Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2007;101:682-691
Published online before print August 2, 2007, doi: 10.1161/CIRCRESAHA.107.151563
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
101/7/682    most recent
CIRCRESAHA.107.151563v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muthig, V.
Right arrow Articles by Hein, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muthig, V.
Right arrow Articles by Hein, L.
Related Collections
Right arrow Other Vascular biology
Right arrow Angiogenesis
Right arrow Genetically altered mice
Right arrowRelated Article
(Circulation Research. 2007;101:682.)
© 2007 American Heart Association, Inc.


Molecular Medicine

Upregulation of Soluble Vascular Endothelial Growth Factor Receptor 1 Contributes to Angiogenesis Defects in the Placenta of {alpha}2B-Adrenoceptor–Deficient Mice

Verena Muthig, Ralf Gilsbach, Miriam Haubold, Melanie Philipp, Tomi Ivacevic, Manfred Gessler, Lutz Hein

From the Institute of Experimental and Clinical Pharmacology (V.M., R.G., M.H., M.P., L.H.), University of Freiburg, Germany; Institute of Cell Biology (M.P.), Duke University Medical Center, Durham, NC; European Molecular Biology Laboratory (T.I.), Heidelberg, Germany; and Department of Physiological Chemistry (M.G.), Biocenter, University of Würzburg, Germany.

Correspondence to Lutz Hein, MD, Institute of Experimental and Clinical Pharmacology and Toxicology, University of Freiburg, Albertstrasse 25, 79104 Freiburg, Germany. E-mail lutz.hein{at}pharmakol.uni-freiburg.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
{alpha}2-adrenoceptors are essential presynaptic regulators of norepinephrine release from sympathetic nerves. Previous studies in mice with targeted deletions in the 3 {alpha}2-adrenoceptor genes have indicated that these receptors are essential for embryonic development. In the present study, we searched for the {alpha}2-adrenoceptor subtype(s) involved in placental development and its molecular mechanism using mice carrying targeted deletions in {alpha}2-adrenoceptor genes. Congenic {alpha}2B-adrenoceptor–deficient mice (Adra2b–/–) developed a defect in fetal and maternal vessel formation in the placenta labyrinth at embryonic day 10.5. This defect was accompanied by reduced endothelial cell proliferation and decreased extracellular signal-regulated kinase 1/2 phosphorylation levels in Adra2b–/– as compared with Adra2b+/+ placentae. Microarray analysis of wild-type and mutant placentae (maternal genotype Adra2b+/–) revealed 179 genes, which were significantly up- or downregulated >1.5-fold in {alpha}2B-deficient placentae. The type 1 receptor for vascular endothelial growth factor (Flt1), which is coexpressed with {alpha}2B-adrenoceptors in spongiotrophoblast and giant cells of the placenta, was found to be 2.3-fold upregulated in {alpha}2B-deficient placentae. Neutralization of Flt1 and its soluble splice variant sFlt1 by a specific antibody in vivo prevented the vascular defect in {alpha}2B-deficient placentae at embryonic day 10.5. Thus, {alpha}2B-adrenoceptors are essential to suppress antiangiogenic (s)Flt1 in spongiotrophoblasts to control the coordinated formation of a vascular labyrinth of fetal and maternal blood vessels in the murine placenta during development.


Key Words: adrenergic receptors • angiogenesis • gene-targeted mice • vascular endothelial growth factor


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Adrenoceptors mediate the biological actions of the endogenous catecholamines epinephrine and norepinephrine. Altogether, 9 different adrenoceptor subtypes have been identified by molecular cloning.1 A large body of physiological evidence has been accumulating that demonstrates the role of adrenergic signaling in peripheral autonomic as well as central nervous system function. Because of the absence of sufficiently selective ligands for some adrenoceptor subtypes, mice carrying targeted deletions in the adrenoceptor genes have confirmed and also expanded current knowledge about the adrenergic system.2,3 Whereas many studies have concentrated on the modulation of physiological functions in the cardiovascular, metabolic and peripheral and central nervous systems, some reports have highlighted the potential role of the adrenergic system for development and remodeling in the cardiovascular system.4,5

Deletion of the 3 {alpha}2-adrenoceptor subtypes in the mouse ({alpha}2ABC–/–) results in embryonic lethality associated with a severe defect in the development of the extraembryonic vasculature and reduced activity of mitogen-activated protein (MAP) kinases extracellular signal-regulated kinase (ERK)1 and -2 in the placenta and yolk sac at embryonic day (E)10.5.5 However, neither the {alpha}2-adrenoceptor subtype(s) required for vascular development nor the underlying molecular mechanism has been uncovered until now. Frequently, defects in the Ras–Raf–MEK–ERK pathway have been associated with vascular defects in extraembryonic tissues during mouse development.6–10 In the present study, we identified the {alpha}2B-adrenoceptor as the {alpha}2-subtype essential for placenta development. Furthermore, deletion of the gene encoding {alpha}2B-adrenoceptors (Adra2b) resulted in upregulation of the vascular endothelial growth factor (VEGF) receptor type 1 (VEGFR1) (Flt1) in spongiotrophoblast cells. Flt1 and its soluble splice variant (sFlt1) have previously been identified as antiangiogenic molecules, which bind VEGF ligand with high affinity and prevent it from activating other receptor subtypes, including the type 2 VEGF receptor (Flk1).11 Upregulation of Flt1 has also been linked with hypertension and preeclampsia during human pregnancy.12–15 Recent data indicate that angiotensin II stimulates secretion and release of soluble Flt1 from human placenta cytotrophoblasts.16 Our current data support a direct link between adrenergic receptor signaling and angiogenic regulation by the VEGF system.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Generation of {alpha}2-Adrenoceptor–Deficient Mice
The targeted deletion of the 3 {alpha}2-adrenoceptor genes (Adra2a, Adra2b, Adra2c) in mice has been described previously.5,17–19

Histology and Immunochemistry
For histological and 5'-bromo-2'-deoxyuridine (BrdUrd) analysis of the placentae, we injected 150 mg/kg (BrdUrd) (Sigma) in pregnant mice at E9.5. Twenty-four hours later (E10.5), the mice were perfused with 2% paraformaldehyde and 0.2% glutaraldehyde. The placentae were postfixed in 4% paraformaldehyde and embedded in paraffin or araldite. Morphology and proliferation rate were analyzed in 3-µm sections stained with the BrdUrd immunohistochemistry system (Calbiochem) and hematoxylin. Labyrinth endothelial cells were stained with anti-CD31 (clone MEC13.3; BD Pharmingen) and Alexa Fluor546–labeled secondary antibody (Molecular Probes).

Western Blot
For Western blot analysis, freshly prepared tissues of yolk sac and placenta at E10.5 or yolk sacs cultured 24 hours in serum-free RPMI 1640 were used. The cultured yolk sacs were stimulated with 10% fetal calf serum or 1 µmol/L medetomidine for 10 minutes as described previously.20 Antibodies against ERK1/2 and P-ERK1/2 were purchased from Cell Signaling Technologies (Danvers, Mass), anti-Gß from Santa Cruz Biotechnology (Heidelberg, Germany), goat anti-mouse VEGFR1 (sFlt-1/Flt-1) from R&D Systems (Wiesbaden, Germany), and rabbit anti-VEGF from Sigma-Aldrich (Munich, Germany).

Autoradiography
Receptor autoradiography was performed as described previously.5,21 Placentae were frozen in isopentane cooled to –40°C with liquid nitrogen and stored at –80°C. Transverse sections (10 µm) were serially cut with a cryostat, thaw-mounted onto slides, and incubated for 60 minutes in 50 mmol/L Tris-HCl (pH 7.5), 1.5 mmol/L EDTA, and 8 nmol/L [3H]RX821002. To determine nonspecific binding, 1 µmol/L atipamezole was included. Following incubations, the air-dried slides were exposed to 3H-Hyperfilm (Amersham Pharmacia, Freiburg, Germany) for 18 weeks.

Gene Expression Analysis
Comparative transcriptome analysis was performed using GeneChip Mouse Genome 430 2.0 Arrays (Affymetrix, Santa Clara, Calif). Sample preparation and hybridization were performed according to the Affymetrix standard protocol (Eukaryotic Sample and Array Processing) using 5 µg of total RNA from individual placenta specimens. Microarray data and a detailed description of the experimental procedure have been submitted to the Gene Expression Omnibus database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/geo; accession number GSE6909). In situ hybridization was performed as described.22 For quantitative RT-PCR, 1 µg of total RNA was reverse transcribed (QuantiTect Rev. Transcription Kit, Qiagen) and 20 ng of cDNA and 300 nmol/L sequence specific primers (MWG, Ebersberg, Germany) were run in triplicate reaction on a MX3000P detector (Stratagene, Amsterdam, Netherlands). Flt-1 and sFlt-1 expression was detected with the following specific primers: sFlt1 sense, 5'-AGGTGAGCACTGCGGCA; sFlt1 antisense, 5'-ATGAGTCCTTTAATGTTTGAC; Flt-1 sense, 5'- TGGCTCTACGACCTTAGACTG; Flt-1 antisense, 5'-CAGGTTTGACTTGTCTGAGGTT.

The cycling conditions were as follows: 15 minutes of polymerase activation at 95°C; 40 cycles at 95°C for 15 seconds, at 58°C for 30 seconds, and at 72°C for 30 seconds. Results were analyzed using MxPro software (Stratagene).23–25

Statistics
Differences between 2 or among multiple groups were analyzed using Student’s t test or ANOVA, followed by Bonferroni post hoc tests, respectively. A probability value of less than 0.05 was considered statistically significant. Results are displayed as means±SEM.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Generation of {alpha}2-Adrenoceptor–Deficient Mice
All animal procedures were approved by the responsible animal care committee of the University of Freiburg. The initial observation that {alpha}2-adrenoceptors are associated with placental angiogenesis was made in a mouse strain lacking all 3 {alpha}2-adrenoceptor subtypes (Adra2a–/–Adra2b–/–Adra2c–/–) which was maintained on a mixed C57BL/6J/129/Sv background.5 Thus, to test which of the {alpha}2-adrenoceptor subtype(s) might be involved in the angiogenic process in the placenta, we backcrossed all of the targeted deletions of {alpha}2A-, {alpha}2B-, and {alpha}2C-adrenoceptor genes for more than 12 generations onto a pure C57BL/6J genetic background. In this case, {alpha}2A- and {alpha}2C-deficient mice survived embryonic development, but {alpha}2B-adrenoceptor-deficient mice were lost during the embryonic period (data not shown). The critical period for placenta angiogenesis in Adra2a–/–Adra2b–/–Adra2c–/– mice was around E10.5 of embryonic development, at which time fetal and maternal blood vessels rapidly developed in wild-type but not in {alpha}2ABC-deficient mice to establish a vascular labyrinth.5 Thus, heterozygous Adra2b+/– mice were mated and extraembryonic vascular development was analyzed at E10.5 (Figure 1). At this time, {alpha}2B-deficient embryos were smaller than wild-type littermates (Figure 1a and 1b), but all embryos analyzed were viable and did not differ in their cardiac beating frequency. Histological analysis and CD31 immunostaining of the placentae revealed a significant deficit in vascularization of the embryonic part of the Adra2b–/– placentae as compared with Adra2b+/+ specimens (Figure 1c through 1j). In Adra2b–/– placentae, fetal blood vessels, which were lined by endothelial cells as well as maternal blood spaces between trophoblast cells, were scarce and contained only a few erythrocytes (Figure 1e and 1f). A reconstruction of 10 sequential sections through the vascular labyrinth showed well-developed fetal vessel branching and interconnection of vessels (Figure 1i). In contrast, fetal blood vessels had a narrow lumen and did not reveal sites of branching in {alpha}2B-deficient placentae (Figure 1j).


Figure 1
View larger version (57K):
[in this window]
[in a new window]

 
Figure 1. Congenic {alpha}2B-adrenoceptor–deficient mice show a defect in placenta vascularization. a and b, Wild-type (Adra2b+/+) and {alpha}2B-deficient (Adra2b–/–) embryos at E10.5. Scale bar=1 mm. c and d, Cross-section of placenta tissue at E10.5 derived from heterozygous intercrosses. Maternal genotype, Adra2b+/–; fetal genotype, Adra2b+/+ (c) or Adra2b–/– (d), respectively. D indicates decidua; GC, giant cells; S, spongiotrophoblast; L, vascular labyrinth. Scale bar=0.5 mm. e and f, The vascular labyrinth of {alpha}2B-deficient placenta (E10.5) develops with fewer fetal (F) and maternal (M) blood vessels than Adra2b+/+ placenta. E indicates endothelial cell; T, trophoblast cell. Scale bar=25 µm. g and h, CD31 staining of endothelial cells lining

Figure 1 (Continued). fetal vessels (F) in the labyrinth of Adra2b+/+ and Adra2b–/– placentae. Scale bar=20 µm. i and j, Reconstruction of 10 sequential sections through the Adra2b–/– vascular labyrinth shows fewer and smaller fetal blood vessels (arrowhead) (F) than Adra2b+/+ control labyrinth. Scale bar=40 µm.

Morphometric analysis of Adra2b+/+ and Adra2b–/– placentae confirmed these observations (Figure 2). In the Adra2b–/– labyrinth, density of endothelial cells was reduced by 65% and trophoblast cell number was significantly higher as compared with Adra2b+/+ embryos (Figure 2a). The area of the labyrinth that was covered by fetal or maternal vessels was reduced in {alpha}2B-deficient specimens by 38% and 35%, respectively (Figure 2b). Density and number of trophoblast giant cells and spongiotrophoblast layers was not affected by deletion of the {alpha}2B-adrenoceptor gene (Figure 2c through 2e). To test whether the altered labyrinthine cell type distribution was attributable to a difference in cell proliferation between Adra2b+/+ and Adra2b–/– cells, pregnant mice were received injections of BrdUrd at E9.5 (Figure 2f through 2h). At E10.5, a similar percentage of giant cells and spongiotrophoblast cells were labeled with BrdUrd in Adra2b+/+ and in Adra2b–/– placentae (Figure 2h). However, BrdUrd incorporation was increased in labyrinth trophoblast cells and significantly decreased in endothelial cells of Adra2b–/– embryos (Figure 2h). Taken together, these data indicate that the primary angiogenesis defect in Adra2b–/– placentae is mediated by altered cell proliferation of labyrinthine endothelial and trophoblast cells.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
Figure 2. Morphometric analysis of {alpha}2B-adrenoceptor–deficient placentae at E10.5. a, In the vascular labyrinth of Adra2b–/– embryos, the number of trophoblast cells is increased, whereas endothelial cell number is decreased. b, The density of fetal and maternal capillaries in the Adra2b–/– vascular labyrinth is decreased at E10.5. c through e, Trophoblast giant cell (c) and spongiotrophoblast (d) numbers are not altered in Adra2b–/– placentae. Total spongiotrophoblast area is identical between mutant and wild-type embryos (n=1 to 2 sections from 6 embryos per genotype; *P<0.05). f through h, Proliferation of placenta cell types was assessed by BrdUrd labeling in vivo (dose, 150 mg/kg; 24 hours before euthanasia). Labyrinth trophoblasts from Adra2b–/– embryos showed a significantly higher percentage of BrdUrd labeling than Adra2b+/+ trophoblasts. {alpha}2B-Deficient endothelial cells in the labyrinth displayed reduced BrdUrd labeling (n=4 to 7 placentae per genotype). *P<0.05, unpaired t test.

{alpha}2-Adrenoceptor–Mediated MAP Kinase Activation
Previous experiments have indicated that several molecules of the MAP kinase signaling cascade are essential for placental vascular development.6–10 In freshly prepared Adra2b–/– placentae and yolk sacs, the amounts of the phosphorylated, active forms of ERK1/2 kinases were 35% lower compared with control specimens (Figure 3a). This was identical to the reduction in P-ERK1/2 levels that we found previously in {alpha}2ABC-deficient placentae at E10.5.20 To test whether {alpha}2B-receptors were directly linked to ERK1/2 activation in mouse extraembryonic tissues, Adra2b–/– and Adra2b+/+ yolk sac tissue was maintained in vitro for 24 hours and stimulated with the {alpha}2-agonist medetomidine or FCS (Figure 3b). The addition of medetomidine for 10 minutes increased P-ERK1/2 levels by 110% in Adra2b+/+ yolk sac but not in Adra2b–/– tissue, demonstrating that the {alpha}2B subtype is essential for {alpha}2-agonist–mediated ERK activation. In contrast to the ERK pathway, Akt expression and phosphorylation in the placenta was not affected by deletion of the Adra2b gene (Figure 3c).


Figure 3
View larger version (29K):
[in this window]
[in a new window]

 
Figure 3. MAP kinase activation by {alpha}2-agonists in the placenta requires {alpha}2B-adrenoceptors. a, Expression of ERK1/2 and phospho-ERK1/2 (P-ERK1/2) in freshly isolated placentae (maternal genotype, Adra2b+/–) or yolk sac tissue from Adra2b–/– or Adra2b+/+ embryos at E10.5. Western blot signals (shown at the top) for ERK and P-ERK were normalized to G protein ß subunit (Gß) density. Levels of phosphorylated ERK1/2 were significantly lower in Adra2b–/– placentae as compared with Adra2b+/+ tissue (placenta, n=5; yolk sac, n=3 to 4 per genotype). *P<0.05. b, In vitro, activation of {alpha}2-adrenoceptors in Adra2b+/+ yolk sac tissue with medetomidine (1 µmol/L, 10 minutes) resulted in a significant increase in ERK1/2 phosphorylation that could not be observed in Adra2b–/– specimens (Adra2b+/+, n=5; Adra2b–/–, n=7 per genotype; *P<0.05). c, Expression of Akt and phospho-Akt (P-Akt) Adra2b–/– or Adra2b+/+ placenta tissue (n=4 per genotype).

Differential Gene Expression in {alpha}2B-Deficient Placentae at E10.5
To search for antiangiogenic or angiogenic genes that might be dysregulated in the placentae of Adra2b–/– embryos, microarray expression profiling was performed using RNA isolated from total placentae of E10.5 wild-type and mutant embryos with the maternal Adra2b+/– genotype. A total of 179 well-annotated and 44 nonannotated genes were identified that were significantly regulated more than 1.5-fold in the Adra2b–/–fetalAdra2b+/–maternal placentae (Table I in the online data supplement, available at http://circres.ahajournals.org). Among the well-annotated genes, 74 were upregulated and 105 were significantly downregulated (Figure 4a). When these genes were clustered into functional groups, 38 genes associated with development were differentially regulated (Figure 4b). Within this group, 2 genes (Spint1, Gjb3) were linked to placenta development and 4 differentially expressed genes were involved in blood vessel morphogenesis (Flt1, Tgfb2, Wt1, Cxcl4). Cxcl4, Flt1, Gjb3, and Spint1 were significantly upregulated in {alpha}2B-deficient placentae, whereas Tgfb2 and Wt1 were downregulated (Figure 4c). Because Flt1 plays an essential role in placenta development26,27 and is coexpressed with {alpha}2B-adrenoceptors in giant cells and spongiotrophoblast cells, we validated expression of Vegfa, Flt1, and the other VEGF receptors by quantitative real-time RT-PCR (Figure 4d). Upregulation of Flt1 expression in the microarray experiments could be confirmed by quantitative real-time RT-PCR. Flt1 mRNA levels were 2.3-fold higher in {alpha}2B-deficient placentae than in wild-type control tissue from the same litter. Similarly, the soluble splice variant of Flt1 (sFlt1) was expressed 2.8-fold greater in {alpha}2B-deficient tissue (Figure 4d). Levels of sFlt1 mRNA were not altered in placenta tissue derived from {alpha}2A- or {alpha}2C-deficient mice (Figure 4e). Expression of placental growth factor mRNA, which is also a ligand of the VEGF receptors, was not different between Adra2b–/– and Adra2b+/+ placentae (91.7±14.1%).


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
Figure 4. Microarray and quantitative PCR analysis of differential gene expression in {alpha}2B-adrenoceptor–deficient placentae at E10.5. a, Microarray analysis of Adra2b+/+ and Adra2b–/– placentae (n=3 per genotype) revealed genes that were differentially expressed >1.5-fold between genotypes (yellow symbols; P<0.05). Expression signals of nonregulated genes are depicted as red symbols. b, Classification of regulated genes according to the Gene Ontology database identified 6 genes that were significantly regulated during organogenesis (2 placenta, 4 blood vessel morphogenesis). c, Expression of differentially expressed genes involved in placenta or vascular development as revealed by microarray analysis. mRNA levels of Cxcl4, Flt1, Gjb3, and Spint1 were significantly upregulated in E10.5 Adra2b–/– placentae as compared with Adra2b+/+ tissues. In contrast, Tgfb2 and Wt1 were expressed at lower levels in Adra2b–/– tissue. d, Validation of expression of VEGF and VEGF receptors by quantitative real-time PCR analysis of E10.5 placentae. The VEGF receptor Flt1 and its soluble version sFlt1 were significantly upregulated in E10.5 Adra2b–/– placentae (n=5 to 8 per genotype; *P<0.05). e, sFlt1 mRNA levels were not significantly altered in Adra2a–/– and Adra2c–/– placentae as compared with the respective wild-type controls at E10.5 (n=5 per genotype).

Localization of Placental {alpha}2B-Adrenoceptors, VEGF Ligand, and VEGF Receptors
To identify the localization of the {alpha}2B-receptors in the spatial context of the VEGF ligand/receptor family, we performed autoradiography and in situ hybridization experiments in placentae from Adra2a–/–Adra2b+/+Adra2c–/– embryos at E10.5, which only expressed the {alpha}2B-adrenoceptor subtype (Figure 5a and 5b and 5d through 5h). Using the non–subtype-selective {alpha}2-adrenoceptor antagonist [3H]RX821002, giant cell and spongiotrophoblast layers were most densely labeled with the radioligand (Figure 5a and 5b). A similar labeling pattern was observed in wild-type placentae, and this signal was completely absent in {alpha}2ABC-deficient placentae.5 To quantify mRNAs for the individual placental {alpha}2-adrenoceptor subtypes, quantitative real-time PCR experiments were performed on wild-type placenta specimens on E10.5 (Figure 5c). Consistent with previous results, {alpha}2B-receptor mRNA was most abundantly expressed, reaching levels that were approximately 100-fold higher than the {alpha}2C-subtype and 50-fold higher than the {alpha}2A-receptor (Figure 5c). A similar pattern of {alpha}2-subtype expression, ie, {alpha}2B>>{alpha}2A>{alpha}2C, was also found in the yolk sac at E10.5 (data not shown). Because placenta angiogenesis requires VEGF signaling, we determined the localization of VEGF and its receptors by in situ hybridization. Of these angiogenic regulators, the VEGF type-1 receptor (Flt1) was expressed in giant cells and spongiotrophoblast cells of Adra2a–/– Adra2b+/+Adra2c–/– placentae, which was similar to the {alpha}2B-receptor (Figure 5b and 5f). VEGF type-2 (Flk1) and type-3 receptors (Flt4) were identified in the vascular labyrinth (Figure 5g and 5h). VEGF-A ligand itself was most densely expressed in localized areas of the labyrinthine part of the Adra2a–/–Adra2b+/+Adra2c–/– placentae (Figure 5e). Protein levels of sFlt1 were 2-fold higher in {alpha}2B-deficient placenta tissue as compared with wild-type specimens (Figure 5i). However, placental VEGF-A expression did not change in Adra2b–/– tissues (Figure 5i).


Figure 5
View larger version (66K):
[in this window]
[in a new window]

 
Figure 5. Detection of {alpha}2B-adrenoceptors and VEGF ligand and receptors in the mouse placenta at E10.5. a and b, Autoradiography with [3H]RX821002 to localize {alpha}2B-adrenoceptors in the placentae of E10.5 Adra2a–/–Adra2b+/+Adra2c–/– embryos. a, Cryostat section through the embryonic part of the placenta. b, Overlay of section in a with autoradiography signal reveals localization of {alpha}2B-receptors in the giant cell (GC) and spongiotrophoblast (S) layers. No specific labeling was observed in the maternal decidua (D) or in the vascular labyrinth (L). Scale bar=60 µm. c, Quantitative real-time RT-PCR analysis of {alpha}2-adrenoceptor subtypes in the wild-type placentae at E10.5 (Adra2a+/+Adra2b+/+Adra2c+/+; n=4). {alpha}2B-Adrenoceptors are most abundantly expressed in the placenta as compared with {alpha}2C- and {alpha}2A-receptors. d through h, In situ hybridization in Adra2a–/–Adra2b+/+Adra2c–/– placentae at E10.5 to detect Tpbpa (d), Vegfa (e), Flt1 (f), Flk1 (g), and Flt4 (h). Scale bars=60 µm. i, Expression of sFlt1 and VEGF-A in E10.5 placentae as detected by Western blot (n=7 per genotype). *P<0.05.

Neutralization of Flt1/sFlt1 Rescues Placenta Vascular Defect
To test whether upregulation of Flt1 and sFlt1 is causally linked with the defect in placenta vascular development of {alpha}2B-deficient mice, we attempted to block Flt1/sFlt function in vivo using a neutralizing antiserum.28 On E9.0, 25 µg of antiserum were injected intravenously into pregnant Adra2b+/– mice that had been mated with Adra2b+/– males.28 At E10.5, vascular structure and MAP kinase activation was assessed in Adra2b–/– and Adra2b+/+ embryos (Figure 6). Anti-Flt1 completely normalized vascularization in {alpha}2B-deficient placentae (Figure 6a through 6c). No difference could be identified in the density of fetal or maternal blood vessels as well as in labyrinth trophoblast and endothelial cell density (Figure 6b and 6c). In addition, phosphorylation of ERK1/2 did not differ in freshly isolated tissue from wild-type or {alpha}2B-deficient placentae (Figure 6d). These data indicate that neutralizing (s)Flt1 by an antibody strategy can inhibit the vascular and ERK1/2 signaling defects in {alpha}2B-deficient mouse placentae.


Figure 6
View larger version (56K):
[in this window]
[in a new window]

 
Figure 6. Neutralization of Flt/sFlt rescues defects in placenta vascularization and ERK1/2 phosphorylation. Anti-Flt1 antiserum (25 µg) was injected intravenously in Adra2b+/– mothers (mated with Adra2b+/–) at E9.0. At E10.5, placenta tissue was harvested for genotyping and morphometric and P-ERK analysis. a through c, Cross-sections (scale bars=100 µm) (a) through the vascular labyrinth and morphometric analysis of vessel density (b) and labyrinth cell density (c) revealed no differences between genotypes after anti-Flt1 injection. Neutralization of (s)Flt1 led to a rescue of the vascularization defect in Adra2b–/– placentae (n=5 per genotype; *P<0.05). d, Expression of ERK and phosphorylated ERK (P-ERK) did not differ between freshly isolated Adra2b+/+ and Adra2b–/– placenta tissue at E10.5 (n=5 per genotype). *P<0.05.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrates that {alpha}2B-adrenoceptors are essential for vascular development in the murine placentae. During the early phase of formation of a vascular labyrinth of fetal and maternal blood vessels, {alpha}2B-adrenoceptors in spongiotrophoblast and giant cells inhibit expression of the soluble VEGF receptor type1 (also termed sFlt1). In mice with a targeted deletion in the {alpha}2B-adrenoceptor gene (Adra2b), upregulation of sFlt1 is causally linked with a vasculogenesis defect in the placenta labyrinth because neutralizing (s)Flt1 via antibody injection prevented the vascular defect in {alpha}2B-deficient extraembryonic tissue.

Previous studies have indicated that all 3 {alpha}2-adrenoceptors are required for extraembryonic vascular development, because mice deficient in {alpha}2A-, {alpha}2B-, and {alpha}2C-adrenoceptors did not survive beyond E10.5.20 However, because of different strategies in the generation of the individual targeted lines (injection of targeted Adra2b+/– and Adra2c+/– 129/Sv embryonic stem cells into C57BL/6J blastocysts18; aggregation of Adra2a+/– embryonic stem cells with FVB/N morulae19), {alpha}2ABC-deficient mice were generated on a mixed genetic background. Thus, to identify the {alpha}2-receptor subtype(s) essential for vascular development, all 3 targeted mutations were crossed back for >12 generations onto a pure C57BL/6J background. Whereas C57BL/6J congenic Adra2a–/– and Adra2c–/– mice were born at the expected Mendelian ratio and did not show any vascular defect in the placenta at E10.5, the placenta phenotype of congenic Adra2b–/– mice resembled the defect observed in {alpha}2ABC-deficient mice.5 This observation is consistent with the abundant expression of {alpha}2B-receptors in the placenta at E10.5. When mRNA expression levels of the 3 {alpha}2-subtypes in the placentae were compared by quantitative RT-PCR, {alpha}2B-receptors were expressed at {approx}100-fold higher levels than {alpha}2C and {approx}50-fold higher levels than {alpha}2A, respectively. By autoradiography labeling with a tritiated {alpha}2-adrenoceptor antagonist, [3H]RX821002, {alpha}2B-adrenoceptors were mostly localized in trophoblast giant cells and spongiotrophoblasts. Despite the expression of {alpha}2B-receptors in these cells, no differences in their number and proliferation rate were identified between Adra2b+/+ and Adra2b–/– embryos. The main developmental defect in the Adra2b–/– placentae was observed in the labyrinth as a decrease in fetal and maternal vessel number and a decreased proliferation rate of labyrinth endothelial cells. Thus, the question arose as to how {alpha}2B-receptors in spongiotrophoblasts and giant cells might control vessel formation in the labyrinth. Identification of soluble VEGF receptor-1 (sFlt1) upregulation in spongiotrophoblasts, which may diffuse into the labyrinth to block VEGF function, provides a plausible explanation for this phenotype (Figure 7).


Figure 7
View larger version (55K):
[in this window]
[in a new window]

 
Figure 7. Model of the role of {alpha}2B-adrenoceptors in formation of the placenta vascular labyrinth of the mouse. {alpha}2B-Adrenoceptors are coexpressed together with the type 1 VEGF receptor (Flt1/sFlt1) in trophoblast giant cells and in spongiotrophoblast cells and repress expression of Flt1 in these cells. After deletion of the gene encoding for {alpha}2B-receptors (Adra2b–/–), expression of Flt1 and its soluble splice variant sFlt1 is increased (red arrows). SFlt1 may diffuse between labyrinthine cells to bind and partially inactivate VEGF-A ligand with high affinity. Scavenging of VEGF-A by sFlt1 may result in reduced activation of angiogenesis by type 2 VEGF receptors (Flk1). E indicates endothelial cell; F, fetal blood vessel; M, maternal blood vessel.

Upregulation of sFlt1 was identified by whole-genome scanning for differentially expressed genes in the placentae at E10.5. Altogether, 179 genes were significantly regulated >1.5-fold in Adra2b–/– versus Adra2b+/+ placentae. The gene ontology algorithm identified only 6 genes within this group, which were classified to be associated with placenta development or blood vessel morphogenesis: Flt1, Tgfb2, Wt1, Cxcl4, Spint1, and Gjb3. Within this group, Flt1 was of particular interest because it overlapped in its expression pattern with the {alpha}2B-adrenoceptor in giant cells and spongiotrophoblast cells (Figures 5 and 7Up). Furthermore, (s)Flt1 has been shown to be an essential regulator of angiogenesis during development and in the adult organism, because mice carrying a targeted deletion in the Flt1 gene died during midgestation with the formation of abnormal vascular channels in embryonic and extraembryonic tissues.26,27,29 Differential splicing of Flt1 results in a soluble VEGF receptor (sFlt1) lacking its transmembrane and intracellular kinase domain.11 This soluble and therefore diffusible sFlt1 protein may capture VEGF and thus inhibit angiogenesis.30 Most recently, (s)Flt1 has been shown to be an essential prerequisite for corneal avascularity in several species.28 In addition, upregulation of sFlt1 has been associated with a number of different pathologies, including preeclampsia.14,15 By neutralizing (s)Flt1 with a blocking antibody in vivo, we could demonstrate that the defect in vessel formation in the placenta labyrinth and in MAP kinase activation of Adra2b–/– embryos could be completely rescued (Figure 6). The phenotypic rescue in the placentae of Adra2b–/– embryos by a neutralizing (s)Flt1 antibody provides support for a plausible model of angiogenic regulation by {alpha}2-adrenoceptors via suppression of (s)Flt1 expression in the spongiotrophoblast and giant cell layers (Figure 7). A possible link between {alpha}2-adrenoceptors and Flt1 expression may be derived from Flt1 promoter studies showing that cAMP is a strong inducer of Flt1 expression.31 Because {alpha}2B-adrenoceptors are known to inhibit adenylyl cyclase and thus lower cellular cAMP levels, deletion of {alpha}2-adrenoceptors should result in increased cAMP accumulation. In addition to the inhibition of adenylyl cyclase, {alpha}2-adrenoceptors have been shown to activate MAP kinase signaling in giant cells and spongiotrophoblasts.5 Future studies are required to determine whether cAMP or MAP kinase pathways are important for {alpha}2-mediated control of (s)Flt1 expression in these cells.

The fact that neutralization of (s)Flt1 by an antibody strategy rescued the defect of vascular development in Adra2b–/– placentae does not rule out that other differentially expressed genes may contribute to the vascular defect in {alpha}2B-deficient embryos. Genes that are already known to participate in vascular and placenta development and that are known to be expressed in spongiotrophoblasts and/or trophoblast giant cells may be candidates (see Figure 4c). Mice with a targeted deletion in the Gjb3 gene, which codes for connexin31, a protein subunit of gap junction channels, die between E10.5 and E13.5.32 Gjb3–/– embryos show reduced labyrinth and spongiotrophoblast size, but the placenta defect recovered progressively during later embryonic development.32

These results highlight the potential clinical relevance of adrenergic signaling for angiogenesis and vasculogenesis in humans. Future investigations may address whether {alpha}2B-adrenoceptors also affect angiogenesis in the adult organism, ie, during tissue ischemia or tumor growth. Recent data support the notion that adrenergic receptors may regulate more aspects of blood vessel development and remodeling than previously appreciated. In a recent report, chronic stress affected growth of tumor cells in vivo via a ß-adrenoceptor–dependent regulation of VEGF in vivo.33 Deficiency of norepinephrine synthesis by deletion of the dopamine ß-hydroxylase gene resulted in reduced remodeling of the vasculature after ischemia.34 Only a few studies have addressed the question of which of the adrenergic receptors may link catecholamine signals with angiogenesis. In the rat heart, norepinephrine stimulates myocardial angiogenesis by a paracrine mechanism that involves cardiac nonmyocytes and TGF-ß,35 and endothelial ß2-adrenoceptors promote neoangiogenesis in response to ischemic injury.36 With respect to vascular development of the placenta, it would be important to identify whether {alpha}2B-adrenoceptors play a similar role in the human placenta. This information may be of great clinical relevance because several functionally relevant polymorphisms that may potentially affect sFlt1 expression and blood vessel formation have been identified in human adrenoceptor genes. Several clinical studies have already demonstrated a link between increased sFlt1 expression and preeclampsia.14,15

In conclusion, the current study provides evidence that {alpha}2B-adrenoceptors can regulate formation of the placenta vasculature during embryonic development of the mouse. A key role in this process is the suppression of expression of the VEGF receptor-1 (Flt1) and its soluble splice variant (sFlt1) by {alpha}2B-adrenoceptors in giant cells and spongiotrophoblasts (Figure 7). Thus, adrenergic activation via {alpha}2B-adrenoceptors may counteract angiotensin II–mediated stimulation of sFlt1 secretion from trophoblast cells.16 Future studies should address the physiological and pathophysiological relevance of adrenergic sFlt1 activation and determine whether similar pathways may also control angiogenesis and vasculogenesis in the adult organism.


*    Acknowledgments
 
We thank the European Molecular Biology Laboratory GeneCore (Genomics Core Facility) staff, especially V. Benes, for helping with the Affymetrix microarrays.

Sources of Funding

This study was supported by the Deutsche Forschungsgemeinschaft (Bonn, Germany).

Disclosures

None.


*    Footnotes
 
Original received March 2, 2007; revision received July 20, 2007; accepted July 24, 2007.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Bylund DB, Bond RA, Clarke DE, Eikenburg DC, Hieble JP, Langer SZ, Lefkowitz RJ, Minneman KP, Molinoff PB, Ruffolo RR, Strosberg AD, Trendelenburg UG. Adrenoceptors. In The IUPHAR Compendium of Receptor Characterization and Classification. London, UK: IUPHAR Media; 1998: 58–74.
  2. Hein L. Transgenic models of {alpha}2-adrenergic receptor subtype function. Rev Physiol Biochem Pharmacol. 2001; 142: 161–185.[Medline] [Order article via Infotrieve]
  3. Philipp M, Hein L. Adrenergic receptor knockout mice: distinct functions of 9 receptor subtypes. Pharmacol Ther. 2004; 101: 65–74.[CrossRef][Medline] [Order article via Infotrieve]
  4. Rohrer DK, Desai KH, Jasper JR, Stevens ME, Regula DP Jr, Barsh GS, Bernstein D, Kobilka BK. Targeted disruption of the mouse ß1–adrenergic receptor gene: developmental and cardiovascular effects. Proc Natl Acad Sci U S A. 1996; 93: 7375–7380.[Abstract/Free Full Text]
  5. Philipp M, Brede ME, Hadamek K, Gessler M, Lohse MJ, Hein L. Placental {alpha}2-adrenoceptors control vascular development at the interface between mother and embryo. Nat Genet. 2002; 31: 311–315.[CrossRef][Medline] [Order article via Infotrieve]
  6. Mikula M, Schreiber M, Husak Z, Kucerova L, Ruth J, Wieser R, Zatloukal K, Beug H, Wagner EF, Baccarini M. Embryonic lethality and fetal liver apoptosis in mice lacking the c-raf-1 gene. EMBO J. 2001; 20: 1952–1962.[CrossRef][Medline] [Order article via Infotrieve]
  7. Giroux S, Tremblay M, Bernard D, Cardin-Girard JF, Aubry S, Larouche L, Rousseau S, Huot J, Landry J, Jeannotte L, Charron J. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr Biol. 1999; 9: 369–372.[CrossRef][Medline] [Order article via Infotrieve]
  8. Hatano N, Mori Y, Oh-hora M, Kosugi A, Fujikawa T, Nakai N, Niwa H, Miyazaki J, Hamaoka T, Ogata M. Essential role for ERK2 mitogen-activated protein kinase in placental development. Genes Cells. 2003; 8: 847–856.[Abstract]
  9. Yao Y, Li W, Wu J, Germann UA, Su MS, Kuida K, Boucher DM. Extracellular signal-regulated kinase 2 is necessary for mesoderm differentiation. Proc Natl Acad Sci U S A. 2003; 100: 12759–12764.[Abstract/Free Full Text]
  10. Wojnowski L, Zimmer AM, Beck TW, Hahn H, Bernal R, Rapp UR, Zimmer A. Endothelial apoptosis in Braf-deficient mice. Nat Genet. 1997; 16: 293–297.[CrossRef][Medline] [Order article via Infotrieve]
  11. Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. J Biochem Mol Biol. 2006; 39: 469–478.[Medline] [Order article via Infotrieve]
  12. Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF, Schisterman EF, Thadhani R, Sachs BP, Epstein FH, Sibai BM, Sukhatme VP, Karumanchi SA. Circulating angiogenic factors and the risk of preeclampsia. N Engl J Med. 2004; 350: 672–683.[Abstract/Free Full Text]
  13. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, Morgan JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest. 2003; 111: 649–658.[CrossRef][Medline] [Order article via Infotrieve]
  14. Nadar SK, Karalis I, Al Yemeni E, Blann AD, Lip GY. Plasma markers of angiogenesis in pregnancy induced hypertension. Thromb Haemost. 2005; 94: 1071–1076.[Medline] [Order article via Infotrieve]
  15. Krysiak O, Bretschneider A, Zhong E, Webb J, Hopp H, Verlohren S, Fuhr N, Lanowska M, Nonnenmacher A, Vetter R, Jankowski J, Paul M, Schonfelder G. Soluble vascular endothelial growth factor receptor-1 (sFLT-1) mediates downregulation of FLT-1 and prevents activated neutrophils from women with preeclampsia from additional migration by VEGF. Circ Res. 2005; 97: 1253–1261.[Abstract/Free Full Text]
  16. Zhou CC, Ahmad S, Mi TJ, Xia L, Abassi S, Hewett PW, Sun CX, Ahmed A, Kellems RE, Xia Y. Angiotensin II induces soluble fms-like tyrosine kinase-1 release via calcineurin signaling pathway in pregnancy. Circ Res. 2007; 100: 88–95.[Abstract/Free Full Text]
  17. Link RE, Stevens MS, Kulatunga M, Scheinin M, Barsh GS, Kobilka BK. Targeted inactivation of the gene encoding the mouse {alpha}2C-adrenoceptor homolog. Mol Pharmacol. 1995; 48: 48–55.[Abstract]
  18. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, Kobilka BK. Cardiovascular regulation in mice lacking {alpha}2-adrenergic receptor subtypes b and c. Science. 1996; 273: 803–805.[Abstract]
  19. Altman JD, Trendelenburg AU, MacMillan L, Bernstein D, Limbird L, Starke K, Kobilka BK, Hein L. Abnormal regulation of the sympathetic nervous system in {alpha}2A-adrenergic receptor knockout mice. Mol Pharmacol. 1999; 56: 154–161.[Abstract/Free Full Text]
  20. Philipp M, Brede M, Hein L. Physiological significance of {alpha}2-adrenergic receptor subtype diversity: one receptor is not enough. Am J Physiol Regul Integr Comp Physiol. 2002; 283: R287–R295.[Abstract/Free Full Text]
  21. Bücheler M, Hadamek K, Hein L. Two {alpha}2-adrenergic receptor subtypes, {alpha}2A and {alpha}2C, inhibit transmitter release in the brain of gene-targeted mice. Neuroscience. 2002; 109: 819–826.[CrossRef][Medline] [Order article via Infotrieve]
  22. Fischer A, Schumacher N, Maier M, Sendtner M, Gessler M. The Notch target genes Hey1 and Hey2 are required for embryonic vascular development. Genes Dev. 2004; 18: 901–911.[Abstract/Free Full Text]
  23. Gilsbach R, Kouta M, Bonisch H, Bruss M. Comparison of in vitro and in vivo reference genes for internal standardization of real-time PCR data. Biotechniques. 2006; 40: 173–177.[Medline] [Order article via Infotrieve]
  24. Gilsbach R, Faron-Gorecka A, Rogoz Z, Bruss M, Caron MG, Dziedzicka-Wasylewska M, Bonisch H. Norepinephrine transporter knockout-induced up-regulation of brain {alpha}2A/C-adrenergic receptors. J Neurochem. 2006; 96: 1111–1120.[CrossRef][Medline] [Order article via Infotrieve]
  25. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29: e45.[Abstract/Free Full Text]
  26. Fong GH, Rossant J, Gertsenstein M, Breitman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995; 376: 66–70.[CrossRef][Medline] [Order article via Infotrieve]
  27. Fong GH, Zhang L, Bryce DM, Peng J. Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development. 1999; 126: 3015–3025.[Abstract]
  28. Ambati BK, Nozaki M, Singh N, Takeda A, Jani PD, Suthar T, Albuquerque RJ, Richter E, Sakurai E, Newcomb MT, Kleinman ME, Caldwell RB, Lin Q, Ogura Y, Orecchia A, Samuelson DA, Agnew DW, St Leger J, Green WR, Mahasreshti PJ, Curiel DT, Kwan D, Marsh H, Ikeda S, Leiper LJ, Collinson JM, Bogdanovich S, Khurana TS, Shibuya M, Baldwin ME, Ferrara N, Gerber HP, De Falco S, Witta J, Baffi JZ, Raisler BJ, Ambati J. Corneal avascularity is due to soluble VEGF receptor-1. Nature. 2006; 443: 993–997.[CrossRef][Medline] [Order article via Infotrieve]
  29. Hirashima M, Lu Y, Byers L, Rossant J. Trophoblast expression of fms-like tyrosine kinase 1 is not required for the establishment of the maternal-fetal interface in the mouse placenta. Proc Natl Acad Sci U S A. 2003; 100: 15637–15642.[Abstract/Free Full Text]
  30. He Y, Smith SK, Day KA, Clark DE, Licence DR, Charnock-Jones DS. Alternative splicing of vascular endothelial growth factor (VEGF)-R1 (FLT-1) pre-mRNA is important for the regulation of VEGF activity. Mol Endocrinol. 1999; 13: 537–545.[Abstract/Free Full Text]
  31. Morishita K, Johnson DE, Williams LT. A novel promoter for vascular endothelial growth factor receptor (flt-1) that confers endothelial-specific gene expression. J Biol Chem. 1995; 270: 27948–27953.[Abstract/Free Full Text]
  32. Plum A, Winterhager E, Pesch J, Lautermann J, Hallas G, Rosentreter B, Traub O, Herberhold C, Willecke K. Connexin31-deficiency in mice causes transient placental dysmorphogenesis but does not impair hearing and skin differentiation. Dev Biol. 2001; 231: 334–347.[CrossRef][Medline] [Order article via Infotrieve]
  33. Thaker PH, Han LY, Kamat AA, Arevalo JM, Takahashi R, Lu C, Jennings NB, Armaiz-Pena G, Bankson JA, Ravoori M, Merritt WM, Lin YG, Mangala LS, Kim TJ, Coleman RL, Landen CN, Li Y, Felix E, Sanguino AM, Newman RA, Lloyd M, Gershenson DM, Kundra V, Lopez-Berestein G, Lutgendorf SK, Cole SW, Sood AK. Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinoma. Nat Med. 2006; 12: 939–944.[CrossRef][Medline] [Order article via Infotrieve]
  34. Chalothorn D, Zhang H, Clayton JA, Thomas SA, Faber JE. Catecholamines augment collateral vessel growth and angiogenesis in hindlimb ischemia. Am J Physiol Heart Circ Physiol. 2005; 289: H947–H959.[Abstract/Free Full Text]
  35. Weil J, Benndorf R, Fredersdorf S, Griese DP, Eschenhagen T. Norepinephrine upregulates vascular endothelial growth factor in rat cardiac myocytes by a paracrine mechanism. Angiogenesis. 2003; 6: 303–309.[CrossRef][Medline] [Order article via Infotrieve]
  36. Iaccarino G, Ciccarelli M, Sorriento D, Galasso G, Campanile A, Santulli G, Cipolletta E, Cerullo V, Cimini V, Altobelli GG, Piscione F, Priante O, Pastore L, Chiariello M, Salvatore F, Koch WJ, Trimarco Ischemic neoangiogenesis enhanced by ß2-adrenergic receptor overexpression: a novel role for the endothelial adrenergic system. Circ Res. 2005; 97: 1182–1189.[Abstract/Free Full Text]

Related Article:

Sympathetic Control of VEGF Angiogenic Signaling: Dual Regulations by {alpha}2-Adrenoceptor Activation?
Yuichi Hattori, Seiji Yamamoto, and Naoyuki Matsuda
Circ. Res. 2007 101: 642-644. [Full Text] [PDF]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
C. Rampon, S. Bouillot, A. Climescu-Haulica, M.-H. Prandini, F. Cand, Y. Vandenbrouck, and P. Huber
Protocadherin 12 deficiency alters morphogenesis and transcriptional profile of the placenta
Physiol Genomics, July 9, 2008; 34(2): 193 - 204.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Hattori, S. Yamamoto, and N. Matsuda
Sympathetic Control of VEGF Angiogenic Signaling: Dual Regulations by {alpha}2-Adrenoceptor Activation?
Circ. Res., September 28, 2007; 101(7): 642 - 644.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
101/7/682    most recent
CIRCRESAHA.107.151563v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muthig, V.