and appeared in 33.4±11% of the sweeps. The 35-pS channel was observed in 60% of the patches and 6.4±0.7% of the sweeps. The 41-pS channel appeared in 36% of the patches and in 5.8±1.6% of the sweeps. Of the four inward rectifiers, the 9-pS channel was the most rare: it was seen in only 4% of the patches and 9.0±3.7% of the sweeps.

Based only on single-channel conductance, hIRK most closely resembles the 41-pS endogenous channel when both oocyte and myocyte recordings are performed with 140 mmol/L K⁺ in the pipette. However, another cardiac channel, IK_ACh, has also been reported to have a similar conductance,^{31 32} and the 41-pS channels we observe may result in part from rare openings of IK_ACh in the absence of agonist.³³ To investigate the nature of the 41-pS channel in our preparations, we performed experiments in the presence of carbachol (10 µmol/L) to activate IK_ACh (data not shown). The carbachol-activated channel had a slope conductance of 45.1±1.1 pS (n=10) and a mean open time of 2.0±0.2 milliseconds (n=10). Although the two conductance values do not differ significantly, the mean open time for IK_ACh was significantly different from that of the 41-pS endogenous channel in the absence of carbachol (5.0±1.0 milliseconds, n=6, P<.01). Therefore, two separate channels (one ACh-activated and one ACh-independent channel) may be represented in the 41-pS conductance class. Although it is tempting to speculate that hIRK contributes to one of the 41-pS endogenous channels that we have described, a definitive correlation cannot be made because of the differences in the gating properties observed in the oocyte versus myocyte.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We describe the cloning and functional expression of an IRK from human atrium, hIRK. The primary sequence of hIRK classifies it as a member of the superfamily of IRKs. hIRK is most closely related to RB-IRK2,²¹ an inward rectifier cloned from rat brain (98% identical at the amino acid level), although it shares 70% identity over the entire amino acid sequence with IRK1, cloned from a mouse macrophage cell line.⁸ hIRK is also 64% identical to HIR,¹⁷ an inward rectifier cloned from human brain. By contrast hIRK is only 39% identical to ROMK1,¹³ an ATP-regulated IRK cloned from rat kidney, and 44% identical to the recently cloned human cardiac ATP-sensitive K⁺ channel, hcK_ATP.¹⁶ Although significantly longer than hIRK, GIRK1, cloned from rat heart and likely to encode the atrial muscarinic G protein–gated K⁺ channel,¹⁴ exhibits 53% identity with hIRK over the first 432 amino acids of primary sequence.

Upon heterologous expression in Xenopus oocytes, hIRK exhibits whole-oocyte currents more like IRK1 than ROMK1 or GIRK1. Thus, there is strong inward rectification and high-affinity block by external Ba²⁺. These properties are also characteristic of both RB-IRK2 and HIR. This is in contrast to ROMK1, which shows weaker inward rectification and 10-fold lower affinity block by Ba²⁺.^{14 28} Despite these similarities at the whole-cell level, hIRK differs from IRK1 at the single-channel level in having a significantly larger single-channel conductance (36 pS in 100 mmol/L K⁺ versus 21 pS for IRK1). With 140 mmol/L K⁺ in the patch pipette, the single-channel conductance of hIRK increases to 41 pS. The single-channel properties of hIRK also differ clearly from those of ROMK1¹³ and GIRK1.¹⁴ No information on the single-channel conductance of RB-IRK2 has been reported.

Through single-channel recordings of IRKs from dispersed human atrial myocytes, we have identified four distinct channels with single-channel K⁺ conductances of 9, 21, 35, and 41 pS with 140 mmol/L K⁺ in the patch pipette. The existence in atrial myocytes of a channel with a slope conductance comparable to hIRK expressed in oocytes might suggest that hIRK is responsible for the 41-pS endogenous channel. However, IK_ACh recorded with carbachol (10 µmol/L) in the pipette has a slope conductance of 45 pS, which is not significantly different from the endogenous 41-pS channel recorded in the absence of agonist. Thus, perhaps more than one atrial channel has a 41-pS conductance under our experimental conditions. If the gene product of hIRK contributes to a 41-pS atrial channel, then the basis for the difference in mean open times between native myocytes and oocytes is presently unclear. However, it is known that a heterologous expression system can affect the kinetics of expressed channels. For example, differences in the steady state activation and inactivation kinetics of Kv1.5 expressed in HEK versus mouse L cells have been described.³⁴ Also, in the case of Na⁺ channels, expression in Xenopus oocytes results in modified inactivation kinetics relative to the currents seen in mammalian expression systems.³⁵

In addition to the 41-pS channel, we have observed another channel of 21 pS in atrial myocytes. Previous studies have identified a 27-pS inward rectifier channel in human atrial myocytes³¹ that may correspond to the 21-pS channel recorded in our experiments. Using RT-PCR of human atrial total RNA, we have shown that in addition to hIRK, another IRK-like sequence is also expressed in human heart. We have obtained a nearly full-length clone from a human atrial cDNA library containing this sequence and found that it is >95% identical to IRK1. A cDNA 97% identical to IRK1 at the amino acid level has also recently been cloned from rabbit heart.³⁶ If the conductance of this cloned channel is similar to IRK1 (21 pS), then it is likely to be the one responsible for the 21-pS endogenous conductance in human atrial myocytes.

We have also observed a smaller (9-pS) channel that is probably generated by yet a third distinct cDNA. Three recent reports have described the independent cloning of the same inward rectifier from human brain: HRK1,¹⁸ HIR,¹⁷ and hIRK2.¹⁹ HRK1 was shown to have a 10-pS single-channel conductance upon heterologous expression in Xenopus oocytes.¹⁸ We have obtained a partial cDNA clone from a human fetal heart cDNA library that is identical to HRK1, so it is likely that this cDNA is also expressed in cardiomyocytes. Furthermore, Northern blots have shown the expression of HIR¹⁷ and hIRK2¹⁹ in human heart as well as brain. At the present time, there is no indication of the molecular nature of the 35-pS channel recorded in our experiments.

Northern blot experiments demonstrate that hIRK is expressed in both the atrium and ventricle of the adult human heart. However, hIRK expression may not be limited to the heart. Northern blots show the expression of the homologous rat channel, RB-IRK2, to be highest in the cerebellum, although it was also expressed in forebrain, skeletal muscle, kidney, uterus, and heart (both atrium and ventricle).

Multiple inward rectifier channels with different conductances have been described in the hearts of other species, including rat, rabbit, and chick,^{9 10 11 12} in which the composition of IRKs has been shown to change during cardiac development. Therefore, the data from animal models supports the diversity of IRKs that we have observed in human atrium. At present, the significance of multiple IRKs for cardiac function remains to be elucidated.

In human heart, the actual contribution of the 41-, 35-, 21-, and 9-pS channels to physiological I_K1 currents remains to be determined. Perhaps each IRK is subject to differential modulation and thus contributes differently to repolarization and maintenance of the resting potential. The function of each of these channels might also differ according to the pathological state of the myocyte. Thus, the analysis of individual IRKs constituting I_K1 in both normal and pathological tissues should bring new insights into the mechanisms underlying the cardiac action potential and may allow for the development of new therapeutic approaches to cardiac dysfunction.

View larger version (78K): [in this window] [in a new window]   Figure 2B.

	Acknowledgments

 
This study was supported by grant HL-37044–Project 2 to Dr Wible, grants HL-37044–Project 4 and HL-36930 to Dr Brown, and a grant from the American Heart Association, Texas Affiliate, Inc (94G218) to Dr Taglialatela.

Received May 23, 1994; accepted December 21, 1994.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Hume JR, Uehara A, Hadley RW, Harvey RD. Comparison of K⁺ channels in mammalian atrial and ventricular myocytes. Prog Clin Biol Res. 1990;334:17-41. [Medline] [Order article via Infotrieve]

2. Coraboeuf E, Nargeot J. Electrophysiology of human cardiac cells. Cardiovasc Res. 1193;27:1713-1725. [Free Full Text]

3. Carmeliet E. Mechanisms and control of repolarization. Eur Heart J. 1993;14(suppl H):3-13.

4. Shimoni Y, Clark RB, Giles WR. Role of inwardly rectifying potassium current in rabbit ventricular action potential. J Physiol (Lond). 1992;448:709-728. [Abstract/Free Full Text]

5. Anumonwo JMB, Freeman LC, Kwok WM, Kass RS. Potassium channels in the heart: electrophysiology and pharmacological regulation. Cardiovasc Drug Rev. 1991;9:299-316.

6. Ten Eick RE, Whalley DW, Rasmussen HH. Connections: heart disease, cellular electrophysiology, and ion channels. FASEB J. 1992;6:2568-2580. [Abstract]

7. Martin CL, Chinn K. Contribution of delayed rectifier and inward rectifier to repolarization of the action potential: pharmacological separation. J Cardiovasc Pharmacol. 1992;19:830-837. [Medline] [Order article via Infotrieve]

8. Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional expression of a mouse inward rectifier potassium channel. Nature. 1993;362:127-133. [Medline] [Order article via Infotrieve]

9. Chen F, Wetzel GT, Friedman WF, Klitzner TS. Single-channel recording of inwardly rectifying potassium currents in developing myocardium. J Mol Cell Cardiol. 1991;23:259-267. [Medline] [Order article via Infotrieve]

10. Josephson IR, Sperelakis N. Developmental increases in the inwardly-rectifying K⁺ current of embryonic chick ventricular myocytes. Biochim Biophys Acta. 1990;1052:123-127. [Medline] [Order article via Infotrieve]

11. Wahler GM. Developmental increases in the inwardly rectifying potassium current of rat ventricular myocytes. Am J Physiol. 1992;262:C1266-C1272. [Abstract/Free Full Text]

12. Masuda H, Sperelakis N. Inwardly rectifying potassium current in rat fetal and neonatal ventricular cardiomyocytes. Am J Physiol. 1993;265:H1107-H1111. [Abstract/Free Full Text]

13. Ho K, Nichols CG, Lederer WJ, Lytton J, Vassilev PM, Kanazirska MV, Hebert SC. Cloning and expression of an inwardly rectifying ATP-regulated potassium channel. Nature. 1993;362:31-38. [Medline] [Order article via Infotrieve]

14. Kubo Y, Reuveny E, Slesinger PA, Jan YN, Jan LY. Primary structure and functional expression of a rat G-protein-coupled muscarinic potassium channel. Nature. 1993;364:802-806. [Medline] [Order article via Infotrieve]

15. Dascal N, Schreibmayer W, Lim NF, Wang W, Chavkin C, DiMagno L, Labarca C, Kieffer BL, Gaveriaux-Ruff C, Trollinger D, Lester HA, Davidson N. Atrial G protein-activated K⁺ channel: expression cloning and molecular properties. Proc Natl Acad Sci U S A. 1993;90:10235-10239. [Abstract/Free Full Text]

16. Ashford MLJ, Bond CT, Blair TA, Adelman JP. Cloning and functional expression of a rat heart K_ATP channel. Nature. 1994;370:456-459. [Medline] [Order article via Infotrieve]

17. Perier F, Radeke CM, Vandenberg CA. Primary structure and characterization of a small-conductance inwardly rectifying potassium channel from human hippocampus. Proc Natl Acad Sci U S A. 1994;91:6240-6244. [Abstract/Free Full Text]

18. Makhina EN, Kelly AJ, Lopatin AN, Mercer RW, Nichols CG. Cloning and expression of a novel human brain inward rectifier potassium channel. J Biol Chem. 1994;269:20468-20474. [Abstract/Free Full Text]

19. Tang W, Yang X-C. Cloning a novel human brain inward rectifier potassium channel and its functional expression in Xenopus oocytes. FEBS Lett. 1994;348:239-243. [Medline] [Order article via Infotrieve]

20. Morishige K-I, Takahashi N, Jahangir A, Yamada M, Koyama H, Zanelli JS, Kurachi Y. Molecular cloning and functional expression of a novel brain-specific inward rectifier potassium channel. FEBS Lett. 1994;346:251-256. [Medline] [Order article via Infotrieve]

21. Koyama H, Morishige KI, Takahashi N, Zanelli JS, Fass DN, Kurachi Y. Molecular cloning, functional expression and localization of a novel inward rectifier potassium channel in the rat brain. FEBS Lett. 1994;341:303-307. [Medline] [Order article via Infotrieve]

22. Nichols CG. The `inner core' of inwardly rectifying K⁺ channels. Trends Pharmacol Sci. 1993;14:320-323. [Medline] [Order article via Infotrieve]

23. Israel D. A PCR-based method for high stringency screening of DNA libraries. Nucleic Acids Res. 1993;21:2627-2631. [Abstract/Free Full Text]

24. Tsao SGS, Brunk CF, Pearlman RE. Hybridization of nucleic acids directly in agarose gels. Anal Biochem. 1983;131:365-372. [Medline] [Order article via Infotrieve]

25. Kirsch GE, Drewe JA, Hartmann HA, Taglialatela M, DeBiasi M, Brown AM, Joho RH. Differences between the deep pores of K⁺ channels determined by an interacting pair of nonpolar amino acids. Neuron. 1992;8:499-505. [Medline] [Order article via Infotrieve]

26. Wang Z, Fermini B, Nattel S. Sustained depolarization-induced outward current in human atrial myocytes: evidence for a novel delayed rectifier K⁺ current similar to Kv1.5 cloned channel currents. Circ Res. 1993;73:1061-1076. [Abstract/Free Full Text]

27. Escande D, Coulombe A, Faivre JF, Deroubaix E, Coraboeuf E. Two types of transient outward currents in adult human atrial cells. Am J Physiol. 1987;252:H142-H148. [Abstract/Free Full Text]

28. Taglialatela M, Wible BA, Caporaso R, Brown AM. Specification of pore properties by the carboxyl terminus of inwardly rectifying K⁺ channels. Science. 1994;264:844-847. [Abstract/Free Full Text]

29. Standen NB, Stanfield PR. A potential- and time-dependent blockade of inward rectification in frog skeletal muscle by barium and strontium ions. J Physiol (Lond). 1978;280:160-191.

30. Hille B. Ionic Channels of Excitable Membranes. 2nd ed. Sunderland, Mass: Sinauer; 1992:chap 5.

31. Heidbüchel H, Vereecke J, Carmeliet E. Three different potassium channels in human atrium: contribution to the basal potassium conductance. Circ Res. 1990;66:1277-1286. [Abstract/Free Full Text]

32. Okabe K, Yatani A, Brown AM. The nature and origin of spontaneous noise in G protein-gated ion channels. J Gen Physiol. 1991;97:1279-93. [Abstract/Free Full Text]

33. Sato R, Hisatome I, Wasserstrom JA, Arentzen CE, Singer DH. Acetylcholine-sensitive potassium channels in human atrial myocytes. Am J Physiol. 1990;259:H1730-H1735. [Abstract/Free Full Text]

34. Wible BA, Fedida D, Brown AM. Expression system affects the steady-state kinetics of human K⁺ channel Kv1.5. Biophys J. 1994;66:A108. Abstract.

35. Ukomadu C, Zhou J, Sigworth FJ, Agnew WS. µ1 Na⁺ channels expressed transiently in human embryonic kidney cells: biochemical and biophysical properties. Neuron. 1992:8:663-676.

36. Ishii K, Yamagishi T, Taira N. Cloning and functional expression of a cardiac inward rectifier K⁺ channel. FEBS Lett. 1994;338:107-111. [Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				A. L. Vega, D. J. Tester, M. J. Ackerman, and J. C. Makielski Protein Kinase A-Dependent Biophysical Phenotype for V227F-KCNJ2 Mutation in Catecholaminergic Polymorphic Ventricular Tachycardia Circ Arrhythm Electrophysiol, October 1, 2009; 2(5): 540 - 547. [Abstract] [Full Text] [PDF]

				S. Tikku, Y. Epshtein, H. Collins, A. J. Travis, G. H. Rothblat, and I. Levitan Relationship between Kir2.1/Kir2.3 activity and their distributions between cholesterol-rich and cholesterol-poor membrane domains Am J Physiol Cell Physiol, July 1, 2007; 293(1): C440 - C450. [Abstract] [Full Text] [PDF]

				S. Rajamani, C. L. Anderson, C. R. Valdivia, L. L. Eckhardt, J. D. Foell, G. A. Robertson, T. J. Kamp, J. C. Makielski, B. D. Anson, and C. T. January Specific serine proteases selectively damage KCNH2 (hERG1) potassium channels and IKr Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1278 - H1288. [Abstract] [Full Text] [PDF]

				D.-H. Yan, K. Nishimura, K. Yoshida, K. Nakahira, T. Ehara, K. Igarashi, and K. Ishihara Different intracellular polyamine concentrations underlie the difference in the inward rectifier K+ currents in atria and ventricles of the guinea-pig heart J. Physiol., March 15, 2005; 563(3): 713 - 724. [Abstract] [Full Text] [PDF]

				E. Zitron, C. Kiesecker, S. Luck, S. Kathofer, D. Thomas, V. A.W Kreye, J. Kiehn, H. A Katus, W. Schoels, and C. A Karle Human cardiac inwardly rectifying current IKir2.2 is upregulated by activation of protein kinase A Cardiovasc Res, August 15, 2004; 63(3): 520 - 527. [Abstract] [Full Text] [PDF]

				J. Tamargo, R. Caballero, R. Gomez, C. Valenzuela, and E. Delpon Pharmacology of cardiac potassium channels Cardiovasc Res, April 1, 2004; 62(1): 9 - 33. [Abstract] [Full Text] [PDF]

				P. S. Lange, F. Er, N. Gassanov, and U. C. Hoppe Andersen mutations of KCNJ2 suppress the native inward rectifier current IK1 in a dominant-negative fashion Cardiovasc Res, August 1, 2003; 59(2): 321 - 327. [Abstract] [Full Text] [PDF]

				G. Schram, M. Pourrier, Z. Wang, M. White, and S. Nattel Barium block of Kir2 and human cardiac inward rectifier currents: evidence for subunit-heteromeric contribution to native currents Cardiovasc Res, August 1, 2003; 59(2): 328 - 338. [Abstract] [Full Text] [PDF]

				C. Zobel, H. C. Cho, T.-T. Nguyen, R. Pekhletski, R. J Diaz, G. J Wilson, and P. H Backx Molecular dissection of the inward rectifier potassium current (IK1) in rabbit cardiomyocytes: evidence for heteromeric co-assembly of Kir2.1 and Kir2.2 J. Physiol., July 15, 2003; 550(2): 365 - 372. [Abstract] [Full Text] [PDF]

				G. Schram, P. Melnyk, M. Pourrier, Z. Wang, and S. Nattel Kir2.4 and Kir2.1 K+ channel subunits co-assemble: a potential new contributor to inward rectifier current heterogeneity J. Physiol., October 15, 2002; 544(2): 337 - 349. [Abstract] [Full Text] [PDF]

				C. A. Karle, E. Zitron, W. Zhang, G. Wendt-Nordahl, S. Kathofer, D. Thomas, B. Gut, E. Scholz, C.-F. Vahl, H. A. Katus, et al. Human Cardiac Inwardly-Rectifying K+ Channel Kir2.1b Is Inhibited by Direct Protein Kinase C-Dependent Regulation in Human Isolated Cardiomyocytes and in an Expression System Circulation, September 17, 2002; 106(12): 1493 - 1499. [Abstract] [Full Text] [PDF]

				P. Melnyk, L. Zhang, A. Shrier, and S. Nattel Differential distribution of Kir2.1 and Kir2.3 subunits in canine atrium and ventricle Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1123 - H1133. [Abstract] [Full Text] [PDF]

				R. Preisig-Muller, G. Schlichthorl, T. Goerge, S. Heinen, A. Bruggemann, S. Rajan, C. Derst, R. W. Veh, and J. Daut Heteromerization of Kir2.x potassium channels contributes to the phenotype of Andersen's syndrome PNAS, May 28, 2002; 99(11): 7774 - 7779. [Abstract] [Full Text] [PDF]

				E. D. Michelakis, E. K. Weir, X. Wu, A. Nsair, R. Waite, K. Hashimoto, L. Puttagunta, H. G. Knaus, and S. L. Archer Potassium channels regulate tone in rat pulmonary veins Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1138 - L1147. [Abstract] [Full Text] [PDF]

				J. Fischer-Lougheed, J.-H. Liu, E. Espinos, D. Mordasini, C. R. Bader, D. Belin, and L. Bernheim Human Myoblast Fusion Requires Expression of Functional Inward Rectifier Kir2.1 Channels J. Cell Biol., May 14, 2001; 153(4): 677 - 686. [Abstract] [Full Text] [PDF]

				G. Xin Liu, C. Derst, G. Schlichthorl, S. Heinen, G. Seebohm, A. Bruggemann, W. Kummer, R. W Veh, J. Daut, and R. Preisig-Muller Comparison of cloned Kir2 channels with native inward rectifier K+ channels from guinea-pig cardiomyocytes J. Physiol., April 1, 2001; 532(1): 115 - 126. [Abstract] [Full Text] [PDF]

				C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF]

				C. I. Spencer, W. Uchida, L. Turner, and R. Z. Kozlowski Signature Currents: A Patch-Clamp Method for Determining the Selectivity of Ion-Channel Blockers in Isolated Cardiac Myocytes Journal of Cardiovascular Pharmacology and Therapeutics, January 1, 2000; 5(3): 193 - 201. [Abstract] [PDF]

				E. Carmeliet Cardiac Ionic Currents and Acute Ischemia: From Channels to Arrhythmias Physiol Rev, July 1, 1999; 79(3): 917 - 1017. [Abstract] [Full Text] [PDF]

				L. Yue, P. Melnyk, R. Gaspo, Z. Wang, and S. Nattel Molecular Mechanisms Underlying Ionic Remodeling in a Dog Model of Atrial Fibrillation Circ. Res., April 16, 1999; 84(7): 776 - 784. [Abstract] [Full Text] [PDF]

				Z. Wang, L. Yue, M. White, G. Pelletier, and S. Nattel Differential Distribution of Inward Rectifier Potassium Channel Transcripts in Human Atrium Versus Ventricle Circulation, December 1, 1998; 98(22): 2422 - 2428. [Abstract] [Full Text] [PDF]

				S. Kaab, J. Dixon, J. Duc, D. Ashen, M. Nabauer, D. J. Beuckelmann, G. Steinbeck, D. McKinnon, and G. F. Tomaselli Molecular Basis of Transient Outward Potassium Current Downregulation in Human Heart Failure : A Decrease in Kv4.3 mRNA Correlates With a Reduction in Current Density Circulation, October 6, 1998; 98(14): 1383 - 1393. [Abstract] [Full Text] [PDF]

				B. A. Wible, Q. Yang, Y. A. Kuryshev, Eric. A. Accili, and A. M. Brown Cloning and Expression of a Novel K+ Channel Regulatory Protein, KChAP J. Biol. Chem., May 8, 1998; 273(19): 11745 - 11751. [Abstract] [Full Text] [PDF]

				T. Y. Nakamura, M. Artman, B. Rudy, and W. A. Coetzee Inhibition of rat ventricular IK1 with antisense oligonucleotides targeted to Kir2.1 mRNA Am J Physiol Heart Circ Physiol, March 1, 1998; 274(3): H892 - H900. [Abstract] [Full Text] [PDF]

				M. E. Shuck, T. M. Piser, J. H. Bock, J. L. Slightom, K. S. Lee, and M. J. Bienkowski Cloning and Characterization of Two K+ Inward Rectifier (Kir) 1.1Potassium Channel Homologs from Human Kidney (Kir1.2 and Kir1.3) J. Biol. Chem., January 3, 1997; 272(1): 586 - 593. [Abstract] [Full Text] [PDF]

				J. Kiehn, A. E. Lacerda, B. Wible, and A. M. Brown Molecular Physiology and Pharmacology of HERG: Single-Channel Currents and Block by Dofetilide Circulation, November 15, 1996; 94(10): 2572 - 2579. [Abstract] [Full Text]

				D. M. Roden, R. Lazzara, M. Rosen, P. J. Schwartz, J. Towbin, and G. M. Vincent Multiple Mechanisms in the Long-QT Syndrome: Current Knowledge, Gaps, and Future Directions Circulation, October 15, 1996; 94(8): 1996 - 2012. [Abstract] [Full Text]

				M. V. Brahmajothi, M. J. Morales, S. Liu, R. L. Rasmusson, D. L. Campbell, and H. C. Strauss In Situ Hybridization Reveals Extensive Diversity of K+ Channel mRNA in Isolated Ferret Cardiac Myocytes Circ. Res., June 1, 1996; 78(6): 1083 - 1089. [Abstract] [Full Text]

				L. Bianchi, M.-L. Roy, M. Taglialatela, D. W. Lundgren, A. M. Brown, and E. Ficker Regulation by Spermine of Native Inward Rectifier K[IMAGE] Channels in RBL-1 Cells J. Biol. Chem., March 15, 1996; 271(11): 6114 - 6121. [Abstract] [Full Text] [PDF]

				C.G. Nichols, E.N. Makhina, W.L. Pearson, Q. Sha, and A.N. Lopatin Inward Rectification and Implications for Cardiac Excitability Circ. Res., January 1, 1996; 78(1): 1 - 7. [Abstract] [Full Text]

				J. Kiehn, B. Wible, E. Ficker, M. Taglialatela, and A.M. Brown Cloned Human Inward Rectifier K+ Channel as a Target for Class III Methanesulfonanilides Circ. Res., December 1, 1995; 77(6): 1151 - 1155. [Abstract] [Full Text]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wible, B. A. Articles by Brown, A. M. Search for Related Content PubMed PubMed Citation Articles by Wible, B. A. Articles by Brown, A. M.