Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2007;101:995-1000
Published online before print September 13, 2007, doi: 10.1161/CIRCRESAHA.107.159228
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
101/10/995    most recent
CIRCRESAHA.107.159228v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimizu, T.
Right arrow Articles by Reidy, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimizu, T.
Right arrow Articles by Reidy, M. A.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Genetically altered mice
Right arrow Smooth muscle proliferation and differentiation
(Circulation Research. 2007;101:995.)
© 2007 American Heart Association, Inc.


Molecular Medicine

Sphingosine 1-Phosphate Receptor 2 Negatively Regulates Neointimal Formation in Mouse Arteries

Takuya Shimizu*, Tatsu Nakazawa*, Aesim Cho, Frank Dastvan, Dustin Shilling, Günter Daum, Michael A. Reidy

From the Department of Pathology (T.S., T.N., A.C., F.D., M.A.R.) and Surgery (D.S., G.D.) University of Washington, Seattle.

Correspondence to Michael Reidy, PhD, Department of Pathology, University of Washington, 815 Mercer St, Seattle, WA 98109. E-mail mar1{at}u.washington.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Neointimal lesion formation was induced in sphingosine 1-phosphate (S1P) receptor 2 (S1P2)-null and wild-type mice by ligation of the left carotid artery. After 28 days, large neointimal lesions developed in S1P2-null but not in wild-type arteries. This was accompanied with a significant increase in both medial and intimal smooth muscle cell (SMC) replication between days 4 to 28, with only minimal replication in wild-type arteries. S1P2-null SMCs showed a significant increase in migration when stimulated with S1P alone and together with platelet-derived growth factor, whereas both wild-type and null SMCs migrated equally well to platelet-derived growth factor. S1P increased Rho activation in wild-type but not in S1P2-null SMCs, and inhibition of Rho activity promoted S1P-induced SMC migration. Plasma S1P levels were similar and did not change after surgery. These results suggest that activation of S1P2 normally acts to suppress SMC growth in arteries and that S1P is a regulator of neointimal development.


Key Words: sphingosine 1-phosphate receptors • smooth muscle cells • neointima


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Sphingosine 1-phosphate (S1P) is a bioactive sphingolipid formed by activation of sphingosine kinases.1 It exerts pleiotropic effects on many cells by regulating cytoskeletal rearrangement, cell survival, cell migration, cell proliferation, angiogenesis, and vascular development.2–5 Recently S1P has received attention as a regulator of the cardiovascular system. In part, this is because there are high levels of S1P in plasma, and a recent report showed that they correlate well with the reoccurrence of vascular events.6–10 Further platelets release S1P during their activation, and consequently S1P levels are likely to be high at sites of arterial injury.11,12

S1P acts through 5 G protein–coupled receptors (S1P1 to S1P5), although arterial smooth muscle cells (SMCs) express only S1P1, S1P2, and S1P3.4,13 Initially these receptors were called endothelial cell differentiation gene receptors.14 Activation of S1P receptors induces coupling to a variety of G proteins, which in turn leads to activation of multiple pathways. In SMCs most work has concentrated on S1P1 and S1P2 because they have opposing actions. S1P1 couples to Gi and leads to activation of extracellular signal-regulated kinase, phosphatidylinositol 3-kinase, and Rac.13,15,16 Adult SMCs only weakly express S1P1, although it is more highly expressed in pup cells, and this has been linked to their increased ability to migrate and proliferate in response to S1P.17 S1P1 is also strongly expressed in SMCs from rat intimal lesions as well as in human atherosclerotic lesions.17,18 These data have been used to suggest that activation of S1P1 may induce events leading to restenosis and the formation of arterial lesions. S1P2 is the main receptor expressed by most adult medial SMCs and couples to Gi, Gq, and G12/13, and its activation by S1P is associated with inhibition of SMC migration.13,19 This is thought to occur via coupling to G12/13, leading to Rho activation and suppression of Rac activity.19,20

Relatively little is known about the function of S1P receptors in arteries. The most striking data come from studies in which S1P receptors have been deleted. S1P1–/– mice exhibit embryonic hemorrhage, have poorly developed blood vessels, and die in utero.21 S1P1–/– embryonic fibroblasts show a defect in migration and in the activation of the small GTPase Rac. The S1P2–/– mice are viable and show no obvious phenotype.22,23 In this study, we proposed to determine whether S1P2 plays any role in the growth of neointimal lesions in mouse arteries. Our data show that S1P2–/– arteries develop significantly larger neointimal lesions than wild-type arteries and that this is associated with an increase in SMC growth.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
PCR primers used in these studies were purchased from IDT. Small interfering RNAs were from Invitrogen Corp. C3 exotoxin was obtained from Cytoskeleton. Platelet-derived growth factor (PDGF) was from R&D, and S1P was purchased from Cayman Chemicals. The RhoA antibody was from Santa Cruz Biotechnology.

Animals and Surgical Procedure
S1P2-null mice and wild-type mice (C57BL/6x129) were kindly provided by Dr Richard L. Proia (NIH, Bethesda, Md).22 These mouse colonies were bred in our laboratory, and genotypes were verified by polymerase chain reaction analysis. Male mice between 7 to 8 weeks old (litter mates) were used for all the experiments. The left common carotid artery was dissected and ligated near the carotid bifurcation as previously described.24 All studies were performed within the guidelines for animal experimentation at the University of Washington.

Immunohistochemistry
Mice were injected intraperitoneally with bromodeoxyuridine (30 µg/g body weight), and carotid arteries were perfusion fixed with 4% paraformaldehyde in PBS for 3 minutes in situ.25 Hematoxylin-positive (total) and bromodeoxyuridine-positive (replicating) cells were counted on arterial sections (8 sections at 100 µm apart).

Mouse Arterial Smooth Muscle Cell Isolation
Arterial SMCs were isolated from adult male mouse carotid arteries by an enzyme dispersion approach using an enzyme mix (2 mg/mL BSA, 1 mg/mL collagenase, 0.375 mg/mL soybean trypsin inhibitor, and 0.125 mg/mL elastase type III in Hanks’ balanced salt solution). After 10 minutes of incubation, the adventitial layer was removed and the remaining tissue was incubated at 37°C for a further 2 hours; cells were then collected. Ten carotids were usually pooled for this procedure, and cells were used up to the ninth passage.

Reverse Transcription–Polymerase Chain Reaction
Total RNA from 8 pooled carotids was prepared using a kit from Qiagen. Following treatment with DNAse I (Promega), RNA was reverse transcribed using Superscript reverse transcriptase (Promega). RNA was then PCR amplified for S1P1, S1P2, and S1P3 expression using a Perkin Elmer Gene Amp PCR system. Forward and reverse primers were CACCACCGTCTTCACTCTGCTC and CTCCCAGTTGCTCCTTCCTTGC for S1P1; GCTCTACGGCAGTGACAAAAGC and GAGAGGCAGCACGGTGGAGCAG for SIP2; and TTGGGAAATGACACTCTCCGGGAA and TTGATCATGGTCAGGTGTCGCTCA for S1P3. The same RNA samples were PCR amplified for GAPDH.

In Vitro Migration
Migration was performed as described previously.25,26 Cells (1x105) were placed in the upper chamber of a 24-well Costar Transwell precoated with 0.1% type I collagen. Medium containing PDGF (20 ng/mL) and S1P (1 µmol/L) was added to the lower chamber. After 7 hours, cells on the lower surface were fixed with methanol and stained with hematoxylin. The cells on the lower surface of membranes (9 fields/membrane) were then counted under a microscope at x40 magnification. The data are expressed as the mean numbers of cells per field.

Measurement of S1P Levels
Plasma was deproteinated by addition of 80% acetonitrile. Extracts were cleared by centrifugation and subjected to reverse-phase chromatography on a Zorbax C-8 SB 2.1x50 mm SB column. S1P was eluted by a ballistic gradient (60% to 100% methanol) and measured by a Micromass Quattro Premier XE Tandem Quadrupole mass spectrometer (Waters) using a multiple reaction mode assay in which the M+H ion (m/z=380) is then fragmented to form a daughter ion at m/z 264, which is used for quantitation. An internal standard, a C17 S1P analog (Avanti Polar Lipids) with the m/z 366>250 transition, was used to correct for variation in sample preparation and instrument response.

Rho Activity
SMCs were seeded into 10-cm plates at 600 000 cells per plate and starved for 3 days. Cells were stimulated with 1 µmol/L S1P for 5 minutes, and Rho activity was measured in cell extracts with equal protein content using an ELISA technique following the instructions of the manufacturer (G-Elisa BK123, Cytoskeleton). Assays were performed in triplicate.

Inhibition of Rho Activity
Cell-permeable C3 Transferase (Cytoskeleton) was used to inhibit Rho proteins. SMCs were plated into 100-mm culture dishes at 700 000 cells per plate and allowed to recover overnight in 10% serum. The cells were rendered quiescent in serum-free DMEM for 32 hours before incubating with 2 µg/mL C3 Transferase in serum-free DMEM for 16 hours; they were then subjected to an in vitro migration assay.

Statistics
Differences between the wild-type group and the S1P2-null group for morphometric data, bromodeoxyuridine index, and migration data were evaluated by unpaired Student’s t test. All data were considered significant at P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
S1P Receptor Expression
As expected, S1P2–/– arteries expressed S1P1 and S1P3 but not S1P2. Wild-type arteries expressed S1P3 and S1P1 at similar levels as S1P2-null arteries and also expressed S1P2 (Figure 1).


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
Figure 1. RT-PCR showing expression of S1P1, S1P2, and S1P3 in S1P2-null (KO) and wild-type (WT) SMCs. GAPDH expression was used as an internal control.

Carotid Artery Remodeling
The left common carotid artery of S1P2-null and wild-type mice was ligated with a 6/0 suture tied just proximal to the internal–external bifurcation. Fourteen days after surgery, a small neointimal lesion was present in S1P2–/– arteries, and by 28 days, the neointima was significantly larger (Figure 2 and 3Down). In wild-type arteries after 14 days, the neointimal lesions were comprised of 1 incomplete layer of SMCs (Figure 3A). Medial cell number remained constant throughout the experiment in both S1P2-null and wild-type arteries (Figure 3B).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Figure 2. Neointimal lesion development in S1P2-null and wild-type (WT) carotid arteries after ligation. A neointima can be seen by 14 days in S1P2-null (KO) arteries but not in wild-type arteries. Arrows denote the internal elastic lamella. After 28 days (28d), large neointimal lesions are found in S1P2-null arteries but not in wild-type arteries. At least 8 mice were used for each time points.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
Figure 3. Intimal (A) and medial (B) cell number per arterial cross-section (4 cross-sections of each artery were counted and averaged for the group size of n=8) in ligated S1P2-null and wild-type (WT) arteries. By days 14 and 28, there was a significant increase in the number of neointimal cells in S1P2 knockout (KO) arteries but with no change in wild-type arteries (*P<0.03) (A). No significant increase in medial cell number was detected in both S1P2 knockout (KO) and wild-type arteries (B).

In conjunction with the growth of the neointima, a significant increase in intimal SMC replication at days 7, 14, and 28 was detected in S1P2–/– arteries with a peak in replication at 14 days (Figure 4A). In a similar fashion, an increase in medial SMC replication was observed at all times after surgery (Figure 4B).


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
Figure 4. A, Intimal cell replication assessed from arterial cross-sections (8 sections per artery) in S1P2-null (KO) and wild-type (WT) cells after carotid ligation. SMC replication was significantly increased in S1P2-null arteries at all times as compared with wild-type arteries. *P<0.03. B, Medial cell replication was significantly higher in S1P2-null (KO) as compared with wild-type (WT) arteries (n=8 for each time point). *P<0.04.

S1P2–/– SMCs Show an Increase in Migration
To measure migration, SMCs were isolated from carotid arteries of both S1P2–/– and wild-type mice, and migration was measured in vitro using a transwell chamber assay. A significant increase in migration of S1P2–/– SMCs occurred when stimulated with S1P alone and with a combination of S1P and PDGF as compared with wild-type SMCs. Both wild-type and S1P2–/– SMCs migrated equally well to PDGF (Figure 5).


Figure 5
View larger version (8K):
[in this window]
[in a new window]

 
Figure 5. Migration of SMCs. S1P2-null (KO) and wild-type (WT) SMCs were placed in a transwell chamber, starved for 48 hours, and then stimulated with PDGF (10 ng/mL) and S1P (1 µmol/L) separately and in combination for 7 hours. The number of cells on the underside of the filter was then quantitated. Each experiment was performed in triplicate *P<0.05.

Rho Activity
S1P2 is known to activate Rho via coupling to the G12/13, and in SMCs, this is associated with inhibition of cell movement.19 S1P activated Rho in wild-type but not in S1P2–/– SMCs under identical conditions (Figure 6).


Figure 6
View larger version (8K):
[in this window]
[in a new window]

 
Figure 6. S1P-induced Rho activation in SMCs. S1P2-null (KO) and wild-type (WT) SMCs were serum starved overnight and then stimulated with S1P (1 µmol/L). Rho activity was determined after 5 minutes using a G-LISA Rho activation assay Biochem kit. The experiment was performed in triplicate with similar results. *P>0.05.

To determine that Rho activation was indeed important in regulating SMC migration, wild-type SMCs were preincubated with 2 µg of the Rho inhibitor C3 exotoxin and the migration assay was repeated after 2 days. This concentration blocked S1P-induced Rho activity (data not shown). After treatment with C3, there was a significant increase in S1P-induced migration of SMCs (Figure 7) and in PDGF-induced migration (data not shown).


Figure 7
View larger version (7K):
[in this window]
[in a new window]

 
Figure 7. Inhibition of Rho with the C3 exotoxin significantly stimulated SMC migration. Wild-type SMCs were pretreated with C3 exotoxin (2 µg/mL) overnight, and then migration was measured in a transwell chamber 7 hours after stimulation with S1P (1 µmol/L) (P<0.01). Control cells received S1P alone. The data are shown as means±SEM. This experiment was repeated 3 times with similar results.

Evaluation of S1P Levels
As mentioned above, plasma S1P in humans correlates well with the reoccurrence of vascular events, and the differences in neointimal lesion size potentially could reflect variations in S1P levels in plasma of S1P2–/– mice.10 Plasma S1P levels in both sets of mice were similar before and at times after injury (Figure 8).


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
Figure 8. S1P plasma levels after injury. Mice underwent carotid ligation injury, and blood was withdrawn before and at day 7 and 14 after surgery. Plasma was prepared, and S1P levels were determined by mass spectrometry (n=4 to 7). wt indicates wild type.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The results of this study show that the deletion of S1P2 converts an unresponsive artery to an artery that develops large neointimal lesions. This highlights a role for S1P as a key regulator of vascular lesion growth, a fact that has previously been suggested but never proven. Furthermore, because loss of S1P2 permits arterial lesions to develop, this firmly establishes that this receptor functions as a potent suppressor of SMC growth. Indeed, an implication from this study is that downregulation or weak expression of S1P2 may predispose arteries to develop lesions after injury.

A key issue arising from this study is how the loss of S1P2 regulates the growth of arterial lesions. S1P is known to promote or inhibit cell migration depending on the S1P receptors expressed, and in general, activation of S1P1 and S1P2 have opposite effects.19,20,27 The predominant receptor in adult SMCs is S1P2, and migration is suppressed when cells are stimulated with S1P.20,28 This phenotype, however, can be changed readily by overexpressing S1P1 or by blocking expression of S1P2 and under such conditions S1P then stimulates SMC migration.20,27,28 In the arteries of small mammals, migration of SMC into the intima is a critical step for lesion growth, and if this growth is blocked by proteases inhibitors or by genetic deletion of matrix metalloproteinases, then the growth of the neointimal lesion is blocked.25,29 The ligation of the carotid artery in mice stimulates the formation of a neointima comprised of SMCs, and it is generally assumed that migration of cells from the media is a necessary step. In the past few years, there are reports suggesting a role for circulating stem cells in arterial lesions. This possibility has been investigated by others, and it has been determined that very few bone marrow–derived cells are present in the lesions after carotid artery ligation.30 Furthermore, recent studies have cast major doubts on the likelihood of circulating stem cells contributing to arterial lesions.31,32

It is difficult to measure SMC migration directly in arteries, especially when the endothelium is intact; however, our data would strongly suggest migration into the neointima must have occurred in the injured arteries. First, there are no intimal SMCs in mice carotid arteries before treatment, and SMCs must gain access to the intima before neointimal lesions can develop. Also, S1P is known to regulate cell movement, and our in vitro data directly show that S1P2–/– SMCs exhibit an enhanced migration. Furthermore, there is a marked peak in medial SMC replication at approximately day 14, reflecting an increase in the cell population yet the number of medial cells remains constant (Figure 2). One explanation for this is that cells have migrated into the neointima.

How activation of S1P receptors regulates migration is not completely understood, although this has been linked to the activities of small GTPases of the Rho family.20 In SMCs, S1P binds to 3 G protein–coupled receptors, and differences in signaling depend on which G-protein pathway is activated. The deletion of S1P2 did not influence expression of the other 2 receptors, as has previously been reported.23 S1P receptors couple to a variety of G protein–coupled receptors, and differences in signaling depend on which G protein pathway is activated. S1P1 couples only to Gi, and this results in the activation of Rac. In contrast, S1P2 couples to Gi, Gq, and G12/13, the latter resulting in Rho activation.13,33 Rho mediates formation of stress fiber and focal adhesion and importantly decreases SMC migration.20,28 In this study, S1P2–/– SMCs do not show any increase in Rho activation, and so the absence of this negative regulator may explain the enhanced migration of these cells. Supporting a role for Rho in downregulating SMC migration is our observation that the Rho inhibitor C3 exotoxin increased migration after stimulation with S1P. Collectively, these data support the hypothesis that differences in Rho activity attributable to variations in S1P2 expression influence SMC migration.

A surprising finding was that SMC replication was increased in S1P2–/– arteries, suggesting that activation of S1P2 normally functions as a suppressor of replication. There are many reports showing that S1P can act as a mitogen, but relatively few show that it inhibits replication. S1P binding to S1P2 of rat hepatocytes blocked their proliferation, and S1P2-null embryonic fibroblasts showed an increase in proliferation compared with wild-type cells.27,33 In this latter study, the reintroduction of S1P2 into the cells blocked this increase in replication.27 Thus, the regulation of cell replication by S1P2 is not without precedent, although how this occurs is currently unknown. As mentioned above, S1P2 is important for the activation of Rho proteins, which have been strongly implicated with progression through G1 phase by downregulating cyclin-dependent kinase inhibitors p21Waf1/Cip1 and p27Kip1.34,35 Furthermore, the inhibition of the Rho kinase, a downstream effector of Rho, prevents the growth of arterial lesions.36,37 In both of these situations, Rho activity is associated with an increase and not a decrease in proliferation, and therefore cells from the S1P2–/– mice with low Rho activity might be expected to show decreased proliferation. Clearly this does not occur, and as such it is unlikely that the increase proliferation in S1P2-null arteries is Rho dependent.

As mentioned above, S1P can function as a mitogen, although it mainly acts through S1P1, which activates phospholipase C, Ras, and phosphatidylinositol 3-kinase.13 Stable transfection of S1P1 in SMCs enhances S1P-induced replication, and this correlated with an increase in p70S6k activity and expression of cyclin D1, both factors being important for cell growth.17 One possibility therefore is that in the absence of S1P2 expression, other S1P receptors such as S1P1 promote cell replication. Deletion of S1P1 is lethal, and so assessing the role of this receptor for neointimal growth will require a tissue specific knockout mouse.

Availability of S1P
Implicit in the results of this study is that S1P must be available to bind the S1P receptors of SMCs after arterial ligation. Mouse plasma has relatively high levels of S1P, approximately 0.2 to 0.9 µmol/L, although a large fraction ({approx}60%) is bound to lipoproteins and considered unavailable to interact with the S1P receptors.38,39 If plasma were the main source of S1P, then changes in plasma S1P levels could be important. Indeed, this is supported by a recent finding showing that high S1P levels are predictive of repeat cardiovascular events in man.10 In this study, however, the plasma S1P levels in S1P2-null and wild-type mice were identical and did not change at times after surgery. One consideration, therefore, is that S1P is readily accessible to arterial SMCs and plasma levels are not rate limiting in this model.

A final issue of interest is that wild-type mice do not develop any significant neointimal lesions. There have been several reports that the arteries of different mouse strains and especially C57BL/6 do not develop arterial lesions after denuding injuries or after carotid ligation.40,41 This finding is somewhat controversial, but in this study, we show that C57BL/6x129 mice behave very much like C57BL/6 carotid arteries, ie, minimal neointimal lesions. Interestingly, we noted that C57BL/6 strongly express S1P2 and that FVB mice that develop large neointimal lesions show a lower expression of S1P2. One possibility, therefore, is that differences in the expression of arterial S1P receptors is a natural occurrence, at least in mice, and may be responsible for the marked variation in neointimal growth.

In summary, we show that the deletion of S1P2 promotes the rapid growth of neointimal lesions by increasing SMC replication and migration. One important inference is that arteries are normally subjected to inhibitory signals from S1P interacting with S1P2.


*    Acknowledgments
 
We thank Thomas F. Kalhorn at the Mass Spectrometry Center in the Department of Medicinal Chemistry at the University of Washington for S1P measurements.

Sources of Funding

This was funded by NIH grants HL70858, HL69907, and HL70850.

Disclosures

None.


*    Footnotes
 
*Both authors contributed equally to this work. Back

Original received August 29, 2006; resubmission received July 5, 2007; revised resubmission received August 22, 2007; accepted August 31, 2007.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Spiegel S, Kolesnick R. Sphingosine 1-phosphate as a therapeutic agent. Leukemia. 2002; 16: 1596–1602.[CrossRef][Medline] [Order article via Infotrieve]

2. Allende ML, Yamashita T, Proia RL. G-protein-coupled receptor S1P1 acts within endothelial cells to regulate vascular maturation. Blood. 2003; 102: 3665–3667.[Abstract/Free Full Text]

3. Saba JD, Hla T. Point-counterpoint of sphingosine 1-phosphate metabolism. Circ Res. 2004; 94: 724–734.[Abstract/Free Full Text]

4. Hla T, Lee MJ, Ancellin N, Paik JH, Kluk MJ. Lysophospholipids–receptor revelations. Science. 2001; 294: 1875–1878.[Abstract/Free Full Text]

5. Spiegel S, Milstien S. Sphingosine 1-phosphate, a key cell signaling molecule. J Biol Chem. 2002; 277: 25851–25854.[Free Full Text]

6. Yatomi Y. Sphingosine 1-phosphate in vascular biology: possible therapeutic strategies to control vascular diseases. Curr Pharm Des. 2006; 12: 575–587.[CrossRef][Medline] [Order article via Infotrieve]

7. Zhang B, Tomura H, Kuwabara A, Kimura T, Miura S, Noda K, Okajima F, Saku K. Correlation of high density lipoprotein (HDL)-associated sphingosine 1-phosphate with serum levels of HDL-cholesterol and apolipoproteins. Atherosclerosis. 2005; 178: 199–205.[CrossRef][Medline] [Order article via Infotrieve]

8. Alewijnse AE, Peters SL, Michel MC. Cardiovascular effects of sphingosine-1-phosphate and other sphingomyelin metabolites. Br J Pharmacol. 2004; 143: 666–684.[CrossRef][Medline] [Order article via Infotrieve]

9. Xu CB, Hansen-Schwartz J, Edvinsson L. Sphingosine signaling and atherogenesis. Acta Pharmacol Sin. 2004; 25: 849–854.[Medline] [Order article via Infotrieve]

10. Deutschman DH, Carstens JS, Klepper RL, Smith WS, Page MT, Young TR, Gleason LA, Nakajima N, Sabbadini RA. Predicting obstructive coronary artery disease with serum sphingosine-1-phosphate. Am Heart J. 2003; 146: 62–68.[CrossRef][Medline] [Order article via Infotrieve]

11. Yang L, Yatomi Y, Miura Y, Satoh K, Ozaki Y. Metabolism and functional effects of sphingolipids in blood cells. Br J Haematol. 1999; 107: 282–293.[CrossRef][Medline] [Order article via Infotrieve]

12. Yatomi Y, Ruan F, Hakomori S, Igarashi Y. Sphingosine-1-phosphate: a platelet-activating sphingolipid released from agonist-stimulated human platelets. Blood. 1995; 86: 193–202.[Abstract/Free Full Text]

13. Taha TA, Argraves KM, Obeid LM. Sphingosine-1-phosphate receptors: receptor specificity versus functional redundancy. Biochim Biophys Acta. 2004; 1682: 48–55.[Medline] [Order article via Infotrieve]

14. Chun J, Goetzl EJ, Hla T, Igarashi Y, Lynch KR, Moolenaar W, Pyne S, Tigyi G. International Union of Pharmacology. XXXIV. Lysophospholipid receptor nomenclature. Pharmacol Rev. 2002; 54: 265–269.[Abstract/Free Full Text]

15. Windh RT, Lee MJ, Hla T, An S, Barr AJ, Manning DR. Differential coupling of the sphingosine 1-phosphate receptors Edg-1, Edg-3, and H218/Edg-5 to the G(i), G(q), and G(12) families of heterotrimeric G proteins. J Biol Chem. 1999; 274: 27351–27358.[Abstract/Free Full Text]

16. Windh RT, Manning DR. Expression of G protein-coupled receptors and G proteins in Sf9 cells: analysis of coupling by radioligand binding. Methods Enzymol. 2002; 343: 417–429.[Medline] [Order article via Infotrieve]

17. Kluk MJ, Hla T. Role of the sphingosine 1-phosphate receptor EDG-1 in vascular smooth muscle cell proliferation and migration. Circ Res. 2001; 89: 496–502.[Abstract/Free Full Text]

18. Zohlnhofer D, Richter T, Neumann F, Nuhrenberg T, Wessely R, Brandl R, Murr A, Klein CA, Baeuerle PA. Transcriptome analysis reveals a role of interferon-gamma in human neointima formation. Mol Cell. 2001; 7: 1059–1069.[CrossRef][Medline] [Order article via Infotrieve]

19. Sugimoto N, Takuwa N, Okamoto H, Sakurada S, Takuwa Y. Inhibitory and stimulatory regulation of Rac and cell motility by the G12/13-Rho and Gi pathways integrated downstream of a single G protein-coupled sphingosine-1-phosphate receptor isoform. Mol Cell Biol. 2003; 23: 1534–1545.[Abstract/Free Full Text]

20. Ryu Y, Takuwa N, Sugimoto N, Sakurada S, Usui S, Okamoto H, Matsui O, Takuwa Y. Sphingosine-1-phosphate, a platelet-derived lysophospholipid mediator, negatively regulates cellular Rac activity and cell migration in vascular smooth muscle cells. Circ Res. 2002; 90: 325–332.[Abstract/Free Full Text]

21. Liu Y, Wada R, Yamashita T, Mi Y, Deng CX, Hobson JP, Rosenfeldt HM, Nava VE, Chae SS, Lee MJ, Liu CH, Hla T, Spiegel S, Proia RL. Edg-1, the G protein-coupled receptor for sphingosine-1-phosphate, is essential for vascular maturation. J Clin Invest. 2000; 106: 951–961.[Medline] [Order article via Infotrieve]

22. Kono M, Mi Y, Liu Y, Sasaki T, Allende ML, Wu YP, Yamashita T, Proia RL. The sphingosine-1-phosphate receptors S1P1, S1P2, and S1P3 function coordinately during embryonic angiogenesis. J Biol Chem. 2004; 279: 29367–29373.[Abstract/Free Full Text]

23. Ishii I, Ye X, Friedman B, Kawamura S, Contos JJ, Kingsbury MA, Yang AH, Zhang G, Brown JH, Chun J. Marked perinatal lethality and cellular signaling deficits in mice null for the two sphingosine 1-phosphate (S1P) receptors, S1P(2)/LP(B2)/EDG-5 and S1P(3)/LP(B3)/EDG-3. J Biol Chem. 2002; 277: 25152–25159.[Abstract/Free Full Text]

24. Kumar A, Lindner V. Remodeling with neointima formation in the mouse carotid artery after cessation of blood flow. Arterioscler Thromb Vasc Biol. 1997; 17: 2238–2244.[Abstract/Free Full Text]

25. Cho A, Reidy MA. Matrix metalloproteinase-9 is necessary for the regulation of smooth muscle cell replication and migration after arterial injury. Circ Res. 2002/11/1; 91: 845–851.[CrossRef]

26. Englesbe MJ, Deou J, Bourns BD, Clowes AW, Daum G. Interleukin-1beta inhibits PDGF-BB-induced migration by cooperating with PDGF-BB to induce cyclooxygenase-2 expression in baboon aortic smooth muscle cells. J Vasc Surg. 2004; 39: 1091–1096.[CrossRef][Medline] [Order article via Infotrieve]

27. Goparaju SK, Jolly PS, Watterson KR, Bektas M, Alvarez S, Sarkar S, Mel L, Ishii I, Chun J, Milstien S, Spiegel S. The S1P2 receptor negatively regulates platelet-derived growth factor-induced motility and proliferation. Mol Cell Biol. 2005; 25: 4237–4249.[Abstract/Free Full Text]

28. Okamoto H, Takuwa N, Yokomizo T, Sugimoto N, Sakurada S, Shigematsu H, Takuwa Y. Inhibitory regulation of Rac activation, membrane ruffling, and cell migration by the G protein-coupled sphingosine-1-phosphate receptor EDG5 but not EDG1 or EDG3. Mol Cell Biol. 2000; 20: 9247–9261.[Abstract/Free Full Text]

29. Schwartz SM, Reidy MA, O’Brien ERM. Assessment of factors important in atherosclerotic occlusion and restenosis. Thromb Haemost. 1995; 74: 541–551.[Medline] [Order article via Infotrieve]

30. Tanaka K, Sata M, Hirata Y, Nagai R. Diverse contribution of bone marrow cells to neointimal hyperplasia after mechanical vascular injuries. Circ Res. 2003; 93: 783–790.[Abstract/Free Full Text]

31. Bentzon JF, Weile C, Sondergaard CS, Hindkjaer J, Kassem M, Falk E. Smooth muscle cells in atherosclerosis originate from the local vessel wall and not circulating progenitor cells in ApoE knockout mice. Arterioscler Thromb Vasc Biol. 2006; 26: 2696–2702.[CrossRef][Medline] [Order article via Infotrieve]

32. Hoofnagle MH, Thomas JA, Wamhoff BR, Owens GK. Origin of neointimal smooth muscle: we’ve come full circle. Arterioscler Thromb Vasc Biol. 2006; 26: 2579–2581.[Free Full Text]

33. Ikeda H, Satoh H, Yanase M, Inoue Y, Tomiya T, Arai M, Tejima K, Nagashima K, Maekawa H, Yahagi N, Yatomi Y, Sakurada S, Takuwa Y, Ogata I, Kimura S, Fujiwara K. Antiproliferative property of sphingosine 1-phosphate in rat hepatocytes involves activation of Rho via Edg-5. Gastroenterology. 2003; 124: 459–469.[CrossRef][Medline] [Order article via Infotrieve]

34. Seasholtz TM, Majumdar M, Kaplan DD, Brown JH. Rho and Rho kinase mediate thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration. Circ Res. 1999; 84: 1186–1193.[Abstract/Free Full Text]

35. Sahai E, Olson MF, Marshall CJ. Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility. EMBO J. 2001; 20: 755–766.[CrossRef][Medline] [Order article via Infotrieve]

36. Shibata R, Kai H, Seki Y, Kato S, Morimatsu M, Kaibuchi K, Imaizumi T. Role of Rho-associated kinase in neointima formation after vascular injury. Circulation. 2001; 103: 284–289.[Abstract/Free Full Text]

37. Sawada N, Itoh H, Ueyama K, Yamashita J, Doi K, Chun TH, Inoue M, Masatsugu K, Saito T, Fukunaga Y, Sakaguchi S, Arai H, Ohno N, Komeda M, Nakao K. Inhibition of rho-associated kinase results in suppression of neointimal formation of balloon-injured arteries. Circulation. 2000; 101: 2030–2033.[Abstract/Free Full Text]

38. Aoki S, Yatomi Y, Ohta M, Osada M, Kazama F, Satoh K, Nakahara K, Ozaki Y. Sphingosine 1-phosphate-related metabolism in the blood vessel. J Biochem (Tokyo). 2005; 138: 47–55.[Abstract/Free Full Text]

39. Murata N, Sato K, Kon J, Tomura H, Yanagita M, Kuwabara A, Ui M, Okajima F. Interaction of sphingosine 1-phosphate with plasma components, including lipoproteins, regulates the lipid receptor-mediated actions. Biochem J. 200015; 352 (pt 3): 809–815.[CrossRef]

40. Harmon KJ, Couper LL, Lindner V. Strain-dependent vascular remodeling phenotypes in inbred mice. Am J Pathol. 2000; 156: 1741–1748.[Abstract/Free Full Text]

41. Kuhel DG, Zhu B, Witte DP, Hui DY. Distinction in genetic determinants for injury-induced neointimal hyperplasia and diet-induced atherosclerosis in inbred mice. Arterioscler Thromb Vasc Biol. 2002; 22: 955–960.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Hum Mol GenetHome page
M. Y. Lee, S. M. Garvey, A. S. Baras, J. A. Lemmon, M. F. Gomez, P. D. Schoppee Bortz, G. Daum, R. C. LeBoeuf, and B. R. Wamhoff
Integrative genomics identifies DSCR1 (RCAN1) as a novel NFAT-dependent mediator of phenotypic modulation in vascular smooth muscle cells
Hum. Mol. Genet., February 1, 2010; 19(3): 468 - 479.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Daum, A. Grabski, and M.A. Reidy
Sphingosine 1-Phosphate: A Regulator of Arterial Lesions
Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1439 - 1443.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. D. Grabski, T. Shimizu, J. Deou, W. M. Mahoney Jr, M. A. Reidy, and G. Daum
Sphingosine-1-Phosphate Receptor-2 Regulates Expression of Smooth Muscle Alpha-Actin After Arterial Injury
Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1644 - 1650.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Skoura and T. Hla
Regulation of vascular physiology and pathology by the S1P2 receptor subtype
Cardiovasc Res, May 1, 2009; 82(2): 221 - 228.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S.-i. Takashima, N. Sugimoto, N. Takuwa, Y. Okamoto, K. Yoshioka, M. Takamura, S. Takata, S. Kaneko, and Y. Takuwa
G12/13 and Gq mediate S1P2-induced inhibition of Rac and migration in vascular smooth muscle in a manner dependent on Rho but not Rho kinase
Cardiovasc Res, September 1, 2008; 79(4): 689 - 697.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. R. Wamhoff, K. R. Lynch, T. L. Macdonald, and G. K. Owens
Sphingosine-1-Phosphate Receptor Subtypes Differentially Regulate Smooth Muscle Cell Phenotype
Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1454 - 1461.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
D. D. Tang and Y. Anfinogenova
Physiologic Properties and Regulation of the Actin Cytoskeleton in Vascular Smooth Muscle
Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2008; 13(2): 130 - 140.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
101/10/995    most recent
CIRCRESAHA.107.159228v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimizu, T.
Right arrow Articles by Reidy, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimizu, T.
Right arrow Articles by Reidy, M. A.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Genetically altered mice
Right arrow Smooth muscle proliferation and differentiation