This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 100/4/545    most recent 01.RES.0000258460.41160.efv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Niagara, M. I. Articles by Ashraf, M. Search for Related Content PubMed PubMed Citation Articles by Niagara, M. I. Articles by Ashraf, M. Related Collections Oxidant stress Angiogenesis Apoptosis Myogenesis Related Article

(Circulation Research. 2007;100:545.)
© 2007 American Heart Association, Inc.

Cellular Biology

Pharmacologically Preconditioned Skeletal Myoblasts Are Resistant to Oxidative Stress and Promote Angiomyogenesis via Release of Paracrine Factors in the Infarcted Heart

Muhammad Idris Niagara^*, Husnain Kh. Haider^*, Shujia Jiang, Muhammad Ashraf

From the Department of Pathology and Laboratory Medicine, University of Cincinnati, Ohio.

Correspondence to Prof Muhammad Ashraf, Department of Pathology and Laboratory Medicine, 231 Albert Sabin Way, University of Cincinnati, OH 45267-0529. E-mail muhammad.ashraf{at}uc.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Strategies to enhance skeletal myoblast (SkM) survival after transplantation in the ischemic heart have achieved little success. We posit that preconditioned (PC) SkMs show improved survival and promote repair of the infarcted myocardium via paracrine signaling after transplantation. SkMs from male Fischer-344 rats (rSkMs) were PC for 30 minutes with 200 µmol/L diazoxide. Treatment of PC rSkMs with 100 µmol/L H₂O₂ for 2 hours resulted in significantly reduced cell injury, as shown by lactate dehydrogenase–release assay, and prevented apoptosis, as demonstrated by cytochrome c translocation, TUNEL, annexin V staining, and preservation of mitochondrial membrane potential. PC rSkMs expressed elevated phospho-Akt (1.85-fold), basic fibroblast growth factor (1.44-fold), hepatocyte growth factor (2.26-fold), and cyclooxygenase-2 (1.33-fold) as compared with non-PC rSkMs. For in vivo studies, female Fischer-344 rats after permanent coronary artery ligation were grouped (n=12/group) to receive 80 µL of basal medium without rSkMs (group 1) or containing 1.5x10⁶ non-PC (group 2) or PC (group 3) rSkMs. Real-time PCR for sry gene 4 days after transplantation (n=4/group) showed 1.93-fold higher survival of rSkMs in group 3 as compared with group 2. Four weeks later, echocardiography revealed improved indices of left ventricular function, including ejection fraction and fractional shortening in group 3 (P<0.02) as compared with groups 1 and 2. Blood vessel count per surface area (at x400 magnification) was highest in scar and periscar areas in group 3 as compared with the other groups (P<0.05). We conclude that activation of signaling pathways of preconditioning in SkMs promoted their survival by release of paracrine factors to promote angiomyogenesis in the infarcted heart. Transplantation of PC SkMs for heart cell therapy is an innovative approach in the clinical perspective.

Key Words: angiogenesis • apoptosis • myocardial infarction • preconditioning

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Proof-of-concept experimental animal studies and clinical trials have shown the suitability of SkM transplantation for treatment of cardiac and skeletal muscle–related pathologies.^1–3 Despite promising results, transplantation of SkMs is confronted with the problem of poor survival in the host myocardium.⁴ A significantly high percentage of SkMs undergoes necrosis within hours after transplantation, thus compromising the optimal outcome of the procedure. In some studies, more than 70% to 80% of the cultured SkMs died within 3 days,^5,6 whereas others have shown that 93% of SkMs were lost in 2 days after transplantation.⁷ Pagani et al showed a meager 1% survival of the transplanted SkMs in patient hearts.² These disconcerting reports regarding the problematic poor survival of SkMs have implicated multiple factors for the extensive cell death in SkM transplantation studies.⁸ Besides other mechanisms, the dynamics of early donor SkM death incriminates local tissue ischemia induced apoptosis as one of the prime factors.⁴

Considering that cell survival may greatly enhance the effectiveness of transplantation therapy, several remedial approaches have been suggested. Physiologically relevant hyperthermia has been shown to selectively overexpress heat shock protein-70 in cardiac myoblasts and thus confers oxidative protection.⁹ This approach was used by Suzuki et al to enhance SkM survival in a rat heart model.¹⁰ Coadministration of cell types dedicated to varying potentials and different functions (myogenesis and angiogenesis) may help the donor cells survive better. Similarly, ex vivo gene modification of SkMs for overexpression of angiogenic growth factors stimulate survival signaling in them.¹¹ Administration of growth factors promoting angiogenesis would improve blood perfusion in the scar, thus leading to the longer term survival of the cell graft. In a more recent development, transgenic overexpression of cell survival signaling molecules including Akt promoted resistance of the donor cells against apoptosis in the infarcted myocardium.¹² To exploit the powerful cytoprotective nature of preconditioning approach, we posit that preconditioning of SkMs using preconditioning mimetics will enhance their resistance to ischemia induced apoptosis.

Ischemic preconditioning has been shown to improve tolerance in various body tissues including the heart.^13,14 These effects have been mimicked via pharmacological intervention using mitochondrial potassium channel openers.^15–17 In vitro cellular models are currently being studied to elucidate the underlying molecular mechanisms involved in preconditioning-induced tolerance and antiapoptotic effects.^16,18 The present study is novel in terms of combining the importance of cellular preconditioning with heart cell therapy to overcome the problem of extensive SkM death post transplantation.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Isolation and Culture of rSkMs
Under sedation, the site of skeletal muscle biopsy in hindlimbs of male Fischer-344 rats was stimulated with intramuscular injection of 0.3 mL mixture of ketamine (10 mg/mL) and xylazine (2 mg/mL). Three days later, an excisional biopsy (1 to 2 g) of the stimulated muscle was removed and processed for isolation of rSkMs.¹⁹ Briefly, biopsy samples were minced into coarse slurry, followed by serial enzymatic digestion (at 37°C) with 0.2% collagenase type XI (GIBCO-BRL) for 90 minutes, 2.4 U/mL of dispase (GIBCO-BRL) for 45 minutes, and finally 0.1% trypsin-EDTA (GIBCO-BRL) for 15 minutes. The muscle extract was preplated 3 times at a 1-hour time interval and twice additionally at 8 and 16 hours to remove the debris and contaminating cells. After the last preplate, 0.1 mmol/L 5-bromodeoxyuridine (BD-Pharmingen) was added to the cell culture for 3 days to inhibit fibroblast growth followed by 3 days of treatment with 15 ng/mL basic fibroblast growth factor (bFGF) (Sigma). The cells were later propagated in medium-199 supplemented with 20% FBS at 37°C/5% CO₂ atmosphere, and purity of the culture was determined by desmin-specific immunostaining as described earlier.¹¹ The purified rSkM culture was repeatedly passaged at regular time intervals to prevent their premature differentiation in vitro. The present study conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes (NIH Publication No. 85-23, revised 1985) and protocol approved by the Institutional Animal Care and Use Committee, University of Cincinnati.

In Vitro Studies for Cytoprotective Effects of Preconditioning
Preconditioning of rSkMs and Oxidant Stress
The cells were grown on Petri dishes at a density of 3.75x10⁴ cells/cm². One day later, they were randomly assigned to 3 experimental groups: non-PC rSkMs (group 1), non-PC rSkMs incubated with 100 µmol/L H₂O₂ for 2 hours (group 2), and rSkMs PC for 30 minutes with 200 µmol/L diazoxide (DZ) (Sigma) and treated with 100 µmol/L H₂O₂ for 2 hours (group 3). The dose and time for H₂O₂ and diazoxide treatment were determined from experiments shown in Figure IA and IB in the online data supplement, available at http://circres.ahajournals.org. All experiments were performed in serum- and glucose-free DMEM. At the end of the experiment, rSkMs and their supernatants were removed for molecular studies to assess cellular injury from oxidative stress and cytoprotective effects of preconditioning.

Lactate Dehydrogenase Leakage
Intracellular lactate dehydrogenase (LDH) leakage, a well-known indicator of cell membrane integrity and viability, was measured in the cell-conditioned medium samples using an LDH Assay kit (Diagnostic Chemicals Ltd) according to the instructions of the manufacturer. Detailed methods are available in the online data supplement.

Annexin V/Propidium Iodide Staining of rSkMs
The percentage of apoptotic, necrotic, and viable rSkMs in the different treatment groups was determined with the annexin V/propidium iodide (PI) Apoptosis Detection kit (Sigma) according to the instructions of the manufacturer. Fluorescence was detected by flow cytometry (FACSCalibur, BD). The apoptotic cells were stained with annexin V; necrotic cells displayed both PI and annexin V staining, whereas live cells remained unstained.

Mitochondrial Membrane Potential
Disruption of mitochondrial transmembrane potential in the early apoptotic cells was detected using DePsipher (R&D Systems Inc). DePsipher is a specific marker of mitochondrial activity. Staining of rSkMs with DePsipher was performed for 15 minutes at 37°C in a 5% CO₂ atmosphere, according to the instructions of the manufacturer, and visualized with a fluorescent microscope.

Cytochrome c–Specific Immunostaining
The integrity of mitochondrial membrane was detected by immunostaining for translocation of cytochrome c from mitochondria to the cytosol. rSkMs from various treatment groups were fixed with 4% paraformaldehyde for 10 minutes at room temperature. Immunostaining was performed using mouse anti–cytochrome c primary antibody (BD Pharmingen; 1:100) and goat anti-mouse secondary antibody (1:100) conjugated with Alexa Fluor-546 (Molecular Probes). The cells were visualized with Olympus BX41 microscope equipped with digital camera (Olympus) for punctate (live rSkMs) or diffused (early apoptotic rSkMs) fluorescence in the cytoplasm.

Terminal Deoxynucleotidyl Transferase–Mediated dUTP Nick-End Labeling
TUNEL on different treatment groups of cells was performed according to the instructions of the manufacturer (Roche, Indianapolis, Ind).

Reverse-Transcription Polymerase Chain Reaction
Isolation of total RNA from the different treatment groups of rSkMs, and their subsequent first-strand cDNA synthesis, was performed using an RNeasy mini kit (Qiagen) and an Omniscript Reverse Transcription kit (Qiagen), respectively, per the instructions of the manufacturer. The following primer sequences were used for PCR:

• bFGF (372 bp): forward, 5'AAGCGGCTCTACTGCAAG3'; reverse, 5'AGCCAGACATTGGAAGAAACA3'
  
• Hepatocyte growth factor (HGF) (246 bp): forward, 5'TATTTACGGCTGGGGCTACA3'; reverse, 5'ACGACCAGGAACAATGACAC3'
  
• Rat GAPDH (738 bp): forward, 5' TTCTTGTGCAGTGCCAGCCTCGTC 3'; reverse, 5' TAGGAACACGGAAGGCCATGCCAG 3'
  
• Rat sry-gene (115): forward, 5'GAGGCACAAGTTGGCTCAACA3'; reverse, 5'CTCCTGCAAAAAGGGCCTTT3'
  

Real-Time PCR for Donor Cell Survival in Rat Heart
The detailed methods for real-time PCR are available in the online data supplement.

Multiplex PCR
For detection of the rat GAPDH, Tie-2, cyclooxygenase (Cox)-2, angiopoietin-2 (Ang-2), Ang-1, and vascular endothelial growth factor (VEGF), an multiplex polymerase chain reaction kit (catalog no. MP70175) was used according to the instructions of the supplier (Maxim Biotech Inc). The following thermocycle profile was used: initial denaturation at 96°C for 1 minute and annealing at 58°C for 4 minutes, repeated twice; 30 cycles of denaturation at 94°C for 1 minute and annealing/extension at 58°C for 2 minutes and a final extension at 70°C for 10 minutes.

Western Immunoblotting
For protein expression, cells from various treatment groups were processed and analyzed by Western immunoblotting as detailed in the online data supplement.

In Vivo Studies
PKH-26 Labeling of rSkMs
Labeling of rSkMs with PKH26 dye to study their fate posttransplantation was performed using a PKH-26 Cell Linker Kit (Sigma) according to the instructions of the supplier.

Rat Heart Model of Acute Myocardial Infarction and Transplantation of rSkMs
Rats were anesthetized by intraperitoneal injection of ketamine/xylazine (24 mg/kg and 4 mg/kg body weight, respectively). After endotracheal intubation and ventilation using Harvard Apparatus Rodent Ventilator (model no. 683), the heart was exposed via minimal left-sided thoracotomy. Left anterior descending coronary artery was ligated with Prolene 6.0 suture. Immediately after that, animals were grouped (n=12/group) to receive intramyocardial injections of 80 µL of basal DMEM without rSkMs (group 1) or containing 1.5x10⁶ non-PC rSkMs (group 2) or PC rSkMs (group 3). The injections were performed at multiple sites (average of 4 to 5 sites/animal) in the free wall of the left ventricle (LV) under direct vision. The chests of animals were sutured, and animals were allowed to recover.

Physiological Assessment of Heart Function
Under general anesthesia, transthoracic echocardiography was performed using Compact Linear Array probe CL10–5 on HDI/5000 SONOS CT (HP Co) to study change in the heart function, as described earlier.²⁰

Immunohistochemical Studies
Immunostaining was performed as described previously.¹¹ Briefly, cells were fixed in 4% paraformaldehyde, blocked with 10% normal goat serum in PBS, and incubated with the respective primary antibody dissolved in blocking solution at a specified dilution of 1:100. The antibodies used were specific for desmin (Sigma), Ki67 and cytochrome c (BD Pharmingen), skeletal muscle myosin heavy chain (fast isoform) (AbCam), connexin 43 (Chemicon), and von Willebrand factor (vWF) VIII (Chemicon). The primary antigen–antibody reaction was detected with goat anti-mouse IgG secondary antibody conjugated with Alexa Fluor-488 or Alexa Fluor-546 (1:100) or Alexa Fluor-546 goat anti-rabbit IgG (1:100) (Molecular Probes). The samples were examined using fluorescent microscope (BX41, Olympus, Tokyo, Japan).

For blood vessel density analysis, frozen histological sections (7-µm thickness) were immunostained using antibodies specific for vWF VIII, as previously described.²⁰ The blood vessels positive for vWF VIII were counted in both infarct and periinfarct regions. At least 32 high-power microscopic fields (x400) each in infarct and periinfarct regions were randomly selected and counted in each treatment group of animals (n=4 animals/group). Blood vessel density was expressed as the number of vessels per surface area (0.155 mm²).

Statistical Analysis
All data were described as mean±SEM. To analyze the data statistically, we performed Student’s t test and 1-way ANOVA with post hoc analysis and considered a value of P<0.05 as statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Purification and Propagation of rSkMs
The purified rSkMs were characterized by their typical cytoskeleton, their peculiar wave-like alignment that radiates from a common origin, and their ability to form myotubes under low-serum concentration cell culture conditions. High purity of rSkM culture (>90%) was further confirmed by desmin expression (data not shown).

In Vitro Studies
Cytoprotective Effect of Preconditioning
The cumulative effect of insufficient nutrients, decreased oxygen availability, and lack of growth and survival factors make it harsh for cells to survive in the ischemic myocardium. We simulated these parameters in vitro by exposing rSkMs to culture conditions without glucose and serum and subjected them to oxidative stress for different time periods. Unlike the rod-shaped morphology of a normal myocyte (Figure 1A), hypercontracted morphology (rounded or irregular shaped) was observed in rSkMs exposed to H₂O₂ (Figure 1B). Preconditioning with 200 µmol/L DZ for 30 minutes prevented these morphological changes (Figure 1C) and hence was used throughout the study for preconditioning of rSkMs. LDH leakage was significantly reduced in PC rSkMs as compared with the non-PC rSkMs when both of these were exposed to H₂O₂ (P=0.017; Figure 1D). Visualization of nuclei by 4',6-diamidino-2-phenylindole (DAPI) revealed that most non-PC rSkMs had big, regular nuclei (Figure 2A). Exposure to oxidative stress caused chromatin condensation together with a shrunken morphology and reduced cell size (Figure 2B). These conditions were reverted to near normal in PC rSkMs (Figure 2C). Electron microscopy showed that preconditioning of rSkMs had no ill effects on cell morphology and ultrastructure organization (Figure 2D and 2E). When treated with H₂O₂, non-PC rSkMs showed shriveled morphology. Their nuclei appeared shrunk and had dark, condensed chromatin network, and their mitochondria were swollen (Figure 2F and 2G). Preconditioning of rSkMs reversed these changes and the cells retained regular morphology and internal structures (Figure 2H and 2I). Injury to non-PC rSkMs in response to H₂O₂ was aggravated in a time- and concentration-dependent manner (supplemental Figure I).

View larger version (111K): [in this window] [in a new window]   Figure 1. A through C, Morphology of non-PC rSkMs without exposure to H2O2 (A), rSkMs treated with H2O2 (B), and PC rSkMs exposed to H2O2. (C). D, LDH release in vitro from various treatment groups of the rSkMs. Treatment with H2O2 caused significantly higher LDH release from the non-PC rSkMs as compared with the PC rSkMs, thus indicating cytoprotective effects of preconditioning. (magnification, x200).

View larger version (79K): [in this window] [in a new window]   Figure 2. A through C, DAPI staining of rSkMs showed that in comparison with the nuclear size and morphology of the non-PC rSkMs (red arrows) (A), their exposure to H2O2 caused nuclear shrinkage with condensed chromatin structure (yellow arrows) (B), whereas PC rSkMs retained nuclear size and morphology on exposure to H2O2 (green arrows) (C). D and E, Ultrastructure studies showed that PC rSkMs had regular morphology, nucleus (n) with normal chromatin network, and mitochondria (m) with regular shape and normal cristae. F and G, Treatment with H2O2 caused wrinkled morphology, condensed and marginated nuclear chromatin, shrunken nucleus, and swollen mitochondria with broken cristae. H and I, PC rSkMs on exposure to H2O2 showed restored morphology, normal nuclear chromatin distribution, and normal mitochondria. E, G, and I are magnified images (x50 000 magnification) of D, F, and H (x5000 magnification), respectively.

TUNEL for DNA strand breaks in the terminal phase of apoptosis revealed that in comparison with the non-PC rSkMs, which exhibited a larger number of TUNEL-positive nuclei after exposure to 100 µmol/L H₂O₂ for 2 hours, the number of TUNEL-positive nuclei was significantly lower in the PC rSkMs (Figure 3A through 3C). The number of annexin V⁺ and PI-stained cells was significantly increased in the non-PC rSkMs as compared with the PC rSkMs on exposure to H₂O₂ (Figure 3D through 3F). Immunostaining for cytochrome c revealed that mitochondrial localization of cytochrome c was characterized by punctate appearance in non-PC rSkMs (Figure 4A). Treatment of the non-PC rSkMs with 100 µmol/L H₂O₂ for 2 hours translocated cytochrome c into cytoplasm, which resulted in the loss of its punctate appearance to a homogeneous distribution in the cell cytoplasm (Figure 4C). Preconditioning of rSkMs before H₂O₂ treatment protected their mitochondrial membrane integrity and prevented cytochrome c translocation into the cytoplasm (Figure 4B). DePsipher, a lipophilic cationic dye has the property of aggregating on membrane polarization to form orange red aggregate. In the event of membrane potential disruption, the dye cannot access the transmembranous space and remains or reverts to its green monomeric form. Staining of cells with DePsipher showed that preconditioning with DZ prevented the collapse of mitochondrial membrane potential (m) in rSkMs after H₂O₂ exposure (Figure 4D through 4F).

View larger version (30K): [in this window] [in a new window]   Figure 3. FACS analysis of rSkMs after TUNEL (A through C) and annexin V/PI staining (D through F). PC rSkMs showed reduced TUNEL positivity (P<0.05) after exposure to H2O2 and increased number of viable rSkMs (annexin V–/PI– cells) (P<0.01) with preserved cell membrane integrity as compared with the non-PC rSkMs exposed to H2O2. A, B, D, and E, Non-PC rSkMs without H2O2 treatment (A and D) non-PC rSkMs exposed to H2O2 (B and E). C and F, PC rSkMs exposed to H2O2.

View larger version (57K): [in this window] [in a new window]   Figure 4. A through C, Immunostaining of rSkMs for cytochrome c. Typical punctate staining (red) for cytochrome c was observed in non-PC rSkMs without H2O2 treatment (A) and PC rSkMs treated with H2O2 (B), which corresponded well with the location of mitochondria. However, the punctate appearance was lost in non-PC rSkMs after H2O2 treatment, which indicated diffusion of cytochrome c into cytoplasm (C). D through F, DePsipher staining for mitochondrial membrane potential. Non-PC rSkMs without H2O2 treatment (D) and PC rSkMs exposed to H2O2 contained red fluorescent mitochondria in the cytoplasm (E). F, Non-PC rSkMs after treatment with H2O2 showed green fluorescence with DePsipher, indicating the loss of mitochondrial membrane potential. Magnification, x400.

Expression of Cell Survival Signaling Molecules and Growth Factors
The changes in the gene expression of several candidate molecules were assessed after treatment with H₂O₂ and DZ by RT-PCR and Western immunoblotting. As shown in Figure 5A, upregulated expression of bFGF (1.44-fold) and HGF (2.26-fold) was observed in the PC rSkMs as compared with the non-PC rSkMs. These growth factors can initiate signaling pathways by binding to their cell surface receptor tyrosine kinases. We believe that one of the signaling circuitry involved in activation of these receptor tyrosine kinases is intracellular signaling along the phosphatidylinositol 3-kinase/Akt-dependent pathway. This is supported by the significantly higher level of phospho-Akt (1.85-fold) observed in cell lysates from PC rSkMs subjected to H₂O₂ as compared with non-PC rSkMs treated with H₂O₂ (Figure 5C). Consistent with this, we also found upregulated expression of cox-2 gene (1.33-fold) in the PC rSkMs (Figure 5B). Activation of phosphatidylinositol 3-kinase/Akt pathway by cox-2 to promote cell survival has been previously reported.²¹ We did not observe a significant change in VEGF or Ang-1 expression in PC rSkMs, which suggested that previous reports demonstrating concomitant upregulation of VEGF with cox-2 occurred only under specific physiological condition like those in the tumor milieu. In summary, we propose that preconditioning of rSkMs promoted cell survival under oxidative stress by release of paracrine factors such as bFGF and HGF that will bind to their receptor tyrosine kinases to activate the phosphatidylinositol 3-kinase/Akt pathway.

View larger version (42K): [in this window] [in a new window]   Figure 5. RT-PCR (A) and multiplex PCR (B) showed upregulated expression of bFGF (1.44-fold), HGF (2.66-fold), Cox-2 (1.33-fold) and insignificantly changed expression of Ang-1 and VEGF in PC rSkMs (lane 3) as compared with the non-PC rSkMs (lane 1). Treatment of non-PC rSkMs with H2O2 (lane 2) resulted in varying degrees of upregulated expression of all of these growth factors with the exception of bFGF, which was downregulated as compared with the non-PC rSkMs (lane 1). C, Western immunoblot showing markedly upregulated expression of phospho-Akt protein in PC rSkMs after treatment with H2O2 (lane 3) as compared with non-PC rSkMs without (lane 1) and with (lane 2) H2O2 treatment.

In Vivo Studies
All animals survived the full length of experiments. There were no deaths related with cell transplantation. Some animals (n=4 animals/group) were harvested 4 days after rSkM transplantation for molecular studies to assess survival of rSkM graft.

The donor rSkMs survived well in both groups 2 and 3, as observed by standard PCR for rat sry gene in the female recipient heart. There was significantly higher survival of the male rSkMs in group 3 at 4 days after transplantation as compared with group 2 (P<0.05) (Figure 6A). No sry gene signals were observed in group 1. Real-time PCR further confirmed this trend in donor cell survival (Figure 6B). Immunostaining on rat heart tissue sections revealed a significantly higher number of Ki67-positive cells per surface area (0.036 mm²) in the PC rSkM transplanted hearts as compared with non-PC rSkM-transplanted hearts (Figure 6C through 6G). Immunostaining of the rat heart tissues for myogenic markers myosin heavy chain (fast skeletal isoform) revealed extensive neomyogenesis in the infarct and periinfarct regions in group 3. Confocal microscopy revealed that rSkMs participated in reparative process by undergoing myogenic differentiation in the infarct and periinfarct regions (Figure 6H through 6J). We did not observe connexin 43 expression. Fluorescent immunostaining for vWF VIII showed significantly higher blood vessel density in the periinfarct and infarct areas in group 3 as compared with groups 1 and 2. Blood vessel density per surface area (0.155 mm²) at x400 magnification in the infarct and periinfarct regions was 37.9±1.2 and 73.3±2.2 in group 3 as compared with group 2 (21.3±1.0, P<0.001; 35.9±1.0, P<0.001.) and group 1 (18.7±1.2, P<0.001; 30.9±1.2, P<0.001) (Figure 7A through 7G).

View larger version (30K): [in this window] [in a new window]   Figure 6. A, Standard PCR for rat sry gene in female rat heart 4 days after male rSkM transplantation. Female rat heart in group 1 was used as negative control (lane 1), whereas male rSkMs were used as positive control (lane 4). Survival of rSkMs was higher in group 3 as compared with group 2 (P<0.05). B, Real-time PCR for sry gene showed a significant 1.93-fold increase in donor cell survival in group 3 as compared with group 2 (P=0.04). C, Immunostaining revealed higher number of Ki67-positive cells in the PC rSkM-transplanted hearts (P<0.001) as compared with the non-PC rSkM-transplanted hearts. Confocal images showed PKH26-labeled PC rSkM transplanted in rat heart (red; D) with Ki67-positive nuclei (green) (E) counterstained with DAPI (blue) (F), respectively. White arrows in the merged image (G) show PKH26-labeled transplanted rSkMs staining positive for Ki67. H, Confocal images of the rat heart tissue in group 3 at 4 weeks after cell transplantation showed extensive localization of the surviving PKH-26–labeled rSkMs in the scar area (red). I, Immunostaining revealed marked expression of myosin heavy chain (fast isoform) in the scar area (green). J, Merged image showed colocalization of red and green fluorescence indicative of myogenic differentiation of the grafted rSkMs.

View larger version (51K): [in this window] [in a new window]   Figure 7. Fluorescent immunostaining for capillary density assessment in the rat heart at 4 weeks after transplantation of PC or non-PC rSkMs. Rat heart tissue sections were immunostained for vWF VIII expression. A significant increase in blood vessel density was observed in infarct (A through C) and periinfarct (D through F) regions in group 3 as compared with groups 1 and 2 (G). Red fluorescence in B, C, E, and F shows the PKH-26–labeled transplanted rSkMs.

Heart Function Studies
Echocardiography results (n=7 animals/group) were compared between the control group 1 and experimental animal groups 2 and 3. LV function and remodeling indices are summarized in Figure 8A through 8D. LV ejection fraction and LV fractional shortening in group 3 were significantly improved (57.94±1.88% and 25.19±1.1%) as compared with group 1 (36.07±1.93%, P<0.001; 13.91±0.87%, P<0.001) and group 2 (45.64±1.47, P<0.001; 18.43±0.75%, P<0.001). LV end diastolic diameter (cm), a marker of LV remodeling, was highest in group 1 (0.87±0.059) as compared with group 3 (0.77±0.04, P=0.179) and group 2 (0.80±0.05, P=0.335). However, LV end systolic diameter (cm) was highest in group 1 (0.75±0.048) as compared with group 3 (0.58±0.04, P=0.011) and group 2 (0.65±0.04, P=0.130).

View larger version (33K): [in this window] [in a new window]   Figure 8. Echocardiography for heart function analysis of rat heart 4 weeks after therapeutic intervention. There was significant improvement in LV function indices, including LV ejection fraction and LV fractional shortening, together with LV chamber dimensions and LV wall thickness in group 3 as compared with group 1 and group 2.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Our study demonstrated that preconditioning was extremely effective to promote SkM survival under oxidative stress in vitro as well as in vivo. The major findings are: (1) preconditioning protected SkMs against oxidative stress via stimulation of the cell survival signaling mediators; (2) preconditioning induced the cells to release paracrine factors, which significantly enhanced rSkM survival in the infarcted myocardium; (3) release of paracrine factors from PC rSkMs promoted angiomyogenesis in the heart; and (4) improvement in the indices of LV heart function was significant in the PC rSkM-transplanted hearts. To our knowledge, this is the first study that has exploited preconditioning for enhanced survival and the paracrine effects of PC SkMs on angiomyogenesis in the ischemic myocardium.

Apoptosis has been implicated as among the mechanisms of cell death in the ischemic myocardium. Hence, developing strategy to alleviate apoptosis under ischemic stress is therefore of prime consequence in heart cell therapy. Indeed, possessing a vital role in cell bioenergetics and being key determinants of cell survival, mitochondria are the logical targets in pathological conditions to prevent cell apoptosis. Activation of mitochondrial pathways that promote cell survival is an endogenously occurring process of "ischemic preconditioning," as a part of the homeostasis.^22,23 Apparently, a brief exposure to ischemia opens the mitochondrial ATP-sensitive potassium (mitoK_ATP) channels and renders the heart more tolerant to subsequent lethal ischemic injury.²⁴ Similar cytoprotective effects can be replicated by pharmacological agents that act on the mitoK_ATP channels.²⁵ A chemically diverse group of compounds share the property of promoting K⁺ current through ATP-sensitive K⁺ channels. Among these, the prototype mitoK_ATP channel opener DZ has been widely demonstrated to suppress cell apoptosis and promote cell survival.²⁶

The beneficial effects of DZ preconditioning have been reported in the heart and other organs.^27,28 Indeed, pharmacological preconditioning now parallels ischemic preconditioning as among the most potent interventions to prevent apoptosis. Although the exact mechanism of cytoprotection remains contentious, these pharmacological agents act via multiple mechanisms. This may include succinate dehydrogenase inhibition, increased free radical production, mitochondrial depolarization, protein kinase C (PKC) activation and involvement of a potassium conductance–independent pathway for cellular protection.^17,29–31 A possible role for the mitoK_ATP channels in modulating complement gene expression in the ischemic myocardium has also been documented.³² They prime the mitochondria to display uncoupling-mediated glucose uptake and maintain mitochondrial ATP biosynthesis during ischemia, thus delaying ischemic cell death.³³ Defining the mechanistic link of DZ treatment with cytoprotection in cardiomyocytes, antiapoptotic properties of DZ have been exclusively attributed to mitoK_ATP activation in a concentration-dependent manner.³⁴ Our group has already shown that cardiac protection from mitoKATP channels is dependent on Akt translocation from cytosol to mitochondria.³⁵ The opening of mitoK_ATP channels may act quite early in the apoptotic cascade by inhibiting cytochrome c release and depolarization, thus altering the earlier steps in the apoptotic cascade. We have reported that DZ-activated PKC isoform translocation to mitochondria prompted phosphorylation-dependent activation of the channels. Moreover, mitoK_ATP channels were not activated by DZ in PKC-downregulated hearts.³⁶ These findings received further support by our observation that DZ-induced cardiac protection was lost after using a specific PKC inhibitor.³⁷

The primary goal of the present study was to investigate the effectiveness of DZ preconditioning for protection of rSkMs against oxidative stress. We conjectured that the protective effects afforded by DZ against apoptosis can be extrapolated to maximize cell graft viability in the infarcted heart. We observed a prodigious improvement in PC rSkM survival as compared with the non-PC rSkMs under oxidant stress in vitro. Parallel observations were made when rSkMs were transplanted in the infarcted rat heart. Based on rat sry gene detection, survival of the donor rSkMs was 1.93-fold higher in group 3 as compared with group 2 at 4 days after transplantation. Keeping in view that prognostic outcome of heart cell therapy is directly related with the number of cells injected,⁴ these results are significant. In the previous studies, up to 1 billion cells have been injected during animal and human studies to compensate for the donor SkM loss posttransplantation. Propagation of SkMs to achieve this large number is time consuming and has economic and logistic implications in clinical settings. In the physiological context, dead cell debris contributes to the donor cell–specific humoral and local inflammatory responses at the site of cell graft. Prevention of the donor cell apoptosis will reduce the intensity of these reactions and create a favorable environment for the transplanted cells.

The cytoprotective effects of DZ resulted in elevated expression of phospho-Akt and various growth factors that favored survival signaling, as activation of Akt and its downstream molecules are known for cytoprotection.³⁸ Therefore, it is logical to suggest that the upregulated levels of phospho-Akt and its downstream molecules in the PC rSkMs were at least in part responsible for the cytoprotective affects. Similarly, significantly improved blood vessel density observed in group 3 may be attributed to the elevated levels of growth factors with angiogenic potential in the PC rSkMs. Although there was some increase in VEGF and Ang-1 expression, more pronounced elevation was observed in bFGF and HGF expression in PC rSkMs. The role of bFGF in functionally significant angiogenesis has been well documented both in the animal and human studies.³⁹ Moreover, the cardioprotective effects of bFGF administration to the heart by perfusion in ischemia reperfusion injury to myocardium has also been reported.⁴⁰ We have already shown the antiapoptotic and angiogenic effects of HGF therapy in mice via Akt/phosphatidylinositol 3-kinase signaling. In light of these results, we infer a possible role for DZ preconditioning–induced bFGF and HGF stimulation of Akt signaling pathway in SkMs for their improved survival under oxidative stress.

In conclusion, we have demonstrated that preconditioning mimetics improve SkM tolerance to oxidative stress, which is associated with a high level expression of paracrine factors. We achieved similar results with human SkMs (our unpublished data, 2006) and mesenchymal stem cells.³⁸ With DZ already in clinical use and SkMs being used in clinical studies, their combined application may therefore be an exciting strategy for improved graft cell survival and angiomyogenesis during heart cell therapy.

	Acknowledgments

 
Sources of Funding

This work was supported by NIH grants R37-HL074272, HL-23597, HL70062, and HL-080686 (to M.A).

Disclosures

None.

	Footnotes

 
*Both authors contributed equally to this work.

Original received September 13, 2006; resubmission received November 28, 2006; revised resubmission received January 4, 2007; accepted January 9, 2007.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Tambara K, Sakakibara Y, Sakaguchi G, Lu F, Premaratne GU, Lin X, Nishimura K, Komeda M. Transplanted skeletal myoblasts can fully replace the infarcted myocardium when they survive in the host in large numbers. Circulation. 2003; 108 (suppl II): II-259–II-263.[Medline] [Order article via Infotrieve]
2. Pagani FD, DerSimonian H, Zawadzka A, Wetzel K, Edge AS, Jacoby DB, Dinsmore JH, Wright S, Aretz TH, Eisen HJ, Aaronson KD. Autologous skeletal myoblasts transplanted to ischemia-damaged myocardium in humans. Histological analysis of cell survival and differentiation. J Am Coll Cardiol. 2003; 41: 879–888.[Abstract/Free Full Text]
3. Hagege AA, Carrion C, Menasche P, Vilquin JT, Duboc D, Marolleau JP, Desnos M, Bruneval P. Viability and differentiation of autologous skeletal myoblast grafts in ischaemic cardiomyopathy. Lancet. 2003; 361: 491–492.[CrossRef][Medline] [Order article via Infotrieve]
4. Pouzet B, Vilquin JT, Hagege AA, Scorsin M, Messas E, Fiszman M, Schwartz K, Menasche P. Factors affecting functional outcome after autologous skeletal myoblast transplantation. Ann Thorac Surg. 2001; 71: 844–850.[Abstract/Free Full Text]
5. Guerette B, Asselin I, Vilquin JT, Roy R, Tremblay JP. Lymphocyte infiltration following allo- and xenomyoblast transplantation in mdx mice. Muscle Nerve. 1995; 18: 39–51.[CrossRef][Medline] [Order article via Infotrieve]
6. Merly F, Huard C, Asselin I, Robbins PD, Tremblay JP. Anti-inflammatory effect of transforming growth factor-beta1 in myoblast transplantation. Transplantation. 1998; 65: 793–799.[CrossRef][Medline] [Order article via Infotrieve]
7. Qu Z, Balkir L, van Deutekom JC, Robbins PD, Pruchnic R, Huard J. Development of approaches to improve cell survival in myoblast transfer therapy. J Cell Biol. 1998; 142: 1257–1267.[Abstract/Free Full Text]
8. Hodgetts SI, Beilharz MW, Scalzo AA, Grounds MD. Why do cultured transplanted myoblasts die in vivo? DNA quantification shows enhanced survival of donor male myoblasts in host mice depleted of CD4+ and CD8+ cells or Nk1.1+ cells. Cell Transplant. 2000; 9: 489–502.[Medline] [Order article via Infotrieve]
9. Su CY, Chong KY, Chen J, Ryter S, Khardori R, Lai CC. A physiologically relevant hyperthermia selectively activates constitutive hsp70 in H9c2 cardiac myoblasts and confers oxidative protection. J Mol Cell Cardiol. 1999; 31: 845–855.[CrossRef][Medline] [Order article via Infotrieve]
10. Suzuki K, Smolenski RT, Jayakumar J, Murtuza B, Brand NJ, Yacoub MH. Heat shock treatment enhances graft cell survival in skeletal myoblast transplantation to the heart. Circulation. 2000; 102 (suppl III): III-216–III-221.[Medline] [Order article via Infotrieve]
11. Haider H, Ye L, Jiang S, Ge R, Law PK, Chua T, Wong P, Sim EK. Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor. J Mol Med. 2004; 82: 539–549.[Medline] [Order article via Infotrieve]
12. Mangi AA, Noiseux N, Kong D, He H, Rezvani M, Ingwall JS, Dzau VJ. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat Med. 2003; 9: 1195–1201.[CrossRef][Medline] [Order article via Infotrieve]
13. Gurke L, Mattei A, Chaloupka K, Marx A, Sutter PM, Stierli P, Harder F, Heberer M. Mechanisms of ischemic preconditioning in skeletal muscle. J Surg Res. 2000; 94: 18–27.[CrossRef][Medline] [Order article via Infotrieve]
14. Yellon DM, Downey JM. Preconditioning the myocardium: from cellular physiology to clinical cardiology. Physiol Rev. 2003; 83: 1113–1151.[Abstract/Free Full Text]
15. Debska G, Kicinska A, Skalska J, Szewczyk A, May R, Elger CE, Kunz WS. Opening of potassium channels modulates mitochondrial function in rat skeletal muscle. Biochim Biophys Acta. 2002; 1556: 97–105.[Medline] [Order article via Infotrieve]
16. Kicinska A, Szewczyk A. Protective effects of the potassium channel opener-diazoxide against injury in neonatal rat ventricular myocytes. Gen Physiol Biophys. 2003; 22: 383–395.[Medline] [Order article via Infotrieve]
17. Takashi E, Wang Y, Ashraf M. Activation of mitochondrial K(ATP) channel elicits late preconditioning against myocardial infarction via protein kinase C signaling pathway. Circ Res. 1999; 85: 1146–1153.[Abstract/Free Full Text]
18. Hillion JA, Takahashi K, Maric D, Ruetzler C, Barker JL, Hallenbeck JM. Development of an ischemic tolerance model in a PC12 cell line. J Cereb Blood Flow Metab. 2005; 25: 154–162.[CrossRef][Medline] [Order article via Infotrieve]
19. Qu-Petersen Z, Deasy B, Jankowski R, Ikezawa M, Cummins J, Pruchnic R, Mytinger J, Cao B, Gates C, Wernig A, Huard J. Identification of a novel population of muscle stem cells in mice: potential for muscle regeneration. J Cell Biol. 2002; 157: 851–864.[Abstract/Free Full Text]
20. Jiang S, Haider H, Idris NM, Salim A, Ashraf M. Supportive interaction between cell survival signaling and angiocompetent factors enhances donor cell survival and promotes angiomyogenesis for cardiac repair. Circ Res. 2006; 99: 776–784.[Abstract/Free Full Text]
21. Lin MT, Lee RC, Yang PC, Ho FM, Kuo ML. Cyclooxygenase-2 inducing Mcl-1-dependent survival mechanism in human lung adenocarcinoma CL1.0 cells. Involvement of phosphatidylinositol 3-kinase/Akt pathway. J Biol Chem. 2001; 276: 48997–49002.[Abstract/Free Full Text]
22. Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation. 1986; 74: 1124–1136.[Abstract/Free Full Text]
23. Maulik N, Engelman RM, Rousou JA, Flack JE 3rd, Deaton D, Das DK. Ischemic preconditioning reduces apoptosis by upregulating anti-death gene Bcl-2. Circulation. 1999; 100 (suppl II): II-369–II-375.[Medline] [Order article via Infotrieve]
24. Oldenburg O, Cohen MV, Yellon DM, Downey JM. Mitochondrial K(ATP) channels: role in cardioprotection. Cardiovasc Res. 2002; 55: 429–437.[Abstract/Free Full Text]
25. Szewczyk A, Wojtczak L. Mitochondria as a pharmacological target. Pharmacol Rev. 2002; 54: 101–127.[Abstract/Free Full Text]
26. Kis B, Rajapakse NC, Snipes JA, Nagy K, Horiguchi T, Busija DW. Diazoxide induces delayed pre-conditioning in cultured rat cortical neurons. J Neurochem. 2003; 87: 969–980.[CrossRef][Medline] [Order article via Infotrieve]
27. Shake JG, Peck EA, Marban E, Gott VL, Johnston MV, Troncoso JC, Redmond JM, Baumgartner WA. Pharmacologically induced preconditioning with diazoxide: a novel approach to brain protection. Ann Thorac Surg. 2001; 72: 1849–1854.[Abstract/Free Full Text]
28. Rajapakse N, Shimizu K, Kis B, Snipes J, Lacza Z, Busija D. Activation of mitochondrial ATP-sensitive potassium channels prevents neuronal cell death after ischemia in neonatal rats. Neurosci Lett. 2002; 327: 208–212.[CrossRef][Medline] [Order article via Infotrieve]
29. Xu M, Wang Y, Ayub A, Ashraf M. Mitochondrial K(ATP) channel activation reduces anoxic injury by restoring mitochondrial membrane potential. Am J Physiol Heart Circ Physiol. 2001; 281: H1295–H1303.[Abstract/Free Full Text]
30. Kudo M, Wang Y, Xu M, Ayub A, Ashraf M. Adenosine A(1) receptor mediates late preconditioning via activation of PKC-delta signaling pathway. Am J Physiol Heart Circ Physiol. 2002; 283: H296–H301.[Abstract/Free Full Text]
31. Dzeja PP, Bast P, Ozcan C, Valverde A, Holmuhamedov EL, Van Wylen DG, Terzic A. Targeting nucleotide-requiring enzymes: implications for diazoxide-induced cardioprotection. Am J Physiol Heart Circ Physiol. 2003; 284: H1048–H1056.[Abstract/Free Full Text]
32. Tanhehco EJ, Yasojima K, McGeer PL, McGeer EG, Lucchesi BR. Preconditioning reduces myocardial complement gene expression in vivo. Am J Physiol Heart Circ Physiol. 2000; 279: H1157–H1165.[Abstract/Free Full Text]
33. Murry CE, Richard VJ, Reimer KA, Jennings RB. Ischemic preconditioning slows energy metabolism and delays ultrastructural damage during a sustained ischemic episode. Circ Res. 1990; 66: 913–931.[Abstract/Free Full Text]
34. Akao M, Ohler A, O’Rourke B, Marban E. Mitochondrial ATP-sensitive potassium channels inhibit apoptosis induced by oxidative stress in cardiac cells. Circ Res. 2001; 88: 1267–1275.[Abstract/Free Full Text]
35. Ahmad N, Wang Y, Haider KH, Wang B, Pasha Z, Uzun O, Ashraf M. Cardiac protection by mitoKATP channels is dependent on Akt translocation from cytosol to mitochondria during late preconditioning. Am J Physiol Heart Circ Physiol. 2006; 290: H2402–H2408.[Abstract/Free Full Text]
36. Wang Y, Hirai K, Ashraf M. Activation of mitochondrial ATP-sensitive K(+) channel for cardiac protection against ischemic injury is dependent on protein kinase C activity. Circ Res. 1999; 85: 731–741.[Abstract/Free Full Text]
37. Wang Y, Takashi E, Xu M, Ayub A, Ashraf M. Downregulation of protein kinase C inhibits activation of mitochondrial K(ATP) channels by diazoxide. Circulation. 2001; 104: 85–90.[Abstract/Free Full Text]
38. Uemura R, Xu M, Ahmad N, Ashraf M. Bone marrow stem cells prevent left ventricular remodeling of ischemic heart through paracrine signaling. Circ Res. 2006; 98: 1414–1421.[Abstract/Free Full Text]
39. Laham RJ, Chronos NA, Pike M, Leimbach ME, Udelson JE, Pearlman JD, Pettigrew RI, Whitehouse MJ, Yoshizawa C, Simons M. Intracoronary basic fibroblast growth factor (FGF-2) in patients with severe ischemic heart disease: results of a phase I open-label dose escalation study. J Am Coll Cardiol. 2000; 36: 2132–2139.[Abstract/Free Full Text]
40. Padua RR, Sethi R, Dhalla NS, Kardami E. Basic fibroblast growth factor is cardioprotective in ischemia-reperfusion injury. Mol Cell Biochem. 1995; 143: 129–135.[CrossRef][Medline] [Order article via Infotrieve]

Related Article:

Preconditioning Stem Cells for Cardiovascular Disease: An Important Step Forward

M. Roselle Abraham and Gary Gerstenblith
Circ. Res. 2007 100: 447-449. [Full Text] [PDF]

This article has been cited by other articles:

				C. Mias, E. Trouche, M.-H. Seguelas, F. Calcagno, F. Dignat-George, F. Sabatier, M.-D. Piercecchi-Marti, L. Daniel, P. Bianchi, D. Calise, et al. Ex Vivo Pretreatment with Melatonin Improves Survival, Proangiogenic/Mitogenic Activity, and Efficiency of Mesenchymal Stem Cells Injected into Ischemic Kidney Stem Cells, July 1, 2008; 26(7): 1749 - 1757. [Abstract] [Full Text] [PDF]

				R. Ray, C. M. Herring, T. A. Markel, P. R. Crisostomo, M. Wang, B. Weil, T. Lahm, and D. R. Meldrum Deleterious effects of endogenous and exogenous testosterone on mesenchymal stem cell VEGF production Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2008; 294(5): R1498 - R1503. [Abstract] [Full Text] [PDF]

				N. Bonaros, R. Rauf, E. Werner, B. Schlechta, E. Rohde, A. Kocher, J. Bonatti, and G. Laufer Neoangiogenesis after combined transplantation of skeletal myoblasts and angiopoietic progenitors leads to increased cell engraftment and lower apoptosis rates in ischemic heart failure Interactive CardioVascular and Thoracic Surgery, April 1, 2008; 7(2): 249 - 255. [Abstract] [Full Text] [PDF]

				Z. Pasha, Y. Wang, R. Sheikh, D. Zhang, T. Zhao, and M. Ashraf Preconditioning enhances cell survival and differentiation of stem cells during transplantation in infarcted myocardium Cardiovasc Res, January 1, 2008; 77(1): 134 - 142. [Abstract] [Full Text] [PDF]

				M. Wang, W. Zhang, P. Crisostomo, T. Markel, K. K. Meldrum, X. Y. Fu, and D. R. Meldrum Sex differences in endothelial STAT3 mediate sex differences in myocardial inflammation Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E872 - E877. [Abstract] [Full Text] [PDF]

				M. R. Abraham and G. Gerstenblith Preconditioning Stem Cells for Cardiovascular Disease: An Important Step Forward Circ. Res., March 2, 2007; 100(4): 447 - 449. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 100/4/545    most recent 01.RES.0000258460.41160.efv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions