| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the British Heart Foundation Cardiovascular Sciences Unit (M.Z., H.C., G.S., K.E., L.A.L., S.C., J.C.M., D.O.H., P.C.E.), National Heart and Lung Institute; and Department of Bioengineering (R.K.) and the Kennedy Institute of Rheumatology Division (A.R.C.), Imperial College, London, United Kingdom.
Correspondence to Dr Paul C. Evans, Senior Lecturer, BHF Cardiovascular Sciences Unit, National Heart and Lung Institute, Imperial College London, Hammersmith Campus, Du Cane Rd, London W12 ONN, United Kingdom. E-mail paul.evans{at}imperial.ac.uk
| Abstract |
|---|
|
|
|---|
Key Words: atherosclerosis endothelial cells shear stress MAP kinases MAP kinase phosphatase-1
| Introduction |
|---|
|
|
|---|
B and mitogen-activated protein (MAP) kinase signaling pathways, which cooperate to induce proinflammatory proteins such as vascular cell adhesion molecule (VCAM)-1.2 Activation of c-Jun N-terminal kinase (JNK) and p38 MAP kinases by proinflammatory agents requires the activity of upstream MAP kinase kinases (eg, MKK3) and MAP kinase kinase kinases (eg, ASK1).3 Active, phosphorylated forms of JNK and p38 activate transcription factors belonging to the activator protein-1 superfamily (eg, c-Jun, activating transcription factor [ATF]-2) and other proteins through phosphorylation.3 Thus active, phosphorylated forms of JNK and p38 induce VCAM-1 expression by activating ATF-2 and c-jun transcription factors4,5 and also by enhancing VCAM-1 mRNA stability.6 Proinflammatory signaling also induces MAP kinase phosphatase (MKP)-1, a negative regulator which inactivates p38 and JNK by removing phosphate groups.7 Atherosclerosis occurs at distinct sites of the arterial tree located near branches and bends that are exposed to nonuniform hemodynamics, whereas arteries with uniform geometries are relatively protected.8,9 Recent studies revealed that proinflammatory activation of ECs is reduced in protected regions compared to atheroprone sites, thus providing a potential explanation for the differing susceptibilities of these sites to atherosclerosis.10,11 Blood flow influences atherosclerosis by exerting shear stress (mechanical drag) on vascular endothelium, which varies in time, magnitude, and direction according to vascular pulsatility and anatomy. Shear stress alters the physiology of ECs, which respond to it via mechanosensory receptors that convert mechanical forces into numerous biochemical signals.12 Several lines of evidence suggest that the spatial distribution of vascular inflammation and atherosclerosis in the arterial tree is regulated by shear stress. Firstly, the magnitude of shear stress at arterial walls is inversely correlated with their susceptibility to atherosclerosis. For example, analysis of the murine aorta8 or human carotid artery9 by computational fluid dynamics revealed that regions exposed to high mean shear are protected from disease, whereas regions exposed to low or oscillatory shear are not. Secondly, it has been shown that inflammation and atherosclerosis can be induced in murine carotid arteries by the application of a flow-altering device that generates spatial and temporal oscillation of the shear stress field.13 Finally, prolonged high shear suppresses proinflammatory activation in cultured ECs and in arteries perfused ex vivo.9,14–16
| Materials and Methods |
|---|
|
|
|---|
Endothelial Cells and Exposure to Flow
Human umbilical vein endothelial cells (HUVECs) were collected using collagenase and cultured as described previously.16 Confluent HUVEC cultures were exposed to steady, unidirectional shear stress (12 dyn/cm2) for 24 or 48 hours using a parallel-plate flow chamber (Cytodyne) as described previously.16
Silencing of MKP-1
RNA interference was carried out using a specific small interfering (si)RNA that is known to silence MKP-1 in ECs.17 MKP-1–specific double-stranded siRNA oligonucleotides with 3'-dTdT (5'-AAGCUGGACGAGGCCUUUGAGUU-3'; Dharmacon, Chicago, Ill) or nontargeting scrambled controls (Silencer Negative control no. 1 siRNA; Ambion, Foster City, Calif) were synthesized. Cell cultures that were 80% to 90% confluent were transfected with siRNA (5 µmol/L final concentration) by microporation (Digital Bio Technology, Seoul, Korea) following the instructions of the manufacturer and then incubated in growth medium without antibiotics for 48 hours before analysis.
Comparative Real-Time PCR
Transcript levels were quantified by comparative real-time PCR using gene-specific primers for MKP-1 (sense, 5'-CAGCTGCTGCAGTTTGAGTC-3'; antisense, 5'-AGGTAGCTCAGCGCACTGTT-3'), MKP-2 (sense, 5'-TGCAAGGTAGCATGATGAGC -3'; antisense, 5'- TGAGCCTTGGCAACATAGTG-3'), MKP-3 (sense, 5'-GGGCAAGAACTGTGGTGTCT-3'; antisense, 5'-AGCAGCTGACCCATGAAGTT-3'), heme oxygenase-1 (sense, 5'-CGAGAAGGCTTTAAGCTGGT-3'; antisense, 5'-TAGACCGGGTTCTCCTTGTT-3'), VCAM-1 (sense, GGTGGGACACAAATAAGGGTTTTGG; antisense, CTTGCAATTCTTTTACAGCCTGCC), and β-actin (sense, 5'-CTGGAACGGTGAAGGTGACA-3'; antisense, 5'-AAGGGACTTCCTGTAACAATGCA-3'). Total RNA was extracted and reverse transcribed as described previously.16 Real-time PCR was carried out using the iCycler system and SYBR green master mix (Sigma) according to the instructions of the manufacturer. Reactions were incubated at 95°C for 3 minutes before thermal cycling at 95°C for 10 seconds and 56°C for 45 seconds. Reactions were performed in triplicate. Relative gene expression was calculated by comparing the number of thermal cycles that were necessary to generate threshold amounts of product (CT) as described previously.16 CT was calculated for the genes of interest and for the housekeeping gene β-actin. For each cDNA sample, the CT for β-actin was subtracted from the CT for each gene of interest to give the parameter
CT, thus normalizing the initial amount of RNA used. The amount of each target was calculated as 2–
CT, where 
CT is the difference between the
CT of the 2 cDNA samples to be compared.
Detection of MKP-1 Protein in Cultured Cells
MKP-1 expression in cultured cells was measured by immunostaining of methanol-fixed cells using rabbit anti–MKP-1 antibodies and Alexa fluor 488–conjugated secondary antibodies followed by laser-scanning confocal microscopy (LSM 510 META; Zeiss). Nuclei were identified using a DNA-binding probe with far-red emission (Draq5; Biostatus). Image analysis was performed using Zeiss LSM 510 META software to calculate average fluorescence values after subtracting background fluorescence values from cells stained with secondary antibody alone. Alternatively, levels of MKP-1 were measured in cell lysates prepared using the Nuclear Extraction Kit (Active Motif) by Western blotting using anti–MKP-1 antibodies, horse radish peroxidase-conjugated secondary antibodies, and chemiluminescent detection.
Assay of p38 Activity in Cultured Cells
Levels of active, phosphorylated p38 were measured in cell lysates prepared using the Nuclear Extraction Kit (Active Motif) by ELISA (Biosource) and were normalized by measuring total levels of p38.
Animals
Male C57BL/6 mice between 2 and 3 months of age were used. The MKP-1 knockout mouse strain (MKP-1–/– [C57BL/6]) used in this study was obtained from Bristol-Myers Squibb. All experiments were performed within guidelines set out by the Federation of European Laboratory Animal Science Associations.
En Face Staining
The expression levels of specific proteins were assessed in ECs at regions of the lesser curvature (high probability [HP] site) and greater curvature (low probability [LP] site) of murine aortae by en face staining as described previously.10,11 Animals were killed by CO2 inhalation. The physiology of vessels in vivo was assessed using aortae that were perfused in situ with PBS (at a pressure of
100 mm Hg) and then perfusion-fixed with 2% formalin before harvesting. Alternatively, physiological responses of vessels were assessed ex vivo using aortae that were perfused with PBS before harvesting. In the latter case, aortae were cut longitudinally along the greater curvature to expose the endothelial surface. They were then bathed in cell culture medium for varying times either in the presence or absence of proinflammatory agents and then fixed with 2% formalin. Fixed aortae from in vivo or ex vivo experiments were tested by immunostaining using specific primary antibodies and Alexa fluor 568–conjugated secondary antibodies (red). Stained vessels were then mounted before visualization of endothelial surfaces en face using confocal laser-scanning microscopy (Zeiss LSM 510 META). ECs were identified by costaining using anti-CD31 antibodies conjugated to the fluorophore FITC and nuclei were costained using Draq5 (Biostatus). Isotype-matched monoclonal antibodies raised against irrelevant antigens or preimmune rabbit sera were used as experimental controls for specific staining (online data supplement, Figure I, available at http://circres.ahajournals.org). The expression of particular proteins at each site was assessed by quantification of fluorescence intensity for multiple cells (at least 100 per site) using LSM 510 software (Zeiss).
Statistics
Differences between samples were analyzed using an unpaired Student t test (*P<0.05, **P<0.01, ***P<0.001).
| Results |
|---|
|
|
|---|
|
MKP-1 Suppresses p38 Activation and VCAM-1 Expression in Sheared ECs
The function of MKP-1 in sheared ECs was assessed using an MKP-1–specific siRNA that significantly suppressed MKP-1 mRNA and protein in sheared ECs, whereas a nontargeting scrambled control had no effect (Figure 2A, compare 2 and 3). We observed that the application of laminar shear stress to HUVECs for 24 hours simultaneously reduced VCAM-1 expression (Figure 2B, top, compare 1 and 2) and suppressed p38 activation (Figure 2B, bottom, compare 1 and 2). Silencing of MKP-1 enhanced VCAM-1 expression and p38 activation in sheared ECs (Figure 2B, compare 2 and 3), indicating that MKP-1 plays an essential role in the suppression of VCAM-1 expression and p38 activation by flow.
|
MKP-1 Is Preferentially Expressed at a High-Shear, Protected Region of the Mouse Aorta
We used en face staining with anti–MKP-1 antibodies to examine whether MKP-1 expression in aortic ECs correlated with local hemodynamics in vivo. Computational fluid dynamic models suggest that the greater curvature of the murine aorta which has an low probability of developing atherosclerosis (LP site) is exposed to higher shear stresses than the lesser curvature, which has a high probability of developing atherosclerosis (HP site).8 Analysis of wild-type C57BL/6 mice revealed that MKP-1 was expressed at high levels in ECs in the LP region but only at low levels in the HP region (Figure 3, compare 1 and 3). Staining was not observed in parallel experiments using MKP-1–/– (C57BL/6) animals (Figure 3, compare 1 and 2), indicating that the anti–MKP-1 antibodies were specific for MKP-1. Thus, we conclude that MKP-1 is expressed at elevated levels in ECs at atheroprotected sites exposed to high shear in vivo.
|
MKP-1 Suppresses the Activities of p38 and JNK in Atheroprotected Regions of the Aorta
We examined whether MKP-1 regulates MAP kinase activation in protected regions of the aorta by performing en face staining using antibodies that recognize active, phosphorylated p38. In untreated wild-type mice, phosphorylated p38 was detected in the HP region but was not identified in the LP region (Figure 4, compare 1 and 3). LPS treatment elevated phosphorylated p38 levels by
2-fold in the HP region (Figure 4, compare 3 and 7) but did not generate detectable levels of phospho-p38 in the LP site (Figure 4, compare 5 and 7). The suppression of phosphorylated p38 in the LP region was not caused by reduced protein expression of p38, which was similar in HP and LP sites (supplemental Figure III). We used MKP-1–/– mice to examine whether MKP-1 is necessary for suppression of p38 activation in LP regions. In contrast to wild-type animals, p38 was phosphorylated constitutively and could be activated further by LPS in LP regions of MKP-1–/– animals (Figure 4, compare 1 and 2 and compare 5 and 6). Thus, we conclude that MKP-1 is essential for the inhibition of p38 activation at the LP site. We observed only modest differences in the levels of active, phosphorylated p38 in ECs at HP sites of wild-type and MKP-1–/– animals (Figure 4, compare 3 and 4 and compare 7 and 8), a finding that is consistent with our observation that MKP-1 is expressed at low levels or is absent from ECs in the HP region of wild-type mice. Interestingly, levels of phosphorylated p38 were
2-fold higher in the HP region compared to the LP region of MKP-1–/– mice (Figure 4, compare 6 and 8), suggesting that other negative regulators cooperate with MKP-1 to suppress MAP kinase activities at the LP site. Parallel studies revealed that activation of JNK by phosphorylation occurs constitutively and can be enhanced by LPS treatment at HP sites (supplemental Figure IV, compare 3 and 7) but is suppressed in LP regions of wild-type animals (supplemental Figure IV, compare 1 and 3 and compare 5 and 7). We concluded that MKP-1 is necessary for suppression of JNK activation in the LP site because phosphorylated JNK levels were increased by genetic deletion of MKP-1 (supplemental Figure IV, compare 5 and 6). In contrast to its effects on p38 and JNK activities, genetic deletion of MKP-1 did not alter the activation of the transcription factor NF-
B (supplemental Figure V).
|
MKP-1 Suppresses VCAM-1 Expression in Atheroprotected Regions of the Aorta
We next assessed whether MKP-1 regulates the spatial localization of VCAM-1 expression in the aorta. En face immunostaining revealed that basal expression of VCAM-1 in untreated wild-type animals was significantly lower in ECs at the LP region compared to the HP region (Figure 5, compare 1 and 3). Injection of LPS induced significantly higher levels of VCAM-1 in the HP region of the mouse aorta compared to the LP region (Figure 5, compare 5 and 7). Thus, our data confirm previous reports that both constitutive and LPS-inducible activation of ECs is suppressed in ECs in the LP region, which is protected from atherosclerosis.10,11 In contrast to wild-type animals, en face staining revealed that VCAM-1 was induced by LPS at similar levels in LP and HP regions of MKP1–/– animals (Figure 5, compare 5 and 6 and compare 7 and 8), indicating that MKP-1 is necessary for suppression of VCAM-1 expression at the LP site. To exclude the effects of MKP-1 genetic deletion on systemic responses to LPS, we isolated aortae from wild-type or MKP-1–/– mice and examined their responses to LPS ex vivo. We observed by en face staining that VCAM-1 was induced by LPS at similar levels in LP and HP sites in aortae of MKP-1–/– mice but was suppressed in LP sites in aortae of wild-type animals (supplemental Figure VI, compare 5 and 7 and compare 6 and 8). Thus, we conclude that it is expression of MKP-1 in the vessel wall that suppresses ECs activation at atheroprotected sites.
|
| Discussion |
|---|
|
|
|---|
B.11,21,22 Thus, the findings presented herein and those from previous studies show that protected regions of the arterial tree resist proinflammatory activation via multiple mechanisms that suppress both MAP kinase and NF-
B signaling pathways. Interestingly, we observed that VCAM-1 expression at the atheroprotected site was restored fully by genetic deletion of MKP-1. We suggest, therefore, that although suppression of Toll-like receptor and bone morphogenetic protein 4 expression and inhibition of NF-
B activation is likely to play a role in the inhibition of EC activation at atheroprotected regions, these mechanisms are not sufficient to protect ECs in the absence of MKP-1.
We provide evidence that shear stress is an important factor in determining the expression pattern of MKP-1 in aortic ECs because, firstly, MKP-1 was induced by unidirectional shear stress in cultured ECs and, secondly, we observed endothelial expression of MKP-1 in the greater curvature of the murine aorta (protected site), which is exposed to high, unidirectional shear stress but not in the lesser curvature (susceptible site), which is exposed to relatively low and oscillatory shear.8 Recent studies have shown that shear stresses in protected regions of the aorta are
20 times higher in the mouse compared to humans.23 We assessed MKP-1 expressed in cultured ECs following the application of 12 dyn/cm2 shear stress, a value that approximates flow conditions in the human aorta. However, it will be interesting in future studies to assess the effects of higher shear stresses that approximate flow conditions in the murine aorta and complex waveforms on the expression of MKP-1 in ECs.
Several signaling pathways have been shown to upregulate MKP-1 in ECs, and further work is now required to identify the precise molecular mechanisms responsible for induction of MKP-1 in response to shear stress. The vascular endothelial growth factor receptor pathway is an interesting candidate because it is activated by shear12 and is known to induce MKP-1 transcription.17 It has also been demonstrated that shear stress suppresses proinflammatory signaling by promoting a reducing state via the induction of reduced forms of glutathione and thioredoxin24 and via activation of Nrf2,25 a transcription factor that induces numerous antioxidants in ECs. Given the exquisite sensitivity of MKP-1 to cellular redox,26 it is plausible that shear stress enhances the catalytic activity of MKP-1, as well as its expression levels in ECs by promoting a reducing environment.
Our finding that MKP-1 can be induced by shear stress is consistent with previous studies that revealed that shear stress can suppress the activation of JNK, p38, and downstream transcription factors and inhibit the induction of VCAM-1 and other adhesion proteins in cultured ECs and in arteries perfused ex vivo.9,14–16 Previous reports have revealed that several intermediaries in the JNK/p38 MAP kinase signaling pathway are negatively regulated by shear stress. For example, the recruitment of TRAF2 (tumor necrosis factor [TNF] receptor–associated factor 2) ubiquitin ligase to the TNF receptor signaling complex, an event that is required for JNK activation in response to TNF
, is reduced in ECs exposed to shear stress.14 In addition, shear stress reduces the activity of ASK1,27 a MAP kinase kinase kinase that functions as a positive regulator of JNK and p38, by enhancing the expression of the reduced form of thioredoxin that acts as a negative regulator of ASK1. Shear stress also induces SHP-2 (Src homology 2–containing protein tyrosine phosphatase-2), a phosphatase that suppresses JNK and p38 activation by targeting MKK3 for dephosphorylation.28 Finally, shear stress also reduces the activation of JNK by TNF
by suppressing the generation of a processed form of protein kinase C
that acts as a positive regulator of the JNK activation pathway.29 Our findings reveal that the suppression of MAP kinase activity by shear stress also involves the induction of MKP-1. Thus, although shear stress modulates JNK and p38 activation by targeting multiple signaling intermediaries, the induction of MKP-1 appears to be essential for full protection.
In summary, our findings suggest that high shear stress protects arteries from inflammation by inducing persistent endothelial expression of MKP-1, which suppresses the activities of p38 and JNK. MKP-1 is expressed in atherosclerotic lesions,30 and further work is now required to assess its potential role in protecting arteries from atherosclerosis.
| Acknowledgments |
|---|
This study was funded by the British Heart Foundation.
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Cybulsky MI, Iiyama K, Li HM, Zhu SN, Chen M, Iiyama M, Davis V, Gutierrez-Ramos JC, Connelly PW, Milstone DS. A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest. 2001; 107: 1255–1262.[Medline] [Order article via Infotrieve]
3. Dong C, Davis RJ, Flavell RA. MAP kinases in the immune response. Ann Rev Immunol. 2002; 20: 55–72.[CrossRef][Medline] [Order article via Infotrieve]
4. Ahmad M, Theofanidis P, Medford RM. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha. J Biol Chem. 1998; 273: 4616–4621.
5. Wadgaonkar R, Pierce JW, Somnay K, Damico RL, Crow MT, Collins T, Garcia JGN. Regulation of c-Jun N-terminal kinase and p38 kinase pathways in endothelial cells. Am J Resp Cell Mol Biol. 2004; 31: 423–431.
6. Pietersma A, Tilly BC, Gaestel N, deJong N, Lee JC, Koster JF, Sluiter W. P38 mitogen activated protein kinase regulates endothelial VCAM-1 expression at the post-transcriptional level. Biochem Biophys Res Comm. 1997; 230: 44–48.[CrossRef][Medline] [Order article via Infotrieve]
7. Liu YS, Shepherd EG, Nelin LD. MAPK phosphatases - regulating the immune response. Nature Rev Immunol. 2007; 7: 202–212.[CrossRef][Medline] [Order article via Infotrieve]
8. Suo J, Ferrara DE, Sorescu D, Guldberg RE, Taylor WR, Giddens DP. Hemodynamic shear stresses in mouse aortas - implications for atherogenesis. Arterioscler Thromb Vasc Biol. 2007; 27: 346–351.
9. Dai GH, Kaazempur-Mofrad MR, Natarajan S, Zhang YZ, Vaughn S, Blackman BR, Kamm RD, Garcia-Cardena G, Gimbrone MA. Distinct endothelial phenotypes evoked by arterial waveforms derived from atherosclerosis-susceptible and -resistant regions of human vasculature. Proc Natl Acad Sci U S A. 2004; 101: 14871–14876.
10. Iiyama K, Hajra L, Iiyama M, Li HM, DiChiara M, Medoff BD, Cybulsky MI. Patterns of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ Res. 1999; 85: 199–207.
11. Hajra L, Evans AI, Chen M, Hyduk SJ, Collins T, Cybulsky MI. The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation. Proc Natl Acad Sci U S A. 2000; 97: 9052–9057.
12. Tzima E, Irani-Tehrani M, Kiosses WB, Dejana E, Schultz DA, Engelhardt B, Cao GY, DeLisser H, Schwartz MA. A mechanosensory complex that mediates the endothelial cell response to fluid shear stress. Nature. 2005; 437: 426–431.[CrossRef][Medline] [Order article via Infotrieve]
13. Cheng C, Tempel D, van Haperen R, van der Baan A, Grosveld F, Daemen MJAP, Krams R, de Crom R. Atherosclerotic lesion size and vulnerability are determined by patterns of fluid shear stress. Circulation. 2006; 113: 2744–2753.
14. Yamawaki H, Lehoux S, Berk BC. Chronic physiological shear stress inhibits tumor necrosis factor-induced proinflammatory responses in rabbit aorta perfused ex vivo. Circulation. 2003; 108: 1619–1625.
15. Chiu JJ, Lee PL, Chen CN, Lee CI, Chang SF, Chen LJ, Lien SC, Ko YC, Usami S, Chien S. Shear stress increases ICAM-1 and decreases VCAM-1 and E-selectin expressions induced by tumor necrosis factor-alpha in endothelial cells. Arterioscler Thromb Vasc Biol. 2004; 24: 73–79.
16. Partridge J, Carlsen H, Enesa K, Chaudhury H, Zakkar M, Luong L, Kinderlerer A, Johns M, Blomhoff R, Mason JC, Haskard DO, Evans PC. Laminar shear stress acts as a switch to regulate divergent functions of NF-kappa B in endothelial cells. FASEB J. 2007; 21: 3553–3561.
17. Kinney CM, Chandrasekharan UM, Mavrakis L, DiCorleto PE. VEGF and thrombin induce MKP-1 through distinct signaling pathways: role for MKP-1 in endothelial cell migration. Am J Physiol Cell Physiol. 2008; 294: C241–C250.
18. De Keulenaer GW, Chappell DC, Ishizaka N, Nerem RM, Alexander RW, Griendling KK. Oscillatory and steady laminar shear stress differentially affect human endothelial redox state. Role of a superoxide-producing NADH oxidase. Circ Res. 1998; 82: 1094–1101.
19. Mullick AE, Soldau K, Kiosses WB, Bell TA, Tobias PS, Curtiss LK. Increased endothelial expression of Toll-like receptor 2 at sites of disturbed blood flow exacerbates early atherogenic events. J Exp Med. 2008; 205: 373–383.
20. Chang K, Weiss D, Suo J, Vega JD, Giddens D, Taylor WR, Jo H. Bone morphogenic protein antagonists are coexpressed with bone morphogenic protein 4 in endothelial cells exposed to unstable flow in vitro in mouse aortas and in human coronary arteries. Role of bone morphogenic protein antagonists in inflammation and atherosclerosis. Circulation. 2007; 116: 1258–1266.
21. Dekker RJ, van Soest S, Fontijn RD, Salamanca S, de Groot PG, VanBavel E, Pannekoek H, Horrevoets AJG. Prolonged fluid shear stress induces a distinct set of endothelial cell genes, most specifically lung Kruppel-like factor (KLF2). Blood. 2002; 100: 1689–1698.
22. Senbanerjee S, Lin ZY, Atkins GB, Greif DM, Rao RM, Kumar A, Feinberg MW, Chen ZP, Simon DI, Luscinskas FW, Michel TM, Gimbrone MA, Garcia-Cardena G, Jain MK. KLF2 is a novel transcriptional regulator of endothelial proinflammatory activation. J Exp Med. 2004; 199: 1305–1315.
23. Weinberg PD, Ethier CR. Twenty-fold difference in hemodynamic wall shear stress between murine and human aortas. J Biomech. 2007; 40: 1594–1598.[CrossRef][Medline] [Order article via Infotrieve]
24. Hojo Y, Saito Y, Tanimoto T, Hoefen RJ, Baines CP, Yamamoto K, Haendeler J, Asmis R, Berk BC. Fluid shear stress attenuates hydrogen peroxide-induced c-jun NH2-terminal kinase activation via a glutathione reductase-mediated mechanism. Circ Res. 2002; 91: 712–718.
25. Hosoya T, Maruyama A, Kang MI, Kawatani Y, Shibata T, Uchida K, Itoh K, Yamamoto M. Differential responses of the Nrf2-Keap1 system to laminar and oscillatory shear stresses in endothelial cells. J Biol Chem. 2005; 280: 27244–27250.
26. Kamata H, Honda S, Maeda S, Chang LF, Hirata H, Karin M. Reactive oxygen species promote TNF alpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell. 2005; 120: 649–661.[CrossRef][Medline] [Order article via Infotrieve]
27. Liu YM, Yin GY, Surapisitchat J, Berk BC, Min W. Laminar flow inhibits TNF-induced ASK1 activation by preventing dissociation of ASK1 from its inhibitor 14-3-3. J Clin Invest. 2001; 107: 917–923.[CrossRef][Medline] [Order article via Infotrieve]
28. Lerner-Marmarosh N, Yoshizumi M, Che WY, Surapisitchat J, Kawakatsu H, Akaike M, Ding B, Huang QH, Yan C, Berk BC, Abe J. Inhibition of tumor necrosis factor-alpha-induced SHP-2 phosphatase activity by shear stress. A mechanism to reduce endothelial inflammation. Arterioscler Thromb Vasc Biol. 2003; 23: 1775–1781.
29. Garin G, Abe JI, Mohan A, Lu W, Yan C, Newby AC, Rhaman A, Berk BC. Flow antagonizes TNF-alpha signaling in endothelial cells by inhibiting caspase-dependent PKC zeta processing. Circ Res. 2007; 101: 97–105.
30. Reddy ST, Nguyen JT, Grijalva V, Hough G, Hama S, Navab M, Fogelman AM. Potential role for mitogen-activated protein kinase phosphatase-1 in the development of atherosclerotic lesions in mouse models. Arterioscler Thromb Vasc Biol. 2004; 24: 1676–1681.
This article has been cited by other articles:
![]() |
L. K. Curtiss and P. S. Tobias Emerging role of Toll-like receptors in atherosclerosis J. Lipid Res., April 1, 2009; 50(Supplement): S340 - S345. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |