Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2008;102:e20-e35
Published online before print January 17, 2008, doi: 10.1161/CIRCRESAHA.107.166744
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
102/2/e20    most recent
CIRCRESAHA.107.166744v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Philip-Couderc, P.
Right arrow Articles by Baertschi, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Philip-Couderc, P.
Right arrow Articles by Baertschi, A. J.
Related Collections
Right arrow Biochemistry and metabolism
Right arrow Other myocardial biology
Right arrow Animal models of human disease
Right arrow Physiological and pathological control of gene expression
(Circulation Research. 2008;102:e20.)
© 2008 American Heart Association, Inc.


UltraRapid Communications

Forkhead Transcription Factors Coordinate Expression of Myocardial KATP Channel Subunits and Energy Metabolism

Pierre Philip-Couderc, Nadia Isidoro Tavares, Angela Roatti, René Lerch, Christophe Montessuit, Alex J. Baertschi

From the Department of Neuroscience (P.P.-C., A.R., A.J.B.) and Division of Cardiology (N.I.T., R.L., C.M.), Hôpitaux Universitaires de Genève, Centre Médical Universitaire, Geneva, Switzerland.

Correspondence to Dr Alex J. Baertschi, Department of Neuroscience, CMU, 1 rue Michel Servet, 1211 Geneva 4, Switzerland. E-mail alex.baertschi{at}medecine.unige.ch


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Coordinate adaptation of myocyte metabolism and function is fundamental to survival of the stressed heart, but the mechanisms for this coordination remain unclear. Bioinformatics led us to discover that Foxs are key transcription factors involved. We performed experiments on the mouse atrial cell line HL-1, neonate rat heart myocytes, and an adult rat model of myocardial infarction. In electrophoretic mobility-shift assays, FoxO1 binds to the FoxO concensus site of the KATP channel subunit KIR6.1 promoter. In primary atrial culture, targeting FoxO1 and FoxO3 with siRNA specifically reduces mRNA expression of FoxO1 and -O3 and KIR6.1. Western blots, confocal immunofluorescence, and quantitative RT-PCR was applied for measuring expression of 10 Fox, 6 KATP channel subunits, and 12 metabolic genes. FoxF2, -O1, and -O3 strongly associate with expression of KATP channel subunits (in particular, KIR6.1, SUR1A and SUR2B) in different heart tissues and in the periinfarct zone of the left ventricle. Patch-clamp recordings demonstrate that molecular plasticity of these channels is matched by pharmacological plasticity and increased sensitivity to a metabolic challenge mimicked by the protonophore CCCP. A balance of FoxF2 and FoxO also regulates expression of at least 9 metabolic genes involved in setting the balance of glycolysis and β-oxidation. Bioinformatics shows that the transcriptional mechanisms are highly conserved among chicken, mouse, rat, and human, and Fox are intimately linked to other metabolic sensors. Thus, FoxF2 and -O are key transcription factors coordinating expression of KATP channels and energy metabolism.


Key Words: Fox transcription factors • KATP channels • metabolic genes • myocardial infarction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Metabolic adaptation is vitally important for cellular function, stress adaptation, and survival. This is particularly true in metabolically highly active tissues. In heart,1 brain,2 kidney,3 adipose tissue,4 muscle,5 and blood vessels,6 the ATP-dependent potassium channels (KATP channels) emerge as the most important sensors of cellular energy status.7 During metabolic stress, these heterooctameric channels open in response to an increased cytoplasmic ADP/ATP ratio, thereby hyperpolarizing the cell and reducing the calcium influx and metabolic demand.1 KATP channels protect cardiac myocytes in pathophysiological situations,8 as well as during vigorous exercise. For example, mice with knockout of the pore-forming KATP channel subunit KIR6.2, or mice overexpressing dominant negative KIR6.1, tolerate only half of the workload compared with wild-type mice, and half of them die.9,10

KATP channels are, however, amazingly diverse, varying in their subunit composition from one tissue to the next. The potassium channel pore consists of 4 KIR6.2 subunits in left ventricle,11 pancreatic β-cells,12 and vascular endothelium13 and mainly of 4 KIR6.1 subunits in vascular smooth muscle.14 The brain2 and skeletal muscle15 express both KIR6.1 and KIR6.2. The same cardiac tissue may change its subunit composition: subunit Kir6.1 is increasingly expressed in left ventricle following ischemia,16 exercise,17 or treatment with KATP channel agonist.18 Moreover, differences in subunit composition of cardiac KATP channels arise during development, aging, and between male and female.19–21 The varying expression of the regulatory subunit sulfonylurea receptor (SUR) adds additional complexity. SUR2A is expressed in left ventricle,22 SUR1A in pancreatic β-cells, and SUR2B in vascular smooth muscle.23

The puzzling molecular diversity of these metabolic sensors raises 2 unresolved questions. What mechanisms cause the varying expression of the KATP channel subunits? Is altered composition of KATP channels coordinated with altered metabolic control? We previously found that atria and ventricles strikingly differ in KATP channel properties and sensitivity to ADP24,25 and sought to determine whether corresponding differences existed in transcriptional mechanisms. Accordingly, our bioinformatics approach reveals that Forkhead transcription factors (Foxs) would be prime candidates mediating KATP channel expression (Figure 1 and Tables 1 and 2Down). Foxs have been known since 1990. Their specific DNA-binding domain is highly conserved through animal evolution. They are emerging as key players in developmental and metabolic processes and could act as transactivators or transrepressors.26 Their powerful role is attested by the fact that some Foxs, such as FoxA, can act independently of acetylation or compaction of the nucleosome. In pancreatic β-cells, FoxA2 causes expression of a cluster of genes including SUR1-KIR6.2, GLUT2, glucokinase, hexokinases, and L-pyruvate kinase.27 The number of Fox members seems to correlate with anatomical and functional complexity: there are 4 Fox genes in Saccharomyces, 15 in Caenorhabditis, 20 in Drosophila, and 39 in Homo sapiens.26 Potential binding sites for Foxs also exist on many genes encoding glucose and fatty acid transporters and enzymes of the glycolytic and β-oxidation pathway (Table 3). Thus Foxs possibly coordinate the expression of KATP channels and enzymes and transporters of metabolic pathways. The experiments described below support this hypothesis.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Predicted putative binding sites for transcription factors on KATP channel genes. A, SUR2-KIR6.1 gene on chromosome 12p (human) and 4 (rat). B, SUR1-KIR6.2 gene on chromosome 11p (human) and 1 (rat). Criteria for selection of transcription factors were: 90% sequence identity between species (human, rat, mouse, and chicken), exclusion of commonly encountered members of the transcription machinery, and known expression in the cardiovascular system. Note the prominent role of the Forkhead family of transcription factors (bold lettering). See the section Bioinformatics under Materials and Methods and the section Abundance of Fox-Binding Sites on SUR-KIR6 and Metabolic Genes under Results.


View this table:
[in this window]
[in a new window]

 
Table 1. Table 1. Forkhead Transcription Factors With Potential Binding Sites on Promoters of Both Channel and Marker Genes


View this table:
[in this window]
[in a new window]

 
Table 2. Table 2. Forkhead Transcription Factors With Potential Binding Sites on Promoters of Both Channel and Marker Genes


View this table:
[in this window]
[in a new window]

 
Table 3. Table 3. Putative Binding Sites on Promoters of Metabolic Genes


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Hearts from 2- to 3-day-old rats were carefully microdissected to separately collect right atrial appendages, left atrial appendages, left ventricles, and right ventricles. The tissues were incubated for 4 hours at 4°C in trypsin (2.5%) and dissociated for 15 minutes at 37°C. After preplating at a density of 130 000 cells/cm2 on plastic to remove a majority of fibroblasts, the suspended cells were plated and cultured for 24 hours on plastic dishes for the extractions of mRNA and protein. Cells were also plated at low density (10 000 to 50 000 cells/dish) on fibronectin–gelatin coated 22-mm glass slides and cultured pending immunocytochemistry or patch-clamp recordings, as described previously.28,29 Medium was DMEM-F12 with 10% FBS, insulin–selenium–transferrin, penicillin–streptomycin, and ascorbic acid. To prevent fibroblast proliferation, 20 µmol/L cytosine arabinonucleoside was added to the culture medium. Contamination with vascular smooth muscle cells or myofibroblasts was 9.1±2.2% after 48 hours (mean±SEM, N=10), as ascertained by immunofluorescence for {alpha}-smooth muscle actin (antibody was provided by Dr M.-L. Piallat, Centre Médical Universitaire, Geneva, Switzerland).

The HL-1 mouse atrial cell line30 was a generous gift from Dr William C. Claycomb (LSU Health Sciences Center, New Orleans, La). HL-1 cells were cultured under a 5% CO2 atmosphere in Claycomb medium (JRL Bioscience) supplemented with 10% FBS, 4 mmol/L L-glutamine, 0.1 mmol/L norepinephrine, 100 U/mL penicillin, and 100 µg/mL streptomycin. The medium was replaced every 24 to 48 hours. Cells were grown in T75 culture flasks or on 22-mm glass coverslips that were precoated overnight with Dulbecco’s PBS containing 0.012 mg/mL fibronectin and 0.2 mg/mL gelatin.

Myocardial Infarction
This investigation conforms to the NIH Guide for the Care and Use of Laboratory Animals. Myocardial infarction was induced in 200- to 225-g male rats by ligature of the left coronary artery as described.31,32 Control rats underwent a sham operation. One, 7, 28, and 140 days after coronary occlusion, the heart was excised under deep pentobarbital anesthesia (150 mg/kg IP). The infarct border zone, defined as the myocardium 2 mm around the infarct scar, was carefully dissected out. Cardiomyocytes were isolated by incubation in collagenase solution, followed by stepwise recovery to physiological calcium levels.

RNA Extraction, Reverse Transcription, and Real-Time PCR
Total RNA was extracted by disrupting cells in TRIzol reagent (Invitrogen) and prepared according to recommended procedures. The quality of RNA was controlled in agarose gels by the 18S/28S ratio. RNA concentration was measured by spectrophotometry at 260 nm, and their quality was controlled by the 280/260 nm emission ratio. RNA was subjected to DNase I to remove all genomic DNA contamination with DNA-free (Ambion) as indicated by the manufacturer. Reverse transcription was performed on 1 µg of total RNA with Thermoscript (Invitrogen), random primers, and dNTP as indicated by the manufacturer. Real-time PCR was performed on cDNA with SYBR Premix ExTaq Takara in an I-Cycler thermocycler (Bio-Rad). Oligonucleotides were designed with the software Primer express 2. Specific TaqMan probes were synthesized by Applied Biosystems and primers by Microsynth (for primers and probes, see Table 4Down). The standard curve method was used for relative quantification. The mRNA values were normalized by the corresponding 18S rRNA and cyclophilin mRNA. The different normalization procedures yielded similar results.


View this table:
[in this window]
[in a new window]

 
Table 4. Table 4. Primers and Probes


View this table:
[in this window]
[in a new window]

 
Table 4A. Table 4. Continued

Electrophoretic Mobility-Shift Assays
Nuclear extracts from cell cultures were prepared according to the method of Schreiber et al.33 Hela cells were used as positive control of the method, using probes for SP-1. Transfected HL-1 cells and nontransfected primary cultured atrial myocytes were used for the tests. Positive controls for Fox binding were made with HL-1 cells transfected with FoxO1 plasmid. Oligonucleotides were obtained from Microsynth: ATTCGATCGGGGCGGGGCGAG for the transcription factor SP-1 as a positive control; TGATGAGTGTTTGTTTATGAG (FoxO probe; Figure 4A) and GATGAGTGTTTATTATATGAG (FoxO1 probe; Figure IC and ID in the online data supplement) for the consensus sequence (mouse, rat, human conserved) found in the KIR6.1 promoter. Oligonucleotides were labeled by the T4 polynucleotide kinase with [{gamma}-32P]ATP and purified on spin columns (NucleoSpin extract II [MN]). The labeled probes (80 000 to 100 000 cpm) were incubated with, or as a control without, the nuclear extracts in gel shift–binding buffer (20% glycerol, 5 mmol/L MgCl2, 2.5 mmol/L EDTA, 2.5 mmol/L dithiothreitol, 250 mmol/L NaCl, 50 mmol/L Tris-HCl (pH7.5), 0.25 mg/mL poly(dI-dC). Cold probe was coincubated for displacing the radioactive probe. Electrophoresis of DNA–protein complexes was performed on 4% polyacrylamide gels (60:1 acrylamide:bisacryl-amide). Gels were dried and placed for at least 5 days against an autoradiographic film with an amplification screen at –80°C.

Western Blot
Cell cultures were disrupted with lysis buffer (25 mmol/L Tris, 150 mmol/L NaCl, 5 mmol/L EDTA, 1% [vol/vol] Triton X-100, pH 7.5, supplemented with a cocktail of protease inhibitors [Roche]). Fifty micrograms of protein were loaded on a polyacrylamide–sodium dodecyl sulfate gel that was blotted on a 0.45-mm nitrocellulose membrane BA85 (Schleicher et Schuell), as described previously.33a Loading controls were performed by red Ponceau staining. Hybridizations were revealed with chemiluminescent substrate according to the protocol of the manufacturer (Roche). Quantification of the detected proteins was performed by scanning and with Metamorph software (Universal Imaging). Primary antibodies were Goat anti-Kir6.1 (sc-11224, Santa Cruz Biotechnology), rabbit anti-Kir6.2 (APC-020, Alomone), rabbit anti-SUR (sc-5791, Santa Cruz Biotechnology), rabbit anti-SUR2B (sc-5793 Santa Cruz Biotechnology), rabbit anti-FoxF2 (ab23306, Abcam), goat anti-FoxO3 (ab17026 Abcam), rabbit anti–green fluorescent protein (GFP) (Synaptic Systems).

Plasmids
FoxF2 expression plasmids were a generous gift from Dr P. Carlsson, Göteborg University (Göteborg, Sweden).34 Wild-type FoxO1-GFP expression plasmids were a generous gift from Dr T.G. Unterman (McGill University, Montreal, Canada).35 FoxO3a expression plasmids were ordered at ADGENE and are the original construct from Dr M.E. Greenberg (Harvard Medical School, Boston, Mass).36

Small Interfering RNA
Small interfering (si)RNAs were obtained from Invitrogen to knock down mouse FoxO1 and -O3 and were successfully tested in HL-1 mouse atrial myocytes. Because the design was optimized to also knock down rat Fox, 1 of the siRNA for FoxO1, and 2 of the siRNAs for FoxO3 also worked in rat. siRNAs with scrambled sequence served as control. A fluorescent siRNA was used as a control for successful electroporation. For each culture well, 1 electroporation (see below) was performed immediately after cell dissociation on 2 million preplated cells. Up to 6 wells were pooled for RNA extraction from the cultures 24 hours later. Each pooled sample served as 1 single data point, and 5 to 7 data points per gene were averaged for the statistical analysis.

Cell Transfection and Electroporation
Lipofections of HL-1 cells were performed with Lipofectamine 2000 (Invitrogen) as recommended by the manufacturer. Cells were lysed 48 hours posttransfection. For single-cell studies, primary cultured myocytes were electroporated with a Bio-Rad Genpulse electroporator as described.28 For nucleoporation of primary cultured atrial myocytes with siRNAs, protocol no. 09 of Amaxa AG (Köln, Germany) was applied, as recommended by the manufacturer.

Immunocytochemistry, Confocal Microscopy, and Quantitative Imaging
Myocytes were fixed in 2% paraformaldehyde and stained as described,28 using antibodies listed previously. Image stacks of immunostained cultures were acquired on a confocal microscope at a fixed laser setting and analyzed.28 For each cell, the mean background-subtracted fluorescence of regions of interest (nucleus, cytoplasm) was determined with Metamorph software at 3 z-positions, normalized by exposure time, and averaged; means of averages±SEM were obtained for groups of 10 to 16 cells. For example, red fluorescence of KIR6.1/Texas Red was plotted as function of cytoplasmic or nuclear green fluorescence of FoxO1–enhanced GFP (EGFP).

Bioinformatics
Promoter analysis was performed online at the Lawrence Livermore Institute Laboratory (http://www.dcode.org) for the following genes: SUR1-KIR6.2, SUR2-KIR6.1, MLC2a, MLC2v, proANP, proBNP, and the metabolic genes listed in Tables 1 and 2Up. The analysis of the promoter across species was performed for chicken, mouse, rat, and human with the ECR Browser software (http://ecrbrowser.dcode. org). The alignment between pairs of promoter regions was performed with blastz software and designed with zpicture (http://zpicture.dcode.org). This alignment was submitted to Rvista2 to identify the putative transcription factor binding sites at http://rvista.dcode.org. The putative promoter and transcription factor binding regions were confirmed with Genomatix ElDorado and Gene2Promoter software.

Electrophysiology
Whole cell patch-clamp recordings of the KATP current were obtained as described previously.24,25,29 From a holding potential of –40 mV, voltage ramps were imposed every 30 seconds from –80 to +90 mV over a 10-second period. This resulted in quasi–steady-state current–voltage curves. Membrane potential was measured in current-clamp mode at 0 pA at the end of each ramp. The pipette solution contained (in mmol/L) 120 KCl, 1.3 CaCl2, 1.3 MgCl2, 10 Hepes, 10 glucose, 10 BAPTA, plus 1 mmol/L K-ATP and 10 µmol/L K-ADP. The pH was adjusted to 7.3, and osmolality to 290 milliosmol/kg. The bath solution contained (in mmol/L): 5 KCl, 1 CaCl2, 1 MgCl2, 118 NaCl, 10 Hepes, and 10 glucose. The pH was adjusted to 7.4, and osmolality was adjusted to 290 milliosmol/kg with sucrose. Drugs were administrated to 23 rat cardiomyocytes in the perfusion system in the sequence control, diazoxide (100 µmol/L), pinacidil P-1075 (100 µmol/L), glibenclamide (1 µmol/L), with 2 to 4 minute washes between drug applications. Metabolic sensitivity was tested in a separate series of 24 rat cardiomyocytes by application of low concentrations (20 nmol/L) of the protonophore CCCP to mimic metabolic stimulation.25

Statistical Analysis
The statistical analysis was performed on Sigmastat 2 SPSS. The mRNA and protein levels were compared by ANOVA with a post hoc Newman–Keuls test. Time varying expressions of Foxs in cardiac infarction studies were compared with a Dunnett test. The correlation analysis was performed with a linear regression and a covariance test, and confirmed by Spearman correlation. Multiple regression analysis was performed with SPSS software.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Abundance of Fox-Binding Sites on SUR-KIR6 and Metabolic Genes
Alignments of chicken, mouse, rat, and human genes coding for KATP channel subunits and metabolic enzymes allowed us to identify the most highly conserved sequences in the 5' upstream region and the presumed transcription factor binding sites (Figure 1; detailed charts are available on request). In sequences 5' upstream of the Kir6.1 coding region, Rvista2.0 finds a high redundancy of binding sites for FoxO1, -O3, -O4, -F2 (FREAC2), -C1 (FREAC3), -D1 (FREAC4), -L1 (FREAC7), and a common Forkhead consensus site. Immediately upstream of the SUR2 coding region, Rvista2.0 finds almost the same sites: FoxO1, -O3, -F2, -D1, -D3, -J2, -P1, and a common Forkhead consensus site. For the Kir6.2 gene, Rvista finds only 1 putative site for FoxC1 (FREAC3) and high redundancy for MEF2, OCT, SREBP1a, SP1, AP2, and NF-{kappa}B.

Presumed promoter sequences of KATP channel subunits were also aligned with presumed promoter sequences of proANP, proBNP, MLC2a, and MLC2v (Tables 1 and 2Up; detailed charts available on request). There are 15 highly conserved sequences 5' upstream of the Kir6.1 gene (more than 90% sequence identity between species) but only 2 sequences 5' upstream of the SUR2 gene. Alignments of the KIR6.1 promoter with putative atrial markers (MLC2a and proANP promoters) yield striking clusters of binding sites for FoxA1, -A2, -C1, -D3, -F1, -F2, -I1, -J1, -J2, and -L1 (Tables 1 and 2Up). Alignments with the MLC2v and proBNP promoter regions yield negative results, except for FoxP1.

A similar analysis on metabolic genes yields clusters of Fox binding sites on the CD36, LPL, FABP3, MCAD, ACCβ, and MCD promoters for the β-oxidation pathway and on the GLUT4 and PKM promoters for the glycolytic pathway (Table 3). Interestingly, a Foxs cluster is also observed for SREBP1a, as are binding sites for SREBP1a, HIF1{alpha}, PPAR, and Nkx2.5. Thus in silico, Foxs emerge from a library of 430 transcription factors as the most prevalent transcriptional regulators of KATP channel subunits and metabolic pathways.

FoxO1, -O3, and -F2 Cause Increased Gene Expression of KIR6, SUR, Metabolic Transporters, and Enzymes in Atrial Myocytes
FoxO1, -O3, and -F2 were selected from a group of 10 Foxs from ongoing experiments on rat hearts. The transfection of HL-1 cells with a FoxO3 plasmid36 induces a 15-fold increase in FoxO3 mRNA, a 3-fold increase in KIR6.1 mRNA, a tight positive correlation between FoxO3 and KIR6.1 protein in quantitative double-immunocytochemistry, and a 5- to 26-fold increase of KIR6.1 protein in Western blots (Figures 2 and 3Down). Moreover, FoxO3 induces a 2-fold increase in KIR6.2 and a 4-fold increase in SUR2A mRNA (Figure 2). Wild-type FoxO1-EGFP35 induces green fluorescence and increased KIR6.1 expression (supplemental Figure IA and IB; R=0.66, P<0.01, n=22 cells), and a 6-fold increase in KIR6.1 protein (Figure 3). Interestingly, transfection with FoxO1-EGFP (or FoxO3) represses FoxF2 protein, whereas human FoxF2 plasmid34 increases FoxO1/O3 mRNA and protein 10-fold (Figure 3B). FoxF2 also increases SUR2A, KIR6.2, and KIR6.1 mRNA (Figure 2). In primary rat atrial myocytes, electroporation with FoxO1-EGFP plasmid induces green fluorescence and increased expression of immunoreactive KIR6.1 (Figure 3G); electroporation with FoxF2 plasmid increases nuclear FoxF2 in inverse correlation with nuclear FoxO1-EGFP (R=–0.51, P<0.05, N=16), supporting the results from HL-1 cells.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
Figure 2. Fox-induced expression of KATP channel subunit and metabolic genes in the HL-1 mouse atrial cell line. Each mean and SEM stems from 3 to 8 separate cultures and transfection series. *P<0.05 relative to no transfection and empty vector; +P<0.05 relative to F2, O3. mRNA levels were determined twice for each culture. For abbreviations, see Table 3. Note predominant effect of FoxF2 and FoxO on KIR6.1, inhibition of glycolytic genes by FoxF2, and stimulation of β-oxidation genes by FoxO.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

 
Figure 3. A and B, Effects of no, sham, or Fox transfection on FoxO3 mRNA and FoxO3, FoxF2, and KIR6.1 protein in HL-1 cells. Note that FoxF2 overexpression stimulates FoxO3 and KIR6.1, whereas FoxO overexpression inhibits FoxF2. C, Effects of FoxO3 transfection on FoxO3 and KIR6.1 in quantitative immunocytochemistry (HL-1). D through F, Three separate experiments showing effects of transfections of FoxF2, -O3, and -O1 on KIR6.1 and KIR6.2 protein quantified from Western blots (HL-1). G, Expression of FoxO1-EGFP stimulates expression of KIR6.1 in primary cultured atrial myocytes. Significant positive correlation (P<0.003) between wt FoxO1-EGFP fluorescence and immunoreactive KIR6.1 (arbitrary units) for 11 atrial myocytes. Another 11 myocytes without green fluorescence were analyzed in the same cultures (for all 22 myocytes, R=0.71, P<0.0002). Scale bar=5 µm. O1-E indicates FoxO1-EGFP; Combi, overlay of DAPI (6-diamidino-2-phenylindole), KIR6.1, and FoxO1-EGFP.

Foxs potently modulate the expression of genes coding for free fatty acid and glucose transport and metabolic enzymes (Figure 2). Many of these findings are new. FoxF2 downregulates, whereas FoxO1 induces phospho-fructokinase 2, in HL-1 cells, possibly via downregulation and induction of SREBP1a, respectively.37–39 Overexpression of FoxF2 downregulates gene expression throughout the glycolytic pathway. FoxO1 and -O3 induce increased expression of malonyl-CoA decarboxylase (MCD), which inactivates malonyl CoA, an inhibitor of carnitine palmitoyltransferase-1 (CPT-1), and FoxO3 increases expression of medium chain acyl CoA dehydrogenase (MCAD). The metabolic sensor AMPK{alpha}1 is also upregulated by FoxO1 and -O3. Additional findings confirm previous studies on other cell types40 and LPL41; gluconeogenesis, glycolysis, and lipid gene expression.39 Putative Fox binding sites also exist on peroxisome proliferator-activated receptors (PPARs), which positively impact on fatty acid oxidation, as confirmed by experiments on HL-1 cells. The results thus suggest cause-and-effect between Foxs and expression of KATP channels and metabolic genes.

Causal Relationships Between FoxO and Channel Subunit Expression Are Demonstrated by Electrophoretic Mobility-Shift Assays and siRNAs
Nuclear extracts from mouse atrial HL-1 myocytes overexpressing FoxO1 slow down the gel migration of a P32-labeled oligonucleotide with FoxO consensus sequence that is present in the KIR6.1 gene promoter. Cold probe erases this shift (Figure 4A, top). Nuclear extracts from nontransfected primary rat cardiomyocyte cultures also cause a shift of the radioactive FoxO probe, and the cold probe decreases the intensity of the shifted band by >90% (supplement Figure IC and ID). Cause-and-effect is further indicated by a 76% to 83% decrease in expression of KIR6.1 mRNA, 24 hours following electroporation of primary cultured rat atrial myocytes with anti-FoxO siRNAs (Figure 4B). Remarkably, anti-FoxO1 siRNA affects primarily FoxO1 and less so FoxO3 mRNA, and vice versa, but both types of siRNAs inhibit KIR6.1 expression relative to the control with scrambled sequence.


Figure 4
View larger version (32K):
[in this window]
[in a new window]

 
Figure 4. Electrophoretic mobility-shift assays (EMSA) and siRNAs prove cause-and-effect between FoxO and KIR6.1 expression. A1, Nuclear extracts of HL-1 overexpressing FoxO1-EGFP slow down migration of P32-labeled probe with FoxO-binding DNA sequence of the KIR6.1 gene promoter (lane 2). Coadded cold probe almost abolishes this shift in migration (lane 3). Lane 1 shows free probe alone. Also see supplemental Figure IC and ID. A2, In positive control, nuclear extract of Hela cells slow down P32-labeled probe with SP-1–binding DNA sequence (lane 2), and cold probe almost erases shift (lane 3). B, siRNAs directed against FoxO1 and FoxO3 significantly reduce expression of KIR6.1 in primary cultured neonatal rat atrial myocytes. Data are means±SEM of mRNA normalized by cyclophilin mRNA in 5 to 7 pooled cultures. *P<0.05, **P<0.01. SCR indicates control, siRNA with scrambled sequence.

Coordination of Tissue-Specific Expression of Fox, Channel Subunits, and Metabolic Genes in Neonate Rat Cardiomyocytes
Atria and ventricles differ in their development and mechanical stress; right and left heart are exposed to different oxygen tension. Would they differ in Fox, channel subunits, and metabolic genes? This is indeed the case. FoxA2, -C2, and -F2 display the highest mRNA levels in the left ventricle, whereas FoxO1, -O3, -O4, and -P1 are highly expressed in the atria (Figure 5A). FoxM1 is expressed at the same level in all cardiac compartments (supplemental Figure II). There is a right/left heart difference in expression for FoxJ2. At the protein level, FoxO3 protein is expressed more strongly in right atrium and FoxF2 in left ventricle. This is indicated by Western blots (Figure 6) and quantitative immunocytochemistry (supplemental Figure IIIA). FoxO3 is mainly localized in the nucleus. FoxF2 resides in both the nucleus and perinuclear zone (Figure 6A2 and 6B2).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Figure 5. Differential expression of Foxs in the 4 chambers of the rat heart and their link to KATP channel expression. A, mRNA levels were quantified by real-time PCR (I-Cycler, Bio-Rad) with specific primers (see Table 6) and normalized by the 18S ribosomal RNA level. Each mean and SEM is from 8 different myocyte cultures. The myocytes were dissociated from the tissue, purified by preplating, and cultured in cytosine arabinonucleoside. Contamination by fibroblasts or vascular smooth muscle cells was <9%. Individual measures were determined twice on extracts of each culture. Note differential distribution of Foxs, with high levels of FoxA2, -C2, and -F2 in the left ventricle (LV), high levels of FoxO1, -O3, -O4, and -P1 in right and left atria (RA and LA), and high levels of FoxJ2 in right heart (RA and RV). *P<0.05 relative to ventricles, +P<0.05 relative to left heart, #P<0.05 relative to all others. B, Differential expression of Foxs results in differential expression of KATP channel subunits (shown in Figure 6). Associations between Fox and channel subunits are marked in black (significant, positive), gray (significant, negative), and white (nonsignificant). For details, see Table 4Up. Note predominant associations with FoxF2 and FoxO.


Figure 6
View larger version (33K):
[in this window]
[in a new window]

 
Figure 6. Endogenous Foxs and KIR6.1 in primary myocyte cultures from neonate rat heart. A1 and B1, High levels of FoxO3 protein in right atrium, and FoxF2 in left ventricle. A2, Immunolocalization of FoxO3 in myocytes from right atrium and left ventricle. B2, Immunolocalization of FoxF2 in right and left ventricle. Scale bar=10 µm. A3, Positive correlation between FoxO3 and KIR6.1 mRNAs (P<0.015; R=0.66). B3, Negative correlation between FoxF2 and KIR6.1 mRNAs (P<0.001; R=–0.94). Extracts for protein (A1 and B1) and mRNA (A3 and B3) were made from cultured myocytes as indicated for Figure 5. Note significant positive association of KIR6.1 with FoxO3 mRNA and negative association with FoxF2.

Significant associations exist between Fox and KATP channel subunit mRNA: both positive (in black: FoxJ2, -O1, -O3) and negative (in gray: FoxD3, -F2) (Figures 5B, 6A3, and 6UpB3; details in Table 5). Atria express 4- to 12-fold higher levels of KIR6.1 and SUR1A mRNA than ventricles, and right heart expresses up to 6-fold higher levels of SUR2B mRNA than left heart (Figure 7A). SUR2A, KIR6.2,l and SUR1B mRNAs are evenly distributed throughout the cardiac chambers. Significant associations also exist between Fox and metabolic enzyme mRNAs (Table 5). In general, ventricles express higher mRNA levels for all enzymes and transporters studied (Figure 8); many of these findings are new, and others extend previous results.42,43


View this table:
[in this window]
[in a new window]

 
Table 5. Table 5. Correlations Between Expression of Fox and KATP Channel Subunit mRNA in the Neonate Rat Heart


Figure 7
View larger version (37K):
[in this window]
[in a new window]

 
Figure 7. Differential expression of KATP channel subunits in myocytes from neonate rat heart. A, Quantitative RT-PCR of KATP channel subunits. The mRNA levels were quantified by real-time PCR (I-Cycler, Bio-Rad) with specific primers and TaqMan probes for each subunit (see Table 6) and normalized by the 18S RNA level. For n and symbols, see the legend of Figure 4. Note even distribution of KIR6.2/SUR2A, high levels of KIR6.1 and SUR1A in atria, and high levels of SUR2B in right heart. B, Protein levels of KIR6.1 and KIR6.2 in myocytes derived from the 4 chambers of the rat heart by immunoblotting from 3 separate culture series; below, quantification of gel scans. *P<0.05 relative to ventricles. Note higher levels of KIR6.1 protein in atria and even distribution of KIR6.2. Elution of KIR6.2 at an apparent molecular weight of 37 kDa is mentioned by antibody vendor (Alomone) and in many publications. C, Immunocytochemistry for KIR6.1 in cardiomyocytes from different cardiac chambers. Scale bar=10 µm. Extracts for mRNA (A) and protein (B) were made with myocyte cultures derived from each cardiac chamber.


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
Figure 8. Expression of metabolic genes in primary cultured cardiomyocytes. Each mean and SEM is from 3 separate cultures and transfection series. *P<0.05 relative to RA, +P<0.05 relative to left ventricle. mRNA levels were determined twice for each culture extract. Note a generally higher gene expression in both right and left ventricle.

Protein levels generally conform to the mRNA measurements (Figure 7B). Kir6.1 is significantly (2-fold) higher in atrial than ventricular myocytes, whereas KIR6.2 is evenly distributed throughout. Immunocytochemistry shows the presence of KIR6.1 protein in myocytes, displaying the typical striated pattern in left ventricular myocytes (Figure 7C), a patchy pattern in atrial myocytes, and a mixed pattern in right ventricle. These most probably reflect the different amounts of contractile proteins present in neonatal myocytes. SUR2B expression is highest in atria and very low in left ventricle (supplemental Figure IIIB).

High Expression of Foxs Following Myocardial Infarction
Results so far indicate a tissue-specific, Fox-related expression of KATP channel subunit and metabolic genes, possibly caused by the varying metabolic challenges. Would ventricular tissue, when exposed to stress, acquire new Fox-related characteristics? Because FoxO1 and -F2 knockout mice are not viable, we tested this hypothesis in a rat model of myocardial infarction,31 where KIR6.1 and SUR mRNAs are highly expressed in the infarct border zone.44 This zone is exposed to low PO2 and high mechanical stress.45 We tested in these same rats the time-varying patterns of Fox expression. Myocardial infarction elicits waves of Fox expression, starting with FoxC2 and -O1 at 7 days, continuing with FoxO3 and -J2 at 56 days, and FoxF2, -O3, and -J2 at 20 weeks (open circles, Figure 9A). Overexpression of genes in the periinfarcted zone reaches mRNA copy numbers found in the Fox-transfected HL-1 cell line. No significant changes occur in FoxA2, -O4, -D3, -P1 (Figure 9A) and -M1 (supplemental Figure IVA). In shams (closed circles), all Fox mRNA levels remain stable over the 20 week period.


Figure 9
View larger version (19K):
[in this window]
[in a new window]

 
Figure 9. Increased expressions of FoxO, -J2, -F2, and -C2 in periinfarcted zone of the adult rat left ventricle in association with KATP channel subunits. A, mRNA levels were quantified in extracts of myocytes isolated from the periinfarcted zone 1, 7, 56, and 140 days postsurgery. Each mean and SEM is from 4 rats with myocardial infarction (open circles) and 4 sham controls (closed circles). Note waves of overexpression for FoxO1, -C2, -O3, -J2, and -F2 in infarcted rats relative to shams (double-sided error bars, P<0.05), and relative to day 1 (*P<0.05) (ANOVA for repeated measures). For other Fox, see text and supplemental Figure IIIA. B, Differential expression of Foxs results in differential expression of KATP channel subunits. Associations are marked in black (significant, positive), gray (significant, negative), and white (nonsignificant). For details, see Table 6. Note significant associations with FoxF2 and FoxO.

Changes in Foxs parallel changes in KATP channel subunit mRNA. The most striking results are the strong positive associations between FoxF2 and KIR6.1, SUR1A, SUR2A, and SUR2B (Figure 9B and Table 6), and associations with FoxO1, -O3, -J2, and -C2. These represent almost the same set of transcription factors revealed in studies on neonate rat myocytes. Note that at these high levels of FoxF2 expression, there is a high expression of KIR6.1, as in HL-1 cells.


View this table:
[in this window]
[in a new window]

 
Table 6. Table 6. Correlations Between Expression of Fox and KATP Channel Subunit mRNA in the Periinfarcted Zone of the Rat Left Ventricle

Other potassium channels, such as IK1 (KIR2.1, KIR2.3),46 Ito (Kv1.4),47 IKs (KvLQT1),48 and IKAch (KIR3.1),49 also display a regional expression in the heart. However, Rvista bioinformatics analysis of their 5' promoter/enhancer regions fails to suggest a clear implication of Foxs. Indeed, no association was found between Foxs and KIR2.1 or KvLQT1 mRNA after myocardial infarction (supplemental Figure IVB and IVC).

Functional Plasticity Matches Molecular Plasticity of KATP Channels
A remarkable molecular plasticity thus exists for Foxs and channel subunits, indicating a pronounced expression of subunits KIR6.1, SUR1A, and SUR2B in regions (right atrium, left ventricle infarct border zone) exposed to low PO2. Atria are already known to display increased diazoxide sensitivity in correlation with increased metabolic sensitivity of the KATP channels,25 but right/left differences had not yet been examined. Right atrial myocytes from neonatal rats readily responded to 100 µmol/L diazoxide by generating within 3 to 4 minutes an inwardly rectifying potassium current of 250 to 550 pA (eg, Figure 10A1). Subsequent 100 µmol/L pinacidil (P-1075) only slightly increased the current by 200 pA. The potassium current was totally abolished by 1 µmol/L glibenclamide, as expected. Diazoxide (100 µmol/L) hardly induced any current in left ventricular myocytes (eg, Figure 10A2), whereas pinacidil induced a current comprised between 500 to 1000 pA (positive control). In Figure 10A4, the current densities clearly indicate a high sensitivity to diazoxide in right and left atrium and right ventricle, and a low sensitivity in left ventricle. In contradistinction, the current densities in response to pinacidil were statistically identical in all tissues (Figure 10A5). The myocyte KATP current in the highly stressed infarct border zone of the left ventricle is also highly sensitive to diazoxide.44 To better characterize the functional implications, another series of experiments was performed on 24 cardiomyocytes by mimicking a metabolic challenge with a very low concentration (20 nmol/L) of CCCP (Figure 10B). Brisk responses were obtained in right and left atrial and right ventricular myocytes, and a very small response in left ventricular myocytes. Thus normal left ventricular myocytes stand out by their minimal responses to diazoxide and CCCP. Compared with left ventricular myocytes, right ventricular myocytes express as much mRNA for creatine kinase, adenylate kinase, and pyruvate kinase (Figure 8); thus increased ATP-ADP buffering in left ventricular myocytes seems not to account for their lack of response to CCCP.


Figure 10
View larger version (16K):
[in this window]
[in a new window]

 
Figure 10. Functional implications of tissue-specific KATP channel expression. A1, Whole cell KATP currents (pA) in right atrial myocyte during voltage ramp protocol. Note large response to 100 µmol/L diazoxide ("D"), small increment in response to 100 µmol/L pinacidil ("P"), and reversibility with 1 µmol/L glibenclamide ("G"). Prior control traces coincide with glibenclamide. A2, KATP currents in left ventricular myocyte. Note small response to diazoxide and large response to pinacidil. Prior control traces coincide with glibenclamide. A3, Voltage ramp protocol. A4 and A5, Summary of mean KATP current densities (pA/pF, mean±SEM, n=4 to 6) in response to diazoxide and pinacidil. Note very low response of left ventricular myocytes to diazoxide. *P<0.01 relative to all other responses. B, Separate experiments showing mean KATP current densities (n=5 to 7) in response to the protonophore CCCP (20 nmol/L). Note very low response of left ventricular myocytes to CCCP. *P<0.05 relative to all other responses.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The capability of adapting cellular function and energy metabolism to varying physiological and pathological conditions is vitally important in animal cells. In the present work, we show that the Fox family may play a central role in expression of both molecular sensors of energy status and key regulatory genes of energy metabolism. First, in atrial cells, the expression of FoxO1, -O3, and -F2 cause increased expression of KATP channel subunits (the quintessential metabolic sensors7) and selective up- and downregulation of specific metabolic genes. A causal relationship between FoxO and KIR6.1 expression is demonstrated by electrophoretic mobility-shift assay and by experiments with siRNAs. Second, FoxO1, -O3, -F2, and -J2 are distributed unevenly within different cardiac chambers of the neonatal rat, in association with channel subunits KIR6.1, SUR1A, and SUR2B and 9 metabolic genes.42,43,50 Third, the periinfarcted zone of the rat left ventricle reveals an impressive plasticity of FoxO1, -O3, -F2, and -J2, associated with the increased expression of KATP channel subunits (KIR6.1 and all SUR) and with the known remodeling of metabolic pathways.31 These findings support the hypothesis that Foxs mediate the tissue-specific gene expression in the face of different mechanical and hypoxic challenges.

Although our study demonstrates a Fox-mediated expression of KATP channel subunits, it does not resolve their quantitative subcellular distribution in mitochondria, sarcoplasmic reticulum, and plasma membrane. In confocal microscopy, immunofluorescence signals from subunits that are endogenously expressed in mitochondria and reticulum overwhelm signals emitted from the adjacent plasma membrane. Thus definite proof is still lacking that sensitivity of atrial and right ventricular myocytes to diazoxide or CCCP is explained solely by increased plasmalemmal KIR6.1, SUR1A, or SUR2B.

Would plasticity in KATP channel expression and composition be advantageous to the cell? The total absence of cardiac KIR6.2 expression or inactivation by dominant negative KIR6.1 is clearly detrimental to the tolerance of intense exercise in mice.9,10 Thus increased expression and function of KATP channels carry vital benefits. The increased expression of KIR6.1 (a channel subunit of lower conductance than KIR6.251) and the expression of SUR1A and SUR2B may serve to limit the maximal KATP current while increasing the sensitivity to ADP52 and to a metabolic challenge. One may anticipate that following myocardial infarction, the periinfarcted zone will readily adapt to hypoxia. The risks of reentry arrhythmia are minimized, because the low conductance KIR6.1 subunit prevents an excessive shortening of the action potential.8,25,53 Interestingly, recent studies unrelated to KATP channels have shown that myocardial infarction,54 myocardial reperfusion injury,55 heart failure,56,57 or myocyte hypertrophy58 induce an overexpression of FoxO. Other studies unrelated to FoxO have shown increased expression of KIR6.1 following ischemia16 and exercise.17 Moreover, recent work suggests that FoxO and KATP channels reduce cardiac ageing and electrical instability in drosophila.59 Our results thus link tissue stress and expression of Fox and KATP channels into a coherent framework.

Other sensors of energy status impact on the expression and function of Foxs. AMP kinase (AMPK)60–62 may signal metabolic stress (AMP/ATP ratio) to Fox.63–65 We show that FoxO1 and -O3 strongly increase the expression of AMPK{alpha}1 in atrial cells; in hepatocytes, AMPK stimulation directs FoxO1 to the proteolytic degradation pathway,60 possibly in a negative-feedback arrangement. Sirtuins66 are activated by the NAD+/NADH ratio and trap FoxO1 in the nucleus of hepatocytes.67 The low-oxygen sensor HIF1{alpha}68,69 is a potential transcription factor for FoxC2, -F2, -O1, and -O3 (supplemental Figure V). Homologs of SREBP1a act as oxygen sensors in fission yeast70; SREBP1a is a potential transcription factor for expression of the SUR2-KIR6.1 and KIR6.2 genes (Figure 1). Although not exhaustive, this list of energy and low-oxygen sensors demonstrates their potential, intimate relationship with Foxs.

Based on present experiments and previous studies,27,71–73 we consider that each cardiac chamber is chronically exposed to a different workload, metabolic demand, and metabolic supply. This leads through as yet unidentified signal transducers to different expression profiles of Foxs and thus of KATP channel subunits and key enzymes for β-oxidation or glycolysis. In response to an increased workload, each cardiac chamber adjusts its local excitability, force of contraction, and mobilization of metabolic pathways, thus optimizing the overall adaptation of the heart to stress. In pathological situations, for example, after myocardial infarction, the chronic stretch45 or possibly recurrent ischemia in the infarct border zone remodels the left ventricular wall, changes the KATP channel profile, and modifies the expression level of key enzymes of β-oxidation and glycolysis. Controversial results regarding the switch from fatty acid oxidation to glycolysis32,74–77 may result from a variable interplay between FoxO3, -O1, -F2, -C2 and PPAR expression.

In conclusion, FoxF2, -O1, -O3, and most likely -C2 and -J2 are intimately involved in both metabolic sensitivity of KATP channels and transcriptional control of energy metabolism. They direct a tissue- and stress-dependent expression of metabolically sensitive potassium channels and the mobilization of additional or alternative energy supplies. The Fox-dependent coordination of metabolic responses appears to be of vital importance in metabolically highly active tissues. Identification of the exact signaling pathways from stress to Foxs remains a challenging task of the future.


*    Acknowledgments
 
We thank Irene Papageorgiou for excellent assistance in studies on myocardial infarction and Mauro Serafin for advice in patch clamping.

Sources of Funding

Supported by the Swiss National Science Foundation, Swiss University Conference project "Heart remodelling in Health and Disease," Swiss Heart Foundation, Novartis Foundation, Société Académique de Genève, and the Gustave and Simone Prévot Foundation.

Disclosures

None.


*    Footnotes
 
Original received June 12, 2007; resubmission received October 25, 2007; revised resubmission received December 5, 2007; accepted January 3, 2008.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Tammaro P, Ashcroft FM. Keeping the heart going: a new role for KATP channels. J Physiol. 2006; 577 (pt 3): 767.[Free Full Text]

2. Thomzig A, Laube G, Pruss H, Veh RW. Pore-forming subunits of K-ATP channels, Kir6.1 and Kir6.2, display prominent differences in regional and cellular distribution in the rat brain. J Comp Neurol. 2005; 484: 313–330.[CrossRef][Medline] [Order article via Infotrieve]

3. Sgard F, Faure C, Drieu la Rochelle C, Graham D, O’Connor SE, Janiak P, Besnard F. Regulation of ATP-sensitive potassium channel mRNA expression in rat kidney following ischemic injury. Biochem Biophys Res Commun. 2000; 269: 618–622.[CrossRef][Medline] [Order article via Infotrieve]

4. Gabrielsson BG, Karlsson AC, Lonn M, Olofsson LE, Johansson JM, Torgerson JS, Sjostrom L, Carlsson B, Eden S, Carlsson LM. Molecular characterization of a local sulfonylurea system in human adipose tissue. Mol Cell Biochem. 2004; 258 (1–2): 65–71.[CrossRef][Medline] [Order article via Infotrieve]

5. Thabet M, Miki T, Seino S, Renaud JM. Treadmill running causes significant fiber damage in skeletal muscle of KATP channel-deficient mice. Physiol Genomics. 2005; 22: 204–212.[Abstract/Free Full Text]

6. Yoshida H, Feig JE, Morrissey A, Ghiu IA, Artman M, Coetzee WA. KATP channels of primary human coronary artery endothelial cells consist of a heteromultimeric complex of Kir6.1, Kir6.2, and SUR2B subunits. J Mol Cell Cardiol. 2004; 37: 857–869.[CrossRef][Medline] [Order article via Infotrieve]

7. Nichols CG. KATP channels as molecular sensors of cellular metabolism. Nature. 2006; 440: 470–476.[CrossRef][Medline] [Order article via Infotrieve]

8. Kane GC, Liu XK, Yamada S, Olson TM, Terzic A. Cardiac KATP channels in health and disease. J Mol Cell Cardiol. 2005; 38: 937–943.[CrossRef][Medline] [Order article via Infotrieve]

9. Tong X, Porter LM, Liu G, Dhar-Chowdhury P, Srivastava S, Pountney DJ, Yoshida H, Artman M, Fishman GI, Yu C, Iyer R, Morley GE, Gutstein DE, Coetzee WA. Consequences of cardiac myocyte-specific ablation of KATP channels in transgenic mice expressing dominant negative Kir6 subunits. Am J Physiol Heart Circ Physiol. 2006; 291: H543–H551.[Abstract/Free Full Text]

10. Zingman LV, Hodgson DM, Bast PH, Kane GC, Perez-Terzic C, Gumina RJ, Pucar D, Bienengraeber M, Dzeja PP, Miki T, Seino S, Alekseev AE, Terzic A. Kir6.2 is required for adaptation to stress. Proc Natl Acad Sci U S A. 2002; 99: 13278–13283.[Abstract/Free Full Text]

11. Babenko AP, Gonzalez G, Aguilar-Bryan L, Bryan J. Reconstituted human cardiac KATP channels: functional identity with the native channels from the sarcolemma of human ventricular cells. Circ Res. 1998; 83: 1132–1143.[Abstract/Free Full Text]

12. Ashcroft FM. AT. P-sensitive potassium channelopathies: focus on insulin secretion. J Clin Invest. 2005; 115: 2047–2058.[CrossRef][Medline] [Order article via Infotrieve]

13. Chatterjee S, Al-Mehdi AB, Levitan I, Stevens T, Fisher AB. Shear stress increases expression of a KATP channel in rat and bovine pulmonary vascular endothelial cells. Am J Physiol Cell Physiol. 2003; 285: C959–C967.[Abstract/Free Full Text]

14. Cole WC, Clement-Chomienne O. ATP-sensitive K+ channels of vascular smooth muscle cells. J Cardiovasc Electrophysiol. 2003; 14: 94–103.[CrossRef][Medline] [Order article via Infotrieve]

15. Tricarico D, Mele A, Lundquist AL, Desai RR, George AL Jr, Conte Camerino D. Hybrid assemblies of ATP-sensitive K+ channels determine their muscle-type-dependent biophysical and pharmacological properties. Proc Natl Acad Sci U S A. 2006; 103: 1118–1123.[Abstract/Free Full Text]

16. Akao M, Otani H, Horie M, Takano M, Kuniyasu A, Nakayama H, Kouchi I, Murakami T, Sasayama S. Myocardial ischemia induces differential regulation of KATP channel gene expression in rat hearts. J Clin Invest. 1997; 100: 3053–3059.[Medline] [Order article via Infotrieve]

17. Brown DA, Chicco AJ, Jew KN, Johnson MS, Lynch JM, Watson PA, Moore RL. Cardioprotection afforded by chronic exercise is mediated by the sarcolemmal, and not the mitochondrial, isoform of the KATP channel in the rat. J Physiol. 2005; 569 (pt 3): 913–924.[Abstract/Free Full Text]

18. Lu C, Halvorsen SW. Channel activators regulate ATP-sensitive potassium channel (KIR6.1) expression in chick cardiomyocytes. FEBS Lett. 1997; 412: 121–125.[CrossRef][Medline] [Order article via Infotrieve]

19. Brown DA, Lynch JM, Armstrong CJ, Caruso NM, Ehlers LB, Johnson MS, Moore RL. Susceptibility of the heart to ischaemia-reperfusion injury and exercise-induced cardioprotection are sex-dependent in the rat. J Physiol. 2005; 564 (pt 2): 619–630.[Abstract/Free Full Text]

20. Morrissey A, Parachuru L, Leung M, Lopez G, Nakamura TY, Tong X, Yoshida H, Srivastiva S, Chowdhury PD, Artman M, Coetzee WA. Expression of ATP-sensitive K+ channel subunits during perinatal maturation in the mouse heart. Pediatr Res. 2005; 58: 185–192.[CrossRef][Medline] [Order article via Infotrieve]

21. Ranki HJ, Budas GR, Crawford RM, Jovanovic A. Gender-specific difference in cardiac ATP-sensitive K(+) channels. J Am Coll Cardiol. 2001; 38: 906–915.[Abstract/Free Full Text]

22. Aguilar-Bryan L, Clement JP 4th, Gonzalez G, Kunjilwar K, Babenko A, Bryan J. Toward understanding the assembly and structure of KATP channels. Physiol Rev. 1998; 78: 227–245.[Abstract/Free Full Text]

23. Gribble FM, Reimann F, Ashfield R, Ashcroft FM. Nucleotide modulation of pinacidil stimulation of the cloned K(ATP) channel Kir6.2/SUR2A. Mol Pharmacol. 2000; 57: 1256–1261.[Abstract/Free Full Text]

24. Baron A, van Bever L, Monnier D, Roatti A, Baertschi AJ. A novel K(ATP) current in cultured neonatal rat atrial appendage cardiomyocytes. Circ Res. 1999; 85: 707–715.[Abstract/Free Full Text]

25. Poitry S, van Bever L, Coppex F, Roatti A, Baertschi AJ. Differential sensitivity of atrial and ventricular K(ATP) channels to metabolic inhibition. Cardiovasc Res. 2003; 57: 468–476.[Abstract/Free Full Text]

26. Carlsson P, Mahlapuu M. Forkhead transcription factors: key players in development and metabolism. Dev Biol. 2002; 250: 1–23.[CrossRef][Medline] [Order article via Infotrieve]

27. Wang H, Gauthier BR, Hagenfeldt-Johansson KA, Iezzi M, Wollheim CB Foxa2 (HNF3beta) controls multiple genes implicated in metabolism-secretion coupling of glucose-induced insulin release. J Biol Chem. 2002; 277: 17564–17570.[Abstract/Free Full Text]

28. Labrador V, Brun C, Konig S, Roatti A, Baertschi AJ. Peptidyl-glycine alpha-amidating monooxygenase targeting and shaping of atrial secretory vesicles: inhibition by mutated N-terminal ProANP and PBA. Circ Res. 2004; 95: e98–e109.[Abstract/Free Full Text]

29. van Bever L, Poitry S, Faure C, Norman RI, Roatti A, Baertschi AJ. Pore loop-mutated rat KIR6.1 and KIR6.2 suppress KATP current in rat cardiomyocytes. Am J Physiol Heart Circ Physiol. 2004; 287: H850–H859.[Abstract/Free Full Text]

30. Claycomb WC, Lanson NA Jr, Stallworth BS, Egeland DB, Delcarpio JB, Bahinski A, Izzo NJ Jr. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc Natl Acad Sci U S A. 1998; 95: 2979–2984.[Abstract/Free Full Text]

31. Remondino A, Rosenblatt-Velin N, Montessuit C, Tardy I, Papageorgiou I, Dorsaz PA, Jorge-Costa M, Lerch R. Altered expression of proteins of metabolic regulation during remodeling of the left ventricle after myocardial infarction. J Mol Cell Cardiol. 2000; 32: 2025–2034.[CrossRef][Medline] [Order article via Infotrieve]

32. Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R. Postinfarction heart failure in rats is associated with upregulation of GLUT-1 and downregulation of genes of fatty acid metabolism. Cardiovasc Res. 2001; 52: 407–416.[Abstract/Free Full Text]

33. Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. 1989; 7: 6419.

33. Brun C, Philip-Couderc P, Raggenbass M, Roatti A, Baertschi AJ. Intracellular targeting of truncated secretory peptides in the mammalian heart and brain. FASEB J. 2006; 20: 732–734.[Abstract/Free Full Text]

34. Hellqvist M, Mahlapuu M, Samuelsson L, Enerback S, Carlsson P. Differential activation of lung-specific genes by two forkhead proteins, FREAC-1 and FREAC-2. J Biol Chem. 1996; 271: 4482–4490.[Abstract/Free Full Text]

35. Gan L, Zheng W, Chabot JG, Unterman TG, Quirion R. Nuclear/cytoplasmic shuttling of the transcription factor FoxO1 is regulated by neurotrophic factors. J Neurochem. 2005; 93: 1209–1219.[CrossRef][Medline] [Order article via Infotrieve]

36. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999; 96: 857–868.[CrossRef][Medline] [Order article via Infotrieve]

37. Im SS, Kwon SK, Kang SY, Kim TH, Kim HI, Hur MW, Kim KS, Ahn YH. Regulation of GLUT4 gene expression by SREBP-1c in adipocytes. Biochem J. 2006; 399: 131–139.[CrossRef][Medline] [Order article via Infotrieve]

38. Meton I, Egea M, Anemaet IG, Fernandez F, Baanante IV Sterol. regulatory element binding protein-1a transactivates 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase gene promoter. Endocrinology. 2006; 147: 3446–3456.[Abstract/Free Full Text]

39. Zhang M, Bolfing MF, Knowles HJ, Karnes H, Hackett BP. Foxj1 regulates asymmetric gene expression during left-right axis patterning in mice. Biochem Biophys Res Commun. 2004; 324: 1413–1420.[CrossRef][Medline] [Order article via Infotrieve]

40. Bastie CC, Nahle Z, McLoughlin T, Esser K, Zhang W, Unterman T, Abumrad NA. FoxO1 stimulates fatty acid uptake and oxidation in muscle cells through CD36-dependent and -independent mechanisms. J Biol Chem. 2005; 280: 14222–14229.[Abstract/Free Full Text]

41. Kamei Y, Mizukami J, Miura S, Suzuki M, Takahashi N, Kawada T, Taniguchi T, Ezaki O. A forkhead transcription factor FKHR up-regulates lipoprotein lipase expression in skeletal muscle. FEBS Lett. 2003; 536 (1–3): 232–236.[CrossRef][Medline] [Order article via Infotrieve]

42. Barth AS, Merk S, Arnoldi E, Zwermann L, Kloos P, Gebauer M, Steinmeyer K, Bleich M, Kaab S, Pfeufer A, Uberfuhr P, Dugas M, Steinbeck G, Nabauer M. Functional profiling of human atrial and ventricular gene expression. Pflugers Arch. 2005; 450: 201–208.[CrossRef][Medline] [Order article via Infotrieve]

43. Tabibiazar R, Wagner RA, Liao A, Quertermous T. Transcriptional profiling of the heart reveals chamber-specific gene expression patterns. Circ Res. 2003; 93: 1193–1201.[Abstract/Free Full Text]

44. Isidoro Tavares N, Philip-Couderc P, Papageorgiou I, Baertschi AJ, Lerch R, Montessuit C. Expression and function of ATP-dependent potassium channels in late post-infarction remodeling. J Mol Cell Cardiol. 2007; 42: 1016–1025.[CrossRef][Medline] [Order article via Infotrieve]

45. Loennechen JP, Stoylen A, Beisvag V, Wisloff U, Ellingsen O. Regional expression of endothelin-1, ANP, IGF-1, and LV wall stress in the infarcted rat heart. Am J Physiol Heart Circ Physiol. 2001; 280: H2902–H2910.[Abstract/Free Full Text]

46. Melnyk P, Zhang L, Shrier A, Nattel S. Differential distribution of Kir2.1 and Kir2.3 subunits in canine atrium and ventricle. Am J Physiol Heart Circ Physiol. 2002; 283: H1123–H1133.[Abstract/Free Full Text]

47. Dixon JE, McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ Res. 1994; 75: 252–260.[Abstract/Free Full Text]

48. Franco D, Demolombe S, Kupershmidt S, Dumaine R, Dominguez JN, Roden D, Antzelevitch C, Escande D, Moorman AF. Divergent expression of delayed rectifier K(+) channel subunits during mouse heart development. Cardiovasc Res. 2001; 52: 65–75.[Abstract/Free Full Text]

49. DePaoli AM, Bell GI, Stoffel M. G protein-activated inwardly rectifying potassium channel (GIRK1/KGA) mRNA in adult rat heart and brain by in situ hybridization histochemistry. Mol Cell Neurosci. 1994; 5: 515–522.[CrossRef][Medline] [Order article via Infotrieve]

50. Kaab S, Barth AS, Margerie D, Dugas M, Gebauer M, Zwermann L, Merk S, Pfeufer A, Steinmeyer K, Bleich M, Kreuzer E, Steinbeck G, Nabauer M. Global gene expression in human myocardium-oligonucleotide microarray analysis of regional diversity and transcriptional regulation in heart failure. J Mol Med. 2004; 82: 308–316.[CrossRef][Medline] [Order article via Infotrieve]

51. Kono Y, Horie M, Takano M, Otani H, Xie LH, Akao M, Tsuji K, Sasayama S. The properties of the Kir6.1–6.2 tandem channel co-expressed with SUR2A. Pflugers Arch. 2000; 440: 692–698.[CrossRef][Medline] [Order article via Infotrieve]

52. Matsuo M, Tanabe K, Kioka N, Amachi T, Ueda K. Different binding properties and affinities for ATP and ADP among sulfonylurea receptor subtypes, SUR1, SUR2A, and SUR2B. J Biol Chem. 2000; 275: 28757–28763.[Abstract/Free Full Text]

53. Seino S, Miki T. Physiological and pathophysiological roles of ATP-sensitive K+ channels. Prog Biophys Mol Biol. 2003; 81: 133–176.[CrossRef][Medline] [Order article via Infotrieve]

54. Morris JB, Kenney B, Huynh H, Woodcock EA. Regulation of the proapoptotic factor FOXO1 (FKHR) in cardiomyocytes by growth factors and alpha1-adrenergic agonists. Endocrinology. 2005; 146: 4370–4376.[Abstract/Free Full Text]

55. Yue TL, Bao W, Gu JL, Cui J, Tao L, Ma XL, Ohlstein EH, Jucker BM. Rosiglitazone treatment in Zucker diabetic fatty rats is associated with ameliorated cardiac insulin resistance and protection from ischemia/reperfusion-induced myocardial injury. Diabetes. 2005; 54: 554–562.[Abstract/Free Full Text]

56. Chen Y, Park S, Li Y, Missov E, Hou M, Han X, Hall JL, Miller LW, Bache RJ. Alterations of gene expression in failing myocardium following left ventricular assist device support. Physiol Genomics. 2003; 14: 251–260.[Abstract/Free Full Text]

57. Hannenhalli S, Putt ME, Gilmore JM, Wang J, Parmacek MS, Epstein JA, Morrisey EE, Margulies KB, Cappola TP. Transcriptional genomics associates FOX transcription factors with human heart failure. Circulation. 2006; 114: 1269–1276.[Abstract/Free Full Text]

58. Skurk C, Izumiya Y, Maatz H, Razeghi P, Shiojima I, Sandri M, Sato K, Zeng L, Schiekofer S, Pimentel D, Lecker S, Taegtmeyer H, Goldberg AL, Walsh K. The FOXO3a transcription factor regulates cardiac myocyte size downstream of AKT signaling. J Biol Chem. 2005; 280: 20814–20823.[Abstract/Free Full Text]

59. Ocorr K, Perrin L, Lim H-Y, Qian L, Wu X, Bodmer R. Genetic control of heart function and aging in drosophila. Trends Cardiovasc Med. 2007; 17: 177–182.[CrossRef][Medline] [Order article via Infotrieve]

60. Barthel A, Schmoll D, Kruger KD, Roth RA, Joost HG. Regulation of the forkhead transcription factor FKHR (FOXO1a) by glucose starvation and AICAR, an activator of AMP-activated protein kinase. Endocrinology. 2002; 143: 3183–3186.[Abstract]

61. Jorgensen SB, Wojtaszewski JF, Viollet B, Andreelli F, Birk JB, Hellsten Y, Schjerling P, Vaulont S, Neufer PD, Richter EA, Pilegaard H. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J. 2005; 19: 1146–1148.[Abstract/Free Full Text]

62. Young LH, Li J, Baron SJ, Russell RR. AMP-activated protein kinase: a key stress signaling pathway in the heart. Trends Cardiovasc Med. 2005; 15: 110–118.[CrossRef][Medline] [Order article via Infotrieve]

63. Giatromanolaki A, Koukourakis MI, Sivridis E, Gatter KC, Harris AL, Banham AH. Loss of expression and nuclear/cytoplasmic localization of the FOXP1 forkhead transcription factor are common events in early endometrial cancer: relationship with estrogen receptors and HIF-1alpha expression. Mod Pathol. 2006; 19: 9–16.[CrossRef][Medline] [Order article via Infotrieve]

64. Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. Roles of the HIF-1 hypoxia-inducible factor during hypoxia response in Caenorhabditis elegans. J Biol Chem. 2005; 280: 20580–20588.[Abstract/Free Full Text]

65. Tang TT, Lasky LA. The forkhead transcription factor FOXO4 induces the down-regulation of hypoxia-inducible factor 1 alpha by a von Hippel-Lindau protein-independent mechanism. J Biol Chem. 2003; 278: 30125–30135.[Abstract/Free Full Text]

66. Longo VD, Kennedy BK. Sirtuins in aging and age-related disease. Cell. 2006; 126: 257–268.[CrossRef][Medline] [Order article via Infotrieve]

67. Frescas D, Valenti L, Accili D. Nuclear trapping of the forkhead transcription factor FoxO1 via Sirt-dependent deacetylation promotes expression of glucogenetic genes. J Biol Chem. 2005; 280: 20589–20595.[Abstract/Free Full Text]

68. Maxwell PH. Hypoxia-inducible factor as a physiological regulator. Exp Physiol. 2005; 90: 791–797.[Abstract/Free Full Text]

69. Semenza GL. HIF-1, O(2), and the 3 PHDs: how animal cells signal hypoxia to the nucleus. Cell. 2001; 107: 1–3.[CrossRef][Medline] [Order article via Infotrieve]

70. Hughes AL, Todd BL, Espenshade PJ. SREBP pathway responds to sterols and functions as an oxygen sensor in fission yeast. Cell. 2005; 120: 831–842.[CrossRef][Medline] [Order article via Infotrieve]

71. Biggs WH 3rd, Meisenhelder J, Hunter T, Cavenee WK, Arden KC. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci U S A. 1999; 96: 7421–7426.[Abstract/Free Full Text]

72. Lantz KA, Vatamaniuk MZ, Brestelli JE, Friedman JR, Matschinsky FM, Kaestner KH. Foxa2 regulates multiple pathways of insulin secretion. J Clin Invest. 2004; 114: 512–520.[CrossRef][Medline] [Order article via Infotrieve]

73. Xuan Z, Zhang MQ. From worm to human: bioinformatics approaches to identify FOXO target genes. Mech Ageing Dev. 2005; 126: 209–215.[CrossRef][Medline] [Order article via Infotrieve]

74. Opie LH. Glucose and the metabolism of ischaemic myocardium. Lancet. 1995; 345: 1520–1521.[CrossRef][Medline] [Order article via Infotrieve]

75. Stanley WC, Recchia FA, Lopaschuk GD. Myocardial substrate metabolism in the normal and failing heart. Physiol Rev. 2005; 85: 1093–1129.[Abstract/Free Full Text]

76. Barger PM, Kelly DP. PPAR signaling in the control of cardiac energy metabolism. Trends Cardiovasc Med. 2000; 10: 238–245.[CrossRef][Medline] [Order article via Infotrieve]

77. Morgan EE, Chandler MP, Young ME, McElfresh TA, Kung TA, Rennison JH, Tserng KY, Hoit BD, Stanley WC. Dissociation between gene and protein expression of metabolic enzymes in a rodent model of heart failure. Eur J Heart Fail. 2006; 8: 687–693.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
N. Isidoro Tavares, P. Philip-Couderc, A. J. Baertschi, R. Lerch, and C. Montessuit
Angiotensin II and tumour necrosis factor {alpha} as mediators of ATP-dependent potassium channel remodelling in post-infarction heart failure
Cardiovasc Res, September 1, 2009; 83(4): 726 - 736.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Dai, D. D. Hall, and J. W. Hell
Supramolecular Assemblies and Localized Regulation of Voltage-Gated Ion Channels
Physiol Rev, April 1, 2009; 89(2): 411 - 452.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. van Bilsen, F. A. van Nieuwenhoven, and G. J. van der Vusse
Metabolic remodelling of the failing heart: beneficial or detrimental?
Cardiovasc Res, February 15, 2009; 81(3): 420 - 428.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. P. Flagg, H. T. Kurata, R. Masia, G. Caputa, M. A. Magnuson, D. J. Lefer, W. A. Coetzee, and C. G. Nichols
Differential Structure of Atrial and Ventricular KATP: Atrial KATP Channels Require SUR1
Circ. Res., December 5, 2008; 103(12): 1458 - 1465.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Perilhou, C. Tourrel-Cuzin, I. Kharroubi, C. Henique, V. Fauveau, T. Kitamura, C. Magnan, C. Postic, C. Prip-Buus, and M. Vasseur-Cognet
The Transcription Factor COUP-TFII Is Negatively Regulated by Insulin and Glucose via Foxo1- and ChREBP-Controlled Pathways
Mol. Cell. Biol., November 1, 2008; 28(21): 6568 - 6579.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
102/2/e20    most recent
CIRCRESAHA.107.166744v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Philip-Couderc, P.
Right arrow Articles by Baertschi, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Philip-Couderc, P.
Right arrow Articles by Baertschi, A. J.
Related Collections
Right arrow Biochemistry and metabolism
Right arrow Other myocardial biology
Right arrow Animal models of human disease
Right arrow Physiological and pathological control of gene expression