| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Integrative Physiology |
From the Genetics Graduate Program (A.M.B., C.M.H.), the Department of Internal Medicine (W.J.d.L., M.L.M., H.L.K., F.M.F., C.D.S.), the Department of Pharmacology (F.M.F.), the Department of Molecular Physiology and Biophysics (C.D.S.), and the Center on Functional Genomics of Hypertension (C.D.S.), Cardiovascular Center, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, Iowa.
Correspondence to Curt D. Sigmund, PhD, Departments of Internal Medicine and Molecular Physiology & Biophysics, 3181B MERF, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, Iowa City, IA 52242. E-mail curt-sigmund{at}uiowa.edu
| Abstract |
|---|
|
|
|---|
) is expressed in vascular endothelium where it exerts anti-inflammatory and antioxidant effects. However, its role in regulating vascular function remains undefined. We examined endothelial function in transgenic mice expressing dominant-negative mutants of PPAR
under the control of an endothelial-specific promoter to test the hypothesis that endothelial PPAR
plays a protective role in the vasculature. Under baseline conditions, responses to the endothelium-dependent agonist acetylcholine were not affected in either aorta or the basilar artery in vitro. In response to feeding a high-fat diet for 12 weeks, acetylcholine produced dilation that was markedly impaired in the basilar artery of mice expressing dominant-negative mutants, but not in mice expressing wild-type PPAR
controlled by the same promoter. Unlike basilar artery, 12 weeks of a high-fat diet was not sufficient to cause endothelial dysfunction in the aorta of mice expressing dominant-negative PPAR
, although aortic dysfunction became evident after 25 weeks. The responses to acetylcholine in basilar artery were restored to normal after treatment with a scavenger of superoxide. Baseline blood pressure was only slightly elevated in the transgenic mice, but the pressor response to angiotensin II was augmented. Thus, interference with PPAR
in the endothelium produces endothelial dysfunction in the cerebral circulation through a mechanism involving oxidative stress. Consistent with its role as a fatty acid sensor, these findings provide genetic evidence that endothelial PPAR
plays a critical role in protecting blood vessels in response to a high-fat diet.
Key Words: endothelium oxidative stress transcription transgenic animals vascular
| Introduction |
|---|
|
|
|---|
) is a ligand-activated transcription factor targeted by the thiazolidinedione (TZD) class of antidiabetes medications. Activation of PPAR
by TZDs improves insulin sensitivity and lowers blood pressure in type II diabetes, whereas individuals with dominant-negative mutations in PPAR
present with severe insulin resistance, type II diabetes, and early-onset hypertension.1 Studies in humans and animals suggest that TZDs are generally cardioprotective, although their clinical safety has been recently challenged.2 That TZDs can lower blood pressure in the face of weight gain and water and salt retention by the kidneys suggests that the antihypertensive effects may be particularly profound.
Heterozygous mice carrying one normal PPAR
allele and one dominant-negative allele (L/+ mice) exhibit a moderate increase in blood pressure.3,4 We have recently reported that L/+ mice exhibit endothelial dysfunction and hypertrophy and inward remodeling in the cerebral vasculature.4 Oxidative stress was the basis of endothelial dysfunction in the model as superoxide was increased and vascular function was restored to normal by a free radical scavenger. These data provided genetic evidence suggesting a functional role for PPAR
in the vascular wall. However, because this knockin mouse exhibited defective PPAR
signaling in all cells, we were not able to determine whether the abnormalities were due to systemic or vascular-specific interference with PPAR
function.
PPAR
is expressed in both vascular muscle and endothelium. We recently reported that PPAR
plays a critical role in vascular muscle, where it is required to mediate cGMP-dependent signaling from nitric oxide released from the endothelium and is required to inhibit vasoconstriction to endothelin-1.5 Mice with vascular muscle-specific interference with PPAR
also exhibited mild hypertension. Despite many reports showing that TZDs improve endothelial function in diabetes and hypertension, the importance of PPAR
in the endothelium, independent of ligand-mediated activation, which may have off target effects, has yet to be defined.6 Only one study has used an animal model that can avoid the use of exogenous ligand treatment to directly implicate endothelial PPAR
.7 In that model, PPAR
was knocked down in endothelial cells by breeding PPAR
-flox mice with mice expressing cre-recombinase controlled by the Tie-2 promoter. Endothelial PPAR
-null mice exhibited an increase in blood pressure only after feeding a high-fat diet. In addition, recent reports suggest that endothelial-specific PPAR
knockout mice also exhibit osteopetrosis8 and production of a toxic milk in pregnancy9 suggesting complete loss of PPAR
has pleiotropic effects, which may affect multiple organ systems. In the current study, we used endothelium-directed expression of 2 different clinically relevant, dominant-negative mutants of PPAR
(P467L and V290M) to test the hypothesis that endothelial PPAR
is a critical mediator of vascular function and its loss through dominant-negative interference causes endothelial dysfunction. The use of these mutants prevents problems associated with off-target effects of TZD drugs and the complete loss of PPAR
function, which is clearly deleterious.
| Materials and Methods |
|---|
|
|
|---|
cDNA was cloned downstream of the promoter with EcoRV. The P467L and V290M mutations were generated using a site-directed mutagenesis kit (Stratagene) using the primers: GATCTCCTGCACAGCCTCCATGGAGCGAAACTGGCAGCC, GCTGCCAGTTTCGCTCCATGGAGGCTGTGCAGGAGATC for V290M, and ACAGACATGAGTCTTCACCTGCTCCTGCAGGAGATCTAC, GTAGATCTCCTGCAGGAGCAGGTGAAGACTCATGTCTGT for P467L. The transgene was excised by ClaI, purified, and microinjected into one cell-fertilized mouse (C57BL/6JxSJL/J F2) embryos. All transgenic mice were maintained by backcross breeding with C57BL/6J mice for at least 4 generations. Genotyping was performed using the primers CAGCTCACAAAGGAACAATAACAG and CTCCATAGTGAAATCCAGAAG. All mice were fed standard mouse chow (LM-485; Teklad Premier Laboratory Diets) and water ad libitum. For the high-fat diet treatment, male animals were fed D12451 (45 kcal% fat) from Research Diets for 12 to 25 weeks beginning at 8 to 10 weeks of age. Experimental animals were 4 to 8 months of age. Care of the mice used in the experiments met the standards set forth by the National Institutes of Health in their guidelines for the care and use of experimental animals. All procedures were approved by the University Animal Care and Use Committee at the University of Iowa.
Molecular Assays
Spleen DNA from transgenic and control mice was isolated as described.11 Genomic DNA (10 µg) was digested with BamHI and Southern blotted. The transgene was digested with EcoR1 to generate a 776-bp fragment to label with Rediprime II Random Primer Labeling System (Amersham Biosciences). For restriction fragment length polymorphism analysis, genomic DNA was amplified using transgene-specific primers, GACTTCTCCAGCATTTCTACTCCA and CACTGCATTCTAGTTGTGG, to generate a 1408-bp product. The amplified product was digested with BsrBI, NcoI, or BamHI. To assay transgene expression, RNA was isolated using Tri-Reagent (Molecular Research Center Inc, Cincinnati, Ohio) and subjected to RNase protection using the RPAIII Kit (Ambion, Austin, Texas) as described previously.5 Protected fragments were 200 for mouse PPAR
, 280 bases for human PPAR
, 105 nt for cyclophilin, and 125 nt for 28S as described previously.5
To assay for endothelial specificity, mice were given a lethal dose of pentobarbital, and the aorta was removed and cleaned of fat and connective tissue. The vessel was divided into 2 segments and one was denuded of endothelium by rolling on a steel wire. Total RNA was extracted from endothelium-intact and endothelium-denuded samples using TriReagent. RNA samples were treated with DNase-I (Fermentas), cDNA was generated by reverse transcriptase using Superscript III (Invitrogen), and polymerase chain reaction was performed using the Hi-Fidelity Platinum Taq system (Invitrogen). Primer sequences were: smooth muscle myosin heavy chain (CGAAGTTGATGCGAATGAA, TGGAGCCGGAAAGACAGA), VeCAD (CTAGATGTGGATGAGCCCCCTGTC, AATTGGCCTCTGTCACTGGTCTTG), E-PPAR
(TGCAGAAGTTGGTCGTGAGG, AGAAGTCAACAGTAGTGAAGG), and GAPDH (TGCACCACCAACTGCTTAG, GATGCAGGGATGATGTTC).
Aortic Ring Preparation
Male and female mice were given a lethal dose of pentobarbital and the thoracic aorta was quickly removed and prepared for measurements of contraction and relaxation as described in detail.12,13
Drugs and Reagents
Acetylcholine (Ach), sodium nitroprusside, A23187, papaverine, PE, KCl, 5-HT, U-46619, Tempol, lucigenin, and NADPH were obtained from Sigma-Aldrich Biochemical and dissolved in physiological saline solution. PGF2
(Lutylase Pfizer Pharmaceutical) was from the University of Iowa pharmacy. Endothelin-1 was from Peninsula Laboratories Inc and dissolved in water.
Studies of Cerebral Arteries In Vitro
Male and female mice were given a lethal dose of pentobarbital, the brain removed, and the basilar artery isolated and prepared for measurements of vessel diameter in vitro as described.14 At the end of each experiment, papaverine (100 µmol/L) was used to produce maximal vasodilation. Vasodilator responses are expressed as percent dilation (percent of induced tone) with 100% representing the difference between the resting value and the constricted value with U46619.
Measurement of Oxidative Stress
Age-matched mice were either fed a normal diet or a high-fat diet for 12 weeks as described previously. Superoxide was measured by the lucigenin assay in the aorta and a pooled sample of cerebral arteries (basilar artery, middle cerebral arteries, and circle of Willis) as previously described.13,15
Microarray Analysis
Mouse aortic endothelial cells were cultured by Dominion Pharmakine. Each culture (3 from NT and 3 from E-V290M) was from aortic samples pooled from 2 mice. Each culture was grown in RPMI media supplemented with 50 U/mL penicillin, 50 g/mL streptomycin, 10% fetal calf serum, 10 U/mL heparin, 1 µg/mL dexamethasone, and 0.1 mg/mL endothelial cell growth supplement (Sigma-Aldrich) on human fibronectin-coated plates to the third passage and then frozen. Cultures were considered to not be contaminated with smooth muscle based on
-actin staining (generally less than 10% smooth muscle cell per culture). RNA was generated using the Trizol method. For the microarray hybridizations, 3 independent biological replicates from each experimental group were used. All the microarray procedures were conducted at the University of Iowa DNA Core facility using standard Affymetrix protocols. In brief, approximately 3 µg of total RNA was used as input to a one-step amplification procedure to generate biotin-labeled RNA fragments for hybridization to the Affymetrix GeneChip Mouse Genome 430 2.0 array. This array contains 45 101 probe sets interrogating 22 485 distinct genes. Data from the microarray studies, including CEL files, have been submitted to the Gene Expression Omnibus at the National Center for Biotechnology Information (Accession No: GSE11870).
Blood Pressure Analysis
Blood pressure was measured by radiotelemetry as described previously.5 Mice were given 7 to 10 days to recover, after which time heart rate and arterial pressure were continuously recorded (sampling every 5 minutes for 20-second intervals) for 1 week as a baseline measure of blood pressure. Data were collected and stored using Dataquest ART. Angiotensin II was infused through a minipump (Alzet) at a dose of 1000 ng/kg/min for 5 days as previously described and blood pressure was measured by tail cuff using the Visitech 2000 system.16
Statistical Analysis
All data are expressed as mean±SEM. Comparisons were made with 2-way repeated-measures analysis of variance using a Tukey post hoc test or t test where appropriate. P<0.05 was considered significant. Data were analyzed by use of SigmaStat (Systat Software).
| Results |
|---|
|
|
|---|
under the control of the endothelial-specific vascular cadherin (VeCad) promoter (Figure 1A). The constructs expressed either wild-type (E-WT) or one of 2 dominant-negative mutations (V290M or P467L) previously shown to cause severe hypertension clinically.1 Multiple founders were identified and validated by both Southern blot (Figure 1B) and the presence of the correct mutation by restriction fragment length polymorphism analysis (Supplemental Figure I). Expression of PPAR
was assessed in each line of mice by RNase protection, and lines were selected on the basis of overexpression compared to endogenous mouse PPAR
in the lung and aorta (Figure 2). Although the copy number of the transgene varied, we chose lines that expressed approximately equal amounts of the transgene. As expected, the transgene was expressed in all tissues because they all contain endothelial cells (Supplemental Figure II). Therefore, to demonstrate endothelial specificity, we assayed for expression of smooth muscle myosin heavy chain (a smooth muscle-specific marker), VeCad (an endothelial cell marker), human PPAR
, and GAPDH in endothelium intact and endothelium-denuded aorta (Figure 3). The data show a preservation of smooth muscle myosin heavy chain and GAPDH expression in all samples but a depletion of VeCad and human PPAR
after removal of the endothelium. Consistent with endothelial specificity, there was no change in body weight (26.5±1.0 versus 27.7±1.0 g), brown adipose (0.37±0.1% versus 0.30±0.03%), or white reproductive adipose tissue (2.2±0.3 versus 2.0±0.2%) of E-V290M compared with nontransgenic littermates.
|
|
|
We next examined vascular function in the aorta in vitro by measuring relaxation to Ach and sodium nitroprusside after precontraction with PGF2
. There was no difference in the response to either agonist in mice expressing either the V290M or P467L mutation in PPAR
(Supplemental Figure III). There was also no difference in the contractile response to several receptor-dependent and receptor-independent vasoconstrictors (Supplemental Figure IV). To examine vascular function in a resistance vessel supplying a major organ, we studied the basilar artery in vitro. Under normal diet conditions, there were no differences in the dilator response to 2 endothelial-dependent agonists, Ach and the calcium ionophore A23187, in either E-V290M or E-P467L mice (Figure 4). There was also no difference in the dilator response to the endothelial-independent agonist papaverine nor the vasoconstrictor KCl.
|
Previous studies suggest that endothelial PPAR
-null mice exhibit an increase in arterial pressure only in response to a high-fat diet.7 Consequently, we examined vascular function in mice fed a high-fat diet for 12 weeks. The increase in body weight due to the high-fat diet was similar in E-V290M (from 26.5±1.0 g to 34.1±2.2 g,
=7.6 g) and nontransgenic littermates (from 27.7±1.0 g to 34.7±1.9 g,
=7.0 g). Whereas a high-fat diet had no effect on endothelial function in the basilar artery of nontransgenic mice, it caused marked impairment in dilation to both Ach and A23187 in E-V290M or E-P467L mice (Figure 5). Endothelial-independent dilation was not altered nor was the contractile response to KCl. Importantly, the impairment observed in the E-V290M and E-P467L was not evident in high-fat diet-fed transgenic mice expressing a wild-type copy of human PPAR
(E-WT) suggesting the impairment was due to dominant-negative interference and not to mere overexpression of PPAR
(Figure 6). A high-fat diet for 12 weeks did not cause vascular dysfunction in the aorta (Supplemental Figure VA–D), although a modest increase in contraction to endothelin-1 was noted at the highest concentrations tested (Supplemental Figure VI). Interestingly, increasing the duration of the high-fat diet to 25 weeks caused endothelial dysfunction in the aorta suggesting there is increased susceptibility to dysfunction even in conduit vessels caused by interference with PPAR
in the endothelium (Supplemental Figure VE–F).
|
|
We previously reported that cerebral vascular dysfunction observed in mice systemically expressing the P465L mutation in PPAR
was due to oxidative stress.4 To test if a similar mechanism is operant in E-V290M mice fed a high-fat diet, we examined the response to Ach before and after treatment with Tempol, a superoxide dismutase mimetic (Figure 7A). As previously stated, the response to Ach was impaired in the basilar artery from mice fed a high-fat diet. Tempol significantly improved the Ach response in mice fed a high-fat diet. We next measured superoxide in the aorta and cerebral arteries in age-matched NT and E-V290M mice fed a normal or high-fat diet using lucigenin (Supplemental Figure VII). Surprisingly, there was no difference in baseline lucigenin or the response to increasing doses of NADPH irrespective of diet or vessel. As expected, Tiron significantly attenuated the lucigenin signal in the presence of NADPH.
|
To obtain a potential molecular explanation for our observations, we performed gene expression profiling on aortic endothelial cells cultured from NT and E-V290M mice. Gene set enrichment analysis, which examines large sets of genes as a group, revealed significant (P=0.019) upregulation of genes considered to be pro-oxidant, including subunits of NADPH oxidase. Individually, there was a modest but significant increase in expression of p22phox, Noxo2, and NoxA2, but not of Nox2 and Nox4 (Figure 7B). Interestingly, there was also a significant decrease in catalase and CuZnSOD (SOD1) expression. We also noted a significant increase in endothelial nitric oxide synthase (NOS3) and Gpx1 expression, which may represent compensatory changes.
We next measured arterial pressure using radiotelemetry. In mice fed a normal-fat diet, we observed a small increase in arterial pressure that was greater during the nighttime hours (9 mm Hg, P=0.07) than during the day (5 mm Hg; Figure 8A–B). Interestingly, although the increase in arterial pressure was only modest, the E-V290M mice were more susceptible to the pressor response caused by subcutaneous administration of angiotensin II through an osmotic minipump (
systolic blood pressure: 38.5±3 versus 26.1±3 mm Hg; Figure 8C–D). We did not observe a significant increase in arterial pressure after 12 weeks of a high-fat diet (109.5±1.9 mm Hg from 105.2±5.7 mm Hg in controls; 112.3±2.7 mm Hg from 111.7±3.9 mm Hg in E-V290M). For reasons that remain unclear, mice implanted with radiotelemeters during the high-fat diet feeding period only gained approximately 50% of the weight as mice lacking transmitters. Similarly, mice implanted with radiotelemeters after the 12-week high-fat diet period lost weight despite being maintained on the high-fat diet.
|
| Discussion |
|---|
|
|
|---|
in the regulation of adipogenesis and type II diabetes is widely accepted, but its role in the vascular wall is not well understood. Although the role of PPAR
in resident macrophages in the vasculature during atherosclerosis has been extensively studied,17 much less is known about the function of PPAR
in the endothelium in vivo. PPAR
is expressed in the endothelium where it has been reported to modulate expression of genes involved in vasoconstriction and oxidative stress.18–21 This is the first study that uses dominant-negative mutations of clinical importance to study the role of PPAR
specifically in the vascular endothelium. In humans, naturally occurring mutations interfering with PPAR
function are associated with severe hypertension and metabolic abnormalities.1 Our results provide genetic evidence supporting an important role for PPAR
in the vascular endothelium. The major finding from our study is that interference with PPAR
function specifically in the endothelium results in a significant impairment in endothelial-dependent relaxation in the basilar artery, a resistance vessel in the cerebral circulation. This impairment in basilar artery function was only observed when the mice were fed a high-fat diet and was not observed in the aorta (a conduit artery) of mice fed high fat for the same period of time. Like other recent studies, our data suggest that a high-fat diet has heterogenous effects on different blood vessels.22 The mechanism accounting for the high-fat diet-induced dysfunction appeared to involve oxidative stress as the function of the vessel returned to normal after addition of a scavenger of superoxide. This is consistent with other data showing increased oxidative stress in the vasculature after a high-fat diet.23
Our data imply that resistance vessels may be more sensitive to the loss of endothelial PPAR
than conduit vessels, because the basilar artery exhibited dysfunction after 12 weeks on a high-fat diet, whereas it took 25 weeks before the same effect was observed in the aorta. The mechanism for this difference is unclear. Nevertheless, these data are consistent with our recent finding that knockin mice carrying a dominant-negative allele of PPAR
(P465L, L/+), expressed in all tissues, exhibit severely impaired cerebral vascular function but only modest aortic dysfunction.4 Interestingly, the knockin mice expressing the dominant-negative mutant in both endothelium and vascular muscle exhibit impaired cerebral artery and arteriolar function under baseline conditions without the requirement for high-fat diet-induced stress. Consequently, we hypothesize that a stressor such as a high-fat diet may be required to unmask a phenotype when the function of PPAR
in the endothelium alone is impaired, but not when its function is impaired in both endothelium and vascular muscle. Recall, endothelium-specific PPAR
knockout mice exhibit an increase in blood pressure only after being fed a high-fat diet.7 These data are consistent with the role of PPAR
as a fatty acid sensor.24 The link between PPAR
and oxidative stress coupled with our finding that Tempol reverses the high-fat diet-induced cerebral vascular dysfunction suggests that free fatty acids or some other PPAR
ligand(s) may increase in the endothelium in response to a high-fat diet. It is likely that an increase in PPAR
activity in the endothelium may provide protective mechanisms by increasing synthesis of nitric oxide and antioxidants.18,19 The V290M or P467L mutations lie in the ligand-binding domain of PPAR
and are thought to destabilize a region of the protein required for coactivator recruitment in response to ligand.25 Thus, the expression of these mutant proteins interferes with this protective mechanism resulting in oxidative stress and impaired vessel function. Along these lines, it is particularly interesting that expression of p22phox was increased and expression of catalase and CuZnSOD decreased in cultured endothelial cells from E-V290M mice. Catalase, CuZnSOD, and p22phox genes have been reported to be targets of PPAR
,18,26–28 and CuZnSOD-deficient mice exhibit oxidative stress and vascular dysfunction.13 Moreover, p22phox-overexpressing mice exhibit augmented Ang II-induced vascular hypertrophy.29 The increase in endothelial nitric oxide synthase expression is interesting in light of its upregulation in mice overexpressing p22phox.30 Consequently, the upregulation of antioxidant enzymes (CuZnSOD and catalase), which is thought to be part, or indicative, of the oxidative stress response, may be PPAR
-dependent. This increase, which would normally be protective, is prevented due to interference with PPAR
function.
Our gene expression data and our finding with Tempol are consistent with an increase in oxidative stress in E-V290M mice. We recognize that not being able to detect an increase in superoxide using chemiluminescence does not support a role for an oxidant-dependent mechanism of vascular dysfunction. Considering related work in this area,4 our new microarray findings, and other studies suggesting antioxidant effects of PPAR
,18,26,27 it still seems likely that a superoxide-related mechanism contributes to vascular dysfunction after the combination of endothelial-specific interference with PPAR
and a high-fat diet. The lack of a detectable increase in superoxide using lucigenin in this model may reflect the sensitivity of that assay in relation to the subcellular localization of superoxide or other factors that may have influenced the results.
The necessity for a high-fat diet in the E-V290M and E-P467L mice described here, but not in the P465L (L/+) knockin mice,4 also suggests a potential contribution of PPAR
in vascular muscle. Indeed, we recently demonstrated the importance of vascular muscle PPAR
by reporting profound aortic dysfunction in mice expressing the same PPAR
mutations (S-P467L and S-V290M) under the control of a smooth muscle-specific promoter.5 Like these studies, the effects were only evident in mice expressing the dominant-negative mutant but not in mice expressing wild-type PPAR
, strongly suggesting the resultant abnormalities were due to dominant-negative interference with PPAR
function and not simple overexpression of PPAR
. S-P467L and S-V290M mice exhibited a loss of responsiveness of the aorta to nitric oxide and hypercontraction to endothelin-1. It is unclear why aortic function in the L/+ was only modestly impaired, although the dominant-negative was expressed in vascular muscle. The most likely explanation is the level of dominant-negative activity. The L/+ mice express one wild-type and one dominant-negative allele (a 1:1 ratio), whereas we were able to achieve a higher level of mutant PPAR
expression at both the mRNA and protein level in the aorta by using the smooth muscle myosin heavy chain promoter. Indeed, we also reported that the magnitude of the aortic dysfunction correlated with the level of dominant-negative PPAR
. Therefore, the magnitude of impairment and the type of vessel affected is dependent on the level of interference garnered and the cell type expressing the mutation.
Male L/+ and male and female S-P467L mice exhibited an approximate 10-mm Hg increase in arterial pressure. Baseline blood pressure in the E-V290M mice was elevated by 9 mm Hg during the nighttime hours but did not achieve statistical significance. Interestingly, although not overtly hypertensive, these mice exhibited an increased pressor response to angiotensin II suggesting that, like a high-fat diet, they may be sensitive to additional stressors. The increase in angiotensin sensitivity is consistent with studies showing that activation of PPAR
by TZDs prevents the angiotensin-induced pressor response and lowers blood pressure in mice overexpressing angiotensin II.12,31 Interestingly, there was no increase in angiotensin II-mediated contraction in the aorta of E-V290M mice (data not shown).
Endothelial-specific PPAR
knockout mice exhibit normal blood pressure under baseline conditions but become hypertensive after being fed a high-fat diet.7 We therefore anticipated a similar finding in our mice. Although we put considerable effort into measuring blood pressure in these mice (both throughout the entire 12-week high-fat diet period or after completion of the high-fat diet), we observed significant weight loss (approximately 50% of the gain) after implantation of the radiotelemeters making interpretation of those results difficult. Consequently, further studies are needed to assess if the high-fat diet-induced vascular dysfunction translates to an increase in arterial pressure. Interestingly, since the original publication of the endothelial PPAR
knockout,32 there have been other reports that have used the same methodology of breeding PPAR
flox/flox mice with Tie2-Cre mice, which express Cre-recombinase in endothelial cells. One study showed that the promoter is active in hematopoietic cells and osteoclasts and resulted in osteopetrosis and increased bone mass.8 In another study, maternal deletion of PPAR
resulted in growth retardation and other defects in nursing pups irrespective of their genotype caused by the production of milk containing elevated inflammatory lipids.9 Therefore, the loss of PPAR
in cells in which the Tie2 promoter is active (endothelial cells and other cell types) may have other unidentified consequences.
In summary, our results identify endothelial PPAR
as a critical regulator of endothelial function in the cerebral circulation, especially under conditions of high fat-induced stress.
| Acknowledgments |
|---|
Sources of Funding
This work was supported by grants from the National Institutes of Health (HL48058, HL61446, and HL55006 to C.D.S.; HL38901, HL62984, and NS24621 to F.M.F.). F.M.F. is also supported by a Bugher Foundation Award in Stroke (0575092N). A.M.B. was funded by a Predoctoral Fellowship from the American Heart Association Heartland Affiliate (0415460Z) and C.M.H. is funded by a National Institutes of Health Predoctoral Training Program in Genetics (T32 GM008629).
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
associated with severe insulin resistance, diabetes mellitus and hypertension. Nature. 1999; 402: 880–883.[CrossRef][Medline]
[Order article via Infotrieve]2. Nissen SE, Wolski K. Effect of rosiglitazone on the risk of myocardial infarction and death from cardiovascular causes. N Engl J Med. 2007; 356: 2457–2471.
3. Tsai YS, Kim HJ, Takahashi N, Kim HS, Hagaman JR, Kim JK, Maeda N. Hypertension and abnormal fat distribution but not insulin resistance in mice with P465L PPAR
. J Clin Invest. 2004; 114: 240–249.[CrossRef][Medline]
[Order article via Infotrieve]
4. Beyer AM, Baumbach GL, Halabi CM, Modrick ML, Lynch CM, Gerhold TD, Ghoneim SM, deLange WJ, Keen HL, Tsai Y-S, Maeda N, Sigmund CD, Faraci FM. Interference with PPAR
signaling causes cerebral vascular dysfunction, hypertrophy, and remodeling. Hypertension. 2008; 51: 867–871.
5. Halabi CM, Beyer AM, de Lange WJ, Keen HL, Baumbach GL, Faraci FM, Sigmund CD. Interference with PPAR
function in smooth muscle causes vascular dysfunction and hypertension. Cell Metab. 2008; 7: 215–226.[CrossRef][Medline]
[Order article via Infotrieve]
6. Feinstein DL, Spagnolo A, Akar C, Weinberg G, Murphy P, Gavrilyuk V, Dello RC. Receptor-independent actions of PPAR thiazolidinedione agonists: is mitochondrial function the key? Biochem Pharmacol. 2005; 70: 177–188.[CrossRef][Medline] [Order article via Infotrieve]
7. Nicol CJ, Adachi M, Akiyama TE, Gonzalez FJ. PPAR
in endothelial cells influences high fat diet-induced hypertension. Am J Hypertens. 2005; 18: 549–556.[CrossRef][Medline]
[Order article via Infotrieve]
8. Wan Y, Chong LW, Evans RM. PPAR
regulates osteoclastogenesis in mice. Nat Med. 2007; 13: 1496–1503.[CrossRef][Medline]
[Order article via Infotrieve]
9. Wan Y, Saghatelian A, Chong LW, Zhang CL, Cravatt BF, Evans RM. Maternal PPAR
protects nursing neonates by suppressing the production of inflammatory milk. Genes Dev. 2007; 21: 1895–1908.
10. Stec DE, Morimoto S, Sigmund CD. Vectors for high level expression of cDNAs controlled by tissue-specific promoters in transgenic mice. Biotechniques. 2001; 31: 256–260.[Medline] [Order article via Infotrieve]
11. Zhou X, Davis DR, Sigmund CD. The human renin kidney enhancer is required to maintain baseline renin expression but is dispensable for tissue-specific, cell-specific and regulated expression. J Biol Chem. 2006; 281: 35296–35304.
12. Ryan MJ, Didion SP, Mathur S, Faraci FM, Sigmund CD. PPAR
agonist rosiglitazone improves vascular function and lowers blood pressure in hypertensive transgenic mice. Hypertension. 2004; 43: 661–666.
13. Didion SP, Ryan MJ, Didion LA, Fegan PE, Sigmund CD, Faraci FM. Increased superoxide and vascular dysfunction in CuZnSOD-deficient mice. Circ Res. 2002; 91: 938–944.
14. Faraci FM, Modrick ML, Lynch CM, Didion LA, Fegan PE, Didion SP. Selective cerebral vascular dysfunction in Mn-SOD-deficient mice. J Appl Physiol. 2006; 100: 2089–2093.
15. Didion SP, Hathaway CA, Faraci FM. Superoxide levels and function of cerebral blood vessels after inhibition of CuZn-SOD. Am J Physiol Heart Circ Physiol. 2001; 281: H1697–H1703.
16. Sinn PL, Davis DR, Sigmund CD. Highly Regulated cell-type restricted expression of human renin in mice containing 140 Kb or 160 Kb P1 phage artificial chromosome transgenes. J Biol Chem. 1999; 274: 35785–35793.
17. Akiyama TE, Sakai S, Lambert G, Nicol CJ, Matsusue K, Pimprale S, Lee YH, Ricote M, Glass CK, Brewer HB Jr, Gonzalez FJ. Conditional disruption of the peroxisome proliferator-activated receptor gamma gene in mice results in lowered expression of ABCA1, ABCG1, and apoE in macrophages and reduced cholesterol efflux. Mol Cell Biol. 2002; 22: 2607–2619.
18. Inoue I, Goto S, Matsunaga T, Nakajima T, Awata T, Hokari S, Komoda T, Katayama S. The ligands/activators for peroxisome proliferator-activated receptor alpha (PPARalpha) and PPAR
increase Cu2+,Zn2+-superoxide dismutase and decrease p22phox message expressions in primary endothelial cells. Metabolism. 2001; 50: 3–11.[CrossRef][Medline]
[Order article via Infotrieve]
19. Cho DH, Choi YJ, Jo SA, Jo I. Nitric oxide production and regulation of endothelial nitric-oxide synthase phosphorylation by prolonged treatment with troglitazone: evidence for involvement of peroxisome proliferator-activated receptor (PPAR) gamma-dependent and PPARgamma-independent signaling pathways. J Biol Chem. 2004; 279: 2499–2506.
20. Satoh H, Tsukamoto K, Hashimoto Y, Hashimoto N, Togo M, Hara M, Maekawa H, Isoo N, Kimura S, Watanabe T. Thiazolidinediones suppress endothelin-1 secretion from bovine vascular endothelial cells: a new possible role of PPAR
on vascular endothelial function. Biochem Biophys Res Commun. 1999; 254: 757–763.[CrossRef][Medline]
[Order article via Infotrieve]
21. Delerive P, Martin-Nizard F, Chinetti G, Trottein F, Fruchart JC, Najib J, Duriez P, Staels B. Peroxisome proliferator-activated receptor activators inhibit thrombin- induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway. Circ Res. 1999; 85: 394–402.
22. Bhattacharya I, Mundy AL, Widmer CC, Kretz M, Barton M. Regional heterogeneity of functional changes in conduit arteries after high-fat diet. Obesity (Silver Spring). 2008; 16: 743–748.[Medline] [Order article via Infotrieve]
23. Roberts CK, Barnard RJ, Sindhu RK, Jurczak M, Ehdaie A, Vaziri ND. Oxidative stress and dysregulation of NAD(P)H oxidase and antioxidant enzymes in diet-induced metabolic syndrome. Metabolism. 2006; 55: 928–934.[CrossRef][Medline] [Order article via Infotrieve]
24. Krey G, Braissant O, L'Horset F, Kalkhoven E, Perroud M, Parker MG, Wahli W. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol. 1997; 11: 779–791.
25. Agostini M, Schoenmakers E, Mitchell C, Szatmari I, Savage D, Smith A, Rajanayagam O, Semple R, Luan J, Bath L, Zalin A, Labib M, Kumar S, Simpson H, Blom D, Marais D, Schwabe J, Barroso I, Trembath R, Wareham N, Nagy L, Gurnell M, O'Rahilly S, Chatterjee K. Non-DNA binding, dominant-negative, human PPAR
mutations cause lipodystrophic insulin resistance. Cell Metab. 2006; 4: 303–311.[CrossRef][Medline]
[Order article via Infotrieve]
26. Girnun GD, Domann FE, Moore SA, Robbins ME. Identification of a functional peroxisome proliferator-activated receptor response element in the rat catalase promoter. Mol Endocrinol. 2002; 16: 2793–2801.
27. Yoo HY, Chang MS, Rho HM. Induction of the rat Cu/Zn superoxide dismutase gene through the peroxisome proliferator-responsive element by arachidonic acid. Gene. 1999; 234: 87–91.[CrossRef][Medline] [Order article via Infotrieve]
28. Calkin AC, Forbes JM, Smith CM, Lassila M, Cooper ME, Jandeleit-Dahm KA, Allen TJ. Rosiglitazone attenuates atherosclerosis in a model of insulin insufficiency independent of its metabolic effects. Arterioscler Thromb Vasc Biol. 2005; 25: 1903–1909.
29. Weber DS, Rocic P, Mellis AM, Laude K, Lyle AN, Harrison DG, Griendling KK. Angiotensin II-induced hypertrophy is potentiated in mice overexpressing p22phox in vascular smooth muscle. Am J Physiol Heart Circ Physiol. 2005; 288: H37–H42.
30. Laude K, Cai H, Fink B, Hoch N, Weber DS, McCann L, Kojda G, Fukai T, Schmidt HH, Dikalov S, Ramasamy S, Gamez G, Griendling KK, Harrison DG. Hemodynamic and biochemical adaptations to vascular smooth muscle overexpression of p22phox in mice. Am J Physiol Heart Circ Physiol. 2005; 288: H7–12.
31. Diep QN, El Mabrouk M, Cohn JS, Endemann D, Amiri F, Virdis A, Neves MF, Schiffrin EL. Structure, endothelial function, cell growth, and inflammation in blood vessels of angiotensin II-infused rats: role of peroxisome proliferator-activated receptor-gamma. Circulation. 2002; 105: 2296–2302.
32. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, Evans RM. PPAR
is required for placental, cardiac, and adipose tissue development. Mol Cell. 1999; 4: 585–595.[CrossRef][Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. Chang, L. Villacorta, J. Zhang, M. T. Garcia-Barrio, K. Yang, M. Hamblin, S. E. Whitesall, L. G. D'Alecy, and Y. E. Chen Vascular Smooth Muscle Cell-Selective Peroxisome Proliferator-Activated Receptor-{gamma} Deletion Leads to Hypotension Circulation, April 28, 2009; 119(16): 2161 - 2169. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |