| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Nephrology Division (J.-W.X., Q.Y., J.Z.) and Cardiovascular Research Center (J.-W.X., J.D.M.), Massachusetts General Hospital and Harvard Medical School, Charlestown, Mass. Present address for J.D.M.: Cardiovascular Research, Childrens Hospital Boston, Mass.
Correspondence to Jing-Wei Xiong, The Nephrology Division, Massachusetts General Hospital-East, Harvard Medical School, 149 13th St, Room 8216, Charlestown, MA 02129. E-mail Xiong{at}cvrc.mgh.harvard.edu
| Abstract |
|---|
|
|
|---|
Key Words: acyltransferase hemangioblast hematopoiesis vasculogenesis zebrafish cloche
| Introduction |
|---|
|
|
|---|
The zebrafish cloche (clo) mutant has significantly reduced endothelial and hematopoietic lineages, as well as no endocardium.9 cloche is thought to act at the level of the hemangioblast and represents the first single gene mutation that almost eliminates both endothelial and hematopoietic lineages. Epistasis analyses have shown that cloche acts upstream of zbp-89 (a Krüppel-like zinc finger–containing transcription factor), scl (a basic helix–loop–helix transcription factor), lmo2 (a LIM-containing protein), gata1 (GATA binding protein 1), fli1 (an ETS domain–containing protein), flk1 (fetal liver kinase 1), and etsrp (a ETS1-related protein) in hematopoietic and endothelial cell development in zebrafish.9–17 In addition, genome-wide microarray analyses have revealed that cloche specifically regulates a panel of hematopoietic and endothelial genes.18–20 All of these early studies have proved that cloche is the earliest gene acting in hemangioblast development. However, it remains unknown what is the molecular nature of the cloche gene.
Here, we have cloned lycat as a candidate gene for the cloche locus in zebrafish. The mouse homolog of Lycat is strongly expressed in the heart and is enriched in the Flk1+/Scl– and Flk1+/Scl+ hemangioblast populations in embryoid bodies.21,22 We have previously reported that mouse Lycat gene plays essential roles in hemangioblast, hematopoietic, and endothelial lineage development using loss-of-function (siRNA knockdown) and gain-of-function (over- and ectopic expression) analyses in mouse ESC differentiation system.21 Both mouse and zebrafish lycat genes encode a transmembrane acyltransferase with a C-terminal endoplasmic reticulum localization signal. The mouse Lycat protein has acyltransferase enzymatic activities using lysocardiolipin as a substrate.22 Protein acyltransferase has emerged as an important player in regulating protein trafficking, sorting, and development.23,24 The porcupine (Porc) gene in fly was isolated and characterized as an endoplasmic reticulum–localized acyltransferase that is required for addition of palmitate to Wnt3a and Wnt1 for producing fully functional Wnt proteins.25,26 Skinny hedgehog (Ski) was found to be another acyltransferase that is required for palmitoylation and biological activity of the Hedgehog.27 Therefore, some protein acyltransferases can be important signaling components regulating embryonic patterning and organogenesis. We therefore analyzed the zebrafish lycat gene function in hemangioblast, endothelial, and hematopoietic lineage development. Morpholino-mediated knockdown of zebrafish lycat results in the reduction of both endothelial and hematopoietic lineages and elimination of the endocardium, which is very similar to that in cloche. Microinjection of zebrafish lycat mRNA into cloche mutants partially rescues the cloche phenotype. Lycat acts upstream of several known hemangioblastic genes. Although lycat is deleted in the spontaneous clochem39 allele, we have not found causative mutations in the open reading frame of lycat from 2 ethylnitrosourea-induced cloche alleles. This study suggests that lycat is the earliest known player in hematopoietic and endothelial (including endocardial) cell development, probably acting on the level of hemangioblasts.
| Materials and Methods |
|---|
|
|
|---|
Morpholinos and Capped mRNA Injections
Three antisense morpholinos were synthesized to target the zebrafish lycat ATG site (lycat-MO1): AACACACACCACGAGGAGACACCAT; the second splicing donor site (lycat-MO2): TAAGCTCTGCGTACCACAGGTAAG; the third splicing donor site (lycat-MO3): CTGAACACACACACTGACCGAAGC; and a control morpholino (Ctr-MO): GCAGCGGGCACTGCTGGTGGAAGT (Gene Tools, LLC). etsrp-MO (an untranslated region morpholino) (TTGGTACATTTCCATATCTTAAAGT) and scl-MO (an untranslated region morpholino) (GCTCGGATTTCAGTTTTTCCATCAT) were reported.16 Zebrafish lycat, mouse Lycat, and zebrafish scl and etsrp were cloned and linearized, and capped mRNA was synthesized using Ambion mMESSAGE mMACHINE mRNA transcription synthesis kits. Morpholinos or mRNA were injected into 1- or 2-cell-stage wild-type, clofv087b; Tg(flk1:GFP), or clofv087b; Tg(gata1:GFP) embryos. Injected embryos were incubated at 28.5°C for examination of phenotypes or were fixed for in situ hybridization. The pictures were taken using a Leica MZ16 fluorescence microscope.
RNA In Situ Hybridization and Histology
In situ hybridization and histology were done using antisense lycat, flk1, fli1, etsrp, scl, lmo2, and gata1 RNA probes.11–14,16
Reverse Transcription–PCR
Zebrafish embryos were pooled from Ctr-MO; clo mutant embryos from clofv087, clom378, or clom39 heterozygous crosses; or lycat-MO3 morphant embryos at 18 or 30 hours postfertilization (hpf). Wild-type TL embryos were collected at different time points. Total RNA was isolated from embryos using TRIzol reagents (Invitrogen). First-strand cDNA was synthesized using the Superscript II RT system (Invitrogen). Semiquantitative PCR for zebrafish lycat, flk1, and β-actin were done with Qiagen Taq polymerases and quantitative PCR were done with TaqMan or SYBR Green probes using the 7000 Sequence Detection System (ABI Prism).
Site-Directed Mutagenesis and Rescue of gata1 Expression in Homozygous clom39 Mutant Embryos
The wild-type lycat cDNA was used for site-directed mutagenesis. Mutations were created using the GeneEditor in vitro Site-Directed Mutagenesis System (Promega) following the instructions of the manufacturer. The E165R-G166L mutation was generated by a substitution of glutamic acid (E) to arginine (R) at amino acid 165 and glycine (G) to leucine (L) at amino acid 166. The following primers were used for making E165R-G166L: 5'-TGCAGCTGCTGCTGTTCCCTcgGctCACCGACCTCA-3' (forward) and 5'-AGGGAACAGCAGCAGCTGCACCGGCTCTCT-3' (reverse). Capped mRNAs were synthesized from wild-type lycat cDNA and E165R-G166L cDNA templates using mMESSAGE mMACHINE SP6 and T7 Kits (Ambion). mRNA was injected into 1- or 2-cell-stage clom39 or clofv087b; Tg(gata1:GFP) embryos from heterozygous clo crosses. Injected embryos were incubated at 28.5°C and later fixed with 4% paraformaldehyde. gata1 expression in the injected embryos was examined by in situ hybridization. Embryos were subsequently genotyped by PCR with the marker Z1412 that is deleted in the clom39 allele or with marker D, a CA repeat marker for clofv087b allele (supplemental Figure I). Marker D is as follows: forward primer, 5'-TCTGATTGGCCACTGAGG-3'; reverse primer, 5'-GCGTGTGTGTAACCCGTCTA-3'. Marker Z1826 is outside of the deletion interval in the clom39 allele, which was used as DNA quality control.
| Results |
|---|
|
|
|---|
|
The zebrafish lycat-MO3 reduced the expression of scl in the intermediate cell mass in a dose-dependent manner (Figure 1m through 1p). Morphants injected with lycat-MO1 or MO1 (Figure 1s), lycat-MO2 or MO2 (Figure 1t), or lycat-MO3 or MO3 (not shown) showed significantly reduced fli1 expression in vessels. The fli1 expression in lycat-MO2 (Figure 1t) or lycat-MO3 morphants (not shown) is similar to that in homozygous clo embryo (Figure 1r), whereas very-low-level fli1 expression remained in trunk vessels in lycat-MO1 morphants (Figure 1s). Lycat-MO2 morphant embryos have similar fli1 expression as that in cloche mutant embryos; therefore, the expression level of fli1 in Figure 1t represents experimental variation. The lycat-MO3 is the most potent one among the three antisense lycat morpholinos tested; therefore, lycat-MO3 is used for subsequent experiments. In summary, morpholino-mediated lycat knockdown results in a similar phenotype as that in cloche, suggesting that lycat is essential for hemangioblast, endothelial, and hematopoietic lineage development and that flk1, scl, gata1, and fli1 function downstream of lycat.
Zebrafish and Mouse Lycat but Not an Enzyme-Defective Lycat Partially Rescues Hematopoiesis in cloche Mutant Embryos
We found that both zebrafish and mouse Lycat mRNA partially rescued cloche embryos (Figure 2). In cloche mutant embryos from clofv087b/+; Tg(gata1:GFP)tg/tg sibling crosses, the gata1:GFP expression was remarkably increased after injection with lycat mRNA (Figure 2c and 2d). Although the rescued cloche embryos lacked an intact circulation, they had significant number of blood cells, whereas uninjected cloche mutants had very few blood cells (data not shown). Using Tg(gata1:GFP) as a marker, the lycat mRNA injection was able to rescue 38.5% (35/91) of cloche mutant embryos (supplemental Table I), genotyped with marker D (supplemental Figure Ia and data not shown). We failed to rescue the flk1+ and etsrp+ endothelial cells in cloche embryos injected with lycat mRNA (not shown). These data are not entirely supportive of lycat as the cloche gene, although ectopic mRNA expression of a developmentally regulated gene does not always rescue its genetic mutant phenotype in zebrafish.
|
Recent studies have shown that acyltransferase from bacteria to mammals contains highly conserved catalytic motifs including H(X)4D and EGTR.22 The zebrafish Lycat protein contains both H(RTRL)D (amino acids 85 to 90) and EGTD (amino acids 165 to 168) motifs (supplemental Figure Ib, shadowed). We examined whether the EGTR motif in Lycat is essential for hematopoiesis in zebrafish. We generated a mutant Lycat with substitutions of both E165R and G166L (named E165R-G166L) by site-directed mutagenesis. We found that the E165R-G166L mutant lycat mRNA rescued hematopoietic gata1 expression only in 2% (2/89) of homozygous clom39 embryos, whereas the wild-type lycat mRNA rescued 47% (31/66) of cloche embryos (Figure 2g and 2j). Gata1-expressing homozygous cloche embryos were confirmed by genotyping with marker Z1412 deleted in the clom39 allele and a control marker Z1826 outside of the clom39 deletion interval (not shown). These data establish that the catalytic activity of the Lycat protein is required for its function in hematopoietic development in zebrafish.
Zebrafish lycat Acts Upstream of scl and etsrp to Specify the Hemangioblast
To determine the role of lycat gene in zebrafish hemangioblast development, we examined the interactions of lycat with scl and etsrp in the lateral plate mesoderm (LPM) in early-somitogenesis-stage embryos. The flk1, etsrp, scl, lmo2, and gata1 genes were not expressed or significantly reduced in both anterior and posterior LPM in lycat-MO3 morphants (87% [47/54] have reduced flk1; 73% [38/52] have reduced etsrp; 96% [45/47] have reduced scl; 80% [32/40] have significantly reduced lmo2; and 95% [37/39] have reduced gata1; Figures 3b, 3l, 4b, 4g, and 4
k). fli1 was not expressed in the anterior LPM in lycat-MO3 morphant embryo (49% [18/37]) (Figure 4h). The expression profile of these genes in lycat-MO3 morphants is very similar to that in homozygous clo embryos (data not shown). scl mRNA rescued flk1 (66%, 40/61), fli1 (88%, 44/50), etsrp (100%, 62/62), lmo2 (59%, 26/44), and gata1 (95%, 40/42) expression in lycat-MO3 morphants (Figures 3c, 3i, 3m, 4 h, and 4
l). In addition, overexpression of scl mRNA in lycat-MO3 morphants led to ectopic fli1 and lmo2 expression (Figures 3i and 4
h) and increased the more lateral stripe of flk1- and etsrp-expression domains (Figure 3c and 3m, arrowheads) and expanded gata1-expression domain (Figure 4l). Similarly, overexpression of etsrp mRNA in MO3 morphants also rescued flk1 (69%, 24/35), fli1 (80%, 28/35), scl (78%, 25/32), lmo2 (53%, 16/30), and gata1 (82%, 23/28) expression, as well as led to ectopic flk1, fli1, scl, lmo2, gata1 expression (Figures 3d, 3j, 4c, 4i, and 4
m). Therefore, lycat acts upstream of both scl and etsrp and is essential for fli1, flk1, etsrp, scl, lmo2, and gata1 expression during development of hemangioblasts, endothelial, and hematopoietic cells.
|
|
To further examine the relationship between lycat and etsrp, etsrp morpholinos were used to knockdown etsrp function in early somitogenesis embryos.16,17 In etsrp morphant (etsrp-mo) embryos, the flk1 expression was significantly reduced (93%, 28/30) in both anterior and posterior LPM (Figure 3e), fli1 was reduced in the anterior LPM (not shown), scl was reduced (79%, 45/57) in the anterior part of the posterior LPM (Figure 4d, arrowheads), and lmo2 and gata1 expressions were not affected (not shown). The etsrp morphant phenotypes could not be rescued by overexpression of lycat mRNA (Figures 3f and 4
e) (100% [28/28] have reduced flk1 expression; 77% [20/26] have reduced scl expression). Together with the rescue of lycat-MO3 morphant phenotypes by etsrp mRNA (Figures 3d, 3j, 4c, 4i, and 4
m), our data support that lycat acts upstream of etsrp in hemangioblast development and etsrp is critical for flk1-expressing angioblastic lineage and plays a role in generation of gata1- and lmo2-expressing hematopoietic lineages.
Antisense morpholino knockdown of scl was also applied to examine the scl and lycat relationship in hemangioblast development. scl morphant showed reduced gata1 expression (44%, 32/72) (Figure 4n) compared with that of control embryo (Figure 4j). This scl morphant phenotype could not be rescued by coexpression of lycat RNA (60%, 41/68) (Figure 4o). We have also carried out knockdown of both scl isoforms (scl
and sclβ) as described31 and have found that lycat RNA could not rescue gata1 expression in scl
and sclβ morphant embryos (data not shown). The lmo2 expression was neither affected in embryos injected with scl morpholinos nor embryos injected with both scl morpholino and lycat RNA (not shown). Therefore, scl acts downstream of lycat and is essential for the derivation of gata1-expressing hematopoietic lineages.
| Discussion |
|---|
|
|
|---|
Genetic studies in Drosophila and Caenorhabditis elegans have identified acyltransferases that are required for the generation of active morphogens, Wingless, and Hedgehog.26,27 Hedgehogs and Wnts are involved in hematopoiesis and vasculogenesis,26,32,33 as well as many other important functions. Therefore, endoplasmic reticulum–associated, transmembrane acyltransferases are important for regulating embryonic patterning and organogenesis in different species. Zebrafish Lycat is predicted as an endoplasmic reticulum–localized transmembrane acyltransferase. Mouse Lycat has acyltransferase activity for Cardiolipin and may modify additional proteins.22 We have shown that mouse Lycat is enriched in the Flk1+/Scl– hemangioblasts and plays an important role in hematopoietic and endothelial cell development during ESC differentiation in vitro.21 It is possible that Lycat could act as a protein acyltransferase modifying 1 or several signaling components that control hematopoietic and endothelial specification in the early embryo. The identification of Lycat targets will reveal the mechanism of Lycat in this process. There is no consensus sequence for an acyltransferase target domain making it challenge to identify potential Lycat targets.34 Future studies are required to determine whether zebrafish Lycat directly modifies important known molecules, such as the Hedgehogs, Wnts, Etsrp, Scl, Runx1, and vascular endothelial growth factor pathway components.16,17,26,33 Another area of interest is to discover novel Lycat targets that influence hemangioblast development by using an unbiased genome-wide proteomics approach.35
The zebrafish clo mutant has significantly reduced hematopoietic and endothelial lineages.9 Gain-of-function analysis in zebrafish suggests that scl, lmo2, and etsrp are involved in specifying the hemangioblast from early lateral posterior mesoderm.11,14,16,17,36,37 However, morpholino knockdown or genetic mutant analyses of these genes have revealed that none of them is absolutely required for the formation of both endothelial and hematopoietic lineages in zebrafish embryos. Our data support that lycat is required for flk1-, etsrp-, fli1-, gata1-, scl-, and lmo2-expressing cell formation (Figures 1, 3, and 4![]()
). To our knowledge, lycat is the first hemangioblastic gene required for both endothelial and hematopoietic lineages in zebrafish embryos. Both scl and etsrp mRNA rescue lycat morphant phenotype in endothelial and hematopoietic development (Figures 3 and 4
), whereas lycat mRNA fails to rescue etsrp or scl morphant phenotypes (Figures 3f, 4e, and 4
o), supporting the notion that lycat is upstream of both scl and etsrp. Our studies and others also support that etsrp, downstream to lycat, is essential for flk1-expressing endothelial and gata1-expressing hematopoietic lineages, whereas scl is essential for generation of the gata1-expressing hematopoietic lineages and plays minor roles in flk1-expressing endothelial lineages (Figures 3 and 4
and data not shown).17
The zebrafish lycat zygotic expression pattern was unclear by RNA in situ hybridization probably because of very low levels of expression (data not shown). Zebrafish lycat mRNA was detected in embryos from 1-cell-stage to 72 hpf by RT-PCR (data not shown). Using RNA in situ analysis with antisense lycat probes, we did find transgenic lycat mRNA expression in Tg(flk1:lycat) embryos, in which lycat is driven by the zebrafish flk1 promoter (data not shown), supporting that the antisense lycat probes that we used were good and that the uncertainness in detecting endogenous lycat mRNA may be attributable to its low level of expression (data not shown). Future studies need to fill this gap as well. We fully anticipate that deciphering Lycat targeting proteins and its expression pattern presumably in hemangioblast domains will lead to both molecular insights in hemangioblast development and therapeutic utility in regenerative medicine.
| Acknowledgments |
|---|
Sources of Funding
This project was supported by NIH grant K01-AG19676, the Harvard Stem Cell Institute, March of Dimes Birth Defects Foundation, and Massachusetts General Hospital Nephrology Division funding (to J.-W.X.).
Disclosures
None.
| Footnotes |
|---|
Original received September 10, 2007; revision received March 14, 2008; accepted March 21, 2008.
| References |
|---|
|
|
|---|
2. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G. A common precursor for hematopoietic and endothelial cells. Development. 1998; 125: 725–732.[Abstract]
3. Kennedy M, DSouza S, Lynch-Kattman M, Schwantz S, Keller G. Development of the hemangioblast defines the onset of hematopoiesis in human ES cell differentiation cultures. Blood. 2007; 109: 2679–2687.
4. Lu S-J, Feng Q, Caballero S, Chen Y, Moore MAS, Grant MB, Lanza R. Generation of functional hemangioblasts from human embryonic stem cells. Nat Methods. 2006; 6: 501–509.
5. Huber TL, Kouskoff V, Fehling HJ, Palis J, Keller G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature. 2004; 432: 625–630.[CrossRef][Medline] [Order article via Infotrieve]
6. Vogeli KM, Jin S-W, Martin GR, Stainier DYR. A common progenitor for haematopoietic and endothelial lineages in the zebrafish gastrula. Nature. 2006; 443: 337–339.[CrossRef][Medline] [Order article via Infotrieve]
7. Kinder SJ, Tsang TE, Quinlan GA, Hadjantonakis A-K, Nagy A, Tam PPL. The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo. Development. 1999; 126: 4691–4701.[Abstract]
8. Ueno H, Weissman IL. Clonal analysis of mouse development reveals a polyclonal origin for yolk sac blood islands. Dev Cell. 2006; 11: 519–533.[CrossRef][Medline] [Order article via Infotrieve]
9. Stainier DYR, Weinstein BM, Detrich HWI, Zon LI, Fishman MC. cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development. 1995; 121: 3141–3150.[Abstract]
10. Li X, Xiong J-W, Shelley CS, Park H, Arnaout MA. The transcription factor ZBP-89 controls generation of the hematopoietic lineage in zebrafish and mouse embryonic stem cells. Development. 2006; 133: 3641–3650.
11. Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, Zon LI. SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev. 1998; 12: 621–626.
12. Liao W, Bisgrove BW, Sawyer H, Hug B, Bell B, Peters K, Grunwald DJ, Stainier DY. The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development. 1997; 124: 381–389.[Abstract]
13. Fouquet B, Weinstein BM, Serluca FC, Fishman MC. Vessel patterning in the embryo of the zebrafish: Guidance by notochord. Dev Biol. 1997; 183: 37–48.[CrossRef][Medline] [Order article via Infotrieve]
14. Patterson LJ, Gering M, Patient R. Scl is required for dorsa aorta as well as blood formation in zebrafish embryos. Blood. 2005; 105: 3502–3511.
15. Brown LA, Rodaway AR, Schilling TF, Jowett T, Ingham PW, Patient RK, Sharrocks AD. Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech Dev. 2000; 90: 237–252.[CrossRef][Medline] [Order article via Infotrieve]
16. Sumanas S, Lin S. Ets1-related protein is a key regulator of vasculogenesis in zebrafish. PLos Biol. 2006; 4: e10.[CrossRef][Medline] [Order article via Infotrieve]
17. Pham T, Lawson ND, Mugford JW, Dye L, Castranova D, Lo B, Weinstein BM. Combinatorial function of ETS transcription factors in the developing vasculature. Dev Biol. 2006; 303: 772–783.[CrossRef][Medline] [Order article via Infotrieve]
18. Sumanas S, Jorniak T, Lin S. Identification of novel vascular endothelial-specific genes by the microarray analysis of the zebrafish cloche mutants. Blood. 2005; 106: 534–541.
19. Weber GJ, Choe SE, Dooley KA, Paffett-Lugassy NN, Zhou Y, Zon LI. Mutant-specific gene programs in the zebrafish. Blood. 2005; 106: 521–530.
20. Qian F, Zhen F, Ong C, Jin SW, Meng SH, Stainier DY, Lin S, Peng J, Wen Z. Microarray analysis of zebrafish cloche mutant using amplified cDNA and identification of potential downstream target genes. Dev Dyn. 2005; 233: 1163–1172.[CrossRef][Medline] [Order article via Infotrieve]
21. Wang C, Faloon P, Tan Z, Lv Y, Zhang P, Ge Y, Deng HK, Xiong J-W. Mouse Lycat controls the development of hematopoietic and endothelial lineages during in vitro embryonic stem-cell differentiation. Blood. 2007; 110: 3601–3609.
22. Cao J, Liu Y, Lockwood J, Burn P, Shi Y. A novel cardiolipin-remodeling pathway revealed by a gene encoding an endoplasmic reticulum-associated acyl-CoA:lysocardiolipin acyltransferase (ALCAT1) in mouse. J Biol Chem. 2004; 279: 31727–31734.
23. Nusse R. Wnts and hedgehogs: lipid-modified proteins and similarities in signaling mechanisms at the cell surface. Development. 2003; 130: 5297–5305.
24. Linder ME, Deschenes RJ. New insights into the mechanisms of protein palmitoylation. Biochemistry. 2003; 42: 4311–4320.[CrossRef][Medline] [Order article via Infotrieve]
25. Kadowaki T, Wilder E, Klingensmith J, Zachary K, Perrimon N. The segment polarity gene porcupine encodes a putative multitransmembrane protein involved in wingless processing. Genes Dev. 1996; 10: 3116–3128.
26. Willert K, Brown JD, Danenberg E, Duncan AW, Weissman I, Reya T, Yates JR, Nusse R. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature. 2003; 423: 448–452.[CrossRef][Medline] [Order article via Infotrieve]
27. Chamoun Z, Mann RK, Nellen D, von Kessler DP, Bellotto M, Beachy PA, Basler K. Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the hedgehog signal. Science. 2001; 293: 2080–2084.
28. Stainier DYR, Fouquet B, Chen J, Warren KS, Weinstein BM, Meiler S, Mohideen MPK, Neuhauss SCF, Solnica-Krezel L, Schier AF, Zwartkruis F, Stemple DL, Malicki J, Driever W, Fishman MC. Mutations affecting the formation and function of the cardiovascular system in the zebrafish embryo. Development. 1996; 123: 285–292.[Abstract]
29. Long Q, Meng A, Wang H, Jessen JR, Farrell MJ, Lin S. GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene. Proc Natl Acad Sci U S A. 1997; 94: 6267–6272.
30. Cross LM, Cook MA, Lin S, Chen JN, Rubinstein AL. Rapid analysis of angiogenesis drugs in live fluorescent zebrafish assay. Arterioscler Thromb Vasc Biol. 2003; 23: 911–912.
31. Qian F, Zhen F, Xu J, Huang M, Li W, Wen Z. Distinct functions for different scl isoforms in zebrafish primitive and definitive hematopoiesis. PLos Biol. 2007; 5: 1110–1119.
32. Lawson ND, Vogel AM, Weinstein BM. Sonic hedgehog and vascular endothelial growth factor act upstream of the notch pathway during arterial endothelial differentiation. Dev Cell. 2002; 3: 127–136.[CrossRef][Medline] [Order article via Infotrieve]
33. Gering M, Patient R. Hedgehog signaling is required for adult blood stem cell formation in zebrafish embryos. Dev Cell. 2005; 8: 389–400.[CrossRef][Medline] [Order article via Infotrieve]
34. Linder ME, Deschenes RJ. Model organisms lead the way to protein palmitoyltransferases. J Cell Sci. 2004; 117: 521–526.
35. Roth AF, Wan J, Bailey AO, Sun B, Kuchar JA, Green WN, Phinney BS, Yates JR, Davis NG. Global analysis of protein palmitoylation in yeast. Cell. 2006; 125: 1003–1013.[CrossRef][Medline] [Order article via Infotrieve]
36. Dooley KA, Davidson AJ, Zon LI. Zebrafish scl functions independently in hematopoietic and endothelial development. Dev Biol. 2005; 277: 522–536.[CrossRef][Medline] [Order article via Infotrieve]
37. Gering M, Yamada Y, Rabbitts TH, Patient RK. Lmo2 and SCL/Tal1 convert non-axial mesoderm into haemangioblasts which differentiate into endothelial cells in the absence of Gata1. Development. 2003; 130: 6187–6199.
Related Article:
Circ. Res. 2008 102: 1005-1007.
This article has been cited by other articles:
![]() |
Y. Zhao, Y.-Q. Chen, S. Li, R. J. Konrad, and G. Cao The microsomal cardiolipin remodeling enzyme acyl-CoA lysocardiolipin acyltransferase is an acyltransferase of multiple anionic lysophospholipids J. Lipid Res., May 1, 2009; 50(5): 945 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Jin and C. Patterson The Opening Act: Vasculogenesis and the Origins of Circulation Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 623 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Peterkin, A. Gibson, and R. Patient Common genetic control of haemangioblast and cardiac development in zebrafish Development, May 1, 2009; 136(9): 1465 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liu and R. Patient Genome-Wide Analysis of the Zebrafish ETS Family Identifies Three Genes Required for Hemangioblast Differentiation or Angiogenesis Circ. Res., November 7, 2008; 103(10): 1147 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Patan Lycat and cloche at the Switch Between Blood Vessel Growth and Differentiation? Circ. Res., May 9, 2008; 102(9): 1005 - 1007. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |