Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2008;102:831-839
Published online before print February 21, 2008, doi: 10.1161/CIRCRESAHA.107.166488
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
102/7/831    most recent
CIRCRESAHA.107.166488v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, X.
Right arrow Articles by Xu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, X.
Right arrow Articles by Xu, X.
Related Collections
Right arrow Animal models of human disease
Right arrow Developmental biology
Right arrow Cardiac development
Right arrow Genetics of cardiovascular disease
(Circulation Research. 2008;102:831.)
© 2008 American Heart Association, Inc.


Molecular Medicine

Wnt3a Regulates the Development of Cardiac Neural Crest Cells by Modulating Expression of Cysteine-Rich Intestinal Protein 2 in Rhombomere 6

Xiaojing Sun, Ruilin Zhang, Xueying Lin, Xiaolei Xu

From the Department of Biochemistry and Molecular Biology/Division of Cardiovascular Diseases, Mayo Clinic College of Medicine, Rochester, Minn.

Correspondence to Xiaolei Xu, PhD, Department of Biochemistry and Molecular Biology/Division of Cardiovascular Diseases, Mayo Clinic College of Medicine, Stabile 4-10, 200 First St SW, Rochester, MN 55905. E-mail xu.xiaolei{at}mayo.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The cardiac neural crest is a subpopulation of neural crest cells (NCCs) that originates from the dorsal neural tube and later migrates to the heart and pharyngeal arch (PA), where they contribute to distinct aspects of cardiogenesis and PA patterning. Wnt family members have been implicated in general neural crest induction; however, the molecular mechanisms underlying the specification of distinct cell types such as cardiac NCCs remain unclear. Here, we have identified cysteine-rich intestinal protein 2 (crip2), a gene encoding for a LIM domain–containing protein, as a novel marker for cardiac NCCs in zebrafish. We observed a dynamic expression pattern for crip2, with expression being detected in the premigratory NCCs in rhombomere 6 (r6), migrating NCCs, ventricular cardiomyocytes, and aortic vessels in PAs 3 to 6. Interestingly, expression of wnt3a was detected in regions of the dorsal neural tube encompassing r6, and reduction of wnt3a led to disrupted expression of crip2 in r6, abnormal migration of NCCs, and defective cardiac function, as well as PA development. Furthermore, these phenotypes could be recapitulated by reduction of crip2 and rescued by overexpression of crip2. In summary, our data suggest a specific role for Wnt3a in the development of cardiac NCCs. We propose that this function of wnt3a in r6 is partially mediated by crip2 expression in the premigratory cardiac NCCs, which subsequently affects cardiac function and PA patterning.


Key Words: wnt3a • crip2sema3d • zebrafish • cardiac neural crest cell


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Proper development of the cardiac neural crest (NC) cells (NCCs) is essential for both cardiogenesis and the establishment of cardiac functions; indeed, cardiac NC defects have been linked to various congenital heart diseases.1 In chicken, the premigratory cardiac NC spans a region of the dorsal hindbrain corresponding to rhombomeres 6 to 8 (r6 to r8).2 Once determined, cardiac NCCs migrate through the third, fourth, and sixth pharyngeal arches (PAs) and then further into the cardiac outflow tract. Some cardiac NCCs stay in the PAs and contribute to the patterning of PA arteries.3 In zebrafish, premigratory cardiac NCCs were mapped to a broader rostrocaudal region of the dorsal neural tube, ranging from r1 to somite 6.4,5 In addition, cardiac NCCs in zebrafish appear to migrate through all PAs and contribute to additional cell types such as cardiomyocytes. Within the segmental PAs, zebrafish NCCs contribute to the formation of cartilage, neurons, glia, and pigment cells, whereas the muscles and endothelia are derived from another group of migrating cells originating in the paraxial mesoderm.6 Expression of dlx2 and hand2 serves as a marker for postmigratory cranial NCCs in the PAs both in mice and zebrafish.7,8 Within each arch, dlx2/hand2-expressing NCCs enclose a central core of endoderm-derived cells, which are demarcated by the expression of endothelin-1.9

Wnt genes encode secreted glycoproteins that play multiple important roles during embryonic development,10 including general induction of NCCs.11,12 In zebrafish, the role of Wnt signaling in general NCC induction has been ascribed to wnt8.1, which is expressed in proximity to the NCC during gastrulation.13 In chicken, wnt6 has been suggested to mediate induction of the NCC.14 wnt1 and wnt3a have been found to express in the dorsal part of the neural tube and to affect NCC development by regulating the patterning along the dorsoventral axis,12 by modulating the proliferation of NCC progenitors,15 and by promoting pigment cell linage at the expense of neurons and glia.16 Antisense-mediated attenuation of wnt1 and wnt3a expression resulted in narrowing of the conotruncal region,17 and mice lacking dishevelled2 (Dvl2) were found to exhibit outflow tract defects.18 However, it still remains elusive whether the cardiac defects observed on disruption of canonical Wnt signaling represent a direct role for canonical Wnts in cardiac NCC development or are simply an indirect consequence of altering general NCC induction.

Here, we reveal a specific and possibly direct role for signaling mediated by the canonical Wnt family member Wnt3a in the development of zebrafish cardiac NCCs. Our discovery originated from the detection of a novel early expression pattern of crip2 (cysteine-rich intestinal protein 2), which encodes a 2-LIM-domain protein and has been reported to express in the developing heart and the adult heart including the cardiac endothelial cells.19,20 In zebrafish, we established crip2 as a novel molecular marker for a subpopulation of premigratory cardiac NCCs in r6. Genetic studies suggested that wnt3a regulates cardiac NCC development, and subsequently cardiac function and PA patterning, by modulating the expression of crip2 in premigratory NCCs in r6.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Zebrafish Husbandry
Wild-type zebrafish (Danio rerio) were raised in the laboratory and handled according to standard procedures outlined in a protocol approved by the Mayo Institutional Animal Care and Use Committee.

Bioinformatics
The phylogenetic tree was constructed by the neighbor-joining method, and bootstrap values were calculated from 1000 random samples of sites from the alignment and implemented in the program ClustalW. Bootstrap value measures the reproducibility of the tree branchings, varying from 0 to 100.

In Situ Hybridization
Whole-mount in situ hybridization (ISH)21 and 2-color ISH22 were performed as previously described. Images were recorded using a Leica III dissecting microscope. Primers for the crip2 riboprobe were 5'-TCGGCCCAAAAGGTGTAAAC-3' (forward) and 5'-GGTAATACGACTCACTATAGG AACATACAGAAGCAGCAGGAC- 3' (reverse).

mRNA Overexpression
The full-length cDNAs of zebrafish wnt3a and dkk1 were amplified using RT-PCR. Capped mRNA was synthesized using the mMachine kit (Ambion Inc). Synthesized mRNA was diluted to 500 µg/mL and injected into 1-cell-staged embryos. Primers for cloning of full-length crip2 were 5'-CGCGGATCCCTCGAGCGATGGCTTCAAAGTGTCCC-3' (forward); 5'-CCGGAATTCAAAGAAAAGTCAAGGCTGAG-3' (reverse).

Morpholino Oligonucleotides
The morpholino-modified oligonucleotides were purchased from Gene Tools, LLC (Corvallis, Ore). The wnt3a morpholino-modified antisense oligonucleotide (MO) recognizes the splicing donor of the first exon.23 The sequence for the crip2 MO targeting the ATG was GCATTTGGGACACTTTGAAGCCATC; the sequence for the crip2 MO targeting exon 2 was TGATCTCTGTTTTACTCACCTCGGC.

Measurement of Cardiac Function
Movies of beating hearts at 48 hours postfertilization (hpf) were recorded using a Zeiss microscope, and the lengths of the long axis (a) and short axis (b) between the myocardial borders of ventricles at diastole and systole, respectively, were measured. The percentage shortening fraction (%SF) was calculated using the formula: %SF=[(length at diastole–length at systole)/length at diastole]x100. To measure the heart rate, we counted the number of sequential contractions of hearts over 30-second intervals.

Alcian Blue Staining
Alcian blue (Sigma) was used to stain the extracellular matrix associated with chondrocytes.6 Images were photographed with a Leica III dissecting microscope.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
crip2 Is Expressed in Premigratory NCCs, Migrating NCCs, Cardiomyocytes, and the Pharyngeal Arches in a Developmentally Regulated Manner
In the process of searching for genes expressed exclusively in the heart or heart progenitor cells of zebrafish, we identified crip2, a gene located on chromosome 17. The 2 LIM domains of Crip2, however, are distinct from those in the closely related cysteine-rich protein (Csrp) family (Figure IA and IB in the online data supplement, available at http://circres. ahajournals.org). The identities of the peptide sequences between zebrafish Crip2 (XP_689198) and homologs from fugu, rat, mouse, and human are 77%, 75%, 75%, and 76%, respectively. Syntenic analysis identified the neighboring gene as MTA1 in both zebrafish and human, suggesting that zebrafish crip2 is an ortholog of human Crip2.

We first determined the expression pattern of crip2 at different stages of development using whole-mount ISH staining. From the 6-somite to the 10-somite stage, crip2 is detected in a subpopulation of cells in the dorsal part of the neural tube (Figure 1A and 1B), a region that has been suggested to represent premigratory NCCs (Figure 1G). At the 10-somite stage, the crip2 expression domain marks the posterior end of the region of the anterior lateral plate mesoderm containing the cardiac progenitor cells, as revealed by costaining for titin (ttna) (inset in Figure 1B), an early molecular marker for the primary heart field.21 As embryogenesis progresses (10- to 18-somite stage), the crip2 signal in the dorsal patch becomes stronger and starts to extend ventrally toward the primary heart field (Figure 1D). Analysis of transverse sections revealed crip2-positive cells in a group of cells adjacent to the neural tube, suggesting their identity as migrating NCCs (arrowhead in Figure 1H). In addition, we also detected 2 patches of crip2-positive cells in the ventral region during the 10- to 20-somite stages (black brackets in Figure 1H through 1K). These cells are located in proximity to the cardiomyocytes in the primary heart field, as revealed by double ISH staining for crip2 and cmlc2, a marker for differentiated cardiomyocytes (Figure 1M through 1O), suggesting their identity as mesoendodermal cells. At later stages of heart development (21-somite to 24 hpf), expression of the crip2 transcript is detected within the heart tube (Figure 1E and 1L), and at 36 hpf, crip2 expression is mainly detected in the ventricular cardiomyocytes, with relatively little expression being detected in the atrium (Figure 1F and 1P through 1R). In addition, crip2-positive cells were also detected in the aortic vessels in PAs 3–6 (Figure 5Q).


Figure 1
View larger version (60K):
[in this window]
[in a new window]

 
Figure 1. crip2 exhibits a developmentally regulated dynamic pattern of expression. A through F, Shown are embryos stained by whole-mount ISH using a crip2 riboprobe. Lateral views are shown in A through C, with anterior at left; dorsal views are shown in D and E; a ventral view is shown in F, with anterior at the top. Arrowheads indicate premigratory and migrating cardiac NCCs, whereas arrows indicate the heart tube. V, ventricle, A, atrium. The inset in B shows a magnified region of a dorsal view of an embryo stained by whole-mount ISH using crip2 and titin (ttna) riboprobes. G through L, Shown are transverse sections of embryos after ISH staining using a crip2 riboprobe. Dorsal is up. Black brackets indicate crip2 staining next to the heart field. The neural tube is outlined by a dashed line. M through O, Shown are dorsal views of left side of the embryos stained using 2-color ISH with riboprobes for crip2 (green) and cmlc2 (red), a cardiomyocyte marker. Anterior is at the top. P through R, Shown are sagittal sections of the ventricle region of embryos at 36 hpf.

Two-color ISH staining using riboprobes for crip2 and either krox20, a hindbrain marker for r3 and r5 (Figure 2H), or hoxd4a, a hindbrain marker for r7 (data not shown), indicated that the crip2 expression domain is located in r6. Indeed, the crip2 expression domain was adjacent to, but not overlapping with, the expression domain of sema3d (Figure 2I), a secreted semaphorin expressed in r3 to r5 and whose expression pattern demarcates a subregion of the premigratory NC containing cells that later migrate into the heart.24 We also compared the location of the crip2 expression domain with the expression domains of sox10, foxD3, and crestin, 3 known NCC markers. As revealed by 2-color ISH staining, the crip2 expression domain overlaps with sox10 (supplemental Figure IIE through IIG) and partially overlaps with foxD3 (supplemental Figure IIH through IIJ), but does not overlap with crestin (supplemental Figure IIK through IIM). Together with the reported fate map data for cardiac NCCs, these observations suggest that crip2 is expressed in a subgroup of premigratory cardiac NCCs in r6.


Figure 2
View larger version (81K):
[in this window]
[in a new window]

 
Figure 2. wnt3a exhibits a spatially and temporally restricted pattern of expression in the cardiac NC. A through F, Shown are lateral views (A through E), with anterior at left, and a ventral view (F), with anterior at the top, of embryos stained for wnt3a using ISH. Brackets indicate the location of wnt3a signal in the hindbrain region. G through I, Shown are lateral views of 10-somite stage embryos after 2-color ISH staining for the indicated markers. Anterior is at left. The hindbrain marker krox20 (red) was used to indicate the location of rhombomeres 3 and 5 (r3 and r5, white asterisks). J, Schematic representation of the expression domains of wnt3a, crip2, and sema3d in the hindbrain.

wnt3a Is Expressed in a Region of the Hindbrain That Overlaps With the crip2 Expression Domain in r6
Members of the Wnt family have been implicated in NC induction; therefore, we have examined the expression patterns of a panel of Wnts using ISH, including wnt1, wnt3a, wnt4a, wnt5a, wnt7a, wnt8.1, wnt8b, wnt11, wnt11r, and wnt16. Of particular interest, we observed that wnt3a is strongly expressed in a dorsal region of the neural tube encompassing r6, which is different from the segmental expression pattern of wnt1 (data not shown).25 Similar to crip2, the expression of wnt3a was initially detected around the 6-somite stage (Figure 2B) and persisted until at least the 26-somite stage (Figure 2C through 2E). A relatively weak level of wnt3a expression was also detected in the dorsal part of r2 to r7 in the hindbrain region (brackets in Figure 2B and 2C), which covers the expression domains of both crip2 and sema3d (Figure 2G through 2I and summarized in 2J). Expression of wnt3a was never detected in the heart or PAs until at least 48 hpf (Figure 2F), suggesting that wnt3a does not have a direct function in early heart or PA development.

Reduction of wnt3a Ablates the Expression of crip2 in the Premigratory NC and Delays the Migration of NCCs
Prompted by the overlap in the wnt3a and crip2 expression domains in r6 (Figure 2J), we examined the relationship between the 2 genes. First, we reduced the expression of wnt3a by injecting 100 pg of MOs into single-cell-staged embryos. Subsequently, the expression of crip2 and sema3d was examined in these wnt3a morphants using ISH. At the 6- to 8-somite stage, reduction of wnt3a resulted in an ablation of crip2 expression, as well as a strong reduction in sema3d expression (n=74/85 and n=14/18; Figure 3E and 3F). Interestingly, migrating NCCs remained positive for crip2 expression (arrowheads in Figure 3Y through 3D'), which conveniently allowed us to observe the development of migrating NCCs. In comparison with age-matched wild-type embryos, the migration of these crip2-positive cells in wnt3a morphants was delayed, and these groups of migrating NCCs appeared less integrated within the separated space between the neural tube and surrounding tissues (Figure 3Z and 3C'). Importantly, coinjection of wnt3a mRNA with wnt3a MOs was capable of rescuing the reduced expression of crip2 in the premigratory NCCs of r6 in a dose-dependent manner (Figure 3H'), suggesting that the ablation of crip2 expression in r6 was a specific consequence of reduced levels of wnt3a. To further analyze the relationship between crip2 and wnt3a expression, we reduced crip2 expression using a MO that targets the crip2 translational start site. In this scenario, the mRNA is still transcribed and remains undisturbed, allowing us to follow the migration of NCCs by ISH staining using a crip2 riboprobe. We observed a defect in the migration of crip2-expressing cells at the 10- to 14-somite stage in crip2 ATG morphants similar to that observed for embryos injected with wnt3a MOs (Figure 3A' and 3D'), whereas the expression of wnt3a in the dorsal neural tube was not affected (data not shown). On the other hand, the expression of crip2 in the mesoendodermal cells remains normal in both wnt3a and crip2 ATG morphants from the 10- to 22-somite stages (Figure 3Y through 3G').


Figure 3
View larger version (88K):
[in this window]
[in a new window]

 
Figure 3. wnt3a is required for crip2 expression and cardiac NCC migration. A through L, Shown are 6- to 10-somite stage embryos stained using ISH with riboprobes for crip2 to mark the cardiac NC in r6, as indicated by arrowheads; sema3d to mark the cardiac NC in r3 to r5, as indicated by black asterisks; sox10 to mark NCCs; and krox20 to mark r3 and r5. A myoD riboprobe was included for all images, except C, G, and K, to label the somites and thereby indicate the developmental stage. Dorsal views are shown in C, G, and K, with anterior at the top. Other images are lateral views, with anterior at left. Insets show a magnified region of the respective dorsal view. M through X, Shown are 10- to 12-somite stage embryos. The expression of both crip2 and sema3d is detected in the cardiac NC. Y through G', Shown are cross-sections of embryos after ISH staining using a crip2 riboprobe. Dorsal is up. Arrowheads indicate the crip2-positive migrating NCCs, whereas the brackets indicate the crip2-positive cells in the ventral region adjacent to the heart field. The neural tube is outlined by a dashed line. H', Shown are percentages of embryos that exhibit expression of crip2 in r6 at the 6- to 10-somite stage.

Although crip2 expression was reduced in wnt3a morphants at the 6- to 8-somite stage, expression of both crip2 and sema3d was detected in these morphants at the 10- to 12-somite stage (n=15/17 and n=56/61; Figure 3M through 3T). Because crip2-positive cells could still be detected in both the migrating NCCs and 2 ventral patches of cells next to the heart field in wnt3a morphants (Figure 3Z and 3C'), a potential explanation for this observation is that the "recovered" expression at the 10- to 12-somite stage simply reflects a later stage of crip2 expression in the migrating NCCs. To eliminate the possibility that other canonical Wnts in the hindbrain region are accountable for the recovered expression of crip2 in r6, we injected dkk1 mRNA, a general Wnt inhibitor, into embryos. As expected, the expression of crip2 at the 6- to 8-somite stage was essentially ablated under these conditions (n=25/26; Figure 3I), and in addition, we observed a strong reduction in sema3d and sox10 expression (n=14/15 and n=8/11; Figure 3J and 3K). However, the expression of crip2 (n=50/82) and sema3d (n=12/15) was still detected at the 10- to 12-somite stage (Figure 3U and 3V). Combined with the coexpression data, our loss-of-function analyses suggest that crip2 expression in the premigratory NCCs in r6, but not its later expression in migrating NCCs, is regulated by wnt3a.

Overexpression of wnt3a Induces Ectopic Expression of crip2 in the Hindbrain
Next, we performed gain-of-function experiments to examine the roles of wnt3a in regulating the expression of crip2 in r6. As shown in Figure 4, injection of 130 pg of wnt3a mRNA significantly enhanced the expression of both crip2 (n=10/12; Figure 4E) and sema3d in the hindbrain (n=6/8; Figure 4F) at the 10- to 12-somite stage. This result lends support to an inductive role for canonical Wnt signaling in the expression of crip2 in premigratory cardiac NCCs. However, expansion of the crip2 expression domain may also be attributable, at least in part, to a general increase in the induction of NCCs, as indicated by the enhanced expression of sox10 (n=12/17; Figure 4G). To further examine whether canonical Wnt signaling plays a direct function in regulating crip2 expression in r6, we activated the canonical Wnt signaling by treating embryos with LiCl, which inhibits glycogen synthase kinase-3β, a negative regulatory component in the canonical Wnt pathway. As expected, treatment of embryos with LiCl at 50% to 90% epiboly, a time frame before general NCC induction, resulted in enhanced expression of crip2, sema3d, and sox10 at the 10- to 12-somite stage (n=13/16, n=11/16, and n=13/15; Figure 4I through 4K). More importantly, treatment of embryos at the 6- to 8-somite stage, a time frame after the induction of NCCs,13 resulted in enhanced expression of crip2 and sema3d, but not sox10, at the 10- to 12-somite stage (n=15/20, n=12/16, and n=14/15; Figure 4M through 4O). Thus, these data strongly suggested a direct role for canonical Wnt signaling in the induction of crip2 expression in r6, which is independent of the earlier function of canonical Wnts in general NCC induction.


Figure 4
View larger version (71K):
[in this window]
[in a new window]

 
Figure 4. Activation of the canonical Wnt signaling pathway expands the expression domain of crip2. A through P, Shown are embryos stained using whole-mount ISH with riboprobes for crip2 at 10- to 12-somite stage to mark the cardiac NC in r6, as indicated by arrowheads; sema3d to mark the cardiac NC in r3 to r5, as indicated by black asterisks; sox10 to mark NCCs; and krox20 to mark r3 and r5. Shown in A through D are wild-type embryos; in E through H are embryos injected with 130 pg of wnt3a; in I through L are embryos treated with 0.3 mol/L LiCl for 20 minutes at 50% epiboly; and in M through P are embryos treated with LiCl at the 6-somite stage. A myoD riboprobe was included in A, B, D, I, and M as an indicator of specific developmental stages by labeling the somites. Shown in C, G, K, and O are dorsal views, with anterior at the top. Other images are lateral views, with anterior at left. Insets show a magnified region of the respective dorsal view. Q through V, The crip2 expression domain is expanded beyond r6 on Wnt activation. Embryos were treated with LiCl at 50% epiboly or injected with Wnt3a mRNA at single-cell stage. Shown are lateral views of embryos stained using 2-color ISH with riboprobes for crip2 (green) and krox20 (red) at 10- to 12-somite stage. Anterior is at left. Arrows indicate the borders of the crip2 expression domain. Asterisks indicate krox20 expression in r3 and r5.

It has been well established that canonical Wnt signaling is involved in the establishment of anterior–posterior polarity in the hindbrain.26 Accordingly, we observed anteriorization of hindbrain pattering on activation (Figure 4H and 4L) and posteriorization on inhibition (Figure 3L and 3X) of the canonical Wnt signaling pathway. However, the crip2 expression domain in the hindbrain is not strictly in register with rhombomere borders, as demonstrated by 2-color ISH staining with krox20 and crip2 riboprobes. The expression domain of crip2 at the 10- to 12-somite stage can expand from r6 to r5 on treatment of embryos with LiCl at 50% epiboly stage (Figure 4Q through 4S) or even as far as r4 on injection of wnt3a mRNA (Figure 4T through 4V). These data suggest that the induction of crip2 expression in the hindbrain by canonical Wnt signaling is not coregulated by Wnts that mediate hindbrain patterning.

crip2 mRNA Can Rescue Defects in Both PA Patterning and Cardiac Function Observed in wnt3a Morphants
To further examine of the relationship between wnt3a and crip2 in cardiac NC development, we compared the cardiac NC-related phenotypes of wnt3a and crip2 morphants, including PA patterning and cardiac function. Reduction of wnt3a led to a disruption in tissues derived from NCCs in PAs 3 to 6, as revealed by ISH using hand2, a marker for ventral NCCs, and dlx2, a marker for cranial NCCs, as riboprobes (Figure 5B and 5F). In addition, at day 5, staining using Alcian blue indicated that the amount of NCC-derived cartilage normally present in PAs 3 to 6 was reduced or undetectable (Figure 5J). As a control, the expression of hand2 and dlx2 in the mandibular arch and hyoid arch was normal, suggesting the specificity of these PA phenotypes. Reduction of wnt3a also led to a disruption in the development of the aortic vessels in PAs 3 to 6, as indicated by ISH staining using cdh5 and crip2 riboprobes (Figure 5N and 5R). Importantly, the defects observed in cartilage cell and aortic vessel development in wnt3a morphants do not appear to be the result of a general delay in development. Indeed, staining for endothelin-1 expression supported that development of the pharyngeal endoderm at the arch "core" and surface ectoderm is normal (Figure 5V).


Figure 5
View larger version (128K):
[in this window]
[in a new window]

 
Figure 5. Defects in pharyngeal arch patterning exhibited by wnt3a morphants are rescued by coinjection of crip2 mRNA. Shown in A through H and M through X are lateral views of 44-hpf embryos of the indicated genotypes (upper green image) stained using whole-mount ISH with riboprobes, as listed at left. Shown in I through L are ventral views of day 5 embryos after Alcian blue staining. Black arrowheads indicate staining in PAs 3 to 6. White arrowheads indicate cartilage in PAs 3 to 6; M, mandibular arch; H, hyoid arch.

Reduction of crip2 by using either the ATG or e2 splicing morpholino led to the same defects in PA development, which are similar to those observed in wnt3a morphants. The patterning of both the known NCC-derived tissues and aortic vessels in PAs 3 to 6 was disrupted (Figure 5C, 5G, 5K, 5O, 5S, and 5W). However, in contrast to the wnt3a morphants, where the cartilage of the mandibular arch failed to develop, mandibular arch development remained normal in crip2 morphants. This is consistent with the observation that the expression domain of wnt3a extends to more anterior regions in the hindbrain, including r2 to r3, which contribute to the formation of the mandibular arch,27,28 whereas the expression of crip2 is restricted to r6.

Although expression of wnt3a was not detected in the heart, in addition to the PA phenotypes, we also detected severe defects in cardiac function in wnt3a morphants. Starting at 48 hpf, the wnt3a morphants exhibited gross cardiac abnormalities, including extensive pericardiac edema and cardiac looping defects (n=123/145; Figure 6B). Quantification of the %SF indicated that ventricular contractility was dramatically reduced in wnt3a morphants (6.5±7.3% in morphant versus 21.5±6.8% in wild-type embryos; Figure 6D), and, additionally, heart rate was also reduced in wnt3a morphants (69±31 in morphant versus 118±10 in wild-type embryos; Figure 6E). Similar to the wnt3a morphants, both crip2 splicing and ATG morphants exhibited strong pericardiac edema (n=86/91; Figure 6C and data not shown), compromised cardiac contractility (%SF was 7.9±6.1% and 8.2±7.5% in splicing and ATG morphants versus 21.5±6.8% in wild-type embryos), and reduced heart rate (85±17 and 89±21 in splicing and ATG morphants versus 118±10 in wild-type embryos; Figure 6D and 6E).


Figure 6
View larger version (49K):
[in this window]
[in a new window]

 
Figure 6. The roles of crip2 and wnt3a in mediating proper cardiac function are interlinked. A through C, Shown are lateral views of live 48-hpf embryos of wild-type (WT), wnt3a MO, and crip2 e2 MO. Black arrowheads indicate pericardiac edema. D and E, Graphs depicting the mean±SD %SF of ventricular chambers (D) or heart rate (E) measured for wild-type, morphant, and rescued embryos, as indicated. *Significant difference (P<0.001) between wild-type embryos and the respective morphants; #significant difference (P<0.001) between wnt3a morphants and wnt3a morphants coinjected with crip2 mRNA.

Finally, to more stringently test the relationship between wnt3a and crip2, we examined whether crip2 mRNA could rescue the cardiac NC-related phenotypes in wnt3a morphants. Indeed, coinjection of 120 pg of crip2 mRNA with 100 pg of wnt3a MOs rescued the PA defects observed in wnt3a morphants, except the mandibular arch defect (Figure 5D, 5H, 5L, 5P, 5T, and 5X). In addition, the wnt3a MO-induced defects in cardiac function could be partially rescued by coinjection of crip2 mRNA. The %SF was increased from 6.5±7.3% in wnt3a morphants to 18.1±10.8% in rescued embryos, which is comparable to the 21.5±6.8% SF measured for wild-type embryos (Figure 6D). Similarly, the heart rate was elevated from 69±31 to 107±22 in wnt3a morphants versus rescued embryos, respectively, which is comparable to the heart rate of wild-type embryos (118±10; Figure 6E). Collectively, these results strongly suggest that Wnt3a regulates crip2 expression and thereby mediates the development of cardiac NCCs.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In this study, we identified a cardiac-specific gene crip2 with a dynamic pattern of expression including the premigratory NCCs in r6 that overlaps with expression domains of wnt3a. Our morphological, genetic, and functional data strongly support that wnt3a regulates the expression of crip2 in the premigratory cardiac NC region and thereby mediates the development and downstream functions of cardiac NCCs. It has been established previously that Wnt signaling mediates further differentiation of NCCs toward the pigment cell lineage,16,29 in addition to general NC induction. Here, our data suggest a specific role for wnt3a in the development of the cardiac NCC lineage in zebrafish. In comparison with crip2 and sema3d, 2 premigratory cardiac NC markers, wnt3a is expressed in a broad domain along the dorsal neural tube, making it a promising candidate gene for a general cardiac NC inducer. Consistent with a previous notion that general NCC induction and hindbrain patterning are 2 independent functions of Wnts,30 our observations suggest that the roles of wnt3a in the induction of the cardiac NC and hindbrain patterning are independent of each other.

The expression of wnt3a has not been detected in the migrating NCC, heart, or PAs until at least 48 hpf, which explains why crip2 expression at later stages is not regulated by wnt3a. However, we observed severe defects in both cardiac function and patterning of the PAs in wnt3a morphants. Importantly, we showed that these phenotypes were recapitulated by reduction of crip2 and, furthermore, that wnt3a morphants could be rescued by coinjection of crip2 mRNA. Our genetic analyses are in strong support of the concept that wnt3a indirectly mediates proper cardiac function and PA development through its direct role in the induction of premigratory cardiac NCCs in r6.

Restriction of the expression domains of crip2 to r6 and sema3d to r3 to r5 suggests that the cardiac NC is partitioned into different subpopulations of cells early on during NCC development, before migration. Indeed, in mouse, Lbx1, a homeobox gene, has also been suggested to specify a subpopulation of cardiac NCCs.31 Our present data suggest that wnt3a is not involved in determining different subpopulations of cardiac NCCs, because both crip2 and sema3d are affected in wnt3a morphants. Obviously, additional temporal- and spatial-restricted cues are needed to ensure proper partition of premigratory cardiac NCCs in r6 or r3 to r5, which will be further investigated.

In contrast to the relatively stable and restricted expression pattern of wnt3a, the highly dynamic and transient nature of crip2 expression suggests Crip2 may serve multiple functions during different stages of cardiac NCC development. Interestingly, crip2 expression was reported in the endocardial cells of the adult mouse heart,20 which raised the possibility that the heart vasculature is, to some extent, derivative of cardiac NCCs. Here, we reveal an essential role for crip2 in the early stages of cardiac NC development. It will be interesting to investigate whether crip2 interacts with actin filaments or functions as an adaptor for transcription factors, as has been suggested by other studies,32,33 during the induction and development of cardiac NCCs.

In summary, our identification and analysis of a novel cardiac NCC marker, crip2, has allowed us to reveal a direct function for the canonical Wnt signaling pathway in the induction and development of the cardiac NC. Future investigation as to how wnt3a and crip2 regulate the development of cardiac NCCs in zebrafish promises to provide important insights into the molecular mechanisms underlying congenital heart defects resulting from defective cardiac NC development.


*    Acknowledgments
 
We thank Dr Masahiko Hibi for providing the pCS2-wnt3a construct, Dr Heather M. Thompson for helping prepare the manuscript, and Beninior Jomok for maintaining the zebrafish facility.

Sources of Funding

This work was supported by the Mayo Foundation (to X.X.).

Disclosures

None.


*    Footnotes
 
Original received October 20, 2007; revision received February 5, 2008; accepted February 8, 2008.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Stoller JZ, Epstein JA. Cardiac neural crest. Semin Cell Dev Biol. 2005; 16: 704–715.[CrossRef][Medline] [Order article via Infotrieve]

2. Kirby ML, Gale TF, Stewart DE. Neural crest cells contribute to normal aorticopulmonary septation. Science. 1983; 220: 1059–1061.[Abstract/Free Full Text]

3. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cardiac neural crest. Development. 2000; 127: 1607–1616.[Abstract]

4. Sato M, Yost HJ. Cardiac neural crest contributes to cardiomyogenesis in zebrafish. Dev Biol. 2003; 257: 127–139.[CrossRef][Medline] [Order article via Infotrieve]

5. Li YX, Zdanowicz M, Young L, Kumiski D, Leatherbury L, Kirby ML. Cardiac neural crest in zebrafish embryos contributes to myocardial cell lineage and early heart function. Dev Dyn. 2003; 226: 540–550.[CrossRef][Medline] [Order article via Infotrieve]

6. Schilling TF, Kimmel CB. Segment and cell type lineage restrictions during pharyngeal arch development in the zebrafish embryo. Development. 1994; 120: 483–494.[Abstract]

7. Akimenko MA, Ekker M, Wegner J, Lin W, Westerfield M. Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J Neurosci. 1994; 14: 3475–3486.[Abstract]

8. Angelo S, Lohr J, Lee KH, Ticho BS, Breitbart RE, Hill S, Yost HJ, Srivastava D. Conservation of sequence and expression of Xenopus and zebrafish dHAND during cardiac, branchial arch and lateral mesoderm development. Mech Dev. 2000; 95: 231–237.

9. Miller CT, Schilling TF, Lee K, Parker J, Kimmel CB. sucker encodes a zebrafish endothelin-1 required for ventral pharyngeal arch development. Development. 2000; 127: 3815–3828.[Abstract]

10. Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004; 20: 781–810.[CrossRef][Medline] [Order article via Infotrieve]

11. Yanfeng W, Saint-Jeannet JP, Klein PS. Wnt-frizzled signaling in the induction and differentiation of the neural crest. Bioessays. 2003; 25: 317–325.[CrossRef][Medline] [Order article via Infotrieve]

12. Saint-Jeannet JP, He X, Varmus HE, Dawid IB. Regulation of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc Natl Acad Sci U S A. 1997; 94: 13713–13718.[Abstract/Free Full Text]

13. Lewis JL, Bonner J, Modrell M, Ragland JW, Moon RT, Dorsky RI, et al. Reiterated Wnt signaling during zebrafish neural crest development. Development. 2004; 131: 1299–1308.[Abstract/Free Full Text]

14. Garcia-Castro MI, Marcelle C, Bronner-Fraser M. Ectodermal Wnt function as a neural crest inducer. Science. 2002; 297: 848–851.[Abstract/Free Full Text]

15. Ikeya M, Lee SM, Johnson JE, McMahon AP, Takada S. Wnt signalling required for expansion of neural crest and CNS progenitors. Nature. 1997; 389: 966–970.[CrossRef][Medline] [Order article via Infotrieve]

16. Dorsky RI, Moon RT, Raible DW. Control of neural crest cell fate by the Wnt signalling pathway. Nature. 1998; 396: 370–373.[CrossRef][Medline] [Order article via Infotrieve]

17. Augustine K, Liu ET, Sadler TW. Antisense attenuation of Wnt-1 and Wnt-3a expression in whole embryo culture reveals roles for these genes in craniofacial, spinal cord, and cardiac morphogenesis. Dev Genet. 1993; 14: 500–520.[CrossRef][Medline] [Order article via Infotrieve]

18. Hamblet NS, Lijam N, Ruiz-Lozano P, Wang J, Yang Y, Luo Z, Mei L, Chien KR, Sussman DJ, Wynshaw-Boris A. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development. 2002; 129: 5827–5838.[CrossRef][Medline] [Order article via Infotrieve]

19. Yu TS, Moctezuma-Anaya M, Kubo A, Keller G, Robertson S. The heart LIM protein gene (Hlp), expressed in the developing and adult heart, defines a new tissue-specific LIM-only protein family. Mech Dev. 2002; 116: 187–192.[CrossRef][Medline] [Order article via Infotrieve]

20. Zhang L, Hoffman JA, Ruoslahti E. Molecular profiling of heart endothelial cells. Circulation. 2005; 112: 1601–1611.[Abstract/Free Full Text]

21. Seeley M, Huang W, Chen Z, Wolff WO, Lin X, Xu X. Depletion of zebrafish titin reduces cardiac contractility by disrupting the assembly of Z-discs and A-bands. Circ Res. 2007; 100: 238–245.[Abstract/Free Full Text]

22. Clay H, Ramakrishnan L. Multiplex fluorescent in situ hybridization in zebrafish embryos using tyramide signal amplification. Zebrafish. 2005; 2: 105–111.[CrossRef][Medline] [Order article via Infotrieve]

23. Shimizu T, Bae YK, Muraoka O, Hibi M. Interaction of Wnt and caudal-related genes in zebrafish posterior body formation. Dev Biol. 2005; 279: 125–141.[CrossRef][Medline] [Order article via Infotrieve]

24. Sato M, Tsai HJ, Yost HJ. Semaphorin3D regulates invasion of cardiac neural crest cells into the primary heart field. Dev Biol. 2006; 298: 12–21.[CrossRef][Medline] [Order article via Infotrieve]

25. Amoyel M, Cheng YC, Jiang YJ, Wilkinson DG. Wnt1 regulates neurogenesis and mediates lateral inhibition of boundary cell specification in the zebrafish hindbrain. Development. 2005; 132: 775–785.[Abstract/Free Full Text]

26. Riley BB, Chiang MY, Storch EM, Heck R, Buckles GR, Lekven AC. Rhombomere boundaries are Wnt signaling centers that regulate metameric patterning in the zebrafish hindbrain. Dev Dyn. 2004; 231: 278–291.[CrossRef][Medline] [Order article via Infotrieve]

27. Yelick PC, Schilling TF. Molecular dissection of craniofacial development using zebrafish. Crit Rev Oral Biol Med. 2002; 13: 308–322.[Abstract/Free Full Text]

28. Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP, Sommer L, Boussadia O, Kemler R. Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development. 2001; 128: 1253–1264.[Abstract]

29. Dorsky RI, Raible DW, Moon RT. Direct regulation of nacre, a zebrafish MITF homolog required for pigment cell formation, by the Wnt pathway. Genes Dev. 2000; 14: 158–162.[Abstract/Free Full Text]

30. Wu J, Yang J, Klein PS. Neural crest induction by the canonical Wnt pathway can be dissociated from anterior-posterior neural patterning in Xenopus. Dev Biol. 2005; 279: 220–232.[CrossRef][Medline] [Order article via Infotrieve]

31. Schafer K, Neuhaus P, Kruse J, Braun T. The homeobox gene Lbx1 specifies a subpopulation of cardiac neural crest necessary for normal heart development. Circ Res. 2003; 92: 73–80.[Abstract/Free Full Text]

32. van Ham M, Croes H, Schepens J, Fransen J, Wieringa B, Hendriks W. Cloning and characterization of mCRIP2, a mouse LIM-only protein that interacts with PDZ domain IV of PTP-BL. Genes Cells. 2003; 8: 631–644.[Abstract]

33. Weiskirchen R, Gunther K. The CRP/MLP/TLP family of LIM domain proteins: acting by connecting. Bioessays. 2003; 25: 152–162.[CrossRef][Medline] [Order article via Infotrieve]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
102/7/831    most recent
CIRCRESAHA.107.166488v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, X.
Right arrow Articles by Xu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, X.
Right arrow Articles by Xu, X.
Related Collections
Right arrow Animal models of human disease
Right arrow Developmental biology
Right arrow Cardiac development
Right arrow Genetics of cardiovascular disease