| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Department of Pathology (T.S., T.N., A.C., F.D., M.A.R.) and Surgery (D.S., G.D.) University of Washington, Seattle.
Correspondence to Michael Reidy, PhD, Department of Pathology, University of Washington, 815 Mercer St, Seattle, WA 98109. E-mail mar1{at}u.washington.edu
| Abstract |
|---|
|
|
|---|
Key Words: sphingosine 1-phosphate receptors smooth muscle cells neointima
| Introduction |
|---|
|
|
|---|
S1P acts through 5 G protein–coupled receptors (S1P1 to S1P5), although arterial smooth muscle cells (SMCs) express only S1P1, S1P2, and S1P3.4,13 Initially these receptors were called endothelial cell differentiation gene receptors.14 Activation of S1P receptors induces coupling to a variety of G proteins, which in turn leads to activation of multiple pathways. In SMCs most work has concentrated on S1P1 and S1P2 because they have opposing actions. S1P1 couples to Gi and leads to activation of extracellular signal-regulated kinase, phosphatidylinositol 3-kinase, and Rac.13,15,16 Adult SMCs only weakly express S1P1, although it is more highly expressed in pup cells, and this has been linked to their increased ability to migrate and proliferate in response to S1P.17 S1P1 is also strongly expressed in SMCs from rat intimal lesions as well as in human atherosclerotic lesions.17,18 These data have been used to suggest that activation of S1P1 may induce events leading to restenosis and the formation of arterial lesions. S1P2 is the main receptor expressed by most adult medial SMCs and couples to Gi, Gq, and G12/13, and its activation by S1P is associated with inhibition of SMC migration.13,19 This is thought to occur via coupling to G12/13, leading to Rho activation and suppression of Rac activity.19,20
Relatively little is known about the function of S1P receptors in arteries. The most striking data come from studies in which S1P receptors have been deleted. S1P1–/– mice exhibit embryonic hemorrhage, have poorly developed blood vessels, and die in utero.21 S1P1–/– embryonic fibroblasts show a defect in migration and in the activation of the small GTPase Rac. The S1P2–/– mice are viable and show no obvious phenotype.22,23 In this study, we proposed to determine whether S1P2 plays any role in the growth of neointimal lesions in mouse arteries. Our data show that S1P2–/– arteries develop significantly larger neointimal lesions than wild-type arteries and that this is associated with an increase in SMC growth.
| Materials and Methods |
|---|
|
|
|---|
Animals and Surgical Procedure
S1P2-null mice and wild-type mice (C57BL/6x129) were kindly provided by Dr Richard L. Proia (NIH, Bethesda, Md).22 These mouse colonies were bred in our laboratory, and genotypes were verified by polymerase chain reaction analysis. Male mice between 7 to 8 weeks old (litter mates) were used for all the experiments. The left common carotid artery was dissected and ligated near the carotid bifurcation as previously described.24 All studies were performed within the guidelines for animal experimentation at the University of Washington.
Immunohistochemistry
Mice were injected intraperitoneally with bromodeoxyuridine (30 µg/g body weight), and carotid arteries were perfusion fixed with 4% paraformaldehyde in PBS for 3 minutes in situ.25 Hematoxylin-positive (total) and bromodeoxyuridine-positive (replicating) cells were counted on arterial sections (8 sections at 100 µm apart).
Mouse Arterial Smooth Muscle Cell Isolation
Arterial SMCs were isolated from adult male mouse carotid arteries by an enzyme dispersion approach using an enzyme mix (2 mg/mL BSA, 1 mg/mL collagenase, 0.375 mg/mL soybean trypsin inhibitor, and 0.125 mg/mL elastase type III in Hanks balanced salt solution). After 10 minutes of incubation, the adventitial layer was removed and the remaining tissue was incubated at 37°C for a further 2 hours; cells were then collected. Ten carotids were usually pooled for this procedure, and cells were used up to the ninth passage.
Reverse Transcription–Polymerase Chain Reaction
Total RNA from 8 pooled carotids was prepared using a kit from Qiagen. Following treatment with DNAse I (Promega), RNA was reverse transcribed using Superscript reverse transcriptase (Promega). RNA was then PCR amplified for S1P1, S1P2, and S1P3 expression using a Perkin Elmer Gene Amp PCR system. Forward and reverse primers were CACCACCGTCTTCACTCTGCTC and CTCCCAGTTGCTCCTTCCTTGC for S1P1; GCTCTACGGCAGTGACAAAAGC and GAGAGGCAGCACGGTGGAGCAG for SIP2; and TTGGGAAATGACACTCTCCGGGAA and TTGATCATGGTCAGGTGTCGCTCA for S1P3. The same RNA samples were PCR amplified for GAPDH.
In Vitro Migration
Migration was performed as described previously.25,26 Cells (1x105) were placed in the upper chamber of a 24-well Costar Transwell precoated with 0.1% type I collagen. Medium containing PDGF (20 ng/mL) and S1P (1 µmol/L) was added to the lower chamber. After 7 hours, cells on the lower surface were fixed with methanol and stained with hematoxylin. The cells on the lower surface of membranes (9 fields/membrane) were then counted under a microscope at x40 magnification. The data are expressed as the mean numbers of cells per field.
Measurement of S1P Levels
Plasma was deproteinated by addition of 80% acetonitrile. Extracts were cleared by centrifugation and subjected to reverse-phase chromatography on a Zorbax C-8 SB 2.1x50 mm SB column. S1P was eluted by a ballistic gradient (60% to 100% methanol) and measured by a Micromass Quattro Premier XE Tandem Quadrupole mass spectrometer (Waters) using a multiple reaction mode assay in which the M+H ion (m/z=380) is then fragmented to form a daughter ion at m/z 264, which is used for quantitation. An internal standard, a C17 S1P analog (Avanti Polar Lipids) with the m/z 366>250 transition, was used to correct for variation in sample preparation and instrument response.
Rho Activity
SMCs were seeded into 10-cm plates at 600 000 cells per plate and starved for 3 days. Cells were stimulated with 1 µmol/L S1P for 5 minutes, and Rho activity was measured in cell extracts with equal protein content using an ELISA technique following the instructions of the manufacturer (G-Elisa BK123, Cytoskeleton). Assays were performed in triplicate.
Inhibition of Rho Activity
Cell-permeable C3 Transferase (Cytoskeleton) was used to inhibit Rho proteins. SMCs were plated into 100-mm culture dishes at 700 000 cells per plate and allowed to recover overnight in 10% serum. The cells were rendered quiescent in serum-free DMEM for 32 hours before incubating with 2 µg/mL C3 Transferase in serum-free DMEM for 16 hours; they were then subjected to an in vitro migration assay.
Statistics
Differences between the wild-type group and the S1P2-null group for morphometric data, bromodeoxyuridine index, and migration data were evaluated by unpaired Students t test. All data were considered significant at P<0.05.
| Results |
|---|
|
|
|---|
|
Carotid Artery Remodeling
The left common carotid artery of S1P2-null and wild-type mice was ligated with a 6/0 suture tied just proximal to the internal–external bifurcation. Fourteen days after surgery, a small neointimal lesion was present in S1P2–/– arteries, and by 28 days, the neointima was significantly larger (Figure 2 and 3
). In wild-type arteries after 14 days, the neointimal lesions were comprised of 1 incomplete layer of SMCs (Figure 3A). Medial cell number remained constant throughout the experiment in both S1P2-null and wild-type arteries (Figure 3B).
|
|
In conjunction with the growth of the neointima, a significant increase in intimal SMC replication at days 7, 14, and 28 was detected in S1P2–/– arteries with a peak in replication at 14 days (Figure 4A). In a similar fashion, an increase in medial SMC replication was observed at all times after surgery (Figure 4B).
|
S1P2–/– SMCs Show an Increase in Migration
To measure migration, SMCs were isolated from carotid arteries of both S1P2–/– and wild-type mice, and migration was measured in vitro using a transwell chamber assay. A significant increase in migration of S1P2–/– SMCs occurred when stimulated with S1P alone and with a combination of S1P and PDGF as compared with wild-type SMCs. Both wild-type and S1P2–/– SMCs migrated equally well to PDGF (Figure 5).
|
Rho Activity
S1P2 is known to activate Rho via coupling to the G12/13, and in SMCs, this is associated with inhibition of cell movement.19 S1P activated Rho in wild-type but not in S1P2–/– SMCs under identical conditions (Figure 6).
|
To determine that Rho activation was indeed important in regulating SMC migration, wild-type SMCs were preincubated with 2 µg of the Rho inhibitor C3 exotoxin and the migration assay was repeated after 2 days. This concentration blocked S1P-induced Rho activity (data not shown). After treatment with C3, there was a significant increase in S1P-induced migration of SMCs (Figure 7) and in PDGF-induced migration (data not shown).
|
Evaluation of S1P Levels
As mentioned above, plasma S1P in humans correlates well with the reoccurrence of vascular events, and the differences in neointimal lesion size potentially could reflect variations in S1P levels in plasma of S1P2–/– mice.10 Plasma S1P levels in both sets of mice were similar before and at times after injury (Figure 8).
|
| Discussion |
|---|
|
|
|---|
A key issue arising from this study is how the loss of S1P2 regulates the growth of arterial lesions. S1P is known to promote or inhibit cell migration depending on the S1P receptors expressed, and in general, activation of S1P1 and S1P2 have opposite effects.19,20,27 The predominant receptor in adult SMCs is S1P2, and migration is suppressed when cells are stimulated with S1P.20,28 This phenotype, however, can be changed readily by overexpressing S1P1 or by blocking expression of S1P2 and under such conditions S1P then stimulates SMC migration.20,27,28 In the arteries of small mammals, migration of SMC into the intima is a critical step for lesion growth, and if this growth is blocked by proteases inhibitors or by genetic deletion of matrix metalloproteinases, then the growth of the neointimal lesion is blocked.25,29 The ligation of the carotid artery in mice stimulates the formation of a neointima comprised of SMCs, and it is generally assumed that migration of cells from the media is a necessary step. In the past few years, there are reports suggesting a role for circulating stem cells in arterial lesions. This possibility has been investigated by others, and it has been determined that very few bone marrow–derived cells are present in the lesions after carotid artery ligation.30 Furthermore, recent studies have cast major doubts on the likelihood of circulating stem cells contributing to arterial lesions.31,32
It is difficult to measure SMC migration directly in arteries, especially when the endothelium is intact; however, our data would strongly suggest migration into the neointima must have occurred in the injured arteries. First, there are no intimal SMCs in mice carotid arteries before treatment, and SMCs must gain access to the intima before neointimal lesions can develop. Also, S1P is known to regulate cell movement, and our in vitro data directly show that S1P2–/– SMCs exhibit an enhanced migration. Furthermore, there is a marked peak in medial SMC replication at approximately day 14, reflecting an increase in the cell population yet the number of medial cells remains constant (Figure 2). One explanation for this is that cells have migrated into the neointima.
How activation of S1P receptors regulates migration is not completely understood, although this has been linked to the activities of small GTPases of the Rho family.20 In SMCs, S1P binds to 3 G protein–coupled receptors, and differences in signaling depend on which G-protein pathway is activated. The deletion of S1P2 did not influence expression of the other 2 receptors, as has previously been reported.23 S1P receptors couple to a variety of G protein–coupled receptors, and differences in signaling depend on which G protein pathway is activated. S1P1 couples only to Gi, and this results in the activation of Rac. In contrast, S1P2 couples to Gi, Gq, and G12/13, the latter resulting in Rho activation.13,33 Rho mediates formation of stress fiber and focal adhesion and importantly decreases SMC migration.20,28 In this study, S1P2–/– SMCs do not show any increase in Rho activation, and so the absence of this negative regulator may explain the enhanced migration of these cells. Supporting a role for Rho in downregulating SMC migration is our observation that the Rho inhibitor C3 exotoxin increased migration after stimulation with S1P. Collectively, these data support the hypothesis that differences in Rho activity attributable to variations in S1P2 expression influence SMC migration.
A surprising finding was that SMC replication was increased in S1P2–/– arteries, suggesting that activation of S1P2 normally functions as a suppressor of replication. There are many reports showing that S1P can act as a mitogen, but relatively few show that it inhibits replication. S1P binding to S1P2 of rat hepatocytes blocked their proliferation, and S1P2-null embryonic fibroblasts showed an increase in proliferation compared with wild-type cells.27,33 In this latter study, the reintroduction of S1P2 into the cells blocked this increase in replication.27 Thus, the regulation of cell replication by S1P2 is not without precedent, although how this occurs is currently unknown. As mentioned above, S1P2 is important for the activation of Rho proteins, which have been strongly implicated with progression through G1 phase by downregulating cyclin-dependent kinase inhibitors p21Waf1/Cip1 and p27Kip1.34,35 Furthermore, the inhibition of the Rho kinase, a downstream effector of Rho, prevents the growth of arterial lesions.36,37 In both of these situations, Rho activity is associated with an increase and not a decrease in proliferation, and therefore cells from the S1P2–/– mice with low Rho activity might be expected to show decreased proliferation. Clearly this does not occur, and as such it is unlikely that the increase proliferation in S1P2-null arteries is Rho dependent.
As mentioned above, S1P can function as a mitogen, although it mainly acts through S1P1, which activates phospholipase C, Ras, and phosphatidylinositol 3-kinase.13 Stable transfection of S1P1 in SMCs enhances S1P-induced replication, and this correlated with an increase in p70S6k activity and expression of cyclin D1, both factors being important for cell growth.17 One possibility therefore is that in the absence of S1P2 expression, other S1P receptors such as S1P1 promote cell replication. Deletion of S1P1 is lethal, and so assessing the role of this receptor for neointimal growth will require a tissue specific knockout mouse.
Availability of S1P
Implicit in the results of this study is that S1P must be available to bind the S1P receptors of SMCs after arterial ligation. Mouse plasma has relatively high levels of S1P, approximately 0.2 to 0.9 µmol/L, although a large fraction (
60%) is bound to lipoproteins and considered unavailable to interact with the S1P receptors.38,39 If plasma were the main source of S1P, then changes in plasma S1P levels could be important. Indeed, this is supported by a recent finding showing that high S1P levels are predictive of repeat cardiovascular events in man.10 In this study, however, the plasma S1P levels in S1P2-null and wild-type mice were identical and did not change at times after surgery. One consideration, therefore, is that S1P is readily accessible to arterial SMCs and plasma levels are not rate limiting in this model.
A final issue of interest is that wild-type mice do not develop any significant neointimal lesions. There have been several reports that the arteries of different mouse strains and especially C57BL/6 do not develop arterial lesions after denuding injuries or after carotid ligation.40,41 This finding is somewhat controversial, but in this study, we show that C57BL/6x129 mice behave very much like C57BL/6 carotid arteries, ie, minimal neointimal lesions. Interestingly, we noted that C57BL/6 strongly express S1P2 and that FVB mice that develop large neointimal lesions show a lower expression of S1P2. One possibility, therefore, is that differences in the expression of arterial S1P receptors is a natural occurrence, at least in mice, and may be responsible for the marked variation in neointimal growth.
In summary, we show that the deletion of S1P2 promotes the rapid growth of neointimal lesions by increasing SMC replication and migration. One important inference is that arteries are normally subjected to inhibitory signals from S1P interacting with S1P2.
| Acknowledgments |
|---|
Sources of Funding
This was funded by NIH grants HL70858, HL69907, and HL70850.
Disclosures
None.
| Footnotes |
|---|
Original received August 29, 2006; resubmission received July 5, 2007; revised resubmission received August 22, 2007; accepted August 31, 2007.
| References |
|---|
|
|
|---|
2. Allende ML, Yamashita T, Proia RL. G-protein-coupled receptor S1P1 acts within endothelial cells to regulate vascular maturation. Blood. 2003; 102: 3665–3667.
3. Saba JD, Hla T. Point-counterpoint of sphingosine 1-phosphate metabolism. Circ Res. 2004; 94: 724–734.
4. Hla T, Lee MJ, Ancellin N, Paik JH, Kluk MJ. Lysophospholipids–receptor revelations. Science. 2001; 294: 1875–1878.
5. Spiegel S, Milstien S. Sphingosine 1-phosphate, a key cell signaling molecule. J Biol Chem. 2002; 277: 25851–25854.
6. Yatomi Y. Sphingosine 1-phosphate in vascular biology: possible therapeutic strategies to control vascular diseases. Curr Pharm Des. 2006; 12: 575–587.[CrossRef][Medline] [Order article via Infotrieve]
7. Zhang B, Tomura H, Kuwabara A, Kimura T, Miura S, Noda K, Okajima F, Saku K. Correlation of high density lipoprotein (HDL)-associated sphingosine 1-phosphate with serum levels of HDL-cholesterol and apolipoproteins. Atherosclerosis. 2005; 178: 199–205.[CrossRef][Medline] [Order article via Infotrieve]
8. Alewijnse AE, Peters SL, Michel MC. Cardiovascular effects of sphingosine-1-phosphate and other sphingomyelin metabolites. Br J Pharmacol. 2004; 143: 666–684.[CrossRef][Medline] [Order article via Infotrieve]
9. Xu CB, Hansen-Schwartz J, Edvinsson L. Sphingosine signaling and atherogenesis. Acta Pharmacol Sin. 2004; 25: 849–854.[Medline] [Order article via Infotrieve]
10. Deutschman DH, Carstens JS, Klepper RL, Smith WS, Page MT, Young TR, Gleason LA, Nakajima N, Sabbadini RA. Predicting obstructive coronary artery disease with serum sphingosine-1-phosphate. Am Heart J. 2003; 146: 62–68.[CrossRef][Medline] [Order article via Infotrieve]
11. Yang L, Yatomi Y, Miura Y, Satoh K, Ozaki Y. Metabolism and functional effects of sphingolipids in blood cells. Br J Haematol. 1999; 107: 282–293.[CrossRef][Medline] [Order article via Infotrieve]
12. Yatomi Y, Ruan F, Hakomori S, Igarashi Y. Sphingosine-1-phosphate: a platelet-activating sphingolipid released from agonist-stimulated human platelets. Blood. 1995; 86: 193–202.
13. Taha TA, Argraves KM, Obeid LM. Sphingosine-1-phosphate receptors: receptor specificity versus functional redundancy. Biochim Biophys Acta. 2004; 1682: 48–55.[Medline] [Order article via Infotrieve]
14. Chun J, Goetzl EJ, Hla T, Igarashi Y, Lynch KR, Moolenaar W, Pyne S, Tigyi G. International Union of Pharmacology. XXXIV. Lysophospholipid receptor nomenclature. Pharmacol Rev. 2002; 54: 265–269.
15. Windh RT, Lee MJ, Hla T, An S, Barr AJ, Manning DR. Differential coupling of the sphingosine 1-phosphate receptors Edg-1, Edg-3, and H218/Edg-5 to the G(i), G(q), and G(12) families of heterotrimeric G proteins. J Biol Chem. 1999; 274: 27351–27358.
16. Windh RT, Manning DR. Expression of G protein-coupled receptors and G proteins in Sf9 cells: analysis of coupling by radioligand binding. Methods Enzymol. 2002; 343: 417–429.[Medline] [Order article via Infotrieve]
17. Kluk MJ, Hla T. Role of the sphingosine 1-phosphate receptor EDG-1 in vascular smooth muscle cell proliferation and migration. Circ Res. 2001; 89: 496–502.
18. Zohlnhofer D, Richter T, Neumann F, Nuhrenberg T, Wessely R, Brandl R, Murr A, Klein CA, Baeuerle PA. Transcriptome analysis reveals a role of interferon-gamma in human neointima formation. Mol Cell. 2001; 7: 1059–1069.[CrossRef][Medline] [Order article via Infotrieve]
19. Sugimoto N, Takuwa N, Okamoto H, Sakurada S, Takuwa Y. Inhibitory and stimulatory regulation of Rac and cell motility by the G12/13-Rho and Gi pathways integrated downstream of a single G protein-coupled sphingosine-1-phosphate receptor isoform. Mol Cell Biol. 2003; 23: 1534–1545.
20. Ryu Y, Takuwa N, Sugimoto N, Sakurada S, Usui S, Okamoto H, Matsui O, Takuwa Y. Sphingosine-1-phosphate, a platelet-derived lysophospholipid mediator, negatively regulates cellular Rac activity and cell migration in vascular smooth muscle cells. Circ Res. 2002; 90: 325–332.
21. Liu Y, Wada R, Yamashita T, Mi Y, Deng CX, Hobson JP, Rosenfeldt HM, Nava VE, Chae SS, Lee MJ, Liu CH, Hla T, Spiegel S, Proia RL. Edg-1, the G protein-coupled receptor for sphingosine-1-phosphate, is essential for vascular maturation. J Clin Invest. 2000; 106: 951–961.[Medline] [Order article via Infotrieve]
22. Kono M, Mi Y, Liu Y, Sasaki T, Allende ML, Wu YP, Yamashita T, Proia RL. The sphingosine-1-phosphate receptors S1P1, S1P2, and S1P3 function coordinately during embryonic angiogenesis. J Biol Chem. 2004; 279: 29367–29373.
23. Ishii I, Ye X, Friedman B, Kawamura S, Contos JJ, Kingsbury MA, Yang AH, Zhang G, Brown JH, Chun J. Marked perinatal lethality and cellular signaling deficits in mice null for the two sphingosine 1-phosphate (S1P) receptors, S1P(2)/LP(B2)/EDG-5 and S1P(3)/LP(B3)/EDG-3. J Biol Chem. 2002; 277: 25152–25159.
24. Kumar A, Lindner V. Remodeling with neointima formation in the mouse carotid artery after cessation of blood flow. Arterioscler Thromb Vasc Biol. 1997; 17: 2238–2244.
25. Cho A, Reidy MA. Matrix metalloproteinase-9 is necessary for the regulation of smooth muscle cell replication and migration after arterial injury. Circ Res. 2002/11/1; 91: 845–851.[CrossRef]
26. Englesbe MJ, Deou J, Bourns BD, Clowes AW, Daum G. Interleukin-1beta inhibits PDGF-BB-induced migration by cooperating with PDGF-BB to induce cyclooxygenase-2 expression in baboon aortic smooth muscle cells. J Vasc Surg. 2004; 39: 1091–1096.[CrossRef][Medline] [Order article via Infotrieve]
27. Goparaju SK, Jolly PS, Watterson KR, Bektas M, Alvarez S, Sarkar S, Mel L, Ishii I, Chun J, Milstien S, Spiegel S. The S1P2 receptor negatively regulates platelet-derived growth factor-induced motility and proliferation. Mol Cell Biol. 2005; 25: 4237–4249.
28. Okamoto H, Takuwa N, Yokomizo T, Sugimoto N, Sakurada S, Shigematsu H, Takuwa Y. Inhibitory regulation of Rac activation, membrane ruffling, and cell migration by the G protein-coupled sphingosine-1-phosphate receptor EDG5 but not EDG1 or EDG3. Mol Cell Biol. 2000; 20: 9247–9261.
29. Schwartz SM, Reidy MA, OBrien ERM. Assessment of factors important in atherosclerotic occlusion and restenosis. Thromb Haemost. 1995; 74: 541–551.[Medline] [Order article via Infotrieve]
30. Tanaka K, Sata M, Hirata Y, Nagai R. Diverse contribution of bone marrow cells to neointimal hyperplasia after mechanical vascular injuries. Circ Res. 2003; 93: 783–790.
31. Bentzon JF, Weile C, Sondergaard CS, Hindkjaer J, Kassem M, Falk E. Smooth muscle cells in atherosclerosis originate from the local vessel wall and not circulating progenitor cells in ApoE knockout mice. Arterioscler Thromb Vasc Biol. 2006; 26: 2696–2702.[CrossRef][Medline] [Order article via Infotrieve]
32. Hoofnagle MH, Thomas JA, Wamhoff BR, Owens GK. Origin of neointimal smooth muscle: weve come full circle. Arterioscler Thromb Vasc Biol. 2006; 26: 2579–2581.
33. Ikeda H, Satoh H, Yanase M, Inoue Y, Tomiya T, Arai M, Tejima K, Nagashima K, Maekawa H, Yahagi N, Yatomi Y, Sakurada S, Takuwa Y, Ogata I, Kimura S, Fujiwara K. Antiproliferative property of sphingosine 1-phosphate in rat hepatocytes involves activation of Rho via Edg-5. Gastroenterology. 2003; 124: 459–469.[CrossRef][Medline] [Order article via Infotrieve]
34. Seasholtz TM, Majumdar M, Kaplan DD, Brown JH. Rho and Rho kinase mediate thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration. Circ Res. 1999; 84: 1186–1193.
35. Sahai E, Olson MF, Marshall CJ. Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility. EMBO J. 2001; 20: 755–766.[CrossRef][Medline] [Order article via Infotrieve]
36. Shibata R, Kai H, Seki Y, Kato S, Morimatsu M, Kaibuchi K, Imaizumi T. Role of Rho-associated kinase in neointima formation after vascular injury. Circulation. 2001; 103: 284–289.
37. Sawada N, Itoh H, Ueyama K, Yamashita J, Doi K, Chun TH, Inoue M, Masatsugu K, Saito T, Fukunaga Y, Sakaguchi S, Arai H, Ohno N, Komeda M, Nakao K. Inhibition of rho-associated kinase results in suppression of neointimal formation of balloon-injured arteries. Circulation. 2000; 101: 2030–2033.
38. Aoki S, Yatomi Y, Ohta M, Osada M, Kazama F, Satoh K, Nakahara K, Ozaki Y. Sphingosine 1-phosphate-related metabolism in the blood vessel. J Biochem (Tokyo). 2005; 138: 47–55.
39. Murata N, Sato K, Kon J, Tomura H, Yanagita M, Kuwabara A, Ui M, Okajima F. Interaction of sphingosine 1-phosphate with plasma components, including lipoproteins, regulates the lipid receptor-mediated actions. Biochem J. 200015; 352 (pt 3): 809–815.[CrossRef]
40. Harmon KJ, Couper LL, Lindner V. Strain-dependent vascular remodeling phenotypes in inbred mice. Am J Pathol. 2000; 156: 1741–1748.
41. Kuhel DG, Zhu B, Witte DP, Hui DY. Distinction in genetic determinants for injury-induced neointimal hyperplasia and diet-induced atherosclerosis in inbred mice. Arterioscler Thromb Vasc Biol. 2002; 22: 955–960.
This article has been cited by other articles:
![]() |
G. Daum, A. Grabski, and M.A. Reidy Sphingosine 1-Phosphate: A Regulator of Arterial Lesions Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1439 - 1443. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Grabski, T. Shimizu, J. Deou, W. M. Mahoney Jr, M. A. Reidy, and G. Daum Sphingosine-1-Phosphate Receptor-2 Regulates Expression of Smooth Muscle Alpha-Actin After Arterial Injury Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1644 - 1650. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Skoura and T. Hla Regulation of vascular physiology and pathology by the S1P2 receptor subtype Cardiovasc Res, May 1, 2009; 82(2): 221 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Takashima, N. Sugimoto, N. Takuwa, Y. Okamoto, K. Yoshioka, M. Takamura, S. Takata, S. Kaneko, and Y. Takuwa G12/13 and Gq mediate S1P2-induced inhibition of Rac and migration in vascular smooth muscle in a manner dependent on Rho but not Rho kinase Cardiovasc Res, September 1, 2008; 79(4): 689 - 697. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Wamhoff, K. R. Lynch, T. L. Macdonald, and G. K. Owens Sphingosine-1-Phosphate Receptor Subtypes Differentially Regulate Smooth Muscle Cell Phenotype Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1454 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Tang and Y. Anfinogenova Physiologic Properties and Regulation of the Actin Cytoskeleton in Vascular Smooth Muscle Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2008; 13(2): 130 - 140. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |