Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2007;100:1292-1299
Published online before print April 5, 2007, doi: 10.1161/01.RES.0000266609.28312.de
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
100/9/1292    most recent
01.RES.0000266609.28312.dev1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Related Collections
Right arrow Cell signalling/signal transduction
Right arrow Gene regulation
Right arrow Mechanism of atherosclerosis/growth factors
(Circulation Research. 2007;100:1292.)
© 2007 American Heart Association, Inc.


Molecular Medicine

CREB Mediates UTP-Directed Arterial Smooth Muscle Cell Migration and Expression of the Chemotactic Protein Osteopontin via Its Interaction with Activator Protein-1 Sites

Sandra Jalvy, Marie-Ange Renault, Laetitia Lam Shang Leen, Isabelle Belloc, Annabel Reynaud, Alain-Pierre Gadeau, Claude Desgranges

From INSERM, U441 (S.J., M.-A.R., L.L.S.L., I.B., A.R., A.-P.G., C.D.), Pessac; IFR 4 (C.D.), Pessac; and University of Bordeaux 2 (C.D.), Bordeaux, France.

Correspondence to Claude Desgranges, INSERM U441, Avenue du Haut-Leveque, F-33600 Pessac, France. E-mail claude.desgranges{at}bordeaux.inserm.fr


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The transcription factor cAMP responsive element-binding protein (CREB) has been found to be involved in arterial smooth muscle cell (SMC) migration. We previously demonstrated that osteopontin (OPN) expression is a key step for UTP-mediated migration of arterial SMCs and that activator protein (AP)-1, nuclear factor {kappa}B, and upstream stimulatory transcription factors are involved in this OPN expression. The present study aims to determine the role of CREB in UTP-induced migration and OPN expression in cultured SMCs. We found that CREB is activated by UTP via extracellular signal-regulated kinase 1/2 and p38 mitogen-activated protein kinase pathways but not by protein kinase A. Both overexpression of a dominant negative CREB and CREB small interfering RNA treatment suppressed UTP-induced OPN expression and SMC migration. Gel-shift and chromatin immunoprecipitation assays revealed that CREB binds 2 AP-1 sites (–1870 and –76) and a cAMP responsive element–like site (–1403) on the OPN promoter. Mutations of these sites showed that only the 2 AP-1 sites were required for UTP-induced OPN expression. Moreover, gel-supershift and sequential chromatin immunoprecipitation assays suggested that CREB was associated with c-Fos on the AP-1 sites of the OPN promoter. These results demonstrate that CREB participates in the induction of UTP-activated OPN expression via its binding to 2 AP-1 sites and is thus involved in UTP-mediated SMC migration.


Key Words: CREB • osteopontin • transcriptional regulation • smooth muscle cell migration


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Arterial smooth muscle cell (SMC) migration plays an essential role in the development of the atherosclerotic and restenotic intimal thickenings.1 This migration can be induced by various factors, including growth factors, hormones, cytokines, and, as shown recently, extracellular nucleotides.2 Several studies suggest that extracellular nucleotides (ATP, ADP, UTP, UDP) could be regarded as important extracellular signaling molecules.3 These nucleotides may be released during platelet aggregation and vascular cell physical or chemical stresses. Recently, it was also demonstrated that UTP is released during cardiac myocardial infarction.4 Nucleotide-induced SMC activation is mediated via G protein–coupled P2Y receptors. Among these, P2Y2, activated by both ATP and UTP, is the most significantly expressed in cultured SMCs5 and is overexpressed in rat and porcine intimal hyperplasia.6,7 This potential action of nucleotides was confirmed by in vivo experiments demonstrating that the perivascular administration of UTP enhances cell accumulation in intimal thickenings in collared arteries in association with osteopontin (OPN) overexpression.8

OPN, a secreted phosphoprotein containing a GRGDS cell adhesion sequence, plays an important role in cell adhesion and migration (reviewed elsewhere9,10), more particularly, in the migration of arterial SMCs.11 Cell culture experiments have demonstrated that several factors, including platelet-derived growth factor (PDGF), angiotensin II, and basic fibroblast growth factor activate OPN expression.12,13 In addition, we have previously shown that extracellular nucleotides, in particular UTP, induce the expression of OPN in cultured arterial SMCs.14 The autocrine production of this chemotactic protein and its binding to its main receptor, the integrin {alpha}vß3, are necessary to UTP-induced SMC migration.2,5 The regulation of OPN expression therefore appears to play a key role in SMC migration.

Various attempts have been made to define the mechanisms of OPN gene expression and have led to the identification of several transcription factors, including Smad,15 Cbfa,16 Ets-1,17 and Sp1,18 involved in this process. In SMCs, OPN gene transcription is upregulated by upstream stimulatory factors (USFs) and activator protein (AP)-1 in glucose-treated cells,19 and by USF-1 in serum-stimulated cells.20 Moreover, we have demonstrated that AP-1, nuclear factor (NF)-{kappa}B, and USF transcription factors are involved in UTP-induced OPN expression in SMCs.21,22

Several SMC chemotactic factors, including PDGF,23 angiotensin II,23 thrombin,24 tumor necrosis factor {alpha},25 and extracellular ATP,26 have been shown to induce the activation of the transcription factor cAMP-response element-binding protein (CREB) in these cells. Moreover, CREB activation by PDGF,27 angiotensin II,28 and UTP27 led to specific gene transcription in SMCs. Altogether, these studies suggest that the activated CREB factor could play a role in the SMC migration process. However, this role has not been clearly established yet and its mechanisms remain to be defined.

The transcription factor CREB is activated by the phosphorylation of Ser133, which is typically performed by protein kinase A. However, other protein kinases can perform this phosphorylation, including extracellular signal-regulated kinases 1 and 2 (ERK1/2), p38 mitogen-activated protein kinase (MAPK), calmodulin kinase (CaMK), and protein kinase B (PKB) (reviewed elsewhere29). Ser133 phosphorylation strongly enhances CREB-dependent transcription. CREB forms either homo- or heterodimers with members of either the CREB/ATF family or the AP-1 family. These dimers generally bind DNA at the CRE binding site (TGACGTCA consensus) found in the promoter of target genes.30 However, some studies demonstrate that these homo- or heterodimers can also bind AP-1 sites.31–33

In the present study, we demonstrate that UTP-induced CREB activation mediates the UTP-induced SMC migration and activates the transcription of the OPN gene through the formation of a CREB/c-Fos complex, which binds AP-1 sites of the OPN promoter.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Adenovirus Production and Cell Transduction
Replication-defective adenovirus vector expressing the dominant negative mutant ACREB (AdACREB), in which the basic region was changed to an acidic region,34 was a gift of C. Vinson (NIH, Bethesda, Md) and was amplified by the Genethon (Evry, France). SMCs grown to semiconfluence were incubated for 48 hours at 37°C with either AdACREB or an adenovirus vector expressing LacZ (AdLacZ) at a multiplicity of infection of 50 in DMEM with 5% FCS. Cells were then washed with PBS and placed in serum-free medium before stimulation. Multiplicity of infection indicates the number of virus per cell added to culture dish.

Small Interfering RNA
Three 21-bp duplex RNAs that specifically target different regions of the rat CREB mRNA (Acc NM_031017) were designed and synthesized by Eurogentec (Liège, Belgium). The small interfering RNA (siRNA) targeting the mRNA sequence AAGCACTTAAGGACCTTTACT was found to exert the greatest downregulation of CREB expression as evaluated by RT-PCR using specific primers (5'-AGCACCCACTAGCACCATTG-3' and 5'-TGACTTGTGGCAGTAAAGGTC-3') and by Western blot using a specific antibody against total CREB (Santa Cruz Biotechnology). Cells were transfected with either 100 nmol/L CREB siRNA or universal negative control siRNA (Eurogentec OR-0030-NEG05) using Lipofectamine Plus according to the instructions of the manufacturer (Invitrogen, Carlsbad, Calif) and then placed in serum-free medium for 24 hours before stimulation.

Chromatin Immunoprecipitation Assay
Chromatin immunoprecipitation (ChIP) assays were performed as previously described21 using 2 µg of anti-CREB (Santa Cruz Biotechnology) or irrelevant antibody anti-VEGF (Santa Cruz Biotechnology). The OPN promoter fragment containing the –1403CRE site was PCR amplified using 5'-ATATTCGATAGTCACAGGTG-3' and 5'-GCAATTACTTCCTAAGCTTCCATTACCTGAAATGGAG-3' primers; the –1870AP-1 site with 5'-GTTGAGTCATTCCTGTGGGC-3'and 5'-GCCCTTTAAGCACGACACCC-3'. The Sp-1 gene fragment control was amplified using 5'-AGAACCGCACAGTCTCTGGT-3' and 5'- GGGACAGCTTGCTGG AGTAG-3' primers.

In sequential ChIP (ReChIP) experiments, we performed a first ChIP with anti-CREB or anti–c-Fos antibodies (Santa Cruz Biotechnology). Immunoprecipitated complexes were eluted by incubation for 30 minutes at 37°C in 25 µL of 10 mmol/L dithiothreitol. After centrifugation, the supernatant was diluted 20 times with ReChIP buffer (1% Triton X-100, 2 mmol/L EDTA, 150 mmol/L NaCl, 20 mmol/L Tris-HCl, [pH 8.1]) and subjected to a second ChIP procedure immunoprecipitation using 2 µg of the complementary antibody (anti–c-Fos after anti-CREB or anti-CREB after anti–c-Fos). PCR amplification was performed as described.

An expanded Materials and Methods section is available in the online data supplement at http://circres.ahajournals.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
UTP Induces CREB Activation in SMCs
CREB is activated by several cytokines and growth factors involved in arterial wall remodeling. We studied the effects of the extracellular nucleotide UTP stimulation on CREB activation, ie, CREB phosphorylation on serine 133, measured by Western blot using a phospho–serine 133 antibody. CREB phosphorylation was rapidly and transiently induced after UTP stimulation of cultured SMCs, although the level of total CREB remained unchanged (Figure 1A). This activation is dependent on UTP concentration, with a maximal effect between 1 and 25 µmol/L (Figure 1B). A similar activation was observed after SMC stimulation by extracellular ATP (data not shown). To determine whether CREB phosphorylation was actually linked to a functional activation, CREB-mediated transcription was monitored in SMCs transfected with a CRE reporter plasmid (CRE-luc). UTP stimulation of quiescent SMCs induced a 50-fold increase of CREB-mediated transcription (Figure 1C). Furthermore, transfection of SMCs with a dominant negative CREB (ACREB) construct totally inhibited the UTP-induced CREB transcription revealed by the activity of the CRE-luc reporter (Figure 1C). Altogether these experiments demonstrated that UTP stimulation induced a functional activation of the CREB transcription factor in cultured SMCs.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Activation of CREB by UTP in quiescent cultured SMCs. A and B, Quiescent SMCs were incubated in serum-free medium containing 10 µmol/L UTP for the indicated time (A) or for 15 minutes in medium containing 0, 0.1, 1, 10, 25, and 100 µmol/L UTP (B). Phospho-CREB (P-CREB) was detected by Western blotting using a polyclonal antibody that recognizes only the serine 133–phosphorylated CREB. Equivalent loading was controlled by total CREB and {alpha}-tubulin detection. C, SMCs were transfected with the CRE reporter plasmid (CRE-luc) alone or cotransfected with either a dominant negative CREB (ACREB) encoding plasmid or an empty pcDNA3. Histograms present the ratio of luciferase activities of UTP-stimulated cells vs those of quiescent cells. Each transfection was performed in triplicate in each experiment (n≥3).

UTP-Mediated CREB Activation Is Not Dependent on the Protein Kinase A Pathway
To determine whether UTP-mediated CREB activation involves the typical protein kinase A (PKA) pathway, we studied UTP-induced CREB phosphorylation in the presence of the PKA inhibitor H89 (Figure 2A). Under these conditions, UTP was still able to induce serine 133 phosphorylation of CREB, demonstrating that PKA was not involved. Several other protein kinases including MAPK-activated protein kinases, CaMK, and PKB/Akt also induce CREB activation (reviewed elsewhere29). Involvement of these different kinases was assessed using specific inhibitors of ERK kinases 1 and 2 (U0126), p38 (SB203580), CaMK (K62), and phosphatidylinositol 3-kinase (LY294002). Inhibitors of CaMK and phosphatidylinositol 3-kinase did not demonstrate any antagonist effect on CREB phosphorylation (data not shown). In contrast, as shown in Figure 2A, preincubation of SMCs with either ERK Kinase 1 and 2 or p38 MAPK inhibitors (U0126 and SB203580, respectively) decreased UTP-induced CREB phosphorylation. Moreover, the effects of these 2 inhibitors were cumulative, suggesting that ERK1/2 and p38 pathways act in parallel to induce CREB phosphorylation. The CREB-mediated transcription was tested using the reporter CRE-luc in the presence of these inhibitors to assess whether these 2 pathways are involved in the functional activation of CREB. When transfected SMCs were stimulated by UTP in the presence of U0126 and SB203580, UTP-induced reporter gene activation was partially inhibited by these inhibitors (Figure 2B), demonstrating that ERK1/2 and p38 pathways mediate functional CREB activation.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
Figure 2. UTP induces CREB activation via ERK1/2 and p38. A, Quiescent SMCs were pretreated with MAPK and PKA inhibitors U0126 (10 µmol/L), SB203580 (10 µmol/L), or H89 (2 µmol/L) for 30 minutes before UTP stimulation for 15 minutes. Phospho-CREB (P-CREB) was detected by Western blotting using an anti–serine 133–phosphorylated CREB antibody. Equivalent loading was controlled by total CREB detection. B, SMCs were transfected with CRE reporter plasmid (CRE-luc) or control plasmid (pLuc-MCS). Quiescent transfected SMCs were pretreated with 10 µmol/L U0126 or 10 µmol/L SB203580 for 30 minutes before UTP stimulation for 15 minutes. Histograms present the ratio of luciferase activities of UTP-stimulated cells vs quiescent cells. Each transfection was performed in triplicate in each experiment (n≥3). *P<0.01 vs CRE-luc.

CREB Is Involved in SMC Migration
Because UTP mediates SMC migration, we questioned whether CREB mediates this effect. The role of CREB in UTP-mediated SMC migration was determined by the Transwell approach using adenovirus expressing the dominant negative ACREB, which efficiently inhibits CREB activity. Proliferating SMCs were transduced with either AdACREB or the control AdLacZ adenoviruses and maintained in serum-free medium for 24 hours. Adenoviruses were added to a multiplicity of infection of 50 assuming a yield of {approx}90% transduced cells, as measured with AdLacZ. Expression of ACREB in rat SMCs transduced with AdACREB was verified by Western blot using an anti-hemagglutinin antibody targeting the hemagglutinin tag of the ACREB chimerical protein (data not shown). UTP induced a 3.7-fold increase of untreated SMC migration (Figure 3). AdACREB transduction inhibited UTP-induced migration by 56% (P<0.01), whereas AdLacZ transduction had no effect on SMC migration (AdLacZ versus untransduced). These results suggest that the UTP-mediated migratory process is, in part, dependent on CREB activation.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. Dominant negative form ACREB inhibits UTP-induced SMC migration. SMCs were transduced with adenoviruses encoding dominant negative ACREB (AdACREB) or control virus (AdLacZ) at a multiplicity of infection of 50 during 48 hours in medium containing 5% FCS. Transduced SMCs were washed and incubated for 24 hours in serum-free medium. SMC migration of transduced or control cells (Co) was then evaluated after 6 hours of stimulation with 10 µmol/L UTP in a Transwell system. The data represent the relative migration compared with the control (unstimulated control SMCs); mean±SD from 3 experiments performed in triplicate. *P<0.01 vs control.

To confirm the involvement of CREB in UTP-induced SMC migration, another strategy using siRNA selectively targeting CREB was conducted. The CREB siRNA duplex effectively downregulated CREB expression in cultured SMCs, at both mRNA and protein levels (Figure 4A). As expected, the negative control siRNA had no effect on CREB expression. CREB siRNA treatment also reduced UTP-induced SMC migration to 55% of the untreated cells (Figure 4B; P<0.01), whereas the siRNA-negative control did not induce any inhibition. Thus, the use of these 2 distinct CREB knockdown strategies demonstrated that CREB is involved in UTP-mediated migratory process.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Figure 4. CREB siRNA inhibits UTP-induced SMC migration. Proliferating SMCs were transfected with CREB siRNA or negative control siRNA (100 nmol/L) using Lipofectamine Plus. RT-PCR analysis (A, top) and Western blotting (A, bottom) for CREB were performed after a 24-hour incubation in serum-free medium. Equal loading was verified by ß-actin amplification for RNA and by {alpha}-tubulin for proteins. B, SMC migration of siRNA-treated or control (Co) cells was evaluated in the Transwell system after a 6-hour stimulation with 10 µmol/L UTP. The data represent the relative migration vs the control (unstimulated control SMCs, open bars); mean±SD from 3 experiments performed in triplicate. *P<0.01 vs Co.

CREB Is Involved in UTP-Induced OPN Expression
We previously demonstrated that UTP induced SMC migration via OPN production.2 We thus proceeded to determine whether CREB, which is involved in SMC migration, is also involved in OPN expression. Total RNA and total proteins were isolated after a 6-hour UTP stimulation of either adenovirus-transduced or siRNA-treated quiescent SMCs. Transduction with AdLacZ had no effect on UTP-induced OPN expression, whereas AdACREB transduction produced an inhibition at both the mRNA and the protein levels (30.1%±2.1 and 32.9%±4.2, respectively) (Figure 5A). In the same way, treatment with control siRNA had no effect on UTP-induced OPN expression, whereas CREB siRNA treatment inhibited this expression (30.4%±0.7 for mRNAs and 40.4%±1.2 for proteins) (Figure 5B). These experiments demonstrated that CREB activation is necessary for OPN production and suggested that the effect of CREB on UTP-induced SMC migration involves OPN expression modulation.


Figure 5
View larger version (40K):
[in this window]
[in a new window]

 
Figure 5. CREB is involved in UTP-induced OPN expression. Proliferating SMCs were infected with AdACREB or the control AdLacZ adenovirus (A) or treated with CREB siRNA or control siRNA (100 nmol/L) (B). After a 24-hour incubation in serum-free medium, quiescent treated or control (Co) SMCs were stimulated with 10 µmol/L UTP for 6 hours. OPN expression was analyzed by RT-PCR (left panels) or by Western blot using a polyclonal anti-OPN antibody (right panels). Equal loading was verified by ß-actin amplification for RNA and by {alpha}-tubulin for proteins.

CREB Binds Two AP-1 Sites and One CRE Site on the OPN Promoter
Our next aim was to identify the mechanisms of CREB-mediated OPN expression, namely by searching, on OPN promoter, for CREB binding sites that regulate UTP-induced OPN gene transcription. Sequence analysis using MatInspector software35 of the –1994 to +66 region of the rat OPN promoter revealed several potential CREB-binding sites: 2 CRE-like sites, 3 E4BP4 sites, and 2 AP-1 sites (supplemental table). To determine whether CREB could bind these sites, electrophoretic mobility-shift assay (EMSA) analyses were performed using a CRE consensus probe (Figure 6A). When nuclear extracts were incubated in the presence of this probe, a CREB/CRE complex was formed. This complex disappeared when a 50-fold excess of the cold CRE probe, but not a nonspecific probe, was added, showing that the interaction was specific. Competition assays using an excess of cold probes representative of the potential CREB binding sites of the rat OPN promoter were then conducted. Among them, only –1870AP-1, –76AP-1, and –1403CRE probes were able to shift the complex, suggesting that CREB can specifically bind these three sites. To verify that CREB could actually bind these sites on OPN promoter in living cells, ChIP assays were conducted. After immunoprecipitation with anti-CREB antibody, we used PCR primers that specifically amplify the OPN promoter regions containing the –1870AP-1, –76AP-1, and –1403CRE-like sites, respectively. This PCR analysis demonstrated that the genomic DNA of these 3 regions of the OPN promoter were immunoprecipitated with the anti-CREB antibody (compared with the irrelevant anti-VEGF antibody). showing that CREB can indeed bind these 3 sites (Figure 6B).


Figure 6
View larger version (41K):
[in this window]
[in a new window]

 
Figure 6. CREB-binding sites on OPN promoter. A, CRE consensus (CRE cons) probe was used for the gel-shift assay with nuclear extracts from quiescent SMCs stimulated for 15 minutes with 10 µmol/L UTP. Competition experiments were performed using a 50-fold excess of unlabeled oligonucleotides representative of the sequence of the putative CREB-binding sites of the OPN promoter. B, ChIP analysis was preformed with quiescent SMCs stimulated for 15 minutes with 10 µmol/L UTP. Transcription factors bound to chromatin were immunoprecipitated using either an anti-CREB antibody or an irrelevant antibody (anti-VEGF). Immunoprecipitated AP-1 or CRE regions of the OPN promoter were detected by PCR analysis. Total extract was used as a positive control of the PCR. Sp-1 amplification was used as a control of specificity. Quantification of the PCR amplification bands was performed by image analysis (Scion Image).

The Two AP-1 Sites Are Involved in UTP-Induced OPN Expression
The functional effect of CREB binding on these 3 potential regulatory sites of the OPN promoter was first evaluated by studying the inhibitory effect of the dominant negative ACREB on UTP-activated transcription in cells transfected with a set of pGL2 plasmids carrying 5' deletions of the rat OPN promoter. Indeed, the inhibition rate by ACREB reflected the implication of CREB in the activation of specific OPN promoter regions by UTP. ACREB inhibited all constructs tested containing the –1994- to +66 bp region of the OPN promoter (Figure 7A). However, this experiment clearly demonstrated a marked decrease of both UTP activation and ACREB inhibition when the regions –1994 to –1599 and –294 to +66 were missing, suggesting that only these 2 regions contained elements able to bind UTP-activated CREB (Figure 7B). To confirm this result, the 3 potential CREB binding sites –1870AP-1, –76AP-1, and –1403CRE-like were individually mutated on –1994-luc constructs, and cells were transfected with each of the mutated constructs. UTP-stimulated promoter activity was unchanged when –1403CRE-like site was mutated. This activity was significantly reduced by 25.6% and 30% when the –1870 and –76AP-1 sites were mutated, respectively, and by 57% when these both sites were mutated, suggesting an additive effect (Figure 7C). When ACREB was expressed, the inhibition of UTP-induced OPN expression was reduced when the 2 AP-1 sites were individually mutated and fully abrogated for the double mutant (Figure 7D), confirming that only the –1870 and –76AP-1 regulatory sites are involved in CREB-mediated OPN transcription induced by UTP.


Figure 7
View larger version (26K):
[in this window]
[in a new window]

 
Figure 7. OPN AP-1 sites are involved in UTP-induced OPN expression. SMCs were cotransfected with the basic pGL2 plasmids carrying 5' deletions of the OPN promoter (–1994 to –294) (A and B) or specific mutations of –1870AP-1, –76AP-1, –1403CRE, or –1870 and –76 AP-1 (–1994{Delta}AP-1{Delta}AP-1) sites (C and D) and by the dominant negative CREB plasmid (ACREB). pcDNA3 was used as control. The ratio of stimulated to unstimulated activities was evaluated (A and C), and the percentage of ACREB inhibition on the various constructs was calculated (B and D). Each transfection was performed in triplicate in each experiment (n≥3). *P<0,05.

Interaction of CREB With AP-1 Sites of OPN Promoter
The results illustrated above indicated that CREB acts through the 2 AP-1 sites on OPN promoter. However, it has previously been demonstrated that –76AP-1 site binds c-Fos factor.21 We thus explored the binding capacities of these sites by EMSA analyses. UTP stimulation largely increased the complex binding to –76AP-1 and –1870AP-1 probes. A supershift assay using anti–c-Fos and anti-CREB antibodies was performed to identify transcription factors bound to the 2 AP-1 sites. When either a CREB or a c-Fos antibody was added to the nuclear extract with the 2 probes, the DNA–protein complex was displaced by 82%±12 and 93%±10.7, respectively, for the –76AP-1 probe and by 82%±8 and 99%±6 for the –1870AP-1 probe (Figure 8A). In contrast, no modification was observed when an anti–NF-{kappa}B p65 subunit was used (Figure 8A). This experiment suggested that c-Fos and CREB were bound together to AP-1 sites. To verify the interaction between these factors on the AP-1 sites in vivo, an ReChIP assay was performed. Chromatin was coimmunoprecipitated using the anti-CREB antibody and then the anti–c-Fos antibody. This coimmunoprecipitation was also performed in inverted order, with anti–c-Fos treatment followed by anti-CREB treatment. In both experiments, PCR analysis of the resulting coimmunoprecipitated chromatin amplified the –1870 and –76 OPN promoter regions significantly compared with the control condition with the irrelevant antibody, suggesting that c-Fos and CREB could form a complex (Figure 8B) that binds to the 2 AP-1 sites of OPN promoter to induce its expression.


Figure 8
View larger version (30K):
[in this window]
[in a new window]

 
Figure 8. OPN AP-1 sites bind CREB/c-Fos complex. A, EMSA assay was preformed using 32P-labeled –76AP-1 and –1870AP-1 probe. Nuclear extracts were obtained from quiescent SMCs stimulated or not for 15 minutes with 10 µmol/L UTP. Anti–c-Fos and anti-CREB antibodies were used for supershift. Anti–NF-{kappa}B p65 subunit was used as a nonspecific antibody. CREB/CRE complex is indicated with an arrow. Quantification of the signal density of 4 experiments was determined by image analysis (Scion Image). UTP-stimulated extract without antibody was taken as reference (n=1). B, ReChIP assay was performed with quiescent SMCs stimulated for 15 minutes with 10 µmol/L UTP. Transcription factors bound to chromatin were coimmunoprecipitated first using an anti-CREB antibody and then an anti–c-Fos antibody, or first using an anti–c-Fos antibody and then an anti-CREB antibody. Irrelevant antibody (anti-VEGF) was used as a control. Immunoprecipitated AP-1 or CRE regions of the OPN promoter were detected by PCR amplification. Total extract was used as a positive control of the PCR. Sp-1 amplification was used as a control of specificity. Quantification of the PCR amplification band was determined by image analysis (Scion Image).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we show that the transcription factor CREB is activated in UTP-stimulated SMCs and takes part in UTP-induced SMC migration. We also demonstrate that this UTP-induced CREB activation is involved in the expression of OPN, an RGD-containing extracellular matrix phosphoprotein required for UTP-induced SMC migration.2 This effect is mediated by the binding of CREB on 2 AP-1 sites of the OPN promoter.

It has been demonstrated that UTP stimulation of SMCs induces expression or activation of several transcription factors, including c-Fos, USF, and NF-{kappa}B. This activation is mainly mediated by ERK and PKC pathways.21,22 In this report, we demonstrate for the first time in SMCs, that UTP activates the phosphorylation of CREB through ERK1/2 and p38 MAPK, but not by the usual PKA pathway. A similar involvement of these MAPK in CREB activation has been previously reported after stimulation of SMCs by thrombin, a mitogen and chemotactic factor for SMCs, acting via a 7-transmembrane domain receptor as well.24

The role of CREB in SMC migration is incompletely characterized and even controversial. Various chemotactic agents for SMCs such as PDGF-BB,27 tumor necrosis factor {alpha},25 angiotensin II,28 thrombin,24 and ATP26 have been shown to stimulate CREB phosphorylation, suggesting that CREB might be involved in the regulation of SMC migration. In the present study, we demonstrate that inactivation of CREB by its dominant negative form or by specific CREB siRNA greatly decreases UTP-induced SMC migration and consequently that CREB is involved in this process. Our result is consistent with the demonstration of CREB involvement in tumor necrosis factor {alpha}–mediated migration of SMCs.25 Moreover, the inhibition of CREB activity by dominant negatives leads to a decrease in SMCs proliferation induced by ATP or thrombin,24,26 demonstrating that CREB is necessary for the activity of these factors that are also chemotactic for SMCs. In contrast, Klemm et al have described a negative correlation between the CREB level and the PDGF-activated SMC migration.36 Moreover, it is now well demonstrated that agents activating the cAMP/PKA pathway not only activate CREB but also inhibit SMC migration,37 suggesting that CREB might be involved in this inhibition. However, different studies report that the inhibition of migration is essentially attributable to the phosphorylation of other PKA targets, leading to the inhibition of various steps involved in the migratory process, ie, inhibition of the ERK and phosphatidylinositol 3-kinase pathways and of Rho kinase and actin polymerization.38 However, CREB may also participate in the expression of genes such as Cox-2 involved in the inhibition of SMC migration.39 It is currently difficult to put forward a rational explanation for the discrepancy observed for the role of CREB in SMC migration. Meanwhile, it can be proposed that CREB regulation is not only dependent on the nature of chemotactic stimuli and of the activated intracellular signalization pathways but also on the phenotypic state of the target SMCs.

OPN is a key actor of UTP-mediated SMC migration.2 We have previously identified different transcription factors involved in UTP-activated OPN expression in SMCs, namely AP-1, USF, and NF-{kappa}B factors.21,22 In the present study, we show that phosphorylated CREB is transcriptionally active and contributes to OPN expression in UTP-stimulated SMCs. It is well documented that CREB binds usual CRE sites on target gene promoters (reviewed elsewhere30). We demonstrate that, among the potential CREB-binding sites, CREB binds only to the –1403CRE site and to the –1870 and –76AP-1 sites. However, only the 2 AP-1 sites were involved in UTP-induced OPN expression, as shown using specific mutated promoter constructs. This unexpected result suggests that CREB could either bind to AP-1 sites as a homodimer31 or participate in a complex with AP-1 proteins.32,33,40 We have previously demonstrated that c-Fos and c-Jun bind the –76AP-1 site.21 In this report, we show, by supershift assay, that CREB is associated with c-Fos on the 2 AP-1 sites of the OPN promoter. We thus can hypothesize that a multicomplex containing CREB, c-Fos, and/or c-Jun proteins regulates the OPN transcription–dependent binding to AP-1 sites. Because our data do not show a CREB-binding site in the 300 bp flanking the AP-1 sites, the ReChIP coimmunoprecipitation experiment strongly supports this hypothesis. A transcriptional complex involving NF-{kappa}B, AP-1, and CREB has already been described.40 In our case, NF-{kappa}B does not take part in the AP-1/CREB complex bound to these 2 AP-1 sites.

In this report, we describe a new pathway for UTP-induced OPN expression involving activation of the transcription factor CREB and its binding, in association with c-Fos, to AP-1 sites of the OPN promoter. Taken together with our previous results, this study underscores the complex regulation of the SMC chemotactic protein OPN by the extracellular nucleotide UTP. Moreover, it suggests a potential role for the activation of CREB not only by UTP but also by other SMC chemotactic agents, because PDGF and angiotensin II also induce OPN expression in SMCs.12,13


*    Acknowledgments
 
Sources of Funding

This study was supported by grants from INSERM, University of Bordeaux 2, and Conseil Régional d’Aquitaine and by a fellowship from the Ministère de la Recherche et de la Technologie (to S.J.).

Disclosures

None.


*    Footnotes
 
Original received July 3, 2006; revision received February 27, 3007; accepted March 27, 2007.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Newby AC, Zaltsman AB. Molecular mechanisms in intimal hyperplasia. J Pathol. 2000; 190: 300–309.[CrossRef][Medline] [Order article via Infotrieve]
  2. Chaulet H, Desgranges C, Renault MA, Dupuch F, Ezan G, Peiretti F, Loirand G, Pacaud P, Gadeau AP. Extracellular nucleotides induce arterial smooth muscle cell migration via osteopontin. Circ Res. 2001; 89: 772–778.[Abstract/Free Full Text]
  3. Weisman GA, Wang M, Kong Q, Chorna NE, Neary JT, Sun GY, Gonzalez FA, Seye CI, Erb L. Molecular determinants of P2Y2 nucleotide receptor function: implications for proliferative and inflammatory pathways in astrocytes. Mol Neurobiol. 2005; 31: 169–183.[CrossRef][Medline] [Order article via Infotrieve]
  4. Wihlborg AK, Balogh J, Wang L, Borna C, Dou Y, Joshi BV, Lazarowski E, Jacobson KA, Arner A, Erlinge D. Positive inotropic effects by uridine triphosphate (UTP) and uridine diphosphate (UDP) via P2Y2 and P2Y6 receptors on cardiomyocytes and release of UTP in man during myocardial infarction. Circ Res. 2006; 98: 970–976.[Abstract/Free Full Text]
  5. Pillois X, Chaulet H, Belloc I, Dupuch F, Desgranges C, Gadeau AP. Nucleotide receptors involved in UTP-induced rat arterial smooth muscle cell migration. Circ Res. 2002; 90: 678–681.[Abstract/Free Full Text]
  6. Seye CI, Gadeau AP, Daret D, Dupuch F, Alzieu P, Capron L, Desgranges C. Overexpression of P2Y2 purinoceptor in intimal lesions of the rat aorta. Arterioscler Thromb Vasc Biol. 1997; 17: 3602–3610.[Abstract/Free Full Text]
  7. Shen J, Seye CI, Wang M, Weisman GA, Wilden PA, Sturek M. Cloning, up-regulation, and mitogenic role of porcine P2Y2 receptor in coronary artery smooth muscle cells. Mol Pharmacol. 2004; 66: 1265–1274.[Abstract/Free Full Text]
  8. Seye CI, Kong Q, Erb L, Garrad RC, Krugh B, Wang M, Turner JT, Sturek M, Gonzalez FA, Weisman GA. Functional P2Y2 nucleotide receptors mediate uridine 5'-triphosphate-induced intimal hyperplasia in collared rabbit carotid arteries. Circulation. 2002; 106: 2720–2726.[Abstract/Free Full Text]
  9. Denhardt DT, Noda M, O’Regan AW, Pavlin D, Berman JS. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J Clin Invest. 2001; 107: 1055–1061.[Medline] [Order article via Infotrieve]
  10. Standal T, Borset M, Sundan A. Role of osteopontin in adhesion, migration, cell survival and bone remodeling. Exp Oncol. 2004; 26: 179–184.[Medline] [Order article via Infotrieve]
  11. Liaw L, Almeida M, Hart CE, Schwartz SM, Giachelli CM. Osteopontin promotes vascular cell adhesion and spreading and is chemotactic for smooth muscle cells in vitro. Circ Res. 1994; 74: 214–224.[Abstract/Free Full Text]
  12. Wang X, Louden C, Ohlstein EH, Stadel JM, Gu JL, Yue TL. Osteopontin expression in platelet-derived growth factor-stimulated vascular smooth muscle cells and carotid artery after balloon angioplasty. Arterioscler Thromb Vasc Biol. 1996; 16: 1365–1372.[Abstract/Free Full Text]
  13. Giachelli CM, Bae N, Almeida M, Denhardt DT, Alpers CE, Schwartz SM. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest. 1993; 92: 1686–1696.[Medline] [Order article via Infotrieve]
  14. Malam-Souley R, Seye C, Gadeau AP, Loirand G, Pillois X, Campan M, Pacaud P, Desgranges C. Nucleotide receptor P2u partially mediates ATP-induced cell cycle progression of aortic smooth muscle cells. J Cell Physiol. 1996; 166: 57–65.[CrossRef][Medline] [Order article via Infotrieve]
  15. Shi X, Bai S, Li L, Cao X. Hoxa-9 represses transforming growth factor-beta-induced osteopontin gene transcription. J Biol Chem. 2001; 276: 850–855.[Abstract/Free Full Text]
  16. Inman CK, Shore P. The osteoblast transcription factor Runx2 is expressed in mammary epithelial cells and mediates osteopontin expression. J Biol Chem. 2003; 278: 48684–48689.[Abstract/Free Full Text]
  17. Vary CP, Li V, Raouf A, Kitching R, Kola I, Franceschi C, Venanzoni M, Seth A. Involvement of Ets transcription factors and targets in osteoblast differentiation and matrix mineralization. Exp Cell Res. 2000; 257: 213–222.[CrossRef][Medline] [Order article via Infotrieve]
  18. Wang D, Yamamoto S, Hijiya N, Benveniste EN, Gladson CL. Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions. Oncogene. 2000; 19: 5801–5809.[CrossRef][Medline] [Order article via Infotrieve]
  19. Bidder M, Shao JS, Charlton-Kachigian N, Loewy AP, Semenkovich CF, Towler DA. Osteopontin transcription in aortic vascular smooth muscle cells is controlled by glucose-regulated upstream stimulatory factor and activator protein-1 activities. J Biol Chem. 2002; 277: 44485–44496.[Abstract/Free Full Text]
  20. Malyankar UM, Hanson R, Schwartz SM, Ridall AL, Giachelli CM. Upstream stimulatory factor 1 regulates osteopontin expression in smooth muscle cells. Exp Cell Res. 1999; 250: 535–547.[CrossRef][Medline] [Order article via Infotrieve]
  21. Renault MA, Jalvy S, Belloc I, Pasquet S, Sena S, Olive M, Desgranges C, Gadeau AP. AP-1 is involved in UTP-induced osteopontin expression in arterial smooth muscle cells. Circ Res. 2003; 93: 674–681.[Abstract/Free Full Text]
  22. Renault MA, Jalvy S, Potier M, Belloc I, Genot E, Dekker LV, Desgranges C, Gadeau AP. UTP induces osteopontin expression through a coordinate action of NFkappaB, activator protein-1, and upstream stimulatory factor in arterial smooth muscle cells. J Biol Chem. 2005; 280: 2708–2713.[Abstract/Free Full Text]
  23. Wang X, Murphy TJ. The inducible cAMP early repressor ICERIIgamma inhibits CREB and AP-1 transcription but not AT1 receptor gene expression in vascular smooth muscle cells. Mol Cell Biochem. 2000; 212: 111–119.[CrossRef][Medline] [Order article via Infotrieve]
  24. Tokunou T, Ichiki T, Takeda K, Funakoshi Y, Iino N, Takeshita A. cAMP response element-binding protein mediates thrombin-induced proliferation of vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2001; 21: 1764–1769.[Abstract/Free Full Text]
  25. Ono H, Ichiki T, Fukuyama K, Iino N, Masuda S, Egashira K, Takeshita A. cAMP-response element-binding protein mediates tumor necrosis factor-alpha-induced vascular smooth muscle cell migration. Arterioscler Thromb Vasc Biol. 2004; 24: 1634–1639.[Abstract/Free Full Text]
  26. Zhang S, Remillard CV, Fantozzi I, Yuan JX. ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells. Am J Physiol Cell Physiol. 2004; 287: C1192–C1201.[Abstract/Free Full Text]
  27. Abbott KL, Robida AM, Davis ME, Pavlath GK, Camden JM, Turner JT, Murphy TJ. Differential regulation of vascular smooth muscle nuclear factor kappa-B by G alpha q-coupled and cytokine receptors. J Mol Cell Cardiol. 2000; 32: 391–403.[CrossRef][Medline] [Order article via Infotrieve]
  28. Reddy MA, Adler SG, Kim YS, Lanting L, Rossi J, Kang SW, Nadler JL, Shahed A, Natarajan R. Interaction of MAPK and 12-lipoxygenase pathways in growth and matrix protein expression in mesangial cells. Am J Physiol Renal Physiol. 2002; 283: F985–F994.[Abstract/Free Full Text]
  29. Johannessen M, Delghandi MP, Moens U. What turns CREB on? Cell Signal. 2004; 16: 1211–1227.[CrossRef][Medline] [Order article via Infotrieve]
  30. Roesler WJ, Vandenbark GR, Hanson RW. Cyclic AMP and the induction of eukaryotic gene transcription. J Biol Chem. 1988; 263: 9063–9066.[Free Full Text]
  31. Rutberg SE, Adams TL, Olive M, Alexander N, Vinson C, Yuspa SH. CRE DNA binding proteins bind to the AP-1 target sequence and suppress AP-1 transcriptional activity in mouse keratinocytes. Oncogene. 1999; 18: 1569–1579.[CrossRef][Medline] [Order article via Infotrieve]
  32. Hai T, Curran T. Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc Natl Acad Sci U S A. 1991; 88: 3720–3724.[Abstract/Free Full Text]
  33. Chatton B, Bocco JL, Goetz J, Gaire M, Lutz Y, Kedinger C. Jun and Fos heterodimerize with ATFa, a member of the ATF/CREB family and modulate its transcriptional activity. Oncogene. 1994; 9: 375–385.[Medline] [Order article via Infotrieve]
  34. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C. A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol. 1998; 18: 967–977.[Abstract/Free Full Text]
  35. Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 1995; 23: 4878–4884.[Abstract/Free Full Text]
  36. Klemm DJ, Watson PA, Frid MG, Dempsey EC, Schaack J, Colton LA, Nesterova A, Stenmark KR, Reusch JE. cAMP response element-binding protein content is a molecular determinant of smooth muscle cell proliferation and migration. J Biol Chem. 2001; 276: 46132–46141.[Abstract/Free Full Text]
  37. Goncharova EA, Billington CK, Irani C, Vorotnikov AV, Tkachuk VA, Penn RB, Krymskaya VP, Panettieri RA Jr. Cyclic AMP-mobilizing agents and glucocorticoids modulate human smooth muscle cell migration. Am J Respir Cell Mol Biol. 2003; 29: 19–27.[Abstract/Free Full Text]
  38. Howe AK. Regulation of actin-based cell migration by cAMP/PKA. Biochim Biophys Acta. 2004; 1692: 159–174.[Medline] [Order article via Infotrieve]
  39. Debey S, Meyer-Kirchrath J, Schror K. Regulation of cyclooxygenase-2 expression by iloprost in human vascular smooth muscle cells. Role of transcription factors CREB and ICER. Biochem Pharmacol. 2003; 65: 979–988.[CrossRef][Medline] [Order article via Infotrieve]
  40. Jaramillo M, Olivier M. Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signal-regulated kinase- and cyclic adenosine 5'-monophosphate (cAMP)-dependent pathways: involvement of NF-kappa B, activator protein 1, and cAMP response element binding protein. J Immunol. 2002; 169: 7026–7038.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Rose, J. Bond, S. Tighe, M. J. Toth, T. L. Wellman, E. M. B. de Montiano, M. M. Lewinter, and K. M. Lounsbury
Genes overexpressed in cerebral arteries following salt-induced hypertensive disease are regulated by angiotensin II, JunB, and CREB
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1075 - H1085.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Irita, T. Okura, M. Kurata, K.-i. Miyoshi, T. Fukuoka, and J. Higaki
Osteopontin in Rat Renal Fibroblasts: Functional Properties and Transcriptional Regulation by Aldosterone
Hypertension, February 1, 2008; 51(2): 507 - 513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
100/9/1292    most recent
01.RES.0000266609.28312.dev1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Related Collections
Right arrow Cell signalling/signal transduction
Right arrow Gene regulation
Right arrow Mechanism of atherosclerosis/growth factors