| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Integrative Physiology |
From the Emory University Division of Cardiology (J.D.W., W.C., L.L., S.D., D.G.H.), Department of Medicine, Atlanta, Ga; the Atlanta Veterans Administration Hospital (J.D.W., W.C., L.L., S.D., D.G.H.), Ga; Division of Clinical Chemistry and Biochemistry (B.T.), University Childrens Hospital Zürich, Switzerland; and Department of Surgery (K.H.), University of Pittsburgh, Pa.
Correspondence to David G. Harrison, Division of Cardiology, Emory University, 101 Woodruff Circle, WMBR 319, Atlanta, GA 30322. E-mail dharr02{at}emory.edu
| Abstract |
|---|
|
|
|---|
prime (
') subunit of casein kinase 2. The increase in H4B caused by shear is essential in allowing proper function of endothelial NO synthase because GPTCH-1 blockade with 2,4-diamino-6-hydroxypyrimidine during shear inhibited dimer formation of endothelial NO synthase, increased endothelial cell superoxide production, and prevented the increase in NO production caused by shear. Thus, shear stress not only increases endothelial NO synthase levels but also stimulates production of H4B by markedly enhancing GTPCH-1 activity via casein kinase 2–dependent phosphorylation on serine 81. These findings illustrate a new function of casein kinase 2 in the endothelium and provide insight into regulation of GTPCH-1 activity.
Key Words: endothelial cell endothelial NO synthase GTP cyclohydrolase 1 shear stress tetrahydrobiopterin
| Introduction |
|---|
|
|
|---|
Tetrahydrobiopterin (H4B) is an essential cofactor for eNOS to produce NO. H4B is involved in the catalytic process of L-arginine oxidation and NO production. The oxygenase domain of each eNOS monomer binds 1 H4B, so each functional dimer binds to 2 H4Bs. In the initiating step of L-arginine oxidation, H4B donates an electron to the ferrous–dioxygen complex in the oxygenase domain, leading to scission of the dioxygen and formation of an iron–oxy species that participates in L-arginine hydroxylation. The lack of sufficient amounts of H4B impairs this process, such that superoxide (O2
) is released from the ferrous–dioxygen complex and NO is not formed.9,10 This phenomenon has been referred to as eNOS uncoupling.
H4B can be synthesized via a de novo pathway, which involves the sequential actions of 3 enzymes. The first enzyme, GTP cyclohydrolase (GTPCH)-1, cleaves GTP to 7,8-dihydroneopterin triphosphate, which is then converted by 6-pyruvoyl-tetrahydropterin synthase (PTPS) to 6-pyruvoyl-tetrahydropterin. Sepiapterin reductase (SR), in a final NADPH-dependent step, reduces 6-pyruvoyl-tetrahydropterin to H4B.11 In addition, H4B can be formed by the action of a salvage pathway that converts 7,8-dihydrobiopterin (H2B) and quinoid–dihydrobiopterin back to H4B. It has recently been shown that endothelial cells predominantly convert H2B back to H4B by the enzyme dihydrofolate reductase (DHFR).12
Because eNOS protein is potently increased by shear and by exercise, it might also be necessary for the endothelial cell to increase H4B levels to maintain proper function of the newly formed eNOS enzyme. In this study, we demonstrate that shear stress increases the H4B levels in endothelial cells through a casein kinase 2 (CK2)-dependent phosphorylation of GTPCH-1 on serine 81. We further show that this increase in H4B in response to shear is necessary to allow proper function of the endothelial NO synthase.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture
Human aortic endothelial cells (HAECs) (Cambrex, San Diego, Calif) were cultured in EBM2 Media (EBM2 Bullet Kit; Cambrex) on 10-cm cell culture dishes, as previously described.13 Postconfluent HAECs between passages 4 to 8 were used for experiments. Cells were exposed to either unidirectional laminar shear (15 dynes) stress or oscillatory shear (±15 dynes) stress using a cone and plate viscometer.14 Cells were pretreated with the indicated agent in media for 1 hour before shear.
Measurements of Biopterin
Measurements of biopterin content were performed using high-performance liquid chromatography (HPLC) analysis (System GOLD, Beckman; fluorescence detector FP2020, Jasoc Inc) and a differential oxidation method, as described previously.15
Enzyme Assays
The activity of GTPCH-1 was measured by monitoring the conversion of the substrate GTP under saturating conditions to dihydroneopterin trisphosphate, detected by HPLC as its oxidized and dephosphorylated product neopterin. PTPS activity was measured by monitoring the conversion of dihydroneopterin triphosphate to H4B. Dihydroneopterin triphosphate was prepared enzymatically using recombinant GTPCH-1 protein (Abnova, Taipei, Taiwan). The activity of SR was assessed by monitoring the conversion of sepiapterin to H4B under saturating conditions.16
Small Interfering RNA Transfection
Cells were transfected with small interfering (si)RNA against CK2
(AS-CK2
: GTCCATGAAATATTCCACCTG), CK2
' (AS-CK2
': GTTCTCCAGAATCTTAACCTC), and GTPCH-1 (AS-GTPCH-1: GATCGTTGGTACGATACGCTT) or transfected with a nonsilencing control sequence (Ambion). Transfection was performed as previously described.8
Real-Time PCR
Endothelial cDNA was amplified using a LightCycler real-time thermocycler (Roche Diagnostics, Indianapolis, Ind). Primers for CK2
and CK2
' were as follow: CK2
forward, 5-GAGGTCCCAACATCATCACAC-3; reverse, 5-TGACATTATGGGGCTTGACATCT-3; and CK
' forward, 5-AACCTTCGTGGTGGAACAAAT-3; reverse, 5-CTTGCTGTGGCAGTAATCCAG-3. The resulting mRNA levels were expressed as a ratio to the level of 18S mRNA.
Western Blot and Detection of GTPCH-1 Phosphorylation
Using nonboiled lysates and low-temperature SDS-PAGE, eNOS dimer/monomer were immunoblotted (eNOS antibody 1:2500; BD-Transduction Laboratory) as described elsewhere.17 DHFR antibody was purchased from BD-Transduction Laboratory. CK2
and CK2
' antibodies were from Santa Cruz Biotechnology. The GTPCH-1 and PTPS antibody are described elsewhere.18,19 An alternate GTPCH-1 antibody was kindly provided by Irmgard Tegeder (University of Frankfurt, Germany). SR antibody was provided by Young Shik Park (Inje University, Kimhae, South Korea). To initially detect GTPCH-1 phosphorylation, the enzyme was immunoprecipitated with a monoclonal antibody (Abnova, Tapai, Taiwan) and A/G PLUS agarose beads (Santa Cruz Biotechnology). Phosphorylation was detected using ProQ Diamond staining (Invitrogen) according to the instructions of the manufacturer. Bands were visualized using a Kodak Image 2000MM station. To examine specific phosphorylation sites in GTPCH-1, rabbit polyclonal anti-phospho antibodies were raised against the phosphopeptides shown in Table I in the online data supplement at http://circres.ahajournals.org.
Measurement of NO and O2
Production
NO production was measured by electron spin resonance (ESR) using the specific colloid probe Fe2+ diethyldithiocarbamate (Fe[DETC]2) as described.20 For detection of O2
formation the spin probe 1-hydroxy-4-methoxy-2,2,6,6-tetramethylpiperidine (TMH) was used. Following either 14 hours of shear or static conditions, the medium was removed and a chelexed Krebs/HEPES containing TMH (0.5 mmol/L) was added to the cells for 60 minutes. The cells were then scraped from the dish, snap frozen, and placed in an ESR finger Dewer under liquid nitrogen. ESR settings were: field sweep, 80 G; microwave frequency, 9.39 GHz; microwave power, 2 mW; modulation amplitude, 5 G; conversion time, 327.68 ms; time constant, 5242.88 ms; 512 points resolution; and receiver gain, 1x104.
Statistical Analysis
All values are means±SEM. The data were compared between groups by t test when 1 comparison was performed and by ANOVA for multiple comparisons. A value of P<0.05 was considered significant. When significance was indicated by ANOVA, the Student–Newman–Keuls post hoc test was used when all groups were compared. The Bonferroni post hoc test was used to make selected comparisons and the Dunnett post hoc test was used when 1 group served as a control. In some cases, when the F test for comparison of variances was significant, groups were compared using the Mann–Whitney test and a Bonferroni correction.
| Results |
|---|
|
|
|---|
|
|
Effect of Shear Stress on Expression of Enzymes Involved in the H4B De Novo Biosynthesis
Other stimuli for H4B de novo synthesis, such as cytokines, increase GTPCH-1 protein levels. We therefore investigated the effect of shear stress on protein levels of GTPCH-1, PTPS, and SR. Laminar shear did not appreciably change the protein levels of any of the enzymes involved in H4B biosynthesis (Figure 2A). Western blots for GTPCH-1 demonstrate a predominant band at
30 kDa and inconsistently revealed a faint band at
35 kDa, which was inconsistently affected by oscillatory and laminar shear. Preliminary experiments using siRNA against GTPCH-1 indicated that both of these bands were specific for this enzyme. Western blots using a second GTPCH-1 antibody confirmed that neither oscillatory nor laminar shear increased GTPCH-1 protein levels (supplemental Figure I).21
|
Regulation of H4B Levels Under Shear Stress by Casein Kinase 2
A common mechanism for enzyme activation is phosphorylation. We immunoprecipitated GTPCH-1 and examined its phosphorylation using ProQ Diamond staining. Laminar shear caused a 2-fold increase in GTPCH-1 phosphorylation (Figure 2B). GTPCH-1 contains 1 protein kinase C phosphorylation site and 5 CK2 phosphorylation sites and has been shown to be phosphorylated by protein kinase C and CK2 in vitro.22,23 We therefore assessed the effects of protein kinase C or CK2 inhibition on H4B levels under laminar shear stress. Protein kinase C inhibition with chelerythrine (3 µmol/L) had no effect on H4B levels after 14 hours of laminar shear compared with untreated control cells. However, inhibition of CK2 with the specific inhibitor TBB dose-dependently blocked the increase in H4B caused by laminar shear (Figure 2C). In addition, pretreatment of cells with TBB for 1 hour before shear also inhibited the increase in GTPCH-1 activity (Figure 2D).
CK2 is composed of a ß regulatory subunit and either an
or
' catalytic subunit, the latter of which can function independently of the ß subunit.24 We therefore performed additional studies to confirm our results with TBB and to identify the catalytic subunit involved in regulation of GTPCH-1 activity. Using siRNA, we were able to selectively downregulate both protein and mRNA of either the
or
' subunits of CK2 (Figure 3A through 3C). Whereas downregulation of CK2
had no effect on the increase in H4B levels caused by shear, downregulation of the
' subunit of CK2 markedly inhibited this increase in H4B (Figure 3D). These changes in H4B levels were paralleled by identical effects of siRNA against CK2
and
' subunits on GTPCH-1 activity (Figure 3E). To clarify the role of CK2-mediated phosphorylation induced by shear, we raised polyclonal phosphospecifc antibodies against each of the 5 predicted CK2 phosphorylation sites. These revealed no evidence of phosphorylation of serine 60, threonine 112, serine 139, or threonine 240 either at baseline or in response to shear. In contrast, serine 81 showed faint phosphorylation in unsheared cells and a striking increase in phosphorylation in response to laminar shear (Figure 4A and 4B). Of note, oscillatory shear did not stimulate phosphorylation of serine 81 (Figure 4B). The band identified by this phospho antibody corresponded in size to the major band identified in Figure 2A and supplemental Figure I and was reduced by siRNA against GTPCH-1 but not by nonsilencing siRNA (Figure 4C). Shear-induced GPTCH-1 phosphorylation on serine 81 was inhibited in endothelial cells transfected with siRNA against the
' subunit of CK2 (Figure 4D). These studies strongly support a role of CK2 in the activation of GTPCH-1 activity caused by shear and demonstrates that this is mediated by phosphorylation of this enzyme on serine 81. Shear stress did not change protein levels of either the
or
' subunits (Figure 4E).
|
|
Effect of Shear Stress on the Salvage Pathway
It has recently been shown that DHFR is a predominant enzyme of the salvage pathway for maintenance of H4B in endothelial cells.12 We considered the possibility that laminar shear stress might increase DHFR expression. Paradoxically, laminar shear downregulated DHFR protein levels in endothelial cells (Figure 5A and 5B). Moreover, the DHFR inhibitor methotrexate (1 µmol/L) had no effect on the increase in H4B caused by shear and had no effect on the ratio of reduced to oxidized biopterin (Figure 5C). These data indicate that DHFR is likely not important for increasing H4B in response to shear in human endothelial cells.
|
Role of H4B Increase With Shear Stress for eNOS Coupling
The studies described above provide insight into how shear modulates H4B and GTPCH-1 activity. It was unclear, however, whether this increase in H4B was essential for eNOS function or whether the small amount of H4B present in human endothelial cells was sufficient to allow full eNOS catalytic function. To examine this question, we pretreated endothelial cells with the GTPCH-1 inhibitor 2,4-diamino-6-hydroxypyrimidine (DAHP) (1 mmol/L). This inhibited the shear-induced H4B increase without changing the ratio of H4B to oxidized pterins (Figure 6A). Basal NO production was then measured using ESR and the spin trap Fe[DETC]2. In the absence of shear, cells produced minimal amounts of NO, and this was not changed by DAHP treatment (Figure 6B). Exposure of endothelial cells to 14 hours of shear strikingly increased endothelial cell NO production, and this was significantly reduced by DAHP (Figure 6B). In the absence of sufficient H4B, eNOS not only fails to produce NO properly but also produces O2
. We therefore also measured O2
using ESR and the spin probe TMH. Under static conditions, the endothelial cell production of O2
was not affected by DAHP (Figure 6C). Laminar shear decreased O2
production in the absence of DAHP (Figure 6C). In the presence of DAHP, however, O2
production was significantly increased in sheared cells. This increase was inhibited by NG-nitro-L-arginine methyl ester, suggesting that the source of O2
was NO synthase. In keeping with these results, low-temperature Western blots for eNOS revealed that when de novo generation of H4B was prevented by DAHP, the formation of intact eNOS dimers caused by both oscillatory shear stress and laminar shear was blunted and monomer formation was increased (Figure 6D and 6E).
|
| Discussion |
|---|
|
|
|---|
30-fold, whereas the activities of PTPS and SR were unchanged. Our data indicate that this increase in GTPCH-1 activity was modulated by its phosphorylation on serine 81 by CK2. In contrast to laminar shear, oscillatory shear did not stimulate GTPCH-1 phosphorylation and caused only a modest increase in H4B and GTPCH-1 activity. The H4B increase with shear was found to be essential for the newly synthesized eNOS to produce NO and to prevent O2
In other cells, GTPCH-1 has been shown to be mediated by transcriptional mechanisms, posttranslationally by phosphorylation, and by the GTPCH-interacting protein GFRP, which modulates the activity of the enzyme. Cytokines lead to a marked upregulation of GTPCH-1 protein levels in several cells types.18,25–27 Hydrogen peroxide has also been shown to stimulate GTPCH-1 mRNA levels in mouse brain microvascular endothelial cells and in bovine endothelial cells.28 Unlike the cytokines and hydrogen peroxide, we found that laminar shear had no effect on GTPCH-1 protein expression but increased its activity by 30-fold. Of interest, the activity of PTPS and SR were unchanged by shear stress. Our data therefore indicate that the activity of GTPCH-1 is the regulating factor for H4B levels with shear stress. If one compares the relative activities of GTPCH-1, PTPS, and SR at baseline, it is obvious that PTPS activity is
10-fold higher than GTPCH-1, whereas SR activity is almost 500-fold greater. Thus, at baseline, the rate limiting step in H4B synthesis is GTPCH-1, the first step in the de novo pathway. Interestingly, in the setting of shear, the marked increase in GTPCH-1 activity exceeds that of PTPS activity, leading to a condition in which PTPS become rate limiting. The extraordinarily high level of SR activity is such that it is unlikely to ever become rate limiting in human endothelial cells. These findings are similar to the condition caused by interferon-
in human umbilical vein endothelial cells, in which the marked increase in GTPCH-1 activity overcomes the activity of PTPS.29 The very high levels of SR activity also explains why sepiapterin can markedly increase the endothelial cell level of H4B.
Our data indicate that phosphorylation of GTPCH-1 on serine 81 is critical in activation of this enzyme by laminar shear. How phosphorylation at this site affects enzyme function remains unknown. An examination of the known crystal structure of human GTPCH-1 indicates that serine 81 resides in an extension of the enzyme, which could shield the GTP binding site. It is conceivable that phosphorylation alters GTP access to its binding site; however, additional studies are needed to address this.
Our data also indicate that the
' subunit of CK2 is responsible for GTPCH-1 Ser-81 phosphorylation. CK2 is composed of 3 subunits, including a regulatory ß subunit and 2 catalytic subunits,
and
'. The
and
' subunits can function independently of the ß subunit and also of each other.24 Of interest, it has recently been shown that CK2 phosphorylates the angiotensin converting enzyme in endothelial cells, promoting its retention in the cell membrane.30 CK2 has been demonstrated to phosphorylate calmodulin, which inhibits its binding to eNOS.31 Relevant to the present study, laminar shear has been shown to cause CK2 phosphorylation of the transcription factor SP1.32 The specific mechanisms underlying activation of CK2 by shear needs further investigation.
The level of H4B is not only regulated by de novo synthesis but also by the salvage pathway, which converts H2B and quinoid–H2B to H4B. Recently, it has been shown that DHFR plays a predominant role in the endothelial cell salvage pathway.12 Our current study suggests that the increase in endothelial cell H4B with shear is unlikely attributable to the salvage pathway because methotrexate, which inhibits DHFR, did not alter this response. Moreover, shear caused a decrease in endothelial DHFR protein levels. Taken together with the above findings, these data would suggest that the predominant effect of shear on H4B synthesis is mediated by the de novo synthesis pathway and not via an alteration of the salvage pathway.
In contrast to laminar shear, oscillatory shear stress only minimally increased H4B levels and GTPCH-1 activity. Our data indicate that a major difference between laminar and oscillatory shear stress is that laminar shear stimulates serine 81 phosphorylation of GTPCH-1, whereas oscillatory shear stress does not. There are numerous prior examples of differing effects of laminar and oscillatory shear stress on endothelial cell function, with laminar shear having antiatherosclerotic effects, whereas oscillatory shear often promotes proinflammatory, proatherosclerotic events. Previously, we have found that oscillatory shear stress increases both NO production and eNOS expression, albeit to a lesser extent than that observed with laminar shear.33 Taken together with the effect on H4B levels, these results would help explain why endothelial cells in areas of disturbed flow have reduced levels of NO production.
Our present study and several others have indicated that an increase in H4B is essential in conditions when eNOS protein levels are elevated. When we prevented the increase in H4B during exposure to laminar shear, the cellular production of NO was only minimally increased and O2
production was increased. Moreover, eNOS dimer formation was blunted. In keeping with these data, Bendall et al recently showed that in transgenic mice overexpressing eNOS, a large portion of this enzyme was uncoupled, leading to excessive endothelial O2
production.34 This situation was ameliorated when these mice were crossed with animals overexpressing GTPCH-1, such that vascular production of O2
was reduced and NO synthesis was increased. Likewise, Bevers et al have recently shown that overexpression of eNOS in microvascular endothelial cells led to enhanced production of both NO and reactive oxygen species.35 When these cells were treated with H4B, NO production dramatically increased and reactive oxygen species production declined.
In accord with our present study, Lam et al have recently shown that H4B levels are increased in vivo by high shear caused by an aortocaval fistula.36 These authors found that GTPCH-1 protein was increased in this model, which might involve stimuli other than shear, such as an inflammatory response. It is likely that GTPCH-1 is phosphorylated by high-flow states in vivo, such as the aortocaval fistula used by Lam et al.
In conclusion, we find that shear stress is a potent stimulus for H4B de novo synthesis in human endothelial cells and that this is dependent on a marked GTPCH-1 activation by phosphorylation on serine 81. Our data indicate that this is likely mediated by CK2 and is necessary to maintain eNOS function during shear stress. These studies define a new role for CK2 in the endothelium and a novel mechanism of GTPCH-1 control.
| Acknowledgments |
|---|
This work was supported by NIH grants HL39006, HL38206, HL59248, and DK51257, NIH program project grants HL58000 and HL075209, and a Department of Veterans Affairs merit grant. J.D.W. was supported by the Deutsche Akademie der Naturforscher Leopoldina (BMBF-LPD 9901/8-97).
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Sessa WC, Pritchard K, Seyedi N, Wang J, Hintze TH. Chronic exercise in dogs increases coronary vascular nitric oxide production and endothelial cell nitric oxide synthase gene expression. Circ Res. 1994; 74: 349–353.
3. Davis ME, Cai H, McCann L, Fukai T, Harrison DG. Role of c-Src in regulation of endothelial nitric oxide synthase expression during exercise training. Am J Physiol Heart Circ Physiol. 2003; 284: H1449–H1453.
4. Fleming I, Busse R. NO: the primary EDRF. J Mol Cell Cardiol. 1999; 31: 5–14.[CrossRef][Medline] [Order article via Infotrieve]
5. Ku DN, Giddens DP, Zarins CK, Glagov S. Pulsatile flow and atherosclerosis in the human carotid bifurcation. Positive correlation between plaque location and low oscillating shear stress. Arteriosclerosis. 1985; 5: 293–302.
6. De Keulenaer GW, Chappell DC, Ishizaka N, Nerem RM, Alexander RW, Griendling KK. Oscillatory and steady laminar shear stress differentially affect human endothelial redox state: role of a superoxide-producing NADH oxidase. Circ Res. 1998; 82: 1094–1101.
7. Chappell DC, Varner SE, Nerem RM, Medford RM, Alexander RW. Oscillatory shear stress stimulates adhesion molecule expression in cultured human endothelium. Circ Res. 1998; 82: 532–539.
8. Mueller CF, Widder JD, McNally JS, McCann L, Jones DP, Harrison DG. The role of the multidrug resistance protein-1 in modulation of endothelial cell oxidative stress. Circ Res. 2005; 97: 637–644.
9. Vasquez-Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P, Pritchard KA Jr. Superoxide generation by endothelial nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci U S A. 1998; 95: 9220–9225.
10. Channon KM. Tetrahydrobiopterin: regulator of endothelial nitric oxide synthase in vascular disease. Trends Cardiovasc Med. 2004; 14: 323–327.[CrossRef][Medline] [Order article via Infotrieve]
11. Thony B, Auerbach G, Blau N. Tetrahydrobiopterin biosynthesis, regeneration and functions. Biochem J. 2000; 347 (pt 1): 1–16.[CrossRef][Medline] [Order article via Infotrieve]
12. Chalupsky K, Cai H. Endothelial dihydrofolate reductase: critical for nitric oxide bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A. 2005; 102: 9056–9061.
13. Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison DG. Transcriptional and posttranscriptional regulation of endothelial nitric oxide synthase expression by hydrogen peroxide. Circ Res. 2000; 86: 347–354.
14. McNally JS, Davis ME, Giddens DP, Saha A, Hwang J, Dikalov S, Jo H, Harrison DG. Role of xanthine oxidoreductase and NAD(P)H oxidase in endothelial superoxide production in response to oscillatory shear stress. Am J Physiol Heart Circ Physiol. 2003; 285: H2290–H2297.
15. Fukushima T, Nixon JC. Analysis of reduced forms of biopterin in biological tissues and fluids. Anal Biochem. 1980; 102: 176–188.[CrossRef][Medline] [Order article via Infotrieve]
16. Bonafe L, Thony B, Leimbacher W, Kierat L, Blau N. Diagnosis of dopa-responsive dystonia and other tetrahydrobiopterin disorders by the study of biopterin metabolism in fibroblasts. Clin Chem. 2001; 47: 477–485.
17. Klatt P, Schmidt K, Lehner D, Glatter O, Bachinger HP, Mayer B. Structural analysis of porcine brain nitric oxide synthase reveals a role for tetrahydrobiopterin and L-arginine in the formation of an SDS-resistant dimer. EMBO J. 1995; 14: 3687–3695.[Medline] [Order article via Infotrieve]
18. Huang A, Zhang YY, Chen K, Hatakeyama K, Keaney JF Jr. Cytokine-stimulated GTP cyclohydrolase I expression in endothelial cells requires coordinated activation of nuclear factor-kappaB and Stat1/Stat3. Circ Res. 2005; 96: 164–171.
19. Oppliger T, Thony B, Nar H, Burgisser D, Huber R, Heizmann CW, Blau N. Structural and functional consequences of mutations in 6-pyruvoyltetrahydropterin synthase causing hyperphenylalaninemia in humans. Phosphorylation is a requirement for in vivo activity. J Biol Chem. 1995; 270: 29498–29506.
20. Hart CM, Kleinhenz DJ, Dikalov SI, Boulden BM, Dudley SC Jr. The measurement of nitric oxide production by cultured endothelial cells. Methods Enzymol. 2005; 396: 502–514.[Medline] [Order article via Infotrieve]
21. Tegeder I, Costigan M, Griffin RS, Abele A, Belfer I, Schmidt H, Ehnert C, Nejim J, Marian C, Scholz J, Wu T, Allchorne A, Diatchenko L, Binshtok AM, Goldman D, Adolph J, Sama S, Atlas SJ, Carlezon WA, Parsegian A, Lotsch J, Fillingim RB, Maixner W, Geisslinger G, Max MB, Woolf CJ. GTP cyclohydrolase and tetrahydrobiopterin regulate pain sensitivity and persistence. Nat Med. 2006; 12: 1269–1277.[CrossRef][Medline] [Order article via Infotrieve]
22. Hatakeyama K, Inoue Y, Harada T, Kagamiyama H. Cloning and sequencing of cDNA encoding rat GTP cyclohydrolase I. The first enzyme of the tetrahydrobiopterin biosynthetic pathway. J Biol Chem. 1991; 266: 765–769.
23. Hesslinger C, Kremmer E, Hultner L, Ueffing M, Ziegler I. Phosphorylation of GTP cyclohydrolase I and modulation of its activity in rodent mast cells. GTP cyclohydrolase I hyperphosphorylation is coupled to high affinity IgE receptor signaling and involves protein kinase C. J Biol Chem. 1998; 273: 21616–21622.
24. Meggio F, Pinna LA. One-thousand-and-one substrates of protein kinase CK2? FASEB J. 2003; 17: 349–368.
25. Werner ER, Werner-Felmayer G, Fuchs D, Hausen A, Reibnegger G, Yim JJ, Pfleiderer W, Wachter H. Tetrahydrobiopterin biosynthetic activities in human macrophages, fibroblasts, THP-1, and T 24 cells. GTP-cyclohydrolase I is stimulated by interferon-gamma, and 6-pyruvoyl tetrahydropterin synthase and sepiapterin reductase are constitutively present. J Biol Chem. 1990; 265: 3189–3192.
26. Hattori Y, Nakanishi N, Kasai K, Shimoda SI. GTP cyclohydrolase I mRNA induction and tetrahydrobiopterin synthesis in human endothelial cells. Biochim Biophys Acta. 1997; 1358: 61–66.[Medline] [Order article via Infotrieve]
27. Katusic ZS, Stelter A, Milstien S. Cytokines stimulate GTP cyclohydrolase I gene expression in cultured human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol. 1998; 18: 27–32.
28. Shimizu S, Shiota K, Yamamoto S, Miyasaka Y, Ishii M, Watabe T, Nishida M, Mori Y, Yamamoto T, Kiuchi Y. Hydrogen peroxide stimulates tetrahydrobiopterin synthesis through the induction of GTP-cyclohydrolase I and increases nitric oxide synthase activity in vascular endothelial cells. Free Radic Biol Med. 2003; 34: 1343–1352.[CrossRef][Medline] [Order article via Infotrieve]
29. Werner-Felmayer G, Werner ER, Fuchs D, Hausen A, Reibnegger G, Schmidt K, Weiss G, Wachter H. Pteridine biosynthesis in human endothelial cells. Impact on nitric oxide-mediated formation of cyclic GMP. J Biol Chem. 1993; 268: 1842–1846.
30. Kohlstedt K, Shoghi F, Muller-Esterl W, Busse R, Fleming I. CK2 phosphorylates the angiotensin-converting enzyme and regulates its retention in the endothelial cell plasma membrane. Circ Res. 2002; 91: 749–756.
31. Greif DM, Sacks DB, Michel T. Calmodulin phosphorylation and modulation of endothelial nitric oxide synthase catalysis. Proc Natl Acad Sci U S A. 2004; 101: 1165–1170.
32. Dunzendorfer S, Lee HK, Tobias PS. Flow-dependent regulation of endothelial Toll-like receptor 2 expression through inhibition of SP1 activity. Circ Res. 2004; 95: 684–691.
33. Cai H, McNally JS, Weber M, Harrison DG. Oscillatory shear stress upregulation of endothelial nitric oxide synthase requires intracellular hydrogen peroxide and CaMKII. J Mol Cell Cardiol. 2004; 37: 121–125.[CrossRef][Medline] [Order article via Infotrieve]
34. Bendall JK, Alp NJ, Warrick N, Cai S, Adlam D, Rockett K, Yokoyama M, Kawashima S, Channon KM. Stoichiometric relationships between endothelial tetrahydrobiopterin, endothelial NO synthase (eNOS) activity, and eNOS coupling in vivo: insights from transgenic mice with endothelial-targeted GTP cyclohydrolase 1 and eNOS overexpression. Circ Res. 2005; 97: 864–871.
35. Bevers LM, Braam B, Post JA, van Zonneveld AJ, Rabelink TJ, Koomans HA, Verhaar MC, Joles JA. Tetrahydrobiopterin, but not L-arginine, decreases NO synthase uncoupling in cells expressing high levels of endothelial NO synthase. Hypertension. 2006; 47: 87–94.
36. Lam CF, Peterson TE, Richardson DM, Croatt AJ, dUscio LV, Nath KA, Katusic ZS. Increased blood flow causes coordinated upregulation of arterial eNOS and biosynthesis of tetrahydrobiopterin. Am J Physiol Heart Circ Physiol. 2006; 290: H786–H793.
Related Article:
Circ. Res. 2007 101: 752-754.
This article has been cited by other articles:
![]() |
J. Bauersachs and J. D. Widder Tetrahydrobiopterin, Endothelial Nitric Oxide Synthase, and Mitochondrial Function in the Heart Hypertension, June 1, 2009; 53(6): 907 - 908. [Full Text] [PDF] |
||||
![]() |
J.-L. Balligand, O. Feron, and C. Dessy eNOS Activation by Physical Forces: From Short-Term Regulation of Contraction to Chronic Remodeling of Cardiovascular Tissues Physiol Rev, April 1, 2009; 89(2): 481 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Hoch, T. J. Guzik, W. Chen, T. Deans, S. A. Maalouf, P. Gratze, C. Weyand, and D. G. Harrison Regulation of T-cell function by endogenously produced angiotensin II Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R208 - R216. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Bowling, Z. Huang, D. Xu, F. Ferdousy, C. D. Funderburk, N. Karnik, W. Neckameyer, and J. M. O'Donnell Direct Binding of GTP Cyclohydrolase and Tyrosine Hydroxylase: REGULATORY INTERACTIONS BETWEEN KEY ENZYMES IN DOPAMINE BIOSYNTHESIS J. Biol. Chem., November 14, 2008; 283(46): 31449 - 31459. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I. Mun, S. M. An, H. Park, H. Jo, and Y. C. Boo Laminar shear stress inhibits lipid peroxidation induced by high glucose plus arachidonic acid in endothelial cells Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H1966 - H1973. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fraccarollo, J. D. Widder, P. Galuppo, T. Thum, D. Tsikas, M. Hoffmann, H. Ruetten, G. Ertl, and J. Bauersachs Improvement in Left Ventricular Remodeling by the Endothelial Nitric Oxide Synthase Enhancer AVE9488 After Experimental Myocardial Infarction Circulation, August 19, 2008; 118(8): 818 - 827. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. d'Uscio and Z. S. Katusic Erythropoietin Increases Endothelial Biosynthesis of Tetrahydrobiopterin by Activation of Protein Kinase B{alpha}/Akt1 Hypertension, July 1, 2008; 52(1): 93 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. De Bono and K. M. Channon Endothelial Cell Tetrahydrobiopterin: Going With the Flow Circ. Res., October 12, 2007; 101(8): 752 - 754. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |